JOURNAL OF BACTERIOLOGY, Jan. 2007, p. 220–227 0021-9193/07/$08.00⫹0 doi:10.1128/JB.01149-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 189, No. 1
Response of Staphylococcus aureus to Salicylate Challenge䌤 James T. Riordan,1,2 Arunachalam Muthaiyan,3 Wayne Van Voorhies,2 Christopher T. Price,4 James E. Graham,4 Brian J. Wilkinson,3 and John E. Gustafson1,2* Microbiology Group, Department of Biology,1 and Molecular Biology Program,2 New Mexico State University, Las Cruces, New Mexico 88003-8001; Department of Biological Sciences, Illinois State University, Normal, Illinois 61791-41203; and Department of Microbiology and Immunology, University of Louisville School of Medicine, Louisville, Kentucky 402924 Received 23 July 2006/Accepted 10 October 2006
Growth of Staphylococcus aureus with the nonsteroidal anti-inflammatory salicylate reduces susceptibility of the organism to multiple antimicrobials. Transcriptome analysis revealed that growth of S. aureus with salicylate leads to the induction of genes involved with gluconate and formate metabolism and represses genes required for gluconeogenesis and glycolysis. In addition, salicylate induction upregulates two antibiotic target genes and downregulates a multidrug efflux pump gene repressor (mgrA) and sarR, which represses a gene (sarA) important for intrinsic antimicrobial resistance. We hypothesize that these salicylate-induced alterations jointly represent a unique mechanism that allows S. aureus to resist antimicrobial stress and toxicity. findings with physiological experimentation. The implications of our findings with respect to the salicylate-inducible multiple antimicrobial resistance mechanism of S. aureus are discussed. (This work was presented in part at poster sessions of the 45th International Conference on Antimicrobial Agents and Chemotherapy, Washington, DC, 2005, and the 106th General Meeting of the American Society for Microbiology, Orlando, FL, 2006.)
In 1985, Judah L. Rosner reported on a “nonheritable” antibiotic resistance mechanism that could be induced in Escherichia coli by the nonsteroidal anti-inflammatory salicylate or aspirin (acetylsalicylate) (47). It was later reported that nonsteroidal anti-inflammatories induce expression of the E. coli multiple antibiotic resistance operon (marRAB) and that repression of marRAB by the winged-helix DNA-binding repressor MarR is alleviated upon exposure to salicylate (1, 6, 31). Since these initial discoveries, the ability of salicylate to induce antimicrobial resistance in multiple bacterial species has been reported (for a review, see reference 44). Growth of the gram-positive pathogen Staphylococcus aureus with salicylate also induces reduced susceptibility to multiple antimicrobials, including membrane-active cleaners/disinfectants and plant essential oils, the DNA topoisomerase inhibitor ciprofloxacin, the protein synthesis inhibitor fusidic acid, and the DNA-intercalating dye ethidium (14, 15, 42, 43, 45, 46). The salicylate-induced phenotype is partially due to the activation of antimicrobial efflux and a proton motive forceindependent reduction in antimicrobial accumulation (43). The drugs for which salicylate reduces accumulation are substrates of the well-characterized multidrug efflux pump NorA, yet NorA does not play a role in this mechanism (23, 43). In addition, salicylate also increases the frequency at which S. aureus acquires genotypic resistance to ciprofloxacin and fusidic acid (14, 45). The S. aureus genome also contains numerous marR paralogs, historically referred to as the staphylococcal accessory regulator (sarA) family of genes (for a review, see reference 29). Some of these S. aureus marR paralogues (e.g., sarA, mgrA, and mepR) have already been implicated in the control of intrinsic antimicrobial resistance (21, 22, 36, 51, 52, 53). We now characterize transcriptome alterations that occur in S. aureus cells exposed to salicylate and support some of these
MATERIALS AND METHODS Bacterial strains, culture conditions, growth curves, and antibiotic susceptibility determination. The S. aureus strains utilized in this study were strain SH1000, which is a rsbU⫹ 8325-4 derivative (17) (a gift of G. Kaatz, Wayne State University); strain Becker (a gift of D. C. Hooper, Harvard Medical School); strain Newman; and their respective mgrA::cat mutants, CYL1040 and CYL1050 (27) (gifts of C. Y. Lee, University of Arkansas for Medical Sciences). All bacteria were cultured in Luria Broth (LB) (Difco, Detroit, MI) at 37°C with shaking (200 rpm) or on LB agar prepared with antibiotic additions as required (chloramphenicol, 20 mg/liter, or kanamycin, 50 mg/liter) (SigmaAldrich, St. Louis, MO). Working-stock LB agar cultures were kept at 4°C, and all strains were maintained in LB containing 20% glycerol at ⫺80°C. All broth cultures were inoculated with overnight cultures to reach an initial optical density at 600 nm (OD600) of 0.01. For growth curves, the OD600 was read over a 7-h period with triplicate LB cultures prepared with or without salicylate addition. To determine the effect of gluconate and glucose on salicylate toxicity, one 24-h OD600 was recorded for triplicate cultures. Cultures for RNA isolation and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) assays were induced at mid-exponential phase (OD600 ⫽ 0.7) with 2 mM sodium salicylate (pH 7.0) (Sigma-Aldrich) for 1 h, and cell lysates and RNA were isolated from cultures that had reached a final OD600 of 1.1. Susceptibility to antimicrobials was determined using the gradient plate method, as previously described (36). Metabolic and glyceraldehyde-3-phosphate dehydrogenase assays. The metabolic activity of S. aureus was determined with mid-exponential-phase control and 2 mM salicylate-induced cultures (OD600 ⫽ 0.5) at 36°C separately dispensed into glass boats within airtight glass chambers. At intervals, a computercontrolled multiplexer (Sable Systems International, Las Vegas, NV) flushed the chambers for 2 min into a Li-Cor 6251 CO2 analyzer (Li-Cor, Lincoln, NE) linked to an Oxzilla O2 analyzer (Sable Systems International), and O2 consumption and CO2 production were determined using DATACAN software (Sable Systems International). Airflow was controlled with a mass flow meter (Sierra Instruments, Monterey, CA) and scrubbed of water vapor with a magnesium perchlorate filter before entering the CO2/O2 analyzers. A chamber containing sterile LB controlled for potential background CO2 and gas leakage in the chambers. GAPDH activities (NAD⫹ reduction [OD340] per mg protein [OD280] per min) of control cultures and 2 mM salicylate-induced cultures were measured
* Corresponding author. Mailing address: Department of Biology, New Mexico State University, P.O. Box 30001 Dept. 3AF, Las Cruces, NM 88003-8001. Phone: (505) 646-5660. Fax: (505) 646-5665. E-mail:
[email protected]. 䌤 Published ahead of print on 20 October 2006. 220
EFFECTS OF SALICYLATE ON S. AUREUS
VOL. 189, 2007
221
TABLE 1. Primers used in this study Primer
Gene
Sequence 5⬘ 3 3⬘
Nucleotide positionsa
SalI linked XbaI linked Rrn1-1 Rrn1-2 16S-F 16S-R SACOL0311F SACOL0311R ClfA1-1 ClfA1-2 NanA1-1 NanA1-2 GapA1-1 GapA1-2 OpuD1-1 OpuD1-2 GntP1-1 GntP1-2 GntK1-1 GntK1-2 SACOL2462F SACOL2462R SigB2-1 SigB2-2 SarA2-1 SarA2-2 SarR1-1 SarR1-2 MgrA1-1 MgrA1-2 SACOL1389F SACOL1389R SACOL2278F SACOL2278R SACOL0593F SACOL0593R SACOL0164F SACOL0164R SACOL1522F SACOL1522R SACOL0640F SACOL0640R
Random Random Ribosomal operon Ribosomal operon rrs rrs SACOL0311 SACOL0311 clfA clfA nanA nanA gapA2 gapA2 opuD2 opuD2 gntP gntP gntK gntK SACOL2462 SACOL2462 sigB sigB sarA sarA sarR sarR mgrA mgrA parE parE SACOL2278 SACOL2278 fusA fusA SACOL0164 SACOL0164 SACOL1522 SACOL1522 SACOL0640 SACOL0640
ATATGTCGACTGAATTCCGTAGG-(9Nb) TGCTCTAGACGTCCTGATGGTT-(9N) TATGGAGAGTTTGATCCTGG TTGATTAAGTCTTCGATCG TCGTGTCGTGAGATGTTG CTGCCCTTTGTATTGTCC TGATTTCATTCAAGGCGTCA TGCCGCAGTATTTAGTTTCCA GGCAACAACTCAATCAAGCA TTCCGCATTTGTAGAATTTTGA AAATGGTAGCTCAGGCGAAA TTCCAAGTTCAATGGCTTCA TGCTAGTTATCCACCCGAAA TGGCAAGTTTTCAGGATTGC TTGCGCTACATTTTTCTTGG TCAGGATCTTCGCCTTCTTC CAAGAGATGCCAGGATTTGG TGTCCCTGCTGTTCCTATCA AGGGACACCGATTCATCCTA TGCGGAAGCCATTGAATAAT TGAATCGACCAGTGCATTAGA TACTTTGGTCATCGCTGTGG TTTCACCTGAGCAAATTAACCA TCTTCGTGATGTGATTGTCCTT CATCAGCGAAAACAAAGAGAAA TTCTTTCATCATGCTCATTACGTT CAACGCAACATTTCAAGTTAAGA GGTTTGAACTCTGAGCACTTAGC CAATGCTCAAAGACAAGTTAATCG TCTTGACGTTTACAGGAGATTCA GACTGATGCTGATACTGATGGTG ACTCGCTTTGTTTTGCCTTT GCAAAAGGGTATCAACAA TTCTCATCGCTAAATCAATCAC CGTGTTGATGGTATGGAA CAGCGATTGATTTTGGAA TGATGTTGTTGTCGGTAGTGTG TGGGTATTCTTGATGCTCGT TAGAGAATACGGAGCAACAG GTGCCAGCCTCATTTTGAAC TGCTACCTCTATCATTCCTAACA ACCGCCACCTACAATAACGA
NA NA 529149–529168 533987–533969 530226–530244 530388–530406 346532–346513 346376–346396 881026–881045 881152–881131 347864–347845 347719–347738 1765994–1765975 1765841–1765860 2258419–2258400 2258299–2258318 2573641–2573622 2573489–2573508 2575614–2575599 2575456–2575475 2521220–2521200 2521105–2521124 2121931–2121910 2121787–2121808 700225–700204 700080–700103 2347148–2347126 2346996–2347018 768265–768242 768144–768166 1397481–1397503 1397633–1397614 2339308–2339291 2339197–2339218 617744–617761 617909–617892 186686–186707 186866–186847 1561692–1561673 1561554–1561573 672660–672638 672543–672562
a b
Nucleotide positions based on the published COL genome sequence. NA, not applicable. Random nonomers.
using the method of Fillinger et al. (9). In separate experiments, the GAPDH inhibitor iodoacetate (20 g/ml) (41) and 2 mM salicylate were added separately to lysates from control cultures to determine if salicylate directly affects GAPDH activity. DNA and RNA purification. S. aureus chromosomal DNA was extracted as described previously (46), and plasmid DNA was purified from E. coli using the Plasmid Midi kit (QIAGEN Inc., Valencia, CA) following the manufacturer’s instructions. RNA for selective capture of transcribed sequences (SCOTS) (13) and real-time PCR was isolated using a bead mill homogenization procedure (28). RNA for microarrays was isolated from cultures pretreated with an equal volume of RNA Protect (QIAGEN Inc.) before cell harvest (8,000 ⫻ g; 20 min; 4°C). The pellets were then resuspended in 1 ml Trizol (Invitrogen, Carlsbad, CA) and processed in an FP120 FastPrep cell disruptor (MP Biomedicals, Irvine, CA) for 40 s at a setting of 6.0. Chloroform (1:1) was then added to the lysates, followed by centrifugation (16,000 ⫻ g; 15 min; 4°C), and RNA was precipitated in 100% ethyl alcohol (1:1). The RNA was then further purified with RNeasy spin columns (QIAGEN) following the manufacturer’s instructions. cDNA synthesis. Contaminating DNA was removed from all RNA samples using DNAfree (Ambion, Austin, TX). For SCOTS and real-time PCR, RNA was converted to first-strand cDNA with Moloney murine leukemia virus SuperScript III Reverse Transcriptase (Invitrogen) using XbaI- or SalI-linked random nonamers (Table 1) (IDT, Coralville, IA) or random hexamers (Invitrogen),
respectively. Second-strand cDNA was synthesized from first-strand cDNA using DNA polymerase I (New England Biolabs Inc., Ipswich, MA) and linked for SCOTS, or from random hexamers at 37°C for 20 min. cDNA for microarray analyses were produced with SuperScript II Reverse Transcriptase (Invitrogen) with 2 g of RNA combined with random hexamers (Invitrogen), 0.25 mM deoxynucleoside triphosphate (Invitrogen), and 0.25 mM aminoallyl-dUTP (Ambion). Remnant RNA was removed by incubation in hydrolysis buffer (100 mM EDTA, 200 mM NaOH) for 15 min at 65°C. S. aureus DNA microarray hybridization and analysis. cDNAs were initially indirectly labeled with Cy3 or Cy5 postlabeling reactive dye (Amersham Biosciences, NJ) according to the manufacturer’s recommendations. To ensure reproducibility, two cDNA samples were prepared from two separate salicylateinduced and control cultures. S. aureus DNA microarrays, version 2 (http://pfgrc .tigr.org/slide_html/array_descriptions/S_aureus_2.shtml), were then utilized for array analysis as previously described by Mongodin et al. (32). Hybridized arrays were scanned with a GenePix 4000B Microarray Scanner (Axon Instruments, Union City, CA), and array TIFF images were analyzed using TIGR-Spotfinder (http://www.tigr.org/software), followed by data normalization with the LOWESS algorithm using TIGR-MIDAS (http://www.tigr.org/software). Array slides were prepared in duplicate for each experiment, and fluorophore dyes were swapped between replicates to account for dye bias. Genes that demonstrated significant transcriptional alterations were identified on the basis of
222
RIORDAN ET AL.
J. BACTERIOL.
TABLE 2. Genes upregulated or downregulated in response to growth in the presence of 2 mM salicylate for 1 h Gene
Upregulated genes gntK gntP opuD2 atl clfA rpoC femC rplN rpsC rpsE fusA
guaB pnbA Downregulated genes gapA2 nanA pflB mgrA sarR cysK
pgi pckA
Locus IDa
Functiona
Change (n-fold) in gene expression Microarray
SCOTS
SACOL2515 SACOL2514 SACOL2300 SACOL2176 SACOL1062 SACOL0856 SACOL1913 SACOL2301 SACOL0589 SACOL2462 SACOL1329 SACOL2229 SACOL2233 SACOL2605 SACOL2222 SACOL0731 SACOL1522 SACOL0593 SACOL2535 SACOL0180 SACOL0792 SACOL0460 SACOL1090 SACOL2459 SACOL0093
Gluconokinase Gluconate permease Conserved hypothetical Putative glycine betaine transporter Bifunctional autolysin Clumping factor A TrmH RNA methyltransferase Formate dehydrogenase ␣-subunit DNA-directed RNA polymerase -subunit ABC-type transporter, ATP-binding component Glutamine synthetase Ribosomal protein L14 Ribosomal protein S3 Putative fructosamine kinase Ribosomal protein S5 LysR family transcriptional regulator Putative elastin binding EF-G D-Lactate dehydrogenase Type I restriction modification enzyme, R subunit Ribonucleoside diphosphate reductase, ␣-chain Inosine-5-monophosphate dehydrogenase Conserved hypothetical Paranitrobenzyl esterase L-Lactate permease
3.1 2.1 2.0 1.9 1.8 1.8 1.7 1.7 1.7 1.6 1.6 1.6 1.6 1.6 1.5 1.5 Up Up Up Up Up Up Up Up Up
NDb Dc D ND ND D ND ND ND D ND ND ND ND ND D D D Dd D D D D D D
SACOL1734 SACOL0311 SACOL0312 SACOL0204 SACOL2386 SACOL0746 SACOL2287 SACOL0557 SACOL0211 SACOL0224 SACOL0314 SACOL0966 SACOL1838 SACOL0214 SACOL0200
GAPDH Sodium solute symporter N-Acetylneuraminate lyase Formate acetyltransferase Nitrite extrusion Multiple gene regulator Staphylococcal accessory regulator family Cysteine synthase Acetyl-coenzyme A (CoA) acetyltransferase PTS system, IIBC component Conserved hypothetical Glucose-6-phosphate isomerase Phosphoenolpyruvate carboxykinase Long-chain fatty acid CoA ligase Phosphoglycerate transporter
0.38 0.43 0.50 0.55 0.55 0.63 0.63 0.63 0.63 0.63 0.63 0.67 0.67 0.67 0.67
ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND
SACOL2278 SACOL1389 SACOL0640 SACOL0164 SACOL0027 SACOL0121 SACOL0394 SACOL0495 SACOL0511 SACOL0614 SACOL0927 SACOL1020 SACOL1293 SACOL1472 SACOL1685 SACOL1701 SACOL1710 SACOL2040 SACOL2530
Acetyl-CoA dehydrogenase Topoisomerase IV, 〉 subunit Pyridine nucleotide disulfide oxidoreductase Surfactin synthetase homologue Hypothetical Purine nucleoside phosphorylase Putative luciferase family protein Conserved hypothetical Conserved multitransmembrane protein Conserved LmbE-like protein Lipoate synthase Putative LigT 2⬘-5⬘ RNA ligase Polyribonucleotide nucleotidyltransferase Cell wall-associated fibronectin-biNDing protein Aspartyl-tRNA synthetase Conserved hypothetical Valyl-tRNA synthetase Putative glycoprotein endopeptidase Putative glyoxylase family protein
ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND
D D D D D D D D D D D D D D D D D D D
RT-PCR (CI)e
5.5 (0.26) 2.9 (0.80) 1.7 (0.43) 1.7 (0.24) 1.9 (0.23) 1.8 (0.23) 1.8 (0.86) ⫺10.0 (0.88) ⫺5.0 (1.41) ⫺5.0 (1.51) ⫺2.0 (0.29) ⫺2.5 (0.41) -
Salicylate-induced cDNAs detected by SCOTS alone parE
deoD1
lipA pnp ebh aspS valS
4.0 (1.22) 2.0 (0.24) 1.7 (0.24) 1.7 (0.38) -
Continued on following page
EFFECTS OF SALICYLATE ON S. AUREUS
VOL. 189, 2007
223
TABLE 2—Continued Gene
asp3 gltB asp2
Locus IDa
SACOL2665 SACOL2672 SACOL2704 SACOL0514 SACOL2673 SACOL2472 SACOL1967
Functiona
Putative phage infection protein Putative accessory secretory protein Putative ATP phosphoribosyltransferase regulatory subunit Glutamate synthase, large subunit Putative accessory secretory protein Peptide ABC transporter, ATP-binding domain Conserved hypothetical
Change (n-fold) in gene expression Microarray
SCOTS
RT-PCR (CI)e
ND ND ND
D D D
-
ND ND ND ND
D D D D
-
a
Based on the published genome of S. aureus strain COL using NCBI and The Institute for Genomic Research databases. ID, identifier. ND, not detected. D, detected by SCOTS. d Represented by two independent SCOTS-captured cDNAs. e RT-PCR (CI), real-time PCR (confidence intervals). -, not done. b c
previously defined criteria (11, 18, 48), including a ⱖ1.5-fold change in gene expression, and a two-tailed Student’s t test (P ⬍ 0.10). SCOTS. The SCOTS technique (13) was used to identify genes exclusively upregulated by growth in the presence of salicylate. The complete rRNA operon of SH1000 was PCR amplified using primers Rrn1-1 and Rrn1-2 (Table 1) and cloned into the pCR-XL-TOPO vector (Invitrogen), resulting in plasmid pJR-1. Initially, photobiotinylated SH1000 chromosomal DNA was prehybridized at 70°C for 30 min to the S. aureus rRNA gene operon (pJR-1). SalI-linked (salicylate-induced) and XbaI-linked (control) (Table 1) cDNAs were then separately hybridized to rRNA gene-blocked chromosomal DNA overnight at 70°C in 10 mM N-[2-hydroxyethyl]-piperazine-N⬘-[3-propanesulfonic acid] and 1 mM EDTA. cDNA-blocked chromosomal DNA duplexes were then pulled down using streptavidin-coated beads (Invitrogen), and captured cDNA was then further PCR amplified with the respective SalI- or XbaI-specific primers (Table 1). These cDNA populations were then normalized by two subsequent rounds of block capture hybridization. To enrich for salicylate-induced cDNAs exclusively, rRNA gene-blocked chromosomal DNA was prehybridized to denatured normalized control XbaI-linked cDNAs for 30 min at 70°C, and then denatured salicylate-induced SalI-linked cDNA was added and hybridization was continued overnight (70°C). Hybridized cDNA-chromosomal duplexes were then captured with streptavidin, and salicylate-induced cDNAs were amplified by PCR using the SalI-linked primer. After three rounds of enrichment, total salicylate-induced cDNA was cloned into pCR-XL-TOPO (Invitrogen), and cDNA clones were purified using Plasmid Midi kits (QIAGEN) and sequenced (Table 2). Real-time quantitative PCR. Control and salicylate-induced cDNAs were used in real-time PCR with the iCycler iQ Real-Time PCR Detection System (BioRad Laboratories, Hercules, CA) and iQ SYBR Green Supermix (Bio-Rad). Gene-specific primers for real-time PCR experiments are presented in Table 1. Critical cycle threshold values were normalized using 16S rRNA as a reference gene, and the relative change in gene expression was reported using the 2⫺⌬⌬CT method (25).
RESULTS AND DISCUSSION In response to growth with 2 mM salicylate for 1 h, microarray analysis revealed 16 upregulated open reading frames (ORFs) and 15 downregulated ORFs (Table 2). Of all the salicylate-altered ORFs identified, 5 (gntP, clfA, SACOL2462, SACOL1522, and fusA) were upregulated in microarray analyses, captured by SCOTS, and upregulated in real-time PCR analysis; 4 (SACOL2278, parE, SACOL0640, and SACOL0164) were captured by SCOTS and upregulated in real-time PCR analysis (Table 2); and 22 were captured by SCOTS alone (Table 2). The 4 SCOTS-captured-only ORFs confirmed with real-time PCR analysis, and the identification of 22 additional salicylate-inducible SCOTS-captured-only ORFs, demonstrate that the SCOTS technique can be used to identify upregulated ORFs that are not detected by the mi-
croarray. During SCOTS analysis, cDNAs common to both the control and experimental cDNA populations are removed, and the cDNAs that are cloned and sequenced are only those that are upregulated in response to salicylate induction (13). Therefore, SCOTS-captured cDNAs or genes can be identified in quantities that appear unaltered by standard microarray technology. Two millimolar salicylate addition slightly reduced the growth of SH1000, and 5 mM halted further growth after 5 h (Fig. 1). Since slowly growing bacteria express increased antimicrobial resistance (2, 7), growth inhibition by salicylate may contribute to the salicylate-inducible antimicrobial resistance mechanism. In addition, respirometric analysis revealed that O2 consumption by SH1000 cultures was reduced (P ⬍ 0.01) during exposure to 2 mM salicylate by 31.2% after 50 min (13.0 versus 9.0 l) and by 59% after 150 min (16.0 versus 6.7 l). Likewise, CO2 production by SH1000 cultures was reduced (P ⬍ 0.01) during salicylate exposure by 35.4% after 50 min (11.3 versus 17.4 l) and by 56.9% after 150 min (9.1 versus 21.0 l). In contrast to our results, it was reported that Mycobacterium tuberculosis demonstrates increased O2 consumption upon exposure to salicylate (8). This reduced metabolic activity correlates with the findings of our transcriptional analyses. In particular, the expression of a putative glyceraldehyde-3-phosphate dehydrogenase gapA2 gene was downregulated following growth with salicylate. This enzyme catalyzes the interconversion of glyceraldehyde-3phosphate to 1,3-bisphosphoglycerate, which is central to glycolysis. Not only is gapA2 transcriptional activity reduced, but GAPDH activity is decreased ⬃2-fold in strain SH1000 following 1 h of exposure to 2 mM salicylate (2.66 ⫾ 0.06 compared to 1.32 ⫾ 0.04 OD340/OD280/min). Addition of the GAPDH inhibitor iodoacetate to untreated SH1000 lysates inhibited GAPDH activity as expected (1.04 ⫾ 0.04 OD340/OD280/min), yet the addition of 2 mM salicylate to the same lysates had no significant effect on activity (2.7 ⫾ 0.23 OD340/OD280/min) (for all experiments, n ⫽ 3 and P ⬍ 0.05). This suggests that growth in the presence of 2 mM salicylate results in lowered GAPDH activity as a consequence of decreased gapA2 expression. It should be noted that the S. aureus chromosome contains two putative gapA genes: gapA1 (336 amino acids; accession no. YP_185712) and gapA2 (341 amino acids; accession no.
224
J. BACTERIOL.
RIORDAN ET AL.
FIG. 1. Growth of SH1000 with and without salicylate. The error bars represent standard deviations.
YP_186571). Growth of S. aureus in the presence of salicylate also downregulated the transcription of pgi, which encodes glucose-6-phosphate isomerase. Pgi catalyzes the interconversion of glucose-6-phosphate to fructose-6-phosphate, and its activity is also required for glycolysis to occur. In addition, a phosphoglycerate transporter (SACOL0200) (phosphoglycerates are important intermediates for glycolysis) was also downregulated (Table 2). In support of our findings, it was previously demonstrated that salicylate reduces glycolysis in a eukaryotic system (4). In contrast to the genes mentioned above, genes found within the S. aureus gluconate operon (gntRKP), gntK and gntP, were upregulated following growth in the presence of salicylate (Table 2). The signal for gntR also appeared strong by array analysis (1.6-fold), but this finding proved insignificant (P ⬎ 0.10). Increased gluconate uptake might be an important metabolic alteration that occurs in S. aureus to compensate for the growth-inhibitory events occurring during salicylate exposure. The addition of gluconate to growth media in excess of salicylate ameliorated the growth-inhibitory effect(s) of salicylate, especially at 10 mM salicylate (Table 3). This gluconate response could be due to (i) gluconate alleviation of enzymatic inhibition by salicylate and/or (ii) the gluconate addition providing an alternative carbon and energy source for utilization by cells exposed to salicylate. In support of the former hypothesis, salicylate acts as a competitive inhibitor of ␣-ketoglutarate dehydrogenase in cardiac mitochrondia (35). Since there is no evidence of an Entner-Doudoroff pathway in S. aureus (49), gluconate is probably initially oxidized via the pentose phosphate cycle (PPC) in S. aureus, as it is in the closely related model bacterium Bacillus subtilis (37). The PPC is required for the production of pentose phosphates for nucleotide biosynthesis and the anabolic redox cofactor NADPH required for various biosynthetic reactions. In B. subtilis, induction of gntKP is repressed by glucose addition (34). Furthermore, S. aureus
grown without glucose metabolizes ⬎64% of added glucose via the PPC, while cells grown with glucose oxidize only ⬍38% via the PPC (49). These findings demonstrate that glucose addition reduces the contributions of gluconate metabolism and the PPC to overall cell metabolism. We hypothesized that if the metabolism of the salicylate-treated cell relied on a gluconate metabolic pathway, which could be repressed by glucose addition, than glucose addition would contribute to salicylate toxicity. As predicted, the addition of glucose to SH1000 cultures growing in the presence of salicylate exacerbated the growthinhibitory effects of salicylate (Table 3). Another gene repressed by growth in the presence of salicylate is pckA, which encodes phosphoenolpyruvate carboxykinase. PckA converts phosphoenolpyruvate from oxaloacetate using ATP and is implicated in gluconeogenesis, as are the salicylate-repressed genes gapA2 and pgi. Collectively, we speculate that salicylate inhibits glycolysis and gluconeogenesis and induces gluconate metabolism, which provides energy and metabolites for growth during salicylate exposure. It should be noted that B. subtilis has the ability to grow on gluconate by an incompletely defined pathway (10). Upon salicylate induction for 1 h, the two cistronic open reading frames SACOL2300 and SACOL2301 are induced 1.7and 2-fold, respectively, and SACOL2300 was also captured by SCOTS (Table 2). SACOL2301 encodes an ␣-subunit of a putative formate dehydrogenase, suggesting that formate dehydrogenase activity increases following salicylate induction. Perhaps salicylate-induced alterations in formate metabolism contribute to the salicylate effect. Topoisomerase IV is required for DNA synthesis and is the primary target of fluoroquinolones in S. aureus (33). Singlestep fluoroquinolone-resistant S. aureus mutants possess mutations in the genes encoding both topoisomerase IV subunits, parE and parC (20, 33). Fusidic acid binds to the complex of elongation factor G (EF-G), GTP/GDP and the ribosome,
EFFECTS OF SALICYLATE ON S. AUREUS
VOL. 189, 2007 TABLE 3. Effects of gluconate and glucose on salicylate growth inhibition OD600 (⫾SD) at salicylate concn:
Addition None 25 mM gluconate 25 mM glucose
0 mM
2 mM
5 mM
10 mM
2.11 ⫾ 0.12 2.13 ⫾ 0.02 2.06 ⫾ 0.01
2.06 ⫾ 0.05 2.23 ⫾ 0.06a 1.57 ⫾ 0.03a
1.95 ⫾ 0.04a 2.15 ⫾ 0.12a 1.21 ⫾ 0.02a
1.30 ⫾ 0.32a 1.96 ⫾ 0.17a 0.82 ⫾ 0.02a
a P ⬍ 0.05 compared to the salicylate concentration with no gluconate or glucose addition.
inhibiting the release of EF-G-GDP after the translocation step of peptide synthesis, thereby inhibiting protein synthesis (5, 50). Mutations in fusA, the gene encoding EF-G in S. aureus, lead to fusidic acid resistance by reducing the affinity of the drug for the protein synthesis machinery (3). Growth of S. aureus with salicylate leads to a reduction in susceptibility to both ciprofloxacin and fusidic acid (14, 42). Both parE and fusA were identified as salicylate inducible via SCOTS analysis, and this was confirmed by real-time PCR (Table 2). Even though parE and parC are carried on a polycistronic transcript (19), neither was upregulated on the array. fusA was also upregulated by salicylate on the array analysis, but this proved insignificant. Since salicylate exposure elevates parE and fusA transcription, it is possible that increased production of antimicrobial target increases intrinsic resistance to ciprofloxacin and fusidic acid, respectively. Such a mechanism may function by binding the antimicrobials and reducing, in this case, the intracellular concentrations of these drugs. In support of this notion, S. aureus mutants overexpressing penicillin-binding protein 4, one of the drug targets of -lactams, leads to elevated -lactam resistance expression (12, 16). On the other hand, Ince and Hooper (19) reported that decreased transcription of the parEC operon in first-step fluoroquinolone-resistant mutants of S. aureus led to increased resistance to fluoroquinolones, making our findings somewhat contradictory. Furthermore, in contrast to our findings, growth in the presence of salicylate actually reduces fusA transcription in E. coli and M. tuberculosis (8, 40). Even though we previously demonstrated that antimicrobial efflux is stimulated by growth in the presence of salicylate, particularly ethidium efflux (43), we did not detect transcriptional alteration of any antimicrobial efflux pump gene. Despite this finding, however, we do reveal that growth in the presence of salicylate downregulates mgrA (Table 2), which
225
encodes a strain-dependent SarA family (for a review, see reference 29) negative regulator of genes encoding the antimicrobial efflux pumps NorA, NorB, NorC, and Tet38 (22, 26, 51, 52, 53). We speculate that early during salicylate induction one or more of these efflux pump transcriptional units may be upregulated transiently, leading to increased production of a pump(s), but then returns to its preinduced activity level. It is therefore of interest that the overexpression of norB leads to increased ethidium resistance (52) and that growth in the presence of salicylate induces ethidium efflux and resistance (43). Since growth of S. aureus in the presence of salicylate reduces susceptibility to fusidic acid (42) and common house cleaners (46) and reduces mgrA expression (this study), we hypothesized that mgrA mutants should demonstrate reduced susceptibility to fusidic acid and a common house cleaner. mgrA::cat mutants of strains Becker (CYL1040) and Newman (CYL1050) demonstrated reduced susceptibility to ciprofloxacin, as expected (53), and to a common house cleaner but increased susceptibility to fusidic acid (Table 4). Furthermore, the addition of 2 mM salicylate to all drug gradients led to reduced susceptibility in all cases, with the exception of Becker and CYL1040 growing on ciprofloxacin gradients, where salicylate actually led to an unexpected reduction in ciprofloxacin resistance. Of the multiple strains this laboratory has investigated, this is the first S. aureus strain we have come across that did not demonstrate increased resistance to ciprofloxacin when induced with salicylate. Since mgrA inactivation does not completely inhibit salicylate-inducible reduced susceptibility to multiple antimicrobials (with the exception discussed above), it appears that salicylate can induce reduced susceptibility via an mgrA-independent pathway. Salicylate induction at 1 h did not significantly alter the expression of most MgrA-regulated virulence genes (e.g., agr, hla, sarS, and spa) (26, 30) in our analysis. However, salicylate induction did induce the expression of the bifunctional autolysin atl (Table 2), which has been reported to be indirectly downregulated by MgrA (30). Besides mgrA, we note that another SarA family gene, sarR, which encodes a negative regulator of sarA, was also downregulated after growth with salicylate. This suggests that sarA is upregulated by salicylate induction, which was demonstrated by real-time PCR analysis in our previous study using SH1000 (46). We also demonstrated that sarA is required for the full expression of intrinsic multiple antimicrobial resistance (36) and salicylate-induced reduced susceptibility to multiple anti-
TABLE 4. Effects of mgrA inactivation on intrinsic antimicrobial resistance Strain
Becker CYL1040 Newman CYL1050 a
Mean distance (⫾SD) grown on drug gradients (mm) (P ⬍ 0.05)a Cip b
25 ⫾ 2.0 29 ⫾ 1.5 13 ⫾ 0.6 15 ⫾ 0.6
FI
1.2 1.2
Cip b ⫹ Sal
FD/FI
Fusc
9 ⫾ 1.5 19 ⫾ 2.1 17 ⫾ 1.5 32 ⫾ 1.5
0.36 0.66 1.3 2.1
40 ⫾ 2.0 30 ⫾ 0.6 25 ⫾ 3.5 13 ⫾ 1.5
FD
0.76 0.52
Fusc ⫹ Sal
FI
PSd
61 ⫾ 2.9 52 ⫾ 2.5 50 ⫾ 3.5 27 ⫾ 2.0
1.5 1.7 2.0 2.1
21 ⫾ 0.6 52 ⫾ 1.0 7 ⫾ 2.9 45 ⫾ 5.0
FI
2.5 6.4
PS d ⫹ Sal
FI
66 ⫾ 5.1 ⬎90 32 ⫾ 2.5 ⬎90
3.1 ND 4.6 ND
Cip, ciprofloxacin; Sal, 2 mM salicylate; Fus, fusidic acid; PS, Pine-Sol; FI, increase (n-fold) in resistance expression of mgr::cat mutant compared to parent or salicylate-induced increase in resistance level compared to uninduced; FD, salicylate-induced decrease (n-fold) in resistance level compared to uninduced, or decrease in resistance expression of mgr::cat mutant compared to parent; ND, not determined. b Drug gradient, 0 to 0.5 mg/liter. c Drug gradient, 0 to 0.2 mg/liter (Becker and CYL1040), 0 to 0.15 mg/liter (Newman and CYL 1050). d Drug gradient, 0 to 0.15% (vol/vol) (Becker and CYL1040), 0 to 0.1% (vol/vol) (Newman and CYL 1050).
226
RIORDAN ET AL.
microbials (46). In contrast to these findings, Kupferwasser et al. (24) reported that sarA regulation in S. aureus was repressed by growth in the presence of 0.3 mM salicylate. Growth in the presence of salicylate also increased expression of the nucleotide-binding component (SACOL2462) of an ABC transporter putatively constituted by SACOL2461 and SACOL2462 (Table 2). The 3⬘ region of the SACOL2462 ORF overlaps with the 5⬘ region of a putative permease gene (SACOL2461), suggesting that the two genes are cistronic. ABC-type pumps transport chemically assorted substrates, including antimicrobials, and have been implicated in antimicrobial resistance (for a review, see reference 38). Pasca et al. (39) described an ABC transporter in M. tuberculosis involved with intrinsic ciprofloxacin resistance and efflux. In conclusion, salicylate downregulates genes involved with glycolysis and gluconeogenesis: mgrA, a repressor of multidrug efflux pump genes, as well as sarR, which regulates a gene (sarA) that enhances intrinsic antimicrobial resistance. Salicylate also upregulates gluconate and formate metabolic genes, as well as two antibiotic target genes. More experimentation will be required to confirm a possible connection between salicylate-induced alterations in metabolic pathways and antibiotic target gene upregulation and reduced antimicrobial susceptibility.
J. BACTERIOL.
13.
14.
15. 16. 17.
18.
19. 20. 21.
ACKNOWLEDGMENTS We acknowledge support from the National Institutes of Health: S06 GM008136-32 (J.E.G.) (NMSU SCORE PROGRAM); R25 GM07667-29 (NMSU-MARC PROGRAM); S06 GM61222-05 (NMSU-MBRS-RISE PROGRAM); and P20RR16480 from the NMINBRE Program of the National Center for Research Resources. The DNA microarrays were obtained through NIAID’s Pathogen Functional Genomics Resource Center, Division of Microbiology and Infectious Diseases, NIAID, NIH. REFERENCES 1. Alekshun, M. N., S. B. Levy, T. R. Mealy, B. A. Seaton, and J. F. Head. 2001. The crystal structure of MarR, a regulator of multiple antibiotic resistance, at 2.3 Å resolution. Nat. Struct. Biol. 8:710–714. 2. Ashby, M. J., J. E. Neale, S. J. Knott, and I. A. Critchley. 1994. Effect of antibiotics on non-growing planktonic cells and biofilms of Escherichia coli. J. Antimicrob. Chemother. 33:443–452. 3. Besier, S., A. Ludwig, V. Brade, and T. A. Wichelhaus. 2003. Molecular analysis of fusidic acid resistance in Staphylococcus aureus. Mol. Microbiol. 47:463–469. 4. Beynen, A. C., K. F. Buechler, A. J. Van der Molen, and M. J. H. Geelen. 1982. Inhibition of hepatic lipogenesis by salicylate. Toxicology 24:33–43. 5. Bodley, J. W., F. J. Zieve, L. Lin, and S. T. Zieve. 1969. Formation of the ribosome-G factor-GDP complex in the presence of fusidic acid. Biochim. Biophys. Res. Commun. 22:437–443. 6. Cohen, S. P., S. B. Levy, J. Foulds, and J. L. Rosner. 1993. Salicylate induction of antibiotic resistance in Escherichia coli: activation of the mar operon and a mar-independent pathway. J. Bacteriol. 175:7856–7862. 7. Cozens, R. M., E. Toumanen, W. Tosch, O. Zak, J. Suter, and A. Tomasz. 1986. Evaluation of the bactericidal activity of beta lactam antibiotics on slowly growing bacteria cultured in the chemostat. Antimicrob. Agents Chemother. 29:797–802. 8. Denkin, S., S. Byrne, C. Jie, and Y. Zhang. 2005. Gene expression profiling analysis of Mycobacterium tuberculosis genes in response to salicylate. Arch. Microbiol. 184:152–157. 9. Fillinger, S., S. Boschi-Muller, S. Azza, E. Dervyn, G. Branlant, and S. Aymerich. 2000. Two glyceraldehyde-3-phosphate dehydrogenases with opposite physiological roles in a nonphotosynthetic bacterium. J. Biol. Chem. 275:14031–14037. 10. Fujita, Y., and T. Fujita. 1983. Genetic analysis of a pleiotropic deletion mutation (⌬igf) in Bacillus subtilis. J. Bacteriol. 154:864–869. 11. Gao, H., Y. Wang, X. Liu, T. Yan, L. Wu, E. Alm, A. Arkin, D. K. Thompson, and J. Zhou. 2004. Global transcriptome analysis of the heat shock response of Shewanella oneidensis. J. Bacteriol. 186:7796–7803. 12. Georgopapadakou, N. H., L. M. Cummings, E. R. La Sala, J. Unowsky, and
22.
23. 24.
25. 26. 27. 28. 29. 30.
31. 32. 33.
34. 35.
D. L. Pruess. 1988. Over-production of penicillin-binding protein 4 in Staphylococcus aureus is associated with methicillin resistance, p. 597–602. In P. Actor, L. Daneo-Moore, M. L. Higgins, M. R. Salton, and G. D. Shockman (ed.), Antibiotic inhibition of bacterial cell surface assembly and function. American Society for Microbiology, Washington, DC. Graham, J. E., and J. E. Clark-Curtiss. 1999. Identification of Mycobacterium tuberculosis RNAs synthesized in response to phagocytosis by human macrophages by selective capture of transcribed sequences (SCOTS). Proc. Natl. Acad. Sci. USA 20:11554–11559. Gustafson, J. E., P. V. Candelaria, S. A. Fisher, J. P. Goodridge, T. M. Lichocik, T. M. McWilliams, C. T. D. Price, F. G. O’Brien, and W. B. Grubb. 1999. Growth in the presence of salicylate increases fluoroquinolone resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 43:990–992. Gustafson, J. E., Y. Liew, S. Cox, S. G. Wyllie, and J. R. Warmington. 2001. The bacterial multiple antibiotic resistance (Mar) phenotype leads to increased tolerance to tea tree oil. Pathology 33:227–231. Henze, U. U., and B. Berger-Bachi. 1996. Penicillin-binding protein 4 overproduction increases beta-lactam resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 40:2121–2125. Horsburgh, M. J., J. L. Aish, I. J. White, L. Shaw, J. K. Lithgow, and S. J. Foster. 2002. B modulates virulence determinant expression and stress resistance: characterization of a functional rsbU strain derived from Staphylococcus aureus 8325-4. J. Bacteriol. 184:5457–5467. Hughes, T. R., C. J. Roberts, H. Dai, A. R. Jones, M. R. Meyer, D. Slade, J. Burchard, S. Dow, T. R. Ward, M. J. Kidd, S. H. Friend, and M. J. Marton. 2000. Widespread aneuploidy revealed by DNA microarray expression profiling. Nat. Genet. 25:333–337. Ince, D., and D. C. Hooper. 2003. Quinolone resistance due to reduced target enzyme expression. J. Bacteriol. 185:6883–6892. Ince, D., X. Zhang, L. C. Silver, and D. C. Hooper. 2003. Topoisomerase targeting with and resistance to gemifloxacin in Staphylococcus aureus. Antimicrob. Agents Chemother. 47:274–282. Kaatz, G. W., C. E. DeMarco, and S. M. Seo. 2006. MepR, a repressor of the Staphylococcus aureus MATE family multidrug efflux pump MepA, is a substrate-responsive regulatory protein. Antimicrob. Agents Chemother. 50: 1276–1281. Kaatz, G. W., R. V. Thyagarajan, and S. M. Seo. 2005. Effect of promoter region mutations and overexpression on transcription of norA, which encodes a Staphylococcus aureus multidrug efflux transporter. Antimicrob. Agents Chemother. 49:161–169. Kaatz, G. W., and S. M. Seo. 2004. Effect of substrate exposure and other growth condition manipulations on norA expression. J. Antimicrob. Chemother. 54:364–369. Kupferwasser, L. I., M. R. Yeaman, C. C. Nast, D. Kupferwasser, Y. Q. Xiong, M. Palma, A. L. Cheung, and A. R. Cheung. 2003. Salicylic acid attenuates virulence in endovascular infections by targeting global regulatory pathways in Staphylococcus aureus. J. Clin. Investig. 112:222–233. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 deltaⴱdelta Ct method. Methods 25:402–408. Luong, T. T., P. M. Dunman, E. Murphy, S. J. Projan, and C. Y. Lee. 2006. Transcription profiling of the mgrA regulons in Staphylococcus aureus. J. Bacteriol. 188:1899–1910. Luong, T. T., S. W. Newell, and C. Y. Lee. 2003. Mgr, a novel global regulator in Staphylococcus aureus. J. Bacteriol. 185:3703–3710. Mangan, J. A., K. M. Sole, D. A. Mitchison, and P. D. Butcher. 1997. An effective method of RNA extraction from bacteria refractory to disruption, including mycobacteria. Nucleic Acids Res. 25:675–676. Manna, A. C., and A. L. Cheung. 2006. Expression of SarX, a negative regulator of agr and exoprotein synthesis, is activated by MgrA in Staphylococcus aureus. J. Bacteriol. 188:4288–4299. Manna, A. C., S. S. Ingavale, M. Maloney, W. van Wamel, and A. L. Cheung. 2004. Identification of sarV (SA2062), a new transcriptional regulator, is repressed by SarA and MgrA (SA0641) and involved in the regulation of autolysis in Staphylococcus aureus. J. Bacteriol. 186:5267–5280. Martin, R. G., and J. L. Rosner. 1995. Binding of purified multiple antibioticresistance repressor protein (MarR) to mar operator sequences. Proc. Natl. Acad. Sci. USA 92:5456–5460. Mongodin, E., J. Finan, M. W. Climo, A. Rosato, S. Gill, and G. L. Archer. 2003. Microarray transcription analysis of clinical Staphylococcus aureus isolates resistant to vancomycin. J. Bacteriol. 185:4638–4643. Ng, E. Y. W., M. Truckis, and D. C. Hooper. 1996. Quinolone resistance mutations in topoisomerase IV: relationship to the flqA locus and genetic evidence that topoisomerase IV is the primary target and DNA gyrase is the secondary target of fluoroquinolones in Staphylococcus aureus. Antimicrob. Agents Chemother. 40:1881–1888. Nihashi, J., and Y. Fujita. 1984. Catabolite repression of inositol dehydrogenase and gluconate kinase syntheses in Bacillus subtilis. Biochim. Biophys. Acta 798:88–95. Nulton-Persson, A. C., L. I. Szweda, and H. A. Sadek. 2004. Inhibition of cardiac mitochondrial respiration by salicylic acid and acetylsalicylate. J. Cardiovasc. Pharmacol. 44:591–595.
VOL. 189, 2007 36. O’Leary, J. O., M. J. Langevin, C. T. D. Price, J. S. Blevins, M. S. Smeltzer, and J. E. Gustafson. 2004. Effects of sarA inactivation on intrinsic multidrug resistance of Staphylococcus aureus. FEMS Microbiol. Lett. 237:297–302. 37. Otani, M., T. Fugita, C. Umezawa, and K. Sano. 1987. Gluconate metabolism in germinated spores of Bacillus megaterium QMB1551: primary roles of glukonokinase and the pentose cycle. Biochim. Biophys. Acta 924:467–472. 38. Otto, M., and F. Gotz. 2001. ABC trasporters of staphylococci. Res. Microbiol. 152:351–356. 39. Pasca, M. R., P. Guglierame, F. Arcesi, M. Bellinzoni, E. De Rossi, and G. Riccardi. 2004. Rv2686c-Rv2687c-Rv2688c, an ABC fluoroquinolone efflux pump in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 48: 3175–3178. 40. Pomposiello, P. J., M. H. J. Bennik, and B. Demple. 2001. Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate. J. Bacteriol. 183:3890–3902. 41. Poolman, B., B. Bosman, J. Kiers, and W. N. Konings. 1987. Control of glycolysis by glyceraldehyde-3-phosphate dehydrogenase in Streptococcus cremoris and Streptococcus lactis. J. Bacteriol. 169:5887–5890. 42. Price, C. T. D., F. G. O’Brien, B. P. Shelton, J. R. Warmington, W. B. Grubb, and J. E. Gustafson. 1999. Effects of salicylate and related compounds on fusidic acid MICs in Staphylococcus aureus. J. Antimicrob. Chemother. 44: 57–64. 43. Price, C. T. D., G. W. Kaatz, and J. E. Gustafson. 2002. The multidrug efflux pump NorA is not required for salicylate-induced reduction in drug accumulation by Staphylococcus aureus. Int. J. Antimicrob. Agents 20:212–219. 44. Price, C. T. D., I. R. Lee, and J. E. Gustafson. 2000. The effects of salicylate on bacteria. Int. J. Biochem. Cell Biol. 32:1029–1043.
EFFECTS OF SALICYLATE ON S. AUREUS
227
45. Price, C. T. D., and J. E. Gustafson. 2001. Increases in the mutation frequency at which fusidic acid-resistant Staphylococcus aureus arise with salicylate. J. Med. Microbiol. 50:104–106. 46. Riordan, J. T., J. O. O’Leary, and J. E. Gustafson. 2006. Contributions of sigB and sarA to distinct multiple antimicrobial resistance mechanisms of Staphylococcus aureus. Int. J. Antimicrob. Agents 28:54–61. 47. Rosner, J. L. 1985. Nonheritable resistance to chloramphenicol and other antibiotics induced by salicylate and other chemotactic repellants in Escherichia coli K-12. Proc. Natl. Acad. Sci. USA 82:8771–8774. 48. Smoot, L. M., J. C. Smoot, M. R. Graham, G. A. Somerville, C. A. Sturdevant, C. A. Migliaccio, G. L. Sylva, and J. M. Musser. 2001. Global differential gene expression in response to growth temperature alteration in group A Streptococcus. Proc. Natl. Acad. Sci. USA 98:10416–10421. 49. Strasters, K. C., and K. C. Winkler. 1963. Carbohydrate metabolism of Staphylococcus aureus. J. Gen. Microbiol. 33:213–229. 50. Tanaka, N., T. Kinoshita, and H. Masukawa. 1968. Mechanism of protein synthesis inhibition by fusidic acid and related antibiotics. Biochem. Biophys. Res. Commun. 30:278–283. 51. Truong-Bolduc, Q. C., J. Strahilevitz, and D. C. Hooper. 2006. NorC, a new efflux pump regulated by MgrA of Staphylococcus aureus. Antimicrob. Agents Chemother. 50:1104–1107. 52. Truong-Bolduc, Q. C., P. M. Dunman, J. Strahilevitz, S. J. Projan, and D. C. Hooper. 2005. MgrA is a multiple regulator of two new efflux pumps in Staphylococcus aureus. J. Bacteriol. 187:2395–2405. 53. Truong-Bolduc, Q. C., X. Zhang, and D. C. Hooper. 2003. Characterization of NorR protein a multi-functional genetic regulator of norA expression in Staphylococcus aureus. J. Bacteriol. 185:3127–3138.
