Response gene to complement 32 suppresses

THE

JOURNAL

• RESEARCH •

www.fasebj.org

Response gene to complement 32 suppresses adipose tissue thermogenic genes through inhibiting b3-adrenergic receptor/mTORC1 signaling Sisi Chen,*,† Xiaohan Mei,* Amelia Yin,‡,§ Hang Yin,‡,§ Xiao-Bing Cui,*,1 and Shi-You Chen*,†,2

*Department of Physiology and Pharmacology, ‡Department of Biochemistry and Molecular Biology, and §Center for Molecular Medicine, University of Georgia, Athens, Georgia, USA; and †Department of Endocrinology, Renmin Hospital, Hubei University of Medicine, Shiyan, China

Our previous studies have shown that response gene to complement (RGC)-32 deficiency (Rgc322/2) protects mice from diet-induced obesity and increases thermogenic gene expression in adipose tissues. However, the underlying mechanisms by which RGC-32 regulates thermogenic gene expression remain to be determined. In the present study, RGC-32 expression in white adipose tissue (WAT) was suppressed during cold exposure–induced WAT browning. Rgc322/2 significantly increased thermogenic gene expression in the differentiated stromal vascular fraction (SVF) of inguinal (i)WAT and interscapular brown adipose tissue (BAT). Rgc322/2 and cold exposure regulated a common set of genes in iWAT, as shown by RNA sequencing data. Pathway enrichment analyses showed that Rgc322/2 down-regulated PI3K/Akt signaling-related genes. Akt phosphorylation was also consistently decreased in Rgc322/2 iWAT, which led to an increase in b3-adrenergic receptor (b3-AR) expression and subsequent activation of mammalian target of rapamycin complex (mTORC)-1. b3-AR antagonist SR 59230A and mTORC1 inhibitor rapamycin blocked Rgc322/2-induced thermogenic gene expression in both iWAT and interscapular BAT. These results indicate that RGC-32 suppresses adipose tissue thermogenic gene expression through down-regulation of b3-AR expression and mTORC1 activity via a PI3K/Akt–dependent mechanism.—Chen, S., Mei, X., Yin, A., Yin, H., Cui, X.-B., Chen, S.-Y. Response gene to complement 32 suppresses adipose tissue thermogenic genes through inhibiting b3-adrenergic receptor/mTORC1 signaling. FASEB J. 32, 000–000 (2018). www.fasebj.org

ABSTRACT:

KEY WORDS:

RGC-32

•

PI3K/Akt

•

WAT browning

•

RNA sequencing

Obesity is an independent risk factor for type 2 diabetes, and cardiovascular disease and is associated with high morbidity and mortality (1). Adipose tissues play critical roles in energy homeostasis. In mammals, there are at least 2 classes of adipocytes that regulate energy balance. White adipose tissue (WAT) stores excessive energy in the form ABBREVIATIONS: Akt, protein kinase B; AR, adrenergic receptor; BAT,

brown adipose tissue; BW, body weight; FBS, fetal bovine serum; H&E, hematoxylin and eosin; HFD, high-fat diet; iWAT, inguinal white adipose tissue; mTORC, mammalian target of rapamycin complex; PGC-1a, peroxisome proliferator-activated receptor g co-activator 1a; Prdm16, PR domain containing 16; PVAT, perivascular adipose tissue; qPCR, quantitative PCR; RGC-32, response gene to complement 32; Rgc322/2, RGC-32 deficiency; S6K1, p70 ribosomal S6 kinase; SVF, stromal vascular fraction; UCP-1, uncoupling protein-1; WAT, white adipose tissue; WT, wild type 1

Correspondence: Department University of Georgia, 501 D. E-mail: [email protected] 2 Correspondence: Department University of Georgia, 501 D. E-mail: [email protected]

of Physiology and Pharmacology, The W. Brooks Dr., Athens, GA 30602, USA. of Physiology and Pharmacology, The W. Brooks Dr., Athens, GA 30602, USA.

doi: 10.1096/fj.201701508R This article includes supplemental data. Please visit http://www.fasebj.org to obtain this information.

•

energy expenditure

of triglycerides and secretes adipokines and free fatty acids. Brown adipose tissue (BAT) is highly enriched in mitochondria and expresses the unique protein uncoupling protein (UCP)-1 to produce heat to maintain body temperature and combat obesity (2–5). Beige adipocytes, similar to brown adipocytes, also express a high level of UCP-1 and can be generated within inguinal (i)WAT in response to cold exposure or activation of b3-adrenergic receptor (b3-AR) (6–8). Beige adipocytes are characterized by their multilocular lipid droplets and high mitochondrial contents, similar to those of BAT (9, 10). Studies using mouse models show that the increase in beige adipocytes is closely associated with the resistance to obesity (11, 12). In humans, the quantity of detectable brown/beige adipocytes also correlates with a reduced percentage of body fat and circulating triglycerides and greater insulin sensitivity (5, 13, 14). Therefore, understanding the molecular regulation of brown and beige adipocyte activity and biogenesis may lead to novel strategies to control energy homoeostasis. Response gene to complement (RGC)-32 was initially identified in oligodendrocytes (15) and plays important roles in various biologic processes including cell

0892-6638/18/0032-0001 © FASEB

Downloaded from www.fasebj.org by (139.81.151.125) on March 29, 2018. The FASEB Journal Vol. 0, No. 0, primary_article.

1

proliferation (16–18) and differentiation (19) and cancer progression (20, 21). Our recent studies have shown that RGC-32 expression is induced in mouse adipose tissue by a high-fat diet (HFD) challenge. RGC-32 deficiency (Rgc322/2) protects mice from HFD-induced obesity and insulin resistance (22). Rgc322/2 increases thermogenic gene expression in adipose tissues without affecting adipocyte differentiation (22). However, the mechanisms underlying RGC-32 function in thermogenic gene regulation remain to be determined. In this study, Rgc322/2 caused an increase in b3-AR expression in iWAT. Rgc322/2 enhanced b3-AR agonist-induced adipose tissue thermogenic gene expression in a b3-AR/mammalian target of rapamycin complex (mTORC)-1–dependent manner. Moreover, RGC32 regulated b3-AR expression through the PI3K/protein kinase B (Akt) signaling pathway. Our results established RGC-32 as a novel regulator for adipose tissue thermogenic gene expression and provided underlying molecular insights. MATERIALS AND METHODS Animals Rgc322/2 mice on the C57BL/6 background were generated and genotyped as described previously (18). Parallel line WT C57BL/ 6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). All animals were housed under conventional conditions in the animal care facilities and received humane care in compliance with the Principles of Laboratory Animal Care formulated by the National Society for Medical Research and the Guide for the Care and Use of Laboratory Animals [National Institutes of Health (NIH), Bethesda, MD, USA]. All experimental procedures were approved by the Institutional Animal Care and Use Committee of the University of Georgia. For cold-challenge experiments, mice were housed individually at 4°C for 12 h. Control mice were maintained at room temperature. For selective activation of b3-AR, mice were injected with CL 316243 [1 mg/kg body weight (BW)/d, i.p.], with or without the b3-AR antagonist SR 59230A (5 mg/kg BW/d, s.c.) (23, 24) or rapamycin (2.5 mg/kg BW/d, i.p.) for 5 consecutive days (25). The mice were then euthanized, and iWAT and interscapular BAT were dissected and immediately fixed in 4% paraformaldehyde or frozen in liquid nitrogen. For indirect calorimetry measurement, the mice were individually housed in metabolic cages (Oxymax; Columbus Instruments, Columbus, OH, USA) with free access to food and water. After a 2 d period of acclimatization, thermogenesis was measured for 5 d while locomotor activities were recorded. For quantitative analysis of energy expenditure, only the data with locomotor activities located in the 95% confidence interval of WT mice were calculated. Cell culture Primary iWAT and interscapular BAT stromal vascular fraction (SVF) cells were isolated by collagenase digestion followed by density separation, as previously described (26). In brief, the iWAT and interscapular BAT were minced and digested in 1.5 mg/ml collagenase at 37°C for 1 and 0.5 h, respectively. The digestions were terminated with DMEM containing 10% fetal bovine serum (FBS), and filtered through 100-m filters to remove connective tissues and undigested trunks of tissues. Cells were then centrifuged at 450 g for 5 min to separate the SVF cells in the 2

Vol. 32

September 2018

sediment and lipid-containing adipocytes in the floating layer. The freshly isolated SVF cells were seeded and cultured in DMEM containing 20% FBS and 1% penicillin/streptomycin at 37°C with 5% CO2 for 3 d, followed by feeding with fresh medium every 2 d. For adipogenic differentiation of SVF cells, confluent cells were cultured in induction medium containing DMEM, 10% FBS, 2.85 mM insulin, 0.3 mM dexamethasone, 1 mM rosiglitazone, and 0.63 mM 3-isobutyl-methylxanthine for 3 d, followed by differentiation in medium containing DMEM, 10% FBS, 200 nM insulin, and 10 nM T3 for 4 d until the adipocytes matured. For SR 59230A or rapamycin treatment, SR 59230A (1 mM) (27) or rapamycin (100 nM) (25) was added every time the induction or differentiation medium was changed. RNA extraction and sequencing and real-time quantitative RT-PCR analysis Total RNA was extracted from cells or tissues with Trizol Reagent (15596018; Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions and as described previously (28). RNA was treated with RNase-free DNase 1 (M0303S; New England Biolabs, Ipswich, MA, USA) to remove contaminating genomic DNA. RNA concentration was measured with a NanoDrop ND-1000 spectrophotometer. For sequencing, 1 mg total RNA from each sample was first treated with RiboMinus (1692567; Thermo Fisher Scientific) to deplete ribosomal RNA, then RNA was cleaned and concentrated by RNA Clean and Concentrator-5 (R1015; Zymo Research, Irvine, CA, USA). Strand-specific sequencing library preparation was performed by Stranded RNA-Seq Kit (KK8400; Kapa Biosystems, Wilmington, MA, USA) with the adaptor ligation by using Multiplex Oligos for Illumina (E7335S; New England Biolabs). Library preparation quality was assessed by Fragment Analyzer Automated CE System (Advanced Analytical Technologies, Ankeny, IA, USA). Sequencing was performed on a Hiseq 4000 platform (Illumina, San Diego, CA, USA), and 150 bp paired-end reads were generated per Illumina’s protocol. Sequences obtained from the RNA-Seq pipeline were aligned against the Mus musculus genome using TopHat v.2.012 (29). HTSeq-count v.0.6.1 (30) was used to count the transcripts associated with each gene, and a count matrix containing the number of counts for each gene across different samples and treatments was obtained. The analysis of differential expression across different samples and treatments was performed by DEGSeq v.1.10.1 (31). Adjusted P , 0.05 [Student’s t test with Benjamini-Hochberg false discovery rate (FDR) adjustment] was used as the cutoff for significantly differential expression. Differentially expressed genes were assayed by enrichment analyses to detect overrepresented functional terms present in the genomic background. Gene ontology (GO) analysis was performed with the GOseq R package v.2.12 (32), in which gene length bias was corrected. Kyoto Encyclopedia of Genes and Genomes pathway analyses were performed with Kobas software, v.2.0 (33). For RT-PCR, 1 mg total RNA was reverse transcribed with the iScript cDNA Synthesis Kit (1708891; Bio-Rad, Hercules, CA, USA). The cDNA was then subjected to real-time quantitative PCR (qPCR) with All-in-One qPCR Mix (QP001; GeneCopoeia, Rockville, MD, USA) using the Mx3005P qPCR system (Agilent Technologies, Santa Clara, CA, USA). Each sample was amplified in triplicate. The expression of an individual gene was normalized to cyclophilin. Primer sequences are summarized in Table 1.

Protein extraction and Western blot analysis Total proteins were isolated from cells or tissues in RIPA buffer [50 mM Tris-HCl (pH 7.4), 1% Triton X-100, 0.25% w/v sodium

The FASEB Journal x www.fasebj.org

CHEN ET AL.


TABLE 1. Primer sequences used for qPCR evaluation of gene expression Primer sequence, 59–39 Gene

Cyclophilin Rgc-32 Ucp-1 Pgc-1a Prdm16 b3-AR

Forward

Reverse

GTGGTCTTTGGGAAGGTGAA CCGATCTGGACAGGACCTTA TATCATCACCTTCCCGCTG ATACCGCAAAGAGCACGAGAA AGCCCTCGCCCACAACTTGC GGCCCTCTCTAGTTCCCAG

TTACAGGACATTGCGAGCAG AGCTTCACTCTCCGAACTGC GTCATATGTTACCAGCTCTG CTCAAGAGCAGCGAAAGCGTCACA TGACCCCCGGCTTCCGTTCA TAGCCATCAAACCTGTTGAGC

deoxycholate, 150 mM NaCl, 1 mM EGTA, and 0.1% SDS], containing protease inhibitors (78428; Thermo Fisher Scientific). The protein concentration was measured with BCA Protein Assay Reagent (23225; Thermo Fisher Scientific). Lysates were denatured by boiling in gel loading buffer containing SDS and 2-ME solution. Cell lysates were resolved on a 9 or 12% gel by SDS-PAGE and then transferred to PVDF membranes (IPFL00010; Bio-Rad). The membranes were blocked with 5% skim milk and then incubated with primary antibodies at 4°C overnight. Antibodies against RGC-32 (1:1000), UCP-1 (1:1000, ab10983), peroxisome proliferatoractivated receptor g co-activator (PGC)-1a (1:1000, ab54481) and b3-AR (1:1000, ab94506; Abcam, Cambridge, United Kingdom); phospho-Akt (1:1000, 9271S), Akt (1:1000, 4691S), p70 ribosomal S6 kinase (S6K1; 1:1000, 9205S), and S6K1 (1:1000, 2708S; Cell Signaling Technology, Danvers, MA, USA); and glyceraldehyde phosphate dehydrogenase (1:5000, G8795; MilliporeSigma, Burlington, MA USA) were used for immunoblot analysis. Corresponding secondary antibodies [1:10,000, anti-mouse 926-68072 (680RD) or 926-32212 (800CW); or anti-rabbit 926-68073 (680RD) or 926-32213 (800CW); Li-Cor Biosciences, Lincoln, NE, USA] were incubated for 1 h at room temperature. Protein bands were detected and analyzed on an Odyssey CLx Imager with Image Studio software (v.4.0; Li-Cor Biosciences). Immunohistological analysis After the tissues were fixed in 4% paraformaldehyde overnight, they were dehydrated in a graded series of ethanol and xylene solutions, embedded in paraffin, and sectioned (5 mm). The sections were deparaffinized in xylene and rehydrated. Hematoxylin and eosin (H&E) staining was performed with an H&E Stain Kit (KTHNEPT; American Mastertech Scientific, Lodi, CA, USA), according to the manufacturer’s instructions. For immunohistochemical staining, the sections underwent microwave antigen retrieval in 10 mM citrate buffer (pH 6.0), were allowed to cool down to room temperature, and were washed with PBS. The endogenous peroxidase activity was quenched by the addition of 3% H2O2. Subsequently, slides were washed with PBS, and nonspecific antibody binding was blocked by incubation with 10% goat serum for 30 min. The sections were then incubated with UCP-1 (1:200, ab10983; Abcam Inc.) primary antibody at 4°C overnight followed by incubation with horseradish peroxidase– conjugated anti-rabbit secondary antibody (1:200). The sections were counterstained with hematoxylin. Images were captured with a CCD camera mounted on a microscope (Nikon, Tokyo, Japan). Quantification was performed with the ImageJ Immunohistochemistry Image Analysis Toolbox (NIH). Statistical analysis All values are expressed as means 6 SEM. For statistical analysis, 2 groups were compared by using 2-tailed Student’s t test, and 3

groups were evaluated by 1-way ANOVA followed by Tukey’s multiple comparison. Four groups were evaluated by 2-way ANOVA followed by the Bonferroni post hoc test for multiple comparisons using Prism 5.0 software (GraphPad, La Jolla, CA, USA). Values of P , 0.05 were considered statistically significant.

RESULTS RGC-32 was highly expressed in WAT, and its expression was suppressed by cold treatment Our previous studies have shown that RGC-32 is induced in fat tissue by HFD challenge, and Rgc322/2 protects mice from HFD-induced obesity. We also found that the levels of BAT marker genes are higher in Rgc322/2 fat tissues than in wild-type (WT) controls (22). To further investigate the relationship between RGC-32 expression and adipose tissue thermogenesis, we first detected RGC32 expression in iWAT and interscapular BAT of WT mice. The mRNA and protein levels of RGC-32 were much higher in iWAT than BAT (Fig. 1A–C). Because cold exposure is a classic activator of thermogenic gene expression, we examined RGC-32 expression in iWAT of WT mice after cold exposure. RGC-32 protein expression was suppressed, whereas UCP-1 was induced by cold exposure (Fig. 1D, E). These results suggest that RGC-32 regulates thermogenic gene expression. Rgc322/2 promoted adipose tissue thermogenic gene expression in a cell-autonomous manner Beige adipocytes in WAT are known to originate from progenitors in the SVF (34, 35). To determine whether RGC-32 regulates thermogenic genes in an adipocyteautonomous manner, we isolated the SVF of iWAT from WT and Rgc322/2 mice and induced adipocyte differentiation in vitro. Rgc322/2 in SVF resulted in a robust mRNA expression of several key thermogenic genes, including UCP-1, PGC-1a, and PR domain containing 16 (Prdm16) as compared to the WT controls (Fig. 2A, B). The increased expression of UCP-1 and PGC-1a was also evident at the protein level (Fig. 2C). Rgc322/2 also increased thermogenic gene expression in differentiated SVF cells of interscapular BAT (Supplemental Fig. S1), suggesting that Rgc322/2 promotes adipose tissue thermogenic gene expression in a cell-autonomous manner.

RGC-32 SUPPRESSES ADIPOSE TISSUE THERMOGENIC GENES


3

Figure 1. RGC-32 was highly expressed in iWAT, and its expression was suppressed by cold treatment. A–C) mRNA (A) and protein (B, C ) expression of RGC-32 in iWAT and interscapular BAT of 8-wk-old male mice (n = 6). **P , 0.01 vs. iWAT. D, E ) Protein expression of RGC-32 and UCP-1 in iWAT of 8-wkold male mice at room temperature (Ctrl) or 4°C (Cold) for 12 h (n = 6). *P , 0.05, **P , 0.01 vs. Ctrl groups.

RGC-32 suppressed WAT b3-AR expression through the PI3K/Akt signaling pathway To globally explore the effect of RGC-32 on thermogenic genes, the gene expression of iWAT isolated from WT and Rgc322/2 mice maintained at room temperature or WT mice exposed to the cold was profiled by RNA sequencing. We found that 289 genes were differentially regulated (62-fold or more; Fig. 3A) in iWAT of WT mice exposed to the cold, as compared to iWAT at room temperature. Rgc322/2 iWAT exhibited 108 genes that were differentially regulated compared to WT iWAT (Fig. 3B). Among the 108 genes, 49 (45%) were also regulated by cold exposure (Fig. 3C). Pathway enrichment analyses showed that most of the 108 genes belonged to different metabolic pathways (up-regulated;

Fig. 3D) or were related to protein digestion/absorption (down-regulated; Fig. 3E), similar to the pathways regulated by cold exposure (Supplemental Fig. S2A, B). These data further support the important role of RGC-32 in thermogenic gene regulation. The PI3K/Akt signaling pathway–related genes were down-regulated by both cold exposure and Rgc322/2. Studies have shown that insulin and catecholamines play opposing roles in regulating adipocyte metabolism. Catecholamines can induce several key downstream targets by activating b-ARs, leading to an increased lipolysis in adipocytes (36, 37). On the other hand, insulin antagonizes catecholamine function by activating lipid synthesis pathways through activating Akt signaling (38). However, it is unclear whether PI3K/Akt regulates thermogenic gene expression in adipose tissues. We hypothesized that

Figure 2. Rgc322/2 promoted WAT thermogenic gene expression in a cell-autonomous manner. SVF cells of iWAT were isolated from age-matched male WT and Rgc322/2 mice, and adipocyte differentiation was induced. A) mRNA expression of RGC-32, UCP-1, PGC-1a, and Prdm16 in the differentiated adipocytes was detected by qPCR. B, C ) Protein expression of RGC-32, UCP-1, and PGC-1a was detected by Western blot analysis. *P , 0.05, **P , 0.01 vs. WT groups. All results are representative of at least 3 independent experiments.

4

Vol. 32

September 2018


CHEN ET AL.


Figure 3. Rgc322/2 had effects on the iWAT transcriptome similar to those of cold exposure. Global gene expression profiles (RNA sequencing analysis) were obtained from total RNA extracted from iWAT of 8-wk-old male WT mice maintained at room temperature (Ctrl) or 4°C (cold) for 12 h and from age-matched male Rgc322/2 mice (n = 3). A, B) Analysis of differentially expressed genes (DEGs; fold change .2.0) in WT iWAT with cold treatment (A) and Rgc322/2 iWAT (B) compared with WT iWAT Ctrl groups. C ) Venn diagram depicting overlap between DEGs in WT iWAT cold and Rgc322/2 iWAT groups. D, E) Statistics of pathway enrichment of up-regulated (D) and down-regulated (E ) genes in Rgc322/2 iWAT vs. WT iWAT Ctrl groups.

Rgc322/2 promotes thermogenic gene expression through inhibiting PI3K/Akt while elevating b-AR signaling. Thus, we first detected Akt phosphorylation (activation) in iWAT from WT and Rgc322/2 mice. As shown in Fig. 4A, B, Akt phosphorylation was significantly attenuated in Rgc322/2 iWAT. The inhibitory effect of Rgc322/2 on Akt phosphorylation was confirmed in cultured iWAT SVF cells in vitro (Fig. 4C, D). To test whether b3-AR is involved, we examined whether Rgc322/2 regulates b3-AR expression. As shown in Fig. 4A–E, Rgc322/2 caused an increase in b3AR expression in iWAT at both mRNA (Fig. 4E) and protein (Fig. 4A, B) levels, as well as in cultured iWAT SVF cells (Fig. 4C, D). To determine whether RGC-32 regulates b3-AR expression through PI3K/Akt signaling, RGC-32 was overexpressed in iWAT SVF cells with pretreatment of vehicle or PI3K inhibitor LY294002.

We found that RGC-32 overexpression increased Akt phosphorylation, along with a decrease in b3-AR expression (Fig. 4F, G). Pretreatment with LY294002, however, blocked RGC-32–induced Akt phosphorylation and b3-AR reduction, suggesting that RGC-32 suppresses b3-AR expression in iWAT by activating Akt signaling. Rgc322/2 promoted b3-AR agonist-induced iWAT thermogenic gene expression and energy expenditure To test whether the increased b3-AR expression in Rgc322/2 iWAT has a functional consequence, the WT and Rgc322/2 mice were injected with vehicle or b3-AR agonist CL 316243 for 5 d to induce iWAT thermogenic gene expression. H&E staining of iWAT showed that CL



5

Figure 4. RGC-32 suppressed iWAT b3-AR expression through activating Akt signaling. A, B) Phosphorylated Akt (p-Akt) and b3-AR expression in iWAT of 8-wk-old male WT and Rgc322/2 mice was detected by Western blot analysis. C, D) SVF cells of iWAT were isolated from agematched male WT and Rgc322/2 mice, and adipocyte differentiation was induced. p-Akt and b3-AR expression in the differentiated adipocytes was detected by Western blot analysis. E) mRNA expression of b3-AR in iWAT of 8-wk-old male WT and Rgc322/2 mice was detected by qPCR. *P , 0.05, **P , 0.01 vs. WT groups (n = 6; A–E). F, G) SVF cells of iWAT were isolated from male WT mice. The cells were pretreated with vehicle or LY294002 (10 mM) for 1 h and then transduced with Ad-green fluorescent protein (GFP) or AdRGC-32 for 48 h. p-Akt, b3-AR, and RGC-32 expression was detected by Western blot analysis. *P , 0.05, **P , 0.01 vs. Ad-GFP groups; #P , 0.05, ##P , 0.01 vs. Ad-RGC32 groups (n = 3).

316243 induced beige adipocyte formation in iWAT, as observed by the presence of multilocular cells within the tissue (Fig. 5A). Although iWAT morphology did not differ significantly between WT and Rgc322/2 groups with vehicle treatment, CL 316243 induced significantly more multilocular cells in Rgc322/2 iWAT as compared to WT iWAT. Immunostaining of UCP-1 was performed to confirm the presence of beige cells, and significantly more UCP-1+ cells were observed in Rgc322/2 iWAT as compared with the WT iWAT after the CL 316243 treatment (Fig. 5B). Consistently, thermogenic genes UCP-1 and PGC-1a were significantly increased in Rgc322/2 iWAT, and were further enhanced by CL 316243 treatment (Fig. 5C, D). 6

Vol. 32

September 2018

To functionally assess the increased thermogenic gene expression, we detected the energy expenditure rates of WT and Rgc322/2 mice treated with CL 316243 by indirect calorimetry. Although we found an increase in locomotor activity in Rgc322/2 mice (Supplemental Fig. S3), the energy expenditure of Rgc322/2 mice was significantly higher than that of WT mice during both light and dark periods (Fig. 5E), when the energy expenditure, along with comparable locomotor activities, was compared between these 2 groups. These data indicate that Rgc322/2 promotes b3-AR agonist– induced iWAT thermogenic gene expression and energy expenditure.


CHEN ET AL.


Figure 5. Rgc322/2 promoted CL 316243-induced iWAT thermogenic gene expression and energy expenditure. WT and Rgc322/2 mice were injected with vehicle or CL 316243 (1 mg/kg body weight, i.p.) for 5 d (n = 6). A, B) Representative images of H&E (A) and immunohistochemistry (B) staining for UCP-1 of iWAT as indicated. C, D) Protein expression of PGC-1a and UCP-1 in iWAT was detected by Western blot analysis. *P , 0.05, **P , 0.01 vs. WT treated with vehicle groups; ##P , 0.01 vs. WT treated with CL 316243 groups. E ) Energy expenditure of the mice injected with CL 316243 was measured by indirect calorimetry in both light and dark cycles. **P , 0.01 vs. WT Light groups, ##P , 0.01 vs. WT Dark groups. Scale bars, 200 mm.

b3-AR signaling was necessary for Rgc322/2 iWAT thermogenic gene expression To determine whether Rgc322/2 caused iWAT thermogenic gene expression depends on b3-AR signaling, SVF cells of WT and Rgc322/2 iWAT were induced to differentiate along with treatment with vehicle or b3-AR antagonist SR 59230A (1 mM) (27). UCP-1 and PGC-1a levels were higher in Rgc322/2 SVFs (Fig. 6A, B). However, their expression was reduced to similar levels in WT and Rgc322/2 SVFs by SR 59230A treatment, suggesting that b3-AR was essential for Rgc322/2-promoted thermogenic gene expression. To confirm these phenomena in vivo, WT and Rgc322/2 mice were injected with CL 316243, along with vehicle or SR 59230A, for 5 d. H&E staining showed that more multilocular beige adipocytes were present in Rgc322/2 iWAT, whereas no difference was observed between WT and Rgc322/2 iWAT after SR 59230A treatment (Fig. 6C). As expected, more UCP-1+ cells were found in Rgc322/2 iWAT, and few UCP-1+ cells were found in both WT and Rgc322/2 iWAT after SR 59230A treatment (Fig. 6D, E). Rgc322/2 consistently increased the expression of thermogenic genes UCP-1 and PGC-1a. However, no significant difference was observed in UCP-1 and PGC-1a expression between the WT and Rgc322/2 groups treated with SR 59230A (Fig. 6F, G). These results demonstrate that b3-AR is essential for Rgc322/2-enhanced iWAT thermogenic gene expression.

To determine whether b3-AR signaling is also involved in RGC-32–regulated thermogenic gene expression in interscapular BAT, we detected UCP-1 expression in interscapular BAT by immune staining and Western blot analysis. Consistent with the iWAT, UCP-1 expression was increased in Rgc322/2 interscapular BAT, but no significant difference was observed between WT and Rgc322/2 BAT after SR 59230A treatment (Supplemental Fig. S4). The PGC-1a expression pattern was similar to that of UCP-1 (Supplemental Fig. S4), suggesting that b3-AR signaling is also necessary for Rgc322/2 -induced thermogenic gene expression in interscapular BAT. Rgc322/2 promoted iWAT thermogenic gene expression through mTORC1 activation mTOR is a conserved serine/threonine kinase that regulates cell growth and metabolism in response to environmental cues such as growth factors and nutrients (39). There are 2 structurally and functionally distinct mTORcontaining protein complexes: mTORC1 and -2 (40, 41). Activation of S6K1 through mTORC1 is a key process in the insulin signaling pathway. Recent studies have shown that activation of mTORC1 is essential for b3-AR–induced WAT browning (25). However, it is unknown whether RGC-32 regulates mTOR signaling. Although RNA



7

Figure 6. b3-AR signaling is necessary for Rgc322/2-induced iWAT thermogenic gene expression. A, B) SVF cells of iWAT was isolated from age-matched male WT and Rgc322/2 mice, and adipocyte differentiation was induced along with vehicle or SR 59230A (1 mM) treatment. PGC-1a and UCP-1 expression was detected by Western blot analysis (n = 3). C, D) WT and Rgc322/2 mice were injected with CL 316243 (1 mg/kg body weight, i.p.) along with vehicle or SR 59230A (5 mg/kg body weight, s.c.) for 5 d (n = 6). Shown are the representative images of H&E (C ) and immunohistochemistry (D) staining for UCP-1 of iWAT. E ) Quantitative analysis of UCP-1 staining density as shown in D. F, G) PGC-1a and UCP-1 expression in iWAT was detected by Western blot analysis. *P , 0.05, **P , 0.01 vs. WT treated with vehicle groups, #P . 0.05 vs. WT treated with SR 59230A groups. Scale bars, 200 mm.

sequencing data showed a reduction in mTOR signalingrelated transcripts (Fig. 3E), mTORC1 activity (S6K1 phosphorylation) was increased in Rgc322/2 iWAT, both in vitro and in vivo (Fig. 7A–D). To determine whether the increased mTORC1 activity in Rgc322/2 iWAT contributes to enhanced thermogenic gene expression, WT and Rgc322/2 iWAT SVF cells were induced to differentiate, along with treatment with vehicle or rapamycin (100 nM) (25). Inhibition of S6K1 phosphorylation by rapamycin blocked the UCP-1 expression in Rgc322/2 SVF to a level similar to that in WT SVF (Fig. 7E, F). To validate these results in vivo, WT and Rgc322/2 mice were injected with CL 316243 along with vehicle or rapamycin for 5 d. H&E staining showed that there were more multilocular beige adipocytes in Rgc322/2 iWAT. However, no difference between WT and Rgc322/2 iWAT was observed with rapamycin treatment (Fig. 7G). More UCP-1+ cells were consistently found in Rgc322/2 iWAT, but very few UCP-1+ cells were found in both WT and Rgc322/2 iWAT 8

Vol. 32

September 2018

after rapamycin treatment (Fig. 7H, I). In addition, Rgc322/2 increased the expression of the thermogenic genes UCP-1 and PGC-1a, which was diminished by rapamycin (Fig. 7J, K). Moreover, rapamycin blocked Rgc322/2-induced UCP-1 and PGC-1a expression in interscapular BAT (Supplemental Fig. S5). These data demonstrate that mTORC1 activation is essential for Rgc322/2-promoted thermogenic gene expression in both iWAT and interscapular BAT.

DISCUSSION Obesity is a chronic disorder caused by the imbalance of energy metabolism. Increased WAT browning and BAT activity has been shown to correlate with resistance to obesity and improved insulin sensitivity, both in mice and humans (5, 11–14). Therefore, targeting factors that regulate thermogenic genes in WAT and BAT may be an


CHEN ET AL.


Figure 7. Rgc322/2 promoted iWAT thermogenic gene expression through mTORC1 activation. A, B) SVF of iWAT was isolated from age-matched male WT and Rgc322/2 mice, and adipocyte differentiation was induced. p-S6K1 was detected by Western blot analysis (n = 3). C, D) p-S6K1 in iWAT from age-matched male WT and Rgc322/2 mice was detected by Western blot analysis (n = 6). **P , 0.01 vs. WT groups. E, F ) SVF of iWAT was isolated from age-matched male WT and Rgc322/2 mice, and adipocyte differentiation was induced along with vehicle or rapamycin (100 nM) treatment. p-S6K1 and UCP-1 levels was detected by Western blot analysis (n = 3). G, H ) WT and Rgc322/2 mice were injected with CL 316243 (1 mg/kg body weight, i.p.) along with vehicle or rapamycin (2.5 mg/kg body weight, i.p.) for 5 d (n = 6). Representative images of H&E (G) and immunohistochemistry (H) staining for UCP-1 of iWAT were shown as indicated. I ) Quantitative analysis of UCP-1 staining density as shown in H. J, K ) PGC-1a and UCP-1 expression in iWAT was detected by Western blot analysis. *P , 0.05, **P , 0.01 vs. WT treated with vehicle groups, #P . 0.05 vs. WT treated with rapamycin groups. Scale bars, 200 mm.

effective approach to treating obesity and combating insulin resistance. Our experiments have established RGC-32 as a negative regulator for both WAT and BAT thermogenic gene expression. RGC-32 was highly expressed in iWAT as compared to BAT, but its expression

was repressed during cold-exposure–induced WAT browning (Fig. 1). Deletion of RGC-32 promoted adipose tissue thermogenic gene expression both in vitro and in vivo. Differentiation of SVF cells further indicated that Rgc322/2 increases adipose tissue thermogenic gene



9

expression in a cell-autonomous manner (Fig. 2 and Supplemental Fig. S1). Rgc322/2 affected the iWAT transcriptome in a manner similar to cold exposure. Rgc322/2 up-regulated genes in metabolic pathways and down-regulated genes involved in protein digestion and absorption as shown by RNA-seq analysis, consistent with the effects of cold exposure (Fig. 3 and Supplemental Fig. S2). In a recent study, genes were identified with Siberian-specific signals using wholeexome sequencing of indigenous Siberian populations who live in the coldest environments on Earth and have markedly high basal metabolic rates (42). These genes are related to fat metabolism, protein digestion and absorption, and pancreatic secretion (42), suggesting that these genes are important for cold adaptation. However, whether and how protein digestion and absorption- and pancreatic secretion–related genes are involved in WAT thermogenic gene regulation are topics for extensive future investigation. Our results indicate that RGC-32 may be involved in these processes. Other common effects between Rgc322/2 and cold exposure include increased peroxisome proliferator–activated receptor signaling and decreased expression of type II diabetes mellitus–related genes (Fig. 3 and Supplemental Fig. S2). In addition to the similarities, some differences were identified. For example, pancreatic secretion–related genes were up-regulated by cold exposure but down-regulated by Rgc322/2, whereas type I diabetes mellitus–related genes were downregulated by cold exposure but were not affected by Rgc322/2 (Fig. 3 and Supplemental Fig. S2). Although the underlying mechanisms causing these differences are unclear, a possible explanation is that Rgc322/2 alters the function of other organs or tissues, which indirectly affect gene expression in fat tissue. Another interesting phenomenon from the RNA sequencing data was the down-regulated PI3K/Akt signaling by Rgc322/2 and cold exposure. PI3K/Akt and b3-AR signaling are 2 opposing prominent regulators of adipocyte functions (36–38), and b3-AR is essential for WAT browning. Our results showed that expression of b3-AR was increased, whereas Akt phosphorylation was decreased by Rgc322/2, both in vivo and in vitro (Fig. 4A–E). RGC-32 suppressed b3-AR expression through activation of PI3K/Akt signaling (Fig. 4F, G). These results provide novel molecular insight into b3-AR regulation and a further support for RGC-32 as a novel regulator for adipose tissue thermogenic gene expression. The mTORC1 signaling pathway serves as a central regulator of cell metabolism, growth, proliferation, and survival. It can be activated by PI3K/Akt signaling. In turn, mTORC1 activation has been shown to suppress PI3K/Akt signaling in different cells (39, 41, 43). Recent studies suggest that mTORC1 activation is essential for b3-AR stimulation–induced WAT browning (25). Although Rgc322/2 and cold exposure down-regulated mTOR signaling–related genes (Fig. 3E and Supplemental Fig. S2B), which could be related to negative feedback, significantly increased mTORC1 activity was observed in Rgc322/2 iWAT in vivo and the differentiated Rgc322/2 iWAT SVF cells in vitro (Fig. 7A–D), which was consistent with the increased b3-AR expression. It remains to be 10

Vol. 32 September 2018

determined whether increased mTORC1 activity caused decreased PI3K/Akt signaling in Rgc322/2 iWAT, but our results clearly indicate that the activation of mTORC1 signaling is essential for Rgc322/2-induced adipose tissue thermogenic gene expression (Fig. 7E–K and Supplemental Fig. S5). A recent study showed that b3-AR negatively regulates chemokine (C-X-C motif) ligand 12/ C-X-C chemokine receptor 4 signaling during bone marrow hematopoietic stem cell activation (44). Our results indicate that Rgc322/2 increases b3-AR expression in adipose tissue. Whether the chemokine (C-X-C motif) ligand 12/ C-X-C chemokine receptor 4 signaling is regulated by RGC-32 or is involved in regulating adipose tissue thermogenic gene expression remains unclear and may be studied in the future. In addition to iWAT and BAT in obesity, perivascular adipose tissue (PVAT), although long assumed to be nothing more than vessel-supporting connective tissue, is now understood to be an important active component of the vasculature, with integral roles in vascular health and disease (45). PVAT secretes numerous biologically active substances that can act in both an autocrine and a paracrine fashion and thus is involved in vascular inflammation (46). Whitening of PVAT in obesity and subsequent dysfunction could drive an inflammatory microenvironment promoting coronary atherosclerosis, whereas increasing the proportion of thermogenic brown or beige adipocytes could improve local inflammation and reduce atherosclerosis (45, 47). More multilocular cells (Supplemental Fig. S6A) along with more UCP-1+ beige cells were observed in Rgc322/2 PVAT than in the WT control (Supplemental Fig. S6B, C). The thermogenic genes UCP-1 and PGC-1a were consistently increased significantly in Rgc322/2 PVAT (Supplemental Fig. S6D, E). These results suggest that Rgc322/2 up-regulates thermogenic gene expression to exert a vascular protection role, which needs extensive future study. Our study demonstrated that, in adipose tissue, RGC-32 activates PI3K/Akt signaling to inhibit b3-AR expression, which suppresses mTORC1/S6K1 activity and thermogenic gene expression (Fig. 8). Therefore, RGC-32 may

Figure 8. Mechanism by which RGC-32 regulates adipose tissue thermogenic gene expression. RGC-32 inhibits b3-AR expression through activating PI3K/Akt signaling, resulting in a decreased mTORC1/S6K1 activity, leading to the suppression of thermogenic gene expression in adipose tissues.


CHEN ET AL.


serve as a novel therapeutic target for treating obesity or its related metabolic diseases. ACKNOWLEDGMENTS This work was supported by U.S. National Institutes of Health (NIH) National Heart, Lung and Blood Institute Grants HL123302, HL119053, and HL135854 (to S.-Y.C.), and American Heart Association Scientist Development Grant 17SDG32790003 (to X.-B.C.). The authors declare no conflicts of interest.

AUTHOR CONTRIBUTIONS X.-B. Cui and S.-Y. Chen conceived and coordinated the study; S. Chen and X.-B. Cui designed and performed the experiments in Figs. 1–8 and Supplemental Figs. S1 and S4–S6; A. Yin and H. Yin contributed to Fig. 5 and Supplemental Fig. S3; X. Mei contributed to Fig. 3 and Supplemental Fig. S2; X.-B. Cui analyzed the results; X.-B. Cui and S.-Y. Chen wrote the paper; and all authors analyzed the results and approved the final version of the manuscript. REFERENCES 1. Friedman, J. M. (2003) A war on obesity, not the obese. Science 299, 856–858 2. Cypess, A. M., Weiner, L. S., Roberts-Toler, C., Franquet El´ıa, E., Kessler, S. H., Kahn, P. A., English, J., Chatman, K., Trauger, S. A., Doria, A., and Kolodny, G. M. (2015) Activation of human brown adipose tissue by a b3-adrenergic receptor agonist. Cell Metab. 21, 33–38 3. Shinoda, K., Luijten, I. H., Hasegawa, Y., Hong, H., Sonne, S. B., Kim, M., Xue, R., Chondronikola, M., Cypess, A. M., Tseng, Y. H., Nedergaard, J., Sidossis, L. S., and Kajimura, S. (2015) Genetic and functional characterization of clonally derived adult human brown adipocytes. Nat. Med. 21, 389–394 4. Lowell, B. B., S-Susulic, V., Hamann, A., Lawitts, J. A., Himms-Hagen, J., Boyer, B. B., Kozak, L. P., and Flier, J. S. (1993) Development of obesity in transgenic mice after genetic ablation of brown adipose tissue. Nature 366, 740–742 5. Virtanen, K. A., Lidell, M. E., Orava, J., Heglind, M., Westergren, R., Niemi, T., Taittonen, M., Laine, J., Savisto, N. J., Enerbäck, S., and Nuutila, P. (2009) Functional brown adipose tissue in healthy adults. N. Engl. J. Med. 360, 1518–1525 6. Harms, M., and Seale, P. (2013) Brown and beige fat: development, function and therapeutic potential. Nat. Med. 19, 1252–1263 7. Wu, J., Boström, P., Sparks, L. M., Ye, L., Choi, J. H., Giang, A. H., Khandekar, M., Virtanen, K. A., Nuutila, P., Schaart, G., Huang, K., Tu, H., van Marken Lichtenbelt, W. D., Hoeks, J., Enerbäck, S., Schrauwen, P., and Spiegelman, B. M. (2012) Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 150, 366–376 8. Wu, J., Cohen, P., and Spiegelman, B. M. (2013) Adaptive thermogenesis in adipocytes: is beige the new brown? Genes Dev. 27, 234–250 9. Fisher, F. M., Kleiner, S., Douris, N., Fox, E. C., Mepani, R. J., Verdeguer, F., Wu, J., Kharitonenkov, A., Flier, J. S., Maratos-Flier, E., and Spiegelman, B. M. (2012) FGF21 regulates PGC-1a and browning of white adipose tissues in adaptive thermogenesis. Genes Dev. 26, 271–281 10. Fang, S., Suh, J. M., Reilly, S. M., Yu, E., Osborn, O., Lackey, D., Yoshihara, E., Perino, A., Jacinto, S., Lukasheva, Y., Atkins, A. R., Khvat, A., Schnabl, B., Yu, R. T., Brenner, D. A., Coulter, S., Liddle, C., Schoonjans, K., Olefsky, J. M., Saltiel, A. R., Downes, M., and Evans, R. M. (2015) Intestinal FXR agonism promotes adipose tissue browning and reduces obesity and insulin resistance. Nat. Med. 21, 159–165

11. Xue, B., Rim, J. S., Hogan, J. C., Coulter, A. A., Koza, R. A., and Kozak, L. P. (2007) Genetic variability affects the development of brown adipocytes in white fat but not in interscapular brown fat. J. Lipid Res. 48, 41–51 12. Schulz, T. J., Huang, P., Huang, T. L., Xue, R., McDougall, L. E., Townsend, K. L., Cypess, A. M., Mishina, Y., Gussoni, E., and Tseng, Y. H. (2013) Brown-fat paucity due to impaired BMP signalling induces compensatory browning of white fat. Nature 495, 379–383 13. Kajimura, S., and Saito, M. (2014) A new era in brown adipose tissue biology: molecular control of brown fat development and energy homeostasis. Annu. Rev. Physiol. 76, 225–249 14. Ouellet, V., Labbé, S. M., Blondin, D. P., Phoenix, S., Guérin, B., Haman, F., Turcotte, E. E., Richard, D., and Carpentier, A. C. (2012) Brown adipose tissue oxidative metabolism contributes to energy expenditure during acute cold exposure in humans. J. Clin. Invest. 122, 545–552 15. Badea, T. C., Niculescu, F. I., Soane, L., Shin, M. L., and Rus, H. (1998) Molecular cloning and characterization of RGC-32, a novel gene induced by complement activation in oligodendrocytes. J. Biol. Chem. 273, 26977–26981 16. Fosbrink, M., Cudrici, C., Tegla, C. A., Soloviova, K., Ito, T., Vlaicu, S., Rus, V., Niculescu, F., and Rus, H. (2009) Response gene to complement 32 is required for C5b-9 induced cell cycle activation in endothelial cells. Exp. Mol. Pathol. 86, 87–94 17. Wang, J. N., Shi, N., Xie, W. B., Guo, X., and Chen, S. Y. (2011) Response gene to complement 32 promotes vascular lesion formation through stimulation of smooth muscle cell proliferation and migration. Arterioscler. Thromb. Vasc. Biol. 31, e19–e26 18. Cui, X. B., Guo, X., and Chen, S. Y. (2013) Response gene to complement 32 deficiency causes impaired placental angiogenesis in mice. Cardiovasc. Res. 99, 632–639 19. Li, F., Luo, Z., Huang, W., Lu, Q., Wilcox, C. S., Jose, P. A., and Chen, S. (2007) Response gene to complement 32, a novel regulator for transforming growth factor-beta-induced smooth muscle differentiation of neural crest cells. J. Biol. Chem. 282, 10133–10137 20. Zhu, L., Qin, H., Li, P. Y., Xu, S. N., Pang, H. F., Zhao, H. Z., Li, D. M., and Zhao, Q. (2012) Response gene to complement-32 enhances metastatic phenotype by mediating transforming growth factor betainduced epithelial-mesenchymal transition in human pancreatic cancer cell line BxPC-3. J. Exp. Clin. Cancer Res. 31, 29 21. Sun, Q., Yao, X., Ning, Y., Zhang, W., Zhou, G., and Dong, Y. (2013) Overexpression of response gene to complement 32 (RGC32) promotes cell invasion and induces epithelial-mesenchymal transition in lung cancer cells via the NF-kB signaling pathway. Tumour Biol. 34, 2995–3002 22. Cui, X. B., Luan, J. N., Ye, J., and Chen, S. Y. (2015) RGC32 deficiency protects against high-fat diet-induced obesity and insulin resistance in mice. J. Endocrinol. 224, 127–137 23. Ruan, H. B., Dietrich, M. O., Liu, Z. W., Zimmer, M. R., Li, M. D., Singh, J. P., Zhang, K., Yin, R., Wu, J., Horvath, T. L., and Yang, X. (2014) O-GlcNAc transferase enables AgRP neurons to suppress browning of white fat. Cell 159, 306–317 24. Bexis, S., and Docherty, J. R. (2009) Role of alpha 1- and beta 3adrenoceptors in the modulation by SR59230A of the effects of MDMA on body temperature in the mouse. Br. J. Pharmacol. 158, 259–266 25. Liu, D., Bordicchia, M., Zhang, C., Fang, H., Wei, W., Li, J. L., Guilherme, A., Guntur, K., Czech, M. P., and Collins, S. (2016) Activation of mTORC1 is essential for b-adrenergic stimulation of adipose browning. J. Clin. Invest. 126, 1704–1716 26. Shan, T., Xiong, Y., Zhang, P., Li, Z., Jiang, Q., Bi, P., Yue, F., Yang, G., Wang, Y., Liu, X., and Kuang, S. (2016) Lkb1 controls brown adipose tissue growth and thermogenesis by regulating the intracellular localization of CRTC3. Nat. Commun. 7, 12205 27. Kwan, H. Y., Wu, J., Su, T., Chao, X. J., Liu, B., Fu, X., Chan, C. L., Lau, R. H. Y., Tse, A. K. W., Han, Q. B., Fong, W. F., and Yu, Z. L. (2017) Cinnamon induces browning in subcutaneous adipocytes. Sci. Rep. 7, 2447 28. Cui, X. B., Luan, J. N., and Chen, S. Y. (2015) RGC-32 deficiency protects against hepatic steatosis by reducing lipogenesis. J. Biol. Chem. 290, 20387–20395 29. Trapnell, C., Pachter, L., and Salzberg, S. L. (2009) TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105–1111 30. Anders, S., Pyl, P. T., and Huber, W. (2015) HTSeq: a Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166–169



11

31. Wang, L., Feng, Z., Wang, X., Wang, X., and Zhang, X. (2010) DEGseq: an R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 26, 136–138 32. Young, M. D., Wakefield, M. J., Smyth, G. K., and Oshlack, A. (2010) Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol. 11, R14 33. Mao, X., Cai, T., Olyarchuk, J. G., and Wei, L. (2005) Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 21, 3787–3793 34. Lee, Y. H., Petkova, A. P., Mottillo, E. P., and Granneman, J. G. (2012) In vivo identification of bipotential adipocyte progenitors recruited by b3-adrenoceptor activation and high-fat feeding. Cell Metab. 15, 480–491 35. Schulz, T. J., Huang, T. L., Tran, T. T., Zhang, H., Townsend, K. L., Shadrach, J. L., Cerletti, M., McDougall, L. E., Giorgadze, N., Tchkonia, T., Schrier, D., Falb, D., Kirkland, J. L., Wagers, A. J., and Tseng, Y. H. (2011) Identification of inducible brown adipocyte progenitors residing in skeletal muscle and white fat. Proc. Natl. Acad. Sci. USA 108, 143–148 36. Lafontan, M., and Berlan, M. (1993) Fat cell adrenergic receptors and the control of white and brown fat cell function. J. Lipid Res. 34, 1057–1091 37. Collins, S., Cao, W., and Robidoux, J. (2004) Learning new tricks from old dogs: beta-adrenergic receptors teach new lessons on firing up adipose tissue metabolism. Mol. Endocrinol. 18, 2123–2131 38. Summers, S. A., Whiteman, E. L., and Birnbaum, M. J. (2000) Insulin signaling in the adipocyte. Int. J. Obes. Relat. Metab. Disord. 24(Suppl 4), S67–S70 39. Dann, S. G., Selvaraj, A., and Thomas, G. (2007) mTOR complex1S6K1 signaling: at the crossroads of obesity, diabetes and cancer. Trends Mol. Med. 13, 252–259

12

Vol. 32 September 2018

40. Sarbassov, D. D., Ali, S. M., and Sabatini, D. M. (2005) Growing roles for the mTOR pathway. Curr. Opin. Cell Biol. 17, 596–603 41. Wullschleger, S., Loewith, R., and Hall, M. N. (2006) TOR signaling in growth and metabolism. Cell 124, 471–484 42. Hsieh, P., Hallmark, B., Watkins, J., Karafet, T. M., Osipova, L. P., Gutenkunst, R. N., and Hammer, M. F. (2017) Exome sequencing provides evidence of polygenic adaptation to a fat-rich animal diet in indigenous Siberian populations. Mol. Biol. Evol. 34, 2913–2926 43. Guertin, D. A., and Sabatini, D. M. (2007) Defining the role of mTOR in cancer. Cancer Cell 12, 9–22 44. Zhu, E., Hu, L., Wu, H., Piao, L., Zhao, G., Inoue, A., Kim, W., Yu, C., Xu, W., Bando, Y. K., Li, X., Lei, Y., Hao, C. N., Takeshita, K., Kim, W. S., Okumura, K., Murohara, T., Kuzuya, M., and Cheng, X. W. (2017) Dipeptidyl peptidase-4 regulates hematopoietic stem cell activation in response to chronic stress. J. Am. Heart Assoc. 6, e006394 45. Aldiss, P., Davies, G., Woods, R., Budge, H., Sacks, H. S., and Symonds, M. E. (2017) ‘Browning’ the cardiac and peri-vascular adipose tissues to modulate cardiovascular risk. Int. J. Cardiol. 228, 265–274 46. Brown, N. K., Zhou, Z., Zhang, J., Zeng, R., Wu, J., Eitzman, D. T., Chen, Y. E., and Chang, L. (2014) Perivascular adipose tissue in vascular function and disease: a review of current research and animal models. Arterioscler. Thromb. Vasc. Biol. 34, 1621–1630 47. Xiong, W., Zhao, X., Garcia-Barrio, M. T., Zhang, J., Lin, J., Chen, Y. E., Jiang, Z., and Chang, L. (2017) MitoNEET in perivascular adipose tissue blunts atherosclerosis under mild cold condition in mice. Front. Physiol. 8, 1032


Received for publication December 14, 2017. Accepted for publication March 19, 2018.

CHEN ET AL.
