Response to steroid therapy in autism secondary to autoimmune ...

Response to steroid therapy in autism secondary to autoimmune lymphoproliferative syndrome Sha/ini Shenoy, ~IH),Slh~an Arnold, ~ID, and Tala[ Chatt'la, 31o

We report a child who developed autoimmune lymphoproliferative syndrome (ALPS) secondary to a heterozygous dominant negative mutation in the death domain of the Fas receptor. Previously developmentally normal, he had symptoms of autism with rapid regression in developmental milestones coincident with the onset of lymphoproliferation and autoimmune hemolytic anemia. Low-dose steroid therapy induced early and complete remission in the ALPS phenotype. There was subjective improvement, followed by objective improvement in speech and developmental milestones. We propose that autism may be part of the autoimmune disease spectrum of ALPS in this child, and this case represents a novel manifestation and target organ involvement in this disease. (d Pediatr 2000; 136:682-7)

The autoimmune lymphoproliferanve syndrome is a recently described disease characterized by lymphadenopathy and autoimmunitv and is associated with impairment of activatlon-induced death (apoptosis) of lymphocytes. 1 Patients with ALPS present with lymphoproliferation and autoimmune disease, particularly hematologic cvtopenia, associated with circulating autoantibodles and hypergammaglobulinemia. Several patients with ALPS have been found to harbor mutations in the Fas receptor? -8 and on one occasion, in its ligand (FasL). 9 A few patients have no detectable mutations in either Fas or FasL, raising the possibility t h a t t h e y

have defects downstream of Fas. 10 An accumulation of CD3+0t-~TCR + C D 4 - C D 8 - T cells results, associated with T cell-directed B-cell activation and development of autoantibodles. S e e e d i t o r i a l , p. 5 7 6 .

Although autoimmune lymphoproliferation is a common theme, the spectrum of manifestations and natural histo W of this disease in humans is unknown. 11 Central nervous system involvement has not been described in children presenting with ALPS. In this report we describe a child with a heterozygous dominant negative Fas mu-

From the Di,,ishms ~g'Hemahdogy-Onco[o.qy, Neurology, and bnmmw/ogy-Rheanzata/agy, Department of Pediatrics, W~hlngton University School af ,'lIedb'ble and St Louis Children :~lfospita[, St Lottio, e~'[ia.,ouri.

Supported by National Institutes of Health KO8 Award CA72587 (S.S.). Submitted for publication June 10, 1999; revisions received Sept 16, 1999, and Nov 30, 1999; accepted Dec 21, 1999. Reprint requests: Shalini Shenoy, MD, Washington University School of Medicine, Division of Pediatric Hematology-Oncology, Box 8116, 660 South Euclid Ave, St Louis, MO 63110. Copyright © 2000 by Mosby, Inc. 0022-3476/2000/$12.00 + 0 9/22/105355 doi:l 0.1067/mpd.2000.105355 682

tation who developed ALPS at 18 months of age and presented with autism coincidental with the onset of autoimmunity and lymphoproliferation. His disease parameters and autism improved during steroid therapy, suggesting a causal association between ALPS and autism. Involvement of the CNS may thus be a novel manifestation of autoimmunity in this disease. ALPS Autoimmune lymphoproliferative

syndrome CNS CSF EBV PBLs

Central nervoussystem Cerebrospinal fluid Epstein-Barrvirus Peripheralblood lymphocytes

CASE HISTORY The patient was normal until 18 months of age when he developed features of autism. He rapidly lost speech and communicative gestures, failed to recognize or handle familiar objects and toys appropriately, and developed poor eye contact. He had previously said at least 5 words but subsequently did not respond to his name or simple commands. Results of audiologic evaluation, head magnetic resonance imaging, awake and asleep electroencephalography, thyroid function tests, serum and urine amino acid determinations, and organic acid tests were normal. Progressive lymphadenopathy was also noticed after a brief febrile period at 18 months and was attributed to a simultaneously recognized EpsteinBarr virus infection. The infection initially involved the cervical region but later became massive and generalized. He next developed intractable diarrhea with significant perineal excoriation.

THE JOURNALOF PEDIATRICS

SHENOY,ARNOLD,AND CHATILA

VOLUME 136,NUMBER5 Insect bites in the summer months resulted in severe and prolonged inflammatory reactions, a new manifestation. There were no serious infections to suggest immune deficiency. The family history was significant only for multiple sclerosis in a paternal aunt. Physical examination at 2 years was significant for pallor; massive cervical, axillaW, and inguinal lymphadenopathy (lymph node size >3 cm); and firm liver (4 cm) and spleen (3 cm) below the costal margin. Enlarged abdominal and mediastinal lymph nodes were identified by computed tomographlc scan. Findings on neurologic examination were normal except for behavioral features of autism. He used no words or gestures. Laboratory investigations revealed microcytic anemia, a low normal white blood cell count, and mild thrombocytopenia (Table I). The differential white blood cell count was normal. The peripheral smear was significant for 30% microspherocytes. The reticulocyte count was elevated (Table I), but the results of direct and indirect Coombs' tests were negative. Serum bilirubin (0.3 mg/dL), lactate dehydrogenase (592 IU/L), and uric acid (4.2 g/dL) levels were normal. Results of iron studies and liver and kidney function tests were normal. Findings on histologic examination of bone marrow and eytogenetic analysis were normal. A positive IgG antibody titer to EBV viral capsid antigen (>1:40) was detected; anti-EBV IgM was negative. The cerebrospinal fluid was negative for EBV antibodies. A stool examination and culture for causes of infection was negative. Quantitative serum immunoglobulin levels were markedly elevated (Table I), but no antibodies against phospholipids, nuclear antigen, or extractable nuclear antigen were detected. Analysis of the CSF revealed normal levels of glucose (54 mg/dL), protein (27 mg/dL), lactate (1.5 mmo]/L), and pyruvale (0.11 mmol/L); no cells were present. CSF electrophoresis revealed no oligoclonal bands. The albumin index, a measure

Table I. Laboratory investigations compared before and after commencing steroid therapy

Laboratory test

Before steroids After steroids

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Hemoglobin (g/dL) [11.5-13.5] MCV (fL) [75-87] WBC count (109/L) [5-15] Platelets (109/L) [150-450] Reticulocytes (%) [0.7-2.1] Neutrophils (%) [16-60] Lymphocytes (%) [20-70] IgG (mg/dL) [345-1213] IgA (mg/dL) [14-159] IgM (mg/dL) (43-200) CD3 (%) [57-82] TCR 0g13(%) TCR 7/15(%) CD3/CD4 (%) [32-60] CD3/CD8 (%) [15-42] CD3/CD4-CD8- (%) CD3/CD56/16* (%) [2-18] CD19/CD20 (%) [4-23] Activated T cells (%)

. . . . . . . . .

9.0 68 6.8 175 4.6 25 63 2380 593 197 64.2 58.9 2.6 30.8 20 13.4 22.1 22.1 3.5

After steroids

. . . . . . . .

12.9 73.3 15.1 470 1.8 43 29 1440 440 158 66.7 57.2 3.0 35.5 24.3

. . . . .

13.1 76.2 8,2 325 1.2 39 53 1040 272 142 81.4 65.9 2.7 40.8 33.3

0

0

18.2 4.0 4.O

11.3 4.8 4.8

MCV, Mean cellvolume; WBC,white blood cell; TCR, T-cellreceptor.

of blood-brain barrier breakdown, was normal (3.4 x 10-5). CSF lgG to albumin ratio was elevated and was reflective of the high serum IgG level. This was confirmed by a normal CSF to serum IgG index. In contrast, physical examination findings, blood counts, serum immunoglobulin levels, and peripheral blood lymphocyte subset analyses fbr both parents and an older sibling were normal. Assays on peripheral blood were done after informed consent had been obtained from the parents and approval had been given by the institutional review board and human studies committee at Washington University.

DNA Sequencing Complementary DNA was derived from EBV cell lines or peripheral blood lymphocytes by using synthetic primers purchased from Integrated DNA Technologies, Inc (Coralville, Iowa). The nested primers used to amplify hFas eDNA were: outer primer pairs, AGT-

G A G G G A A G C G G T T T A C G A G (bp 14-52; sense) and AGTGGGGTTAGCCTGTGGATAGAC (bp 1565-1542; antisense); and inner primer pairs, CGGAGTTGGGGAAGCTCTTTC (bp 150-170; sense) and AAAACCAAGCAGTATTTACAGCCAG (bp 1290-1266; antlsense). Amplified eDNA was subcloned into TA cloning vector (Invitrogen, Carlsbad, Calif). Seven to 10 clones per individual were sequenced in their entirety by automated fluorescence sequencing.

Flow Cytometry PBLs were stained with CH- 1 l (antiFas monoclonal antibody) (Kamiya Biomedical, Seattle, Wash) or isotypematched mouse IgM, counterstained with fluorescein isothiocyanate-conjugated rat anti-mouse immunoglobulin (Jackson ImmunoResearch Labs, West Grove, Pa), and evaluated on a FACScan (Becton Dickinson, Mountain View, Calif). For fluorescence-activated cell sorter analysis of lymphocytes, 683

SHENOY,ARNOLD, AND CHATILA

THE JOURNAL OF PEDIAI MAY

WT TAGAT

MUT I:I'ACAT

[

=

o

,,~/~'r'~ t ~

C

CH-11IPattent

Fluorescence 190O01

~-

~-

[]radiation II Mouse Ig II Fas mAb 3O 2O 1

D

!

control

patient

F~ure. Nucleotide sequence of Fas gene localized at positions 972 to 976 in the death domain. A, Wild type (W 0 or normal sequence.B, Mutar (MUT)with G-eC substitution at position 974. C, Surface expression of Fas was comparable to control levels,Background staining is with mouse irr munoglobulin, D, Patient PBLswere resistant to activation-induced Fas monoclonal antibody-mediated apoptosis but were sensitiveto radiation,

FITC-anti-CD2, peridinin chlorophyll protein (PerCP) anti-CD3, phycoerythrin-anti-CD5, FITC-anti-CD4, and phycoerythrin-anti-CD8 were purcha.sed from Becton Dickinson.

Assay of Fas-DependentApoptosis PBLs were activated with 5 gg/mL phytohemagglutinin (Sigma, St Louis, Mo) and 20 U/mL recombinant human interleukin-2 (rhIL-2) (Chiron Corp, Emeryville, Calif) for 7 days, washed, and incubated with CH-11 (100 ng/inL) (Kamiya Biomedical) or mouse IgM for 24 hours at 37°C. Percent apoptosis was calculated by propidium iodide (Boehringer Mannheim Corp, Indianapolis, Ind) staining. Radiated PBLs (3000 tad) were controls for cell death.

RESULTS Genotypic and Phenotypic Analysis of Fas Sequence analysis of the patient's Fas cDNA revealed a heterozygous

684

missense mutation at position 974 (G-+C) of one allele (Figure, B). This mutation results in an aspartic acid to histidine substitution at position 244 in the death domain of the Fas protein. This is in contrast to Fas gene polymorphisms, which never result in amino acid substitutions in conserved regions of the molecule. 12 Substitution in the conserved death domain or adjacent sites is sufficient for disrupted signaling as evidenced by T-cell apoptosis studies. The asymptomatic mother was also heterozygous for the same mutation, whereas the father was unaffected (Figure, A). Fas expression on the patient's PBLs was normal (Figure, C), but activation-induced Fas-mediated apoptosis was profoundly impaired (Figure, D) in the patient, °although normal in both parents (not shown). Activated patient PBLs were able to lyse Fas-positive targets as effectively as normal control cells in standard chromium release assays (not shown), consistent with normal FasL fhnetlon.

The majority of lymph node (75%) were CD2 +, CD3 +, CD5 + CD4-, CD8-. CD4+CD8 - cells 17% and CD4-CD8 + cells were 1( Lymphocyte subset analysis of pe eral blood revealed the presen characteristic CD3+~[~TCR+CD4-q T cells (Table I).

Reversal of Immunologic Abnormalities with Steroid Therapy After confirmation of the diag treatment with oral prednisor mg/kg/d) was commenced at the 33 months. This dose resulted in sive irritability but was associatec dramatic clinical response. In 2 -s the chronic diarrhea and perinea rash completely subsided. Inflam W cutaneous reactions disapp~ Physical examination at 1 mon vealed small posterior cervical but no hepatosplenomegaly. St~ were gradually tapered over the 1 months to 0.5 mg£kg daily. A lowe

THE JOURNALOF PEDIATRICS VOLUME 136, NUMBER5 of 0.4 mg/kg, given every other day, 8 months later, again precipitated diarrhea and cervical adenopathy. Steroids were increased to 1 mg/kg on alternate days for 2 weeks and again tapered to 0.5 mg/kg on alternate days. Twenty-six months after institution of therapy, the patient was free of symptoms, and findings on physical examination and laboratory evaluation were normal. Laboratory investigation before therapy is compared with improvement at 3 months and 1 year af}er commencement of therapy in Table I. O f note, almost all laboratory parameters returned to normal within 3 months of commencing treatment with oral steroids.

SHENOY,ARNOLD, AND CHATILA

Table II. Developmental and speech assessmentbefore and after institution of therapy

Treatment Before onset Before steroids

After steroids (10 wk)

Amelioration of Language Impairment and Autistic Features During Steroid Therapy At the end of a month of steroid therapy, subjective improvement in autistic behavior was present; the parents reported an increased awareness of environment and return of playful interactions, especially with family members. He started responding to his name, seemed to understand his parents, initiated games of peek-a-boo, and imitated behavior. There was also increased awareness of other children and jealousy. Gradually, over the next 4 months, speech returned in the form of spontaneous babbling during play. Vocalization subsequently expanded to include a number of consonants and patterned utterances, followed by actual words. There was improvement in attention span with increased concentration in favorite activities (eg, jumping and computer games). He used gestures to communicate needs, initiated interactions with familiar peers and teachers by means of eye contact, indicated choice on presentation of objects, and actively cooperated with dressing and feeding activities--all skills previously lost. After 1 year of steroid therapy, his vocabulary had increased to over 200 spontaneous words with even more word imitation.

Chronologic age Assessedage

.....h.!.s..t..o..~y. ....................................

After steroids (1 y)

Z~.t...~p..p.!!~..d. ..............................

Denver REEL Receptive language Expressive language REEL Receptive language Expressive language Vineland Communication Socialization Child Autism Rating Scale REEL Receptive language Expressive language Vineland Communication Socialization Rosetti Language comprehension Language expression Interaction-attachment Pragmatics Gesture Rosetti Language comprehension Language expression Interaction-attachment Pragmatics Gesture

.(m.o.) .......................... (.m....o.).

. . . . . . . . . . . . . .

12

12

26 26

6 4

33 33

8 7

33 33 33

7 10 Mildly autistic

35 35

7-8 7-8

35 35

8 10

35 35 35 35 35

6-9 6-9 9-12 6-9 12-15

44 44 44 44 44

15 15 18 18 21

REEL, ReceptiveExpressiveEmergentLanguageScale.

Objectively, before the development of illness, results of the Denver II Developmental Screening were normal at 12 months of age. By 26 months, there was significant regression of receptive and expressive language (Table II). Minimal improvement occurred in the following 7 months. During high-dose prednisone therapy for the next 10 weeks, a lack of objective improvement on repeat testing could be attributable to excessive irritability during treatment with high-dose steroids (2 mg/kg). In the subsequent 9 months, distinct improvement in language and behavior was documented (summarized in Table II). Progress in this peri-

od was rapid compared with the preceding 7-month period (26 to 33 months of age) in the absence of any change in other interventions such as speech therapy.

DiSCUSSiON We report a child who was developmentally normal until the simultaneous onset of ALPS and autism at 18 months of age. Deterioration in milestones were rapidly progressive for the next 15 months in spite of speech and occupational therapy until the institution of steroid therapy, after which

685

THE JOURNALOF PEDIATRICS MAY 2000


there was early and continued improvement in speech and behavior that paralleled recovery from autoilnmunity and systemic manifestations. Autism is frequently associated with congenital disorders and delayed development from infancy. It is often considered the result of organic brain damage. 14-18 However, approximately one third of children develop normally until a period of regression in skills, usually between 1 and 3 years of age.19 Autoimmune causes have been implicated in autism, associated with immunologic or cytokine abnormalities, or increased activated peripheral blood lymphocytes. 20'21 Some autistic patients with circulating antibodies to human herpesvirus-6 or measles virus have developed high levels of autoantibodies to myelin basic protein or neuron-axon filament protein. 22-25 Yet the efficacy of immunoglobulin or steroid therapy is considered generally poor. 26 Autoimmune disease secondary to absent or mutated Fas was recognized and termed ALPS in 1995.1 About 25 patients with specific mutations and defective apoptosis have been described. 2-8 The disease is characterized by an accumulation of undeleted activated C D S + 0 ~ T C R + C D d - C D 8 - T cells in peripheral blood and lymphoid organs. T cells do not undergo Fas-rnediated apoptosis but remain sensitive to cell death pathways mediated b.v glucocorticoids, ceramide, etc. The factors determining target organ predilection in ALPS are unknown. To our knowledge, CNS involvement is not described in ALPS. FasL expression has been detected in various cells of the CNS and is thought to be responsible for regulating inflammatory responses by deletion of infiltrating activated Fas-expressing T cells. 27'28 This process may be defective in the presence of Fas mutations, thus predisposing to inflammation. Alternately, the CNS could be the target of T cell-mediated B-cell activation and autoantibodies against neuronal antigens. B-cell numbers were modestly elevat686

ed at diagnosis but decreased with therapy in this case. The trigger for the development of autoimmune symptoms in ALPS is unknown. The age at which disease manifests is also variable. 7 Heterozygous Fas mutations are frequently detected in unaffected family members (similar to the mother of this child). This suggests that additional genetic or environmental factors may predispose to disease. The presence of similar disease in a subset of patients with normal Fas also supports this. 10 Alternately, the presence of Fas mutations may potentiate factors that predispose to autoimmunity. This patient had EBV infection that correlated with the onset of symptoms. Viral infections are known to interfere with the apoptosis process, 2931 and an additional compromise in T-cell deletion may be the precipitating factor for disease. A change in the cytokine milieu may interfere with alternate apoptosis pathways, such as tumor necrosis factor-Or, and thus promote the development of disease. The development of autism in this child alongside lymphoproliferation and autoimmunity and the temporal relationship of improvement in language and communication skills coincident with the regression of all clinical autoimmune manifestations with steroid therapy suggest a common etiology. Improvement in social and language abilities with steroid therapy contrasted with minimal progress on these fronts in the preceding 7 months. Improvement in language skills after steroid therapy has been described in some children with Landau-Kleffner syndrome, an autistic disorder characterized by seizures and abnormal findings on electroencephalogram, 52'35 and in a patient with pervasive developmental delay, 34 in which autoimmune etiologies have been postulated without systemic evidence of autoimmunity. The clinical presentation of our patient is distinct from that associated with Landau-Kleffner syndrome in that he had no seizures or electroen-

cephalographic abnormalities. This association of autism with autoimmune disease reinforces the need for further investigation into the range of clinical manifestations in ALPS, as well as the links between autoirnmunity, language regression, and autistic behavior.

REFERENCES 1. Fisher GH, Rosenberg F J, Straus SE, Dale JK, Middleton LA, Lin AY, et al. Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell 1995;81:935-46. 2. Sneller MC, Straus SE, Jaffe ES, Jaffe JS, Fleisher TA, Stetler-Stevenson M, et al. A novel lvmphoproliferative/autoimmune syndrome resembling routine lpr/gld disease. J Clin Invest 1992;90:334-41. 3. Rieux-Laucat F, Le Deist E Hivroz C, Roberts IA, Debatin KM, Fischer A, et al. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science 1995;268: 1347-9. 4. Drappa J, Vaishnaw AK, Sullivan KE, Chu JL, Elkon KB. Fas gene mutations in the Canale-Smith syndrome, an inherited lymphoproliferative disorder associated with autoimmunity. N Engl J Med 1996;335:1643-9. 5. Le Deist F, Emile JF, Rieux-Laucat E Benkerrou M, Roberts I, Brousse N, et al. Clinical, immunological, and pathological consequences of Fas-deficient conditions. Lancet 1996;348:719-23. 6. Bettinardi A, Brugnoni D, QuirosRoldan E, Malagoli A, La Grutta S, Correra A, et a]. Missense mutations in the Fas gene resulting in autoimmune ]ymphoproliferative syndrome: a molecular and immunological analysis. Blood 1997;89:902-9. 7. Infante AJ, Britton HA, DeNapoli T, Middehon LA, Lenardo M J, Jackson CE, et al. The clinical spectrum in a large kindred with autoimmune lymphoproliferative syndrome caused by a Fas mutation that impairs lymphocyte apoptosis. J Pediatr 1998; 133:629-33. 8. Sneller MC, Wang J, Dale JK, Strober W, Middelton LA, Choi Y, et al. Clinical, immunologic, and genetic features of an autoimmune lymphoproliferative syndrome associated with abnormal lymphocyte apoptosis. Blood 1997;89:1341-8. 9. Wu J, Wilson J, He J, Xiang L, Schur


THEJOURNALOF PEDIATRICS VOLUME 136,NUMBER5

10.

11.

12.

13.

14.

15.

16.

17.

PH, Mountz J D . Fas ligand mutation in a patient with systemic lupus erythematosus and lymphoproliferative disease. J Clin Invest 1996;98:1107-13. Dianzani U, Bragardo NI, DiFranco D, Alliaudi C, Scagnl P, Buonfiglio D, et al. Deficiency of the Fas apoptosis pathway without Fas gene mutations in pediatric patients with autoimmunity/lymphoproliferation. Blood 1997;89:2871-9. Benkerrou M, Le Deist E de Villartay JP, Caillat-Zucman S, Rieux-Laucat E Jabado N, et al. Correction of Fas (CD95) deficiency by haploidentical bone marrow transplantation. Eur J Immunol 1997;27:2043-7. Fiucci G, Ruberti G. Detection of polymorphisms within the Fas cDNA gene sequence by GC-clamp denaturing gradient gel electrophoresis. Immunogenetlcs 1994;39:437-9. Kraus MD, Shenoy S, Chatila T, Hess JL. A light microscopic, immunophenotypic and molecular genetic study of autoimmune lymphoproliferative syndrome caused by Fas mutation. Pediatr Dev Pathol 2000;3:101-9. Fattal-Valevski A, Kramer U, Leitner Y, Nevo Y, Greenstein Y, Harel S. Characterization and comparison of autistic subgroups: 10 years' experience with autistic children. Dev Med Child Neurol 1999;41:21-5. Gillberg C. Chromosomal disorders and autism. J Autism Dev Disord 1998;28:415-25. Volkmar FR, Klin A, Pauls D. Nosological and genetic aspects of Asperger syndrome. J Autism Dev Disord 1998; 28:457-63. Feinstein C, Reiss AL. Autism: the point of view from fragile X studies. J Autism Dev Disord 1998;28:393-405.

18. Nordin V, Lekman A, Johansson M, Fredman E Gillberg C. Gangliosides in cerebrospinal fluid in children with autism spectrum disorders. Dev Med Child Neurol 1998;40:587-94. 19. Tuchman RF, Rapin I. Regression in pervasive developmental disorders: seizures and epileptiform electroencephalogram correlates. Pediatrics 1997;99:560-6. 20. van Gent T, Heijnen C J, Treffers PD. Autism and the immune system. J Child Psychol Psychiatry 1997;38:33749. 21. Plioplys AV, Greaves A, Kazemi K, Silverman E. Lymphocyte function in autism and Rett syndrome. NeuropsychobioloKy 1994;29:12-6. 22. Singh VK, Lin SX, Yang VC. Serological association of measles virus and human herpesvirus-6 with brain autoantibodies in autism. Clin Immunol Immunopathol 1998;89:105-8. 23. Singh VK, Warren R, Averett R, Ghaziuddin M. Circulating autoantibodies to neuronal and glial filament proteins in autism. Pecliatr Neurol 1997; 17:88-90. 24. Singh VK, Warren RE Odell J D , Warren WL, Cole E Antibodies to myelin basic protein in children with autistic behavior. Brain Behav Immun 1993;7:97-103. 25. Connolly AM, Chez MG, Pestronk A, Arnold ST, Mehta S, Deuel RK. Serum autoantibodies to brain in Landau-Kleffner variant, autism, and other neurologic disorders. J Pediatr 1999; 134:607-13. 26. Plioplys AV. Intravenous immunoglobulin treatment of children with autism. J Child Neurol 1998;13:79-82, 27. Saas E Walker PR, Hahne M, Qui-

28.

29.

30.

31.

32.

33.

34.

querez AL, Schnuriger V, Perrin G, et al. Fas ligand expression by astrocytoma in vivo: Maintaining immune privilege in the brain? J Clin Invest 1997;99:1173-8. French LE, Hahne M, Viard I, Radlgruber G, Zanone R, Becker K, et al. Fas and Fas ligand in embryos and adult mice: ligand expression in several immune-privileged tissues and coexpression in adult tissues characterized by apoptosis cell turnover. J Cell Biol 1996; 133:335-43. Ray RB, Meyer K, Steele R, Shrivastava A, Aggarwal BB, Ray R. Inhibition of tumor necrosis factor (TNFalpha)-mediated apoptosis by hepatitis C virus core protein. J Biol Chem 1998;273:2256-9. Jerome KR, Tait J E Koelle DM, Corey L. Herpes simplex virus type 1 renders infected cells resistant to cytotoxic T-lymphocyte-induced apoptosis. J Virol 1998;72:436-41. Seshagiri S, Miller LK. Baculovirus inhibitors of apoptosis (IAPs) block activation of Sf-caspase-1. Proc Natl Acad Sci USA 1997;94:13606-11. Marescaux C, Hirsch E, Finck S, Maquet E Schlumberger E, Sellal E et al. Landau-Kleffner syndrome: a pharmacologic study of five cases. Epilepsia 1990;31:768-77. Lerman P, Lerman-Sagie T, Kivity S. Effect of early corticosteroid therapy for Landau-Kleffner syndrome. Dev Med Child Neurol 1991;33:257-60. Stefanos GA, Grover W, Geller E. Case study: corticosteroid treatment of language regression in pervasive developmental disorder. J Am Acad Child Adolesc Psychiatry 1995;54: 1107-11.

687