Repression of SIRT1 Promotes the Differentiation of

Download PDF
1 downloads 0 Views 2MB Size Report
Comment
1016/0006-291X(02)03020-6. Tanno M, Kuno A, Horio Y, ... Zhao Y, Bhattacharjee S, Jones BM, Dua P, Alexandrov PN, Hill JM,. Lukiw WJ (2013) Regulation of ...
Cell Mol Neurobiol DOI 10.1007/s10571-014-0071-8

ORIGINAL RESEARCH

Repression of SIRT1 Promotes the Differentiation of Mouse Induced Pluripotent Stem Cells into Neural Stem Cells Bin Hu • Ye Guo • Chunyuan Chen • Qing Li • Xin Niu • Shangchun Guo • Aijun Zhang • Yang Wang • Zhifeng Deng

Received: 18 February 2014 / Accepted: 27 April 2014 Ó Springer Science+Business Media New York 2014

Abstract The use of transplanting functional neural stem cells (NSCs) derived from induced pluripotent stem cells (iPSCs) has increased for the treatment of brain diseases. As such, it is important to understand the molecular mechanisms that promote NSCs differentiation of iPSCs for future NSC-based therapies. Sirtuin 1 (SIRT1), a NAD?-dependent protein deacetylase, has attracted significant attention over the past decade due to its prominent role in processes including organ development, longevity, and cancer. However, it remains unclear whether SIRT1 plays a role in the differentiation of mouse iPSCs toward NSCs. In this study, we produced NSCs from mouse iPSCs using serum-free medium supplemented with retinoic acid. We then assessed changes in the expression of SIRT1 and microRNA-34a, which regulates SIRT1 expression. Moreover, we used a SIRT1 inhibitor to investigate the role of SIRT1 in NSCs differentiation of iPSCs. Data revealed that the expression of SIRT1 decreased, whereas miRNAs-34a Bin Hu and Ye Guo have contributed equally to this work. B. Hu  C. Chen  Q. Li  X. Niu  S. Guo  Y. Wang (&) Institue of Orthopaedic Surgery, Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Shanghai 200233, China e-mail: [email protected] Y. Guo  C. Chen Graduate School of Nanchang University, Nanchang 330006, China Y. Guo Department of Neurosurgery, Nanchang University Affiliated Second Hospital, Nanchang 330006, China A. Zhang  Z. Deng (&) Department of Neurosurgery, Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Shanghai 200233, China e-mail: [email protected]

increased, during this process. In addition, the inhibition of SIRT1 enhanced the generation of NSCs and mature neurocytes. This suggests that SIRT1 negatively regulated the differentiation of mouse iPSCs into NSCs, and that this process may be regulated by miRNA-34a. Keywords Induced pluripotent stem cell  Neural stem cell  Differentiation  SIRT1  microRNA-34a

Introduction With improved understanding of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), neural stem cells (NSCs) and mature nerve cells derived from ESCs or iPSCs are becoming far more widely available to treat the diseases of central nervous system (CNS) diseases. Compared with ESCs, iPSCs have the ability to differentiate into a wide variety of cell types without the same ethical issues and concerns over immunological rejection. However, our present understanding of the molecular mechanisms that control the differentiation of iPSCs into NSCs is limited. Sirtuins are nicotinamide adenine dinucleotide (NAD?)dependent protein lysine modifying enzymes with deacetylase, adenosine diphosphate ribosyl transferase, and other deacylase activities (Yuan et al. 2013a). In mammals, there are seven sirtuins (SIRT1-7) that exert diverse effects on multiple physiological and pathological processes (Yuan et al. 2013a; Braidy et al. 2012; Liu et al. 2013; Min et al. 2013; Knight and Milner 2012). By deacetylating transcription factors and co-factors, sirtuin 1 (SIRT1), a homolog of SIRT2, modulates metabolism, lifespan, and cancer (Yamakuchi 2012; Chen and Bhatia 2013; Kemper et al. 2013; Knight and Milner 2012). In neural development,

123

Cell Mol Neurobiol

SIRT1 has been implicated in NSCs proliferation, differentiation, and neurodegenerative diseases (Saharan et al. 2013; Min et al. 2013; Aranha et al. 2011; Zhang et al. 2011). Inhibiting SIRT1 can promote motoneuron differentiation of human ESCs (Zhang et al. 2011). MicroRNAs (miRNAs) are involved in a range of diverse biological processes by regulating the expression of target genes at the post-transcriptional level (Cremisi 2013; Roese-Koerner et al. 2013). MiR-34a, a member of the miR-34 family, modulates the expression of genes involved in cell cycle regulation and apoptosis in a p53-dependent or -independent manner (Ito et al. 2010; Yamakuchi et al. 2008). It is expressed ubiquitously, with the highest expression in the brain (Agostini et al. 2011). Numerous studies have suggested that overexpressing miR-34a could increase the number of post-mitotic neurons and promote neurite elongation in human NSCs by inhibiting SIRT1 expression (Yamakuchi et al. 2008; Aranha et al. 2011). Nevertheless, further studies are required to determine whether SIRT1/miR-34a regulates the differentiation of iPSCs toward NSCs. If so, modulating SIRT1/miR-34a may become a future alternative method to derive abundant iPSCs-derived neural progenitor cells (NPCs) for therapeutic uses. In this study, we generated NSCs from mouse iPSCs using serum-free medium combined with retinoic acid (RA), which is an effective method to derive iPSCs-derived NSCs in vitro (Yuan et al. 2013b). The level of SIRT1 decreased, whereas miR-34a increased, during the differentiation of iPSCs toward NSCs. When nicotinamide (NAM, a SIRT1 inhibitor) was used to inhibit SIRT1, the generation of NSCs and mature nerve cells was enhanced. These data suggest that SIRT1 inhibited NSCs differentiation of iPSCs, and that this process may be regulated by miRNA-34a.

medium for iPSCs cultures contained KnockoutTM DMEM medium supplemented with 15 % KnockOutTM serum replacement, 2 mM L-glutamine, 0.01 mM nonessential amino acid, 4 ng/mL bFGF, 1 % sodium pyruvate, and 0.1 mM b-mercaptoethanol (Gibco, Grand Island, NY, USA). Production of iPSCs-Derived NSCs The generation of NSCs followed the four-stage protocol described previously (Yuan et al. 2013b). Briefly, iPSC colonies (labeled D0) were dissociated and transferred to low-attachment Petri dishes. Cells were resuspended with EB medium for 4 days (D4) and grown into embryoid bodies (EBs) (stage 1). The EBs were cultured in EB medium supplemented with 5 9 10-7 M RA for 4 days (D8), and then transferred to NSC media (serum-free) for 7 days (stage 2). Some cells then detached from bottom of the dish and grew in suspension (stage 3). These suspended cells were then plated on poly-1-ornithine/laminin-coated dishes in NSC media for adhesion for 7 days (D22) (stage 4). The iPSCs being cultured in NSC media supplemented with RA were designated ‘‘NSC ? RA’’, and those cultured without RA were labeled ‘‘NSC’’ or ‘‘control’’. NSCs markers were analyzed by immunocytochemistry. SIRT1 Inhibition Nicotinamide (NAM; 100 lM; Sigma), a SIRT1 inhibitor, was added to EB medium containing RA for 4 days (NSC ? RA ? NAM). Subsequent procedures were performed as above-described. A group of cells in RA and NSC media (NSC ? RA) were used as a control. The levels of neural lineage markers in the induced cells from D22 were assessed using qRT-PCR analysis and immunocytochemistry.

Materials and Methods

Quantitative Real-Time PCR Analysis (qRT-PCR)

Mouse iPSCs Culture

TRIzol Reagent (Invitrogen, USA) was used to isolate total RNA to determine changes in the expression of miR-34a, SIRT1, and Nestin. The concentration and purity of RNA were estimated using the 260/280 ratio and an Agilent 2,100 Bioanalyzer (Agilent Technologies, Clara, CA, USA). One microgram of total RNA was used to synthesize the first-strand cDNA using the Revert Aid first-strand cDNA synthesis kit (Takara Biotechnology, Japan) following the manufacturer’s instructions. For miRNA analysis, the miRNA 30 should be processed first using the Escherichia coli poly(A) polymerase; 1 lL of the Poly(A) reaction was needed to synthesize the first-strand cDNA following the instructions provided in the kit (Tiangen, Life Sciences, QIAGEN, Germany). qRT-PCR

Mouse iPSCs (iPSC-S103F9) were provided by the Duanqing Pei research group at the Institute of Biological Medicine and Health of the Chinese Academy of Sciences (Chen et al. 2010). Mouse embryonic fibroblasts (MEFs) were derived from day 12.5 embryos (e12.5) hemizygous for the Oct4-GFP transgenic allele, and were maintained in fibroblast medium (Chen et al. 2010). The iPSCs were induced using six transcription factors (Oct4, Sox2, Nanog, Lin28, C-myc, and Klf4) (Liao et al. 2008), and then were plated on a MEF feeder layer inactivated by mitomycin in iPSC medium. The culture of mouse iPSCs followed the protocol described previously (Yuan et al. 2013b). The

123

Cell Mol Neurobiol Table 1 Primers used for realtime fluorescence quantitative PCR (RT-PCR) analysis

Genes

Forward primer (50 –30 )

Reverse primer (50 –30 )

SIRT1

TGGAAGAAAAACCACAGGAAGT

CGGGAGCGTGTACTTATCCTT

miR-34a

TCGCGGTCTTTGGTTATCTAGCT

–

Nestin

AGATGAGCAGATGACAGTGA

CAGTCTCCAGTGATTCTATGTTC

SOX2

GCGGAGTGGAAACTTTTGTCC

CCGCGATTGTTGTGATTAGT

GFAP

GTACCATGCCACGCTTCTCC

AGCGCCTTGTTTTGCTGTTC GTTCCAGGTTCCAAGTCCACC

b-tubulin I

TAGACCCCCAGCGGCAACTAT

GAPDH

ACTTCAACAGCAACTCCCACTC

TAGGCCCCTCCTGTTATTATGG

U6

CTCGCTTCGGCAGCACA

AACGCTTCACGAATTTGCGT

analysis was performed using an ABI PRISMÒ7900HT Fast Real-Time PCR System with SYBR Premix Ex TaqTM II (Takara Biotechnology, Japan). All values were normalized using an internal reference (U6, for miR-34a; and GAPDH, for SIRT1 and Nestin). Relative expression was calculated by the comparative Ct method (2-44Ct). A 2-44Ct [3 or \0.3 was deemed to indicate statistical significance. All primers are shown in Table 1. Immunocytochemistry The expression of neural lineage markers was assessed using immunocytochemistry as described previously(Yuan et al. 2013b). Primary antibodies (monoclonal, Cell Signaling Technology, USA) were used as follows: anti-Nestin, anti-Sox2, anti-b-Tubulin III, and anti-glial fibrillary acidic protein (GFAP). All secondary antibodies (Jackson ImmunoResearch, USA) were labeled with Alexa Fluor 594. Western Blotting Protein Extraction Reagent Kit (Takara Biotechnology, China) was used to extract total proteins. Proteins (30 lg) were separated by SDS-PAGE (5 % spacer gel and 10 % separation gel) and transferred to nitrocellulose membranes. Membranes were then incubated with TBST (10 mM Tris–HCl pH 7.5, 150 mM NaCl) containing with 5 % non-fat dry milk and 0.1 % Tween-20 to block nonspecific sites for 1 h, before incubation with primary antibodies at 4 °C overnight. Membranes were then washed using TBST for 5 min, which was repeated 3 times. Incubations with secondary antibodies were then performed at 37 °C for 1 h, and signals were visualized using enhanced chemiluminescence reagent (Pierce, USA). After exposure, developing, and fixing, images were analyzed using an image analysis system. All values were normalized using b-actin. The following antibodies (Cell Signaling, Danvers, MA, USA) were used for western blotting: anti-SIRT1, and HRP-labeled goat anti-mouse IgG.

Fig. 1 The expression of Nestin in the differentiation of mouse iPSCs toward NSCs. Detection of the expression of Nestin at indicated time during NSCs differentiation of mouse iPSCs by qRT-PCR analysis. The horizontal dashed line at 1.0 indicates the expression level of Nestin in the cells at D0. 4P \ 0.05, *P \ 0.05, compared with D0; # P \ 0.05, compared with the NSC group (cells cultured in NSC differentiation media)

Statistical Analysis All analyses were performed using SPSS17.0, and data are presented as mean ± SD. Differences were analyzed using one-way analysis of variance (ANOVA). P \ 0.05 was considered to indicate statistical significance.

Results Generation of iPSCs-Derived NSCs To investigate whether SIRT1 was involved in NSCs differentiation of iPSCs, we first induced mouse iPSCs to differentiate into NSCs using serum-free medium combined with RA. The expression of Nestin in the cells induced by RA increased significantly at D8 and D22 compared to that cultured in NSC media alone (Fig. 1). The result indicates that NSCs were generated successfully from mouse iPSCs using serum-free medium supplemented with RA. This was consistent with the results of our previous study (Yuan et al. 2013b).

123

Cell Mol Neurobiol

Fig. 2 The dynamic expression changes of SIRT1 and miRNA-34a during the differentiation of mouse iPSCs into NSCs. a Western blot analysis of the protein level of SIRT1 at indicated time during NSCs differentiation of mouse iPSCs. b Quantitative analysis of the western blot results in a. c Expression levels of miRNA-34a were increased in

the differentiation of mouse iPSCs toward NSCs. The horizontal dashed lines at 1.0 in (a) and (b) indicate the levels of internal reference (b-actin) and miRNA-34a in the cells at D0, respectively. 4 P \ 0.05, *P \ 0.05, compared with D0; #P \ 0.05, compared with the NSC group (cells cultured in NSC differentiation media)

The Dynamic Expression Changes of SIRT1 and miRNA-34a During the Differentiation of Mouse iPSCs into NSCs

SIRT1 Inhibition Facilitates the Formation of NSCs Derived from iPSCs

Next, we detected the expression level of SIRT1 in NSCs differentiation of iPSCs by western blot analysis. Our result showed that the protein levels of SIRT1, both in the control group and in the NSC ? RA group, were down-regulated at D4 and D8 during the differentiation of mouse iPSCs into NSCs, and then were up-regulated at D22 compared with D0. However, the level of SIRT1 at D22 was much lower in NSC ? RA group than that of the control group (Fig. 2a, b), indicating that RA treatment inhibited upregulation of SIRT1 during the differentiation process. Previous studies showed that the SIRT1 is a target of miR-34a, and its expression is inhibited by miR-34a (Aranha et al. 2011; Yamakuchi et al. 2008). To determine whether miR-34a is involved in this process, we further detected the expression level of miR-34a. qRT-PCR analysis showed that miR-34a increased during NSCs differentiation, and its expression at D22 was much higher in RA group than that of the control group (Fig. 2c), as expected. Our results indicate that miR-34a is induced by RA, which resulted in the decrease of SIRT1 at D22, suggesting that depression of SIRT1 by miR-34a may benefit the differentiation of iPSCs into NSCs.

123

To investigate whether suppression of SIRT1 may promote NSCs differentiation of iPSCs, we used NAM, a SIRT1 inhibitor, to inhibit the function of SIRT1 in the differentiation process, and then detected the expression of neural lineage markers (SOX2, Nestin, neural precursor cells; GFAP, astrocytes; b-tubulin III, neurons). qRT-PCR analysis showed that the mRNA levels of all these markers were upregulated in the group with NAM compared to that of NSC ? RA group (Fig. 3a). Immunofluorescent analyses further confirmed the up-regulation of these markers, as shown in Fig. 3b. These data indicate that inhibition of SIRT1 at early stage of induction may facilitate the differentiation of iPSCs toward NSCs as well as mature neurocytes.

Discussion It is an important scientific breakthrough to reprogram the adult somatic cells into iPSCs using the delivery of defined combinations of transcription factors. This provides significant opportunities for the modulation of human diseases, since iPSCs can be acquired from individual patients and differentiated into disease-relevant cell types (Lee

Cell Mol Neurobiol

Fig. 3 Inhibition of SIRT1 facilitates the generation of NSCs and mature neurocytes derived from iPSCs. a Expression levels of neural lineage markers were increased as examined by qRT-PCR analysis at

D22 of differentiation. *P \ 0.05, compared with the NSC group (cells cultured in NSC differentiation media). b Immunofluorescent analyses of the indicated neural markers. bar 50 lm

et al. 2012; Sanchez-Danes et al. 2013). iPSCs can generate functional cells such as neurons, hematopoietic cells, or myocytes in vitro. iPSCs-derived NSCs, which can survive, migrate, and differentiate into neural cells after transplantation into the developing brain, have positive effects on the treatment of neurological insults (Yuan et al. 2013b; Wang et al. 2013b; Stover et al. 2013; Kobayashi et al. 2012). They have considerable therapeutic efficacy on conditions including spinal cord injury (Kobayashi et al. 2012), Parkinson’s disease (Sundberg et al. 2013; Xu et al. 2013; Wernig et al. 2008), Alzheimer’s disease (Donmez and Outeiro 2013), stroke (Jensen et al. 2013; Chang et al. 2013), and middle cerebral artery occlusion (Wang et al. 2013a). These reports demonstrate that iPSCs could potentially be used to generate patient-specific stem cells for use in regenerative medicine, and for developing models to study disease processes (Lee et al. 2012). Nevertheless, optimized methods to engineer stem cells from iPSCs are required. The four-stage induction system using serum-free media supplemented with RA induces iPSCsderived NSCs consistently and efficiently (Yuan et al. 2013b). These induced cells express high levels of the NSC markers such as Nestin and Sox-2, and could be amplified and passaged over 35 cell generations (Yuan et al. 2013b). SIRT1 is an NAD-dependent histone deacetylase and multifunctional protein that plays roles in processes including intracellular signaling, angiogenesis, metabolism, inflammation, stress responses, organ degeneration, longevity, and neoplasms (Yamakuchi 2012; Chen and Bhatia 2013; Kemper et al. 2013; Knight and Milner 2012; Chen et al. 2013; Tanno et al. 2012). It exerts its roles by associating with the bHLH repressors HES1 and HEY2 (Takata and Ishikawa 2003), or by deacetylating a series of

transcription factors including p53, the tumor protein p73 (p73), 70-kDa subunit (Ku70), and nuclear factor jB (NFjB) (Calvanese et al. 2010). SIRT1 is expressed ubiquitously in all tissues, including the brain. Research assessing the role of SIRT1 in neural development and differentiation has increased gradually. For example, SIRT1 might promote cellular differentiation by binding to the transcription factor Hes1 and subsequently inhibiting the pro-neuronal factor Mash1 (Prozorovski et al. 2008). The activation of SIRT1 suppressed the proliferation of cortical NPCs and directed their differentiation toward the astroglial lineage (Prozorovski et al. 2008). However, SIRT1 might negatively regulate neuronal differentiation. For example, Zhang et al. reported that the formation of motoneuron from human ESCs increased dramatically when SIRT1 was inhibited by nicotinamide (NAM) (Zhang et al. 2011). The overexpression of SIRT1 prevented NPCs from differentiating into neurons (Saharan et al. 2013). NAM, which intercepts an ADP-ribosylenzyme-acetyl peptide intermediate leading to the regeneration of NAD? (transglycosidation) (Jackson et al. 2003), can non-competitively inhibit SIRT1 at physiological concentrations (11–400 lM) by switching between deacetylation and base exchange (Sauve and Schramm 2003; Bitterman et al. 2002). This study explored the putative role of SIRT1 in the differentiation of mouse iPSCs into NSCs by first measuring the expression of SIRT1 during the process in vitro. Levels of SIRT1 decreased as soon as the differentiation of iPSCs into NSCs, suggesting that SIRT1 had a role in this process. The expression of SIRT1 at D22 was up-regulated compared with D0, which may be due to the reactivation of SIRT1 during NSCs proliferation. Treating cells with the

123

Cell Mol Neurobiol

SIRT1 inhibitor, NAM, accelerated the formation of NSCs and mature nerve cells derived from iPSCs. These results indicate that inhibition of SIRT1 at early stage of induction could facilitate the neural differentiation of iPSCs. The switch of stem cells between self-renewal and differentiation requires rapid and widespread changes in gene expression (Mathieu and Ruohola-Baker 2013). MiRNAs are a class of non-coding small RNAs, 20–25 nucleotides in length, that regulate gene expression by modulating translation or the stability of target mRNAs (Kashyap et al. 2009). Emerging evidence has demonstrated that miRNAs regulate gene expression post-transcriptionally. For example, miR-34a can regulate C/EBPa-mediated pre-B cell-tomacrophage transdifferentiation by inhibiting the lymphoid transcription factor Lef1 (Rodriguez-Ubreva et al. 2014). It also may be involved in shaping innate immune and phagocytic responses that contribute to inflammatory neurodegeneration by targeting human TREM2 mRNA 30 untranslated region (30 -UTR) (Zhao et al. 2013). Recent studies indicated that miR-34a crosses talk with SIRT1. Yamakuchi et al. reported that more than 16 miRNAs control SIRT1 expression (Yamakuchi 2012), including miR-34a, the first miRNA identified that regulated SIRT1 (Yamakuchi et al. 2008). Many studies have shown that miR-34a modulates a wide range of biological processes by targeting SIRT1. Adenoviral-mediated overexpression of miR-34a significantly decreased the protein levels of SIRT1 by binding to the 30 -UTR of SIRT1 mRNA in mouse liver (Lee et al. 2010). In addition, miR-34a might induce endothelial progenitor cell (EPC) senescence, impair EPCmediated angiogenesis, and act as a tumor suppressor by blocking SIRT1 (Lee et al. 2010; Yamakuchi et al. 2008). And atorvastatin could up-regulate SIRT1 expression by inhibiting miR-34a (Tabuchi et al. 2012). Recently, miR34a was shown to modulate the differentiation of ESCs and NSCs by regulating SIRT1 (Aranha et al. 2011; Tarantino et al. 2010). For example, miR-34a promoted the appearance of post-mitotic neurons and regulated neurite elongation by down-regulating SIRT1 (Aranha et al. 2011). Moreover, miR-34a could inhibit iPSCs formation by suppressing SIRT1 expression (Lee et al. 2012). However, there are few studies investigating whether SIRT1 and miR-34a play roles in NSCs differentiation of iPSCs. Consistent with previous studies, we found that miR-34a and SIRT1 participated in neural differentiation. We demonstrated that the expression of SIRT1 was downregulated, whereas miRNA-34a was up-regulated in the differentiation of iPSCs into NSCs. And the level of miRNA-34a was remarkably higher, but SIRT1, in contrast, significantly lower in group treated with RA than that of the control group. This suggests that miR-34a may have a critical role during the NSCs differentiation of mouse iPSCs by regulating SIRT1.

123

Conclusion In summary, the current study successfully generated NSCs from mouse iPSCs using serum-free media combined with RA in vitro. We observed that SIRT1 could exert an inhibitory role during the NSCs differentiation of mouse iPSCs, and that this process may be regulated by miR-34a. Inhibiting SIRT1 stimulated the generation of iPSCsderived NSCs and mature neurocytes. This suggests that the inhibition of SIRT1, using a chemical inhibitor or after regulation by miR-34a, could be the novel approach to obtain abundant nerve-related cells for use in regenerative medicine or to assess the molecular mechanisms of neurological diseases. Acknowledgments This work was financially supported by the National Natural Science Foundation of China (Nos.: 81160154, 81272170), and the innovation team construction plan of Jiangxi Province (20113BCB24018). Conflict of interest

No conflicts of interest were declared.

References Agostini M, Tucci P, Killick R, Candi E, Sayan BS, di Val RivettiCervo P, Nicotera P, McKeon F, Knight RA, Mak TW, Melino G (2011) Neuronal differentiation by TAp73 is mediated by microRNA-34a regulation of synaptic protein targets. Proc Natl Acad Sci USA 108(52):21093–21098. doi:10.1073/111206 Aranha MM, Santos DM, Sola S, Steer CJ, Rodrigues CM (2011) miR-34a regulates mouse neural stem cell differentiation. PLoS ONE 6(8):e21396. doi:10.1371/0021396 Bitterman KJ, Anderson RM, Cohen HY, Latorre-Esteves M, Sinclair DA (2002) Inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of yeast sir2 and human SIRT1. J Biol Chem 277(47):45099–45107. doi:10.1074/ 20567 Braidy N, Jayasena T, Poljak A, Sachdev PS (2012) Sirtuins in cognitive ageing and Alzheimer’s disease. Curr Opin Psychiatry 25(3):226–230. doi:10.1097/0b013e32835112c1 Calvanese V, Lara E, Suarez-Alvarez B, Abu-Dawud R, VazquezChantada M, Martinez-Chantar ML, Embade N, Lopez-Nieva P, Horrillo A, Hmadcha A, Soria B, Piazzolla D, Herranz D, Serrano M, Mato JM, Andrews PW, Lopez-Larrea C, Esteller M, Fraga MF (2010) Sirtuin 1 regulation of developmental genes during differentiation of stem cells. Proc Natl Acad Sci USA 107(31):13736–13741. doi:10.1073/1001399107 Chang DJ, Lee N, Park IH, Choi C, Jeon I, Kwon J, Oh SH, Shin DA, Do JT, Lee DR, Lee H, Moon H, Hong KS, Daley GQ, Song J (2013) Therapeutic potential of human induced pluripotent stem cells in experimental stroke. Cell Transplant 22(8):1427–1440. doi:10.3727/0963689 Chen W, Bhatia R (2013) Roles of SIRT1 in leukemogenesis. Curr Opin Hematol 20(4):308–313. doi:10.1097/0b013e328360ab64 Chen J, Liu J, Han Q, Qin D, Xu J, Chen Y, Yang J, Song H, Yang D, Peng M, He W, Li R, Wang H, Gan Y, Ding K, Zeng L, Lai L, Esteban MA, Pei D (2010) Towards an optimized culture medium for the generation of mouse induced pluripotent stem cells. J Biol Chem 285(40):31066–31072. doi:10.1074/110. 139436

Cell Mol Neurobiol Chen J, Michan S, Juan AM, Hurst CG, Hatton CJ, Pei DT, Joyal JS, Evans LP, Cui Z, Stahl A, Sapieha P, Sinclair DA, Smith LE (2013) Neuronal sirtuin1 mediates retinal vascular regeneration in oxygen-induced ischemic retinopathy. Angiogenesis 16(4): 985–992. doi:10.1007/10456 Cremisi F (2013) MicroRNAs and cell fate in cortical and retinal development. Front Cell Neurosci 7:141. doi:10.3389/2013. 00141 Donmez G, Outeiro TF (2013) SIRT1 and SIRT2: emerging targets in neurodegeneration. EMBO Mol Med 5(3):344–352. doi:10.1002/ 201302451 Ito T, Yagi S, Yamakuchi M (2010) MicroRNA-34a regulation of endothelial senescence. Biochem Biophys Res Commun 398(4):735–740. doi:10.1016/2010.07.012 Jackson MD, Schmidt MT, Oppenheimer NJ, Denu JM (2003) Mechanism of nicotinamide inhibition and transglycosidation by Sir2 histone/protein deacetylases. J Biol Chem 278(51): 50985–50998. doi:10.1074/M306552200 Jensen MB, Yan H, Krishnaney-Davison R, Al-Sawaf A, Zhang SC (2013) Survival and differentiation of transplanted neural stem cells derived from human induced pluripotent stem cells in a rat stroke model. J Stroke Cerebrovasc Dis 22(4):304–308. doi:10. 1016/2011.09.008 Kashyap V, Rezende NC, Scotland KB, Shaffer SM, Persson JL, Gudas LJ, Mongan NP (2009) Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription factors with polycomb repressive complexes and stem cell microRNAs. Stem Cell Dev 18(7):1093–1108. doi:10.1089/ 2009.0113 Kemper JK, Choi SE, Kim DH (2013) Sirtuin 1 deacetylase: a key regulator of hepatic lipid metabolism. Vitam Horm 91:385–404. doi:10.1016/978-0-12-407766-9.00016 Knight JR, Milner J (2012) SIRT1, metabolism and cancer. Curr Opin Oncol 24(1):68–75. doi:10.1097/0b013e32834d813b Kobayashi Y, Okada Y, Itakura G, Iwai H, Nishimura S, Yasuda A, Nori S, Hikishima K, Konomi T, Fujiyoshi K, Tsuji O, Toyama Y, Yamanaka S, Nakamura M, Okano H (2012) Pre-evaluated safe human iPSC-derived neural stem cells promote functional recovery after spinal cord injury in common marmoset without tumorigenicity. PLoS ONE 7(12):e52787. doi:10.1371/0052787 Lee J, Padhye A, Sharma A, Song G, Miao J, Mo YY, Wang L, Kemper JK (2010) A pathway involving farnesoid X receptor and small heterodimer partner positively regulates hepatic sirtuin 1 levels via microRNA-34a inhibition. J Biol Chem 285(17):12604–12611. doi:10.1074/M109.094524 Lee YL, Peng Q, Fong SW, Chen AC, Lee KF, Ng EH, Nagy A, Yeung WS (2012) Sirtuin 1 facilitates generation of induced pluripotent stem cells from mouse embryonic fibroblasts through the miR-34a and p53 pathways. PLoS ONE 7(9):e45633. doi:10. 1371/0045633 Liao J, Wu Z, Wang Y, Cheng L, Cui C, Gao Y, Chen T, Rao L, Chen S, Jia N, Dai H, Xin S, Kang J, Pei G, Xiao L (2008) Enhanced efficiency of generating induced pluripotent stem (iPS) cells from human somatic cells by a combination of six transcription factors. Cell Res 18(5):600–603. doi:10.1038/2008.51 Liu Y, Yao Z, Zhang L, Zhu H, Deng W, Qin C (2013) Insulin induces neurite outgrowth via SIRT1 in SH-SY5Y cells. Neuroscience 238:371–380. doi:10.1016/2013.01.034 Mathieu J, Ruohola-Baker H (2013) Regulation of stem cell populations by microRNAs. Adv Exp Med Biol 786:329–351. doi:10.1007/978-94-007-6621-1-18 Min SW, Sohn PD, Cho SH, Swanson RA (2013) Gan L (2013) Sirtuins in neurodegenerative diseases: an update on potential mechanisms. Front Aging Neurosci 5:53. doi:10.3389/00053

Prozorovski T, Schulze-Topphoff U, Glumm R, Baumgart J, Schroter F, Ninnemann O, Siegert E, Bendix I, Brustle O, Nitsch R, Zipp F, Aktas O (2008) Sirt1 contributes critically to the redox-dependent fate of neural progenitors. Nat Cell Biol 10(4):385–394. doi:10. 1038/1700 Rodriguez-Ubreva J, Ciudad L, van Oevelen C, Parra M, Graf T, Ballestar E (2014) C/EBPa-mediated activation of micrornas 34a and 223 inhibits Lef1 expression to achieve efficient reprogramming into macrophages. Mol Cell Biol 34(6):1145–1157. doi:10. 1128/01487-13 Roese-Koerner B, Stappert L, Koch P, Brustle O, Borghese L (2013) Pluripotent stem cell-derived somatic stem cells as tool to study the role of microRNAs in early human neural development. Curr Mol Med 13(5):707–722. doi:10.2174/1566524011313050003 Saharan S, Jhaveri DJ, Bartlett PF (2013) SIRT1 regulates the neurogenic potential of neural precursors in the adult subventricular zone and hippocampus. J Neurosci Res 91(5):642–659. doi:10.1002/23199 Sanchez-Danes A, Benzoni P, Memo M, Dell’era P, Raya A, Consiglio A (2013) Induced pluripotent stem cell-based studies of Parkinson’s disease: challenges and promises. CNS Neurol Disord 12(8):1114–1127. doi:10.2174/187152731131200128 Sauve AA, Schramm VL (2003) Sir2 regulation by nicotinamide results from switching between base exchange and deacetylation chemistry. Biochemistry 42(31):9249–9256. doi:10.1021/034959l Stover AE, Brick DJ, Nethercott HE, Banuelos MG, Sun L, O’Dowd DK, Schwartz PH (2013) Process-based expansion and neural differentiation of human pluripotent stem cells for transplantation and disease modeling. J Neurosci Res 91(10):1247–1262. doi:10.1002/23245 Sundberg M, Bogetofte H, Lawson T, Jansson J, Smith G, Astradsson A, Moore M, Osborn T, Cooper O, Spealman R, Hallett P, Isacson O (2013) Improved cell therapy protocols for Parkinson’s disease based on differentiation efficiency and safety of hESC-, hiPSC-, and non-human primate iPSC-derived dopaminergic neurons. Stem Cells 31(8):1548–1562. doi:10.1002/1415 Tabuchi T, Satoh M, Itoh T, Nakamura M (2012) MicroRNA-34a regulates the longevity-associated protein SIRT1 in coronary artery disease: effect of statins on SIRT1 and microRNA-34a expression. Clin Sci 123(3):161–171. doi:10.1042/20110563 Takata T, Ishikawa F (2003) Human Sir2-related protein SIRT1 associates with the bHLH repressors HES1 and HEY2 and is involved in HES1- and HEY2-mediated transcriptional repression. Biochem Biophys Res Commun 301(1):250–257. doi:10. 1016/0006-291X(02)03020-6 Tanno M, Kuno A, Horio Y, Miura T (2012) Emerging beneficial roles of sirtuins in heart failure. Basic Res Cardiol 107(4):273. doi:10.1007/s00395-012-0273-5 Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T (2010) miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. FASEB J 24(9): 3255–3263. doi:10.1096/09-152207 Wang J, Chao F, Han F, Zhang G, Xi Q, Li J, Jiang H, Wang J, Yu G, Tian M, Zhang H (2013a) PET demonstrates functional recovery after transplantation of induced pluripotent stem cells in a rat model of cerebral ischemic injury. J Nucl Med 54(5):785–792. doi:10.2967/112.111112 Wang S, Bates J, Li X, Schanz S, Chandler-Militello D, Levine C, Maherali N, Studer L, Hochedlinger K, Windrem M, Goldman SA (2013b) Human iPSC-derived oligodendrocyte progenitor cells can myelinate and rescue a mouse model of congenital hypomyelination. Cell Stem Cell 12(2):252–264. doi:10.1016/ 2012.12.002 Wernig M, Zhao JP, Pruszak J, Hedlund E, Fu D, Soldner F, Broccoli V, Constantine-Paton M, Isacson O, Jaenisch R (2008) Neurons

123

Cell Mol Neurobiol derived from reprogrammed fibroblasts functionally integrate into the fetal brain and improve symptoms of rats with Parkinson’s disease. Proc Natl Acad Sci USA 105(15):5856–5861. doi:10. 1073/0801677105 Xu L, Tan YY, Wu L, Wang LL, Li H, Ding JQ, Chen SD (2013) Road to future: iPSC clinical application in Parkinson’s disease treatment. Curr Mol Med 13(9):1412–1418. doi:10.2174/ 15665240113139990070 Yamakuchi M (2012) MicroRNA regulation of SIRT1. Front Physiol 3:68. doi:10.3389/2012.00068 Yamakuchi M, Ferlito M, Lowenstein CJ (2008) miR-34a repression of SIRT1 regulates apoptosis. Proc Natl Acad Sci USA 105(36):13421–13426. doi:10.1073/0801613105 Yuan H, Su L, Chen WY (2013a) The emerging and diverse roles of sirtuins in cancer: a clinical perspective. Onco Targets Ther 6:1399–1416. doi:10.2147/37750

123

Yuan T, Liao W, Feng NH, Lou YL, Niu X, Zhang AJ, Wang Y, Deng ZF (2013b) Human induced pluripotent stem cell-derived neural stem cells survive, migrate, differentiate, and improve neurological function in a rat model of middle cerebral artery occlusion. Stem Cell Res Ther 4(3):73. doi:10.1186/224 Zhang Y, Wang J, Chen G, Fan D, Deng M (2011) Inhibition of Sirt1 promotes neural progenitors toward motoneuron differentiation from human embryonic stem cells. Biochem Biophys Res Commun 404(2):610–614. doi:10.1016/2010.12.014 Zhao Y, Bhattacharjee S, Jones BM, Dua P, Alexandrov PN, Hill JM, Lukiw WJ (2013) Regulation of TREM2 expression by an NFsmall ka, CyrillicB-sensitive miRNA-34a. NeuroReport 24(6): 318–323. doi:10.1097/0b013e32835fb6b0