JOURNAL OF VIROLOGY, Sept. 1999, p. 7874–7876 0022-538X/99/$04.00⫹0 Copyright © 1999, American Society for Microbiology. All Rights Reserved.
Vol. 73, No. 9
Rhesus Rhadinovirus Establishes a Latent Infection in B Lymphocytes In Vivo ERIC P. BERGQUAM,1 NANCY AVERY,1 STANLEY M. SHIIGI,1 MICHAEL K. AXTHELM,1 AND SCOTT W. WONG1,2* Division of Pathobiology and Immunology, Oregon Regional Primate Research Center, Beaverton, Oregon 97006,1 and Department of Molecular Microbiology and Immunology, Oregon Health Sciences University, Portland, Oregon 972012 Received 18 March 1999/Accepted 9 June 1999
Recent DNA sequence analysis indicates that rhesus rhadinovirus (RRV) is a member of the lymphotropic gamma-2 herpesvirus family. To determine if RRV is lymphotropic, peripheral blood mononuclear cells from naturally infected monkeys were separated by immunomagnetic bead depletion and analyzed for the presence of RRV by virus isolation and nested PCR. The recovery and consistent detection of RRV in the CD20ⴙenriched fraction clearly demonstrates that B lymphocytes are a major site of virus persistence. with whole RRV-infected cell lysate (13) and randomly sampled monkeys for prior exposure to RRV as revealed by the presence of reactive antibodies. Our studies corroborated those of Desrosiers et al. (6) in finding that greater than 90% of rhesus monkeys over 2 years of age and group housed were strongly positive for antibodies to RRV and that infants 6 to 9 months of age and individually housed with their mothers or hand reared were the least likely to possess antibodies reactive to RRV-infected cells (data not shown). To determine if RRV is present in the blood as cell-associated virus in naturally infected monkeys, we generated a set of nested PCR primers and a hybridization probe to amplify and detect DNA sequences specific to the RRV DNA polymerase gene (Table 1). Nested PCR analysis, rather than single-round PCR, was developed, as naive monkeys experimentally infected with RRV strain 17577 become PCR negative 2 to 4 weeks postinoculation (13). Peripheral blood samples from seropositive and seronegative rhesus monkeys were collected by standard venipuncture, and the mononuclear cells were isolated by density gradient centrifugation over Ficoll. DNA from purified PBMCs was isolated with a Puregene DNA isolation kit (Gentra Systems, Minneapolis, Minn.) and subjected to 30 cycles of PCR amplification with the first-round primers under the following conditions: 94°C for 1 min (1 cycle) followed by 94°C for 1 min, 50°C for 2 min, and 72°C for 1.5 min (30 cycles). Each firstround PCR used 0.1 g of genomic DNA, 100 pmol of each primer, 2.5 U of Vent polymerase, 200 M each deoxynucleotide triphosphate, and 2 mM MgSO4 in a 50 l reaction. For nested PCR, 5 l of the first-round reaction mixtures was
Kaposi’s sarcoma-associated herpesvirus (KSHV)/human herpesvirus 8 is a member of the gamma-2 herpesvirus family of lymphotropic viruses and is currently accepted to be the etiological agent associated with the development of Kaposi’s sarcoma (KS) and B-cell lymphoproliferative disorders (LPD) such as primary effusion lymphoma (PEL) and multicentric Castleman’s disease (MCD). KSHV DNA has been found in almost all forms of KS (5), localized specifically in the endothelial and spindle cells (3) and in monocytes that comprise the lesion (2), as well as in DNA isolated from patients with PEL and MCD (4, 9). Moreover, KSHV DNA has also been found in CD19⫹ B cells and monocytes from peripheral blood of individuals with or without KS and in KS patients with or without human immunodeficiency virus (HIV) infection (1, 2, 12). Detection of KSHV DNA in peripheral blood is thought to be predictive of the development of KS in HIV-infected individuals. Related gamma-2 herpesviruses have been previously identified in other animal species, most recently in rhesus monkeys (referred to as rhesus rhadinovirus [RRV]) (6). DNA sequence analysis of the unique long region of the RRV genome reveals it is essentially colinear with KSHV and that it encodes several of the cellular homologues hypothesized to mediate host immune response or alter cell growth and cell cycle regulation (8). Although much can now be illuminated from the DNA sequence of RRV, little is currently known about the biology of RRV infection. Results from experimental RRV infections of naive and simian immunodeficiency virus (SIV)-infected monkeys indicate that RRV induces B-cell hyperplasia and persistent lymphadenopathy that resembles MCD in immunocompromised but not immunocompetent monkeys, suggesting the virus is associated with LPD (13). In this brief report, we provide evidence to demonstrate that in rhesus monkeys naturally infected with RRV, the virus can be found in peripheral blood mononuclear cells (PBMCs) and that further fractionation reveals that B lymphocytes are a major site of virus persistence and latency. To identify rhesus monkeys naturally infected with RRV, we utilized an enzyme-linked immunosorbent assay generated
FIG. 1. RRV DNA detection by nested PCR amplification of PBMCs obtained from healthy rhesus monkeys. Total DNA from purified PBMCs was amplified by nested PCR, and the products were analyzed by Southern hybridization. Lanes 1 to 3, PCR reagent controls containing water, 50 pg of rhesus cytomegalovirus DNA, or 100 ng of rhesus lymphocryptovirus-infected cell DNA, respectively; lanes 4 to 10, reaction mixtures containing PBMC DNA from healthy seropositive monkeys (lanes 4, 7, 8, 9, and 10) or seronegative monkeys (lanes 5 and 6).
* Corresponding author. Mailing address: Division of Pathobiology and Immunology, Oregon Regional Primate Research Center, 505 N.W. 185th Ave., Beaverton, OR 97006. Phone: (503) 690-5285. Fax: (503) 690-5524. E-mail:
[email protected]. 7874
VOL. 73, 1999
NOTES
7875
TABLE 1. Oligonucleotide primers for RRV DNA polymerase Primer
Orientation
Position
Sequence (5⬘ to 3⬘)
Sequence position (bp)a
DP-1 DP-2 DP-3 DP-4 DP-5
Sense Antisense Sense Antisense Sense
Outside Outside Inner Inner Probe
AATCCGCCAAACATACTG TTTGTAGTCGGAGAGGCTG CGTCGGAATATGACATGCTGGTG GGCTCGTGAACTTCAAAGATGGAG CGATCTCCCGTACCTAATCAC
15124–15141 15480–15498 15194–15214 15360–15383 15282–15302
a
The position of the nucleotides is based upon the DNA sequence of RRV strain 17577 (GenBank accession no. AF083501) (8).
added to the inner primer set and amplified for an additional 30 cycles under identical conditions. Nested PCR products were resolved by agarose gel electrophoresis, transferred to nitrocellulose, hybridized to the oligonucleotide probe overnight, and washed at 55°C in 2⫻ SSC (1⫻ SSC is 0.15 M NaCl plus 0.015 M sodium citrate)–0.1% sodium dodecyl sulfate prior to being exposed to X-ray film. Analysis of the Southern blot hybridizations shown in Fig. 1 indicates that all five seropositive monkeys are nested PCR positive and the two seronegative monkeys are negative. Moreover, the nested primer set and probe are specific for RRV, as DNAs from rhesus cytomegalovirus (11) and rhesus lymphocryptovirus (7) were also negative. TABLE 2. RRV isolation and flow cytometric analysis of lymphocyte subpopulations obtained by immunomagnetic bead depletiona Rhesus monkey no.
Fraction type
RRV serology
Positive cells (%)b CD4⫹ CD8⫹ CD20⫹
Virus isolationc
1
Total PBMCs Seronegative 51 T-cell enriched 56 B-lymphocyte 0 enriched
35 33 19
8.4 0 69
⫺ ⫺ ⫺
2
Total PBMCs Seropositive T-cell enrichedd B-cell enrichede
38 41 16
37 51 19
12 0 75
⫺ ⫺ ⫺
3
Total PBMCs Seropositive T-cell enriched B-cell enriched
43 47 0
38 43 0
27 12 50
⫺ ⫺ ⫹
4
Total PBMCs Seropositive T-cell enriched B-cell enriched
26 19 2.8
49 59 5.0
37 12 80
⫺ ⫺ ⫹
5
Total PBMCs Seropositive T-cell enriched B-cell enriched
41 47 0
28 35 12
24 15 86
⫺ ⫺ ⫹
a Negative selection by immunomagnetic bead depletion was performed according to the manufacturer’s instructions (Coulter-Immunotech). b One hundred thousand cells from each fraction were separated into five aliquots and stained individually with monoclonal antibodies labeled with FITC—OKT4 (CD4), B9.11 (CD8), and B-Ly-1 (CD20)—and the appropriate isotypic negative control. c One hundred thousand cells from each fraction were cocultured with primary rhesus fibroblasts for virus isolation in triplicate. A positive virus isolation was scored when two of three wells developed cytopathic effects characteristic of RRV (6, 13) after 10 days and confirmed by indirect immunofluorescence with serum samples obtained from monkeys experimentally inoculated with RRV strain 17577. d The T-cell-enriched population was generated by depleting PBMCs with B-Ly-1-conjugated magnetic beads (CD20⫹ cells; Coulter-Immunotech). e The B-cell-enriched population was generated by depleting PBMCs with the magnetic beads conjugated with the monoclonal antibodies FN18 (CD3⫹ cells; generously provided by M. Jonker) and B9.11 (CD8⫹ cells; Coulter-Immunotech).
To evaluate which lymphocyte subset of PBMCs harbored viral genomes, we collected blood samples from five monkeys, one seronegative and four seropositive. All five monkeys were 1.5 years or older, and the seropositive monkeys had been seropositive for at least 6 months. PBMCs were negatively selected by immunomagnetic bead depletion to generate two populations of cells, B-cell or T-cell enriched, and subsequently stained with fluorescein isothiocyanate (FITC)-labeled antibodies. Table 2 shows that two of five T-cell-enriched populations were depleted of CD20⫹ B cells, while the three remaining fractions exhibited nearly twofold depletion. The immunomagnetic bead procedure appeared to be more effective for enriching for B cells, as significant depletion of T cells was observed in four of five B-cell-enriched populations. Failure to achieve complete depletion in some of these fractions is most likely due to the high percentage of cells prior to negative selection or the accidental washing of cells off the magnetic beads. The results in Table 2 also indicate that enrichment of B cells coincided with the isolation of infectious virus in three of four fractions from seropositive monkeys, whereas no virus was recovered in PBMCs or the T-cell-enriched fractions. Similar
FIG. 2. Detection of RRV DNA in enriched lymphocyte fractions. Total DNA from PBMCs, T-cell-enriched (T cell) or B-cell-enriched (B cell) fractions, obtained from the monkeys indicated in Table 2, were amplified by nested PCR, and the products were analyzed by Southern hybridization.
7876
NOTES
J. VIROL.
results have been reported for the related gamma-2 herpesvirus MHV-68 (10). Confirmation was further evident when enriched-cell populations were analyzed by nested PCR as described above. Analysis of the PCR products by Southern blot analysis revealed that virus was present in the PBMCs as well as in the B-cell-enriched fraction but less evident or absent in the T-cell-enriched fractions. The slight signal observed in three of four T-cell-enriched fractions is most likely due to the small percentage of CD20⫹ B cells remaining after negative selection (Fig. 2). Our data demonstrate that rhesus B lymphocytes are a major site for RRV persistence. Moreover, this is consistent with the B-cell involvement observed in SIV-infected rhesus monkeys experimentally inoculated with RRV strain 17577 (13). Interestingly, although B-cell hyperplasia was evident in the peripheral blood compartment of SIV-RRV-infected monkeys, we did not detect a substantial increase in cell-associated virus. This would suggest that a subpopulation of B lymphocytes are infected or that other cell types in the peripheral blood also harbor virus. Further experiments are under way to identify the subpopulation of B lymphocytes persistently infected and whether peripheral blood monocytes are also infected. Nonetheless, the data suggest that RRV and KSHV share similar biological properties and indicate that RRV infection of rhesus monkeys may serve as an accessible animal model for elucidating the biology of KSHV infection and associated disease. This work was supported by Public Health Service grants RR00163 and CA 75922. We thank Lori Boshears for assistance in preparation of the manuscript. REFERENCES 1. Ambroziak, J. A., D. J. Blackbourn, B. G. Herndier, R. G. Glogau, J. H. Gullett, A. R. McDonald, E. T. Lennette, and J. A. Levy. 1995. Herpes-like sequences in HIV-infected and uninfected Kaposi’s sarcoma patients. Science 268:582–583.
2. Blasig, C., C. Zietz, B. Haar, F. Neipel, S. Esser, N. H. Brockmeyer, E. Tschachler, S. Colombini, B. Ensoli, and M. Sturzl. 1997. Monocytes in Kaposi’s sarcoma lesions are productively infected by human herpesvirus 8. J. Virol. 71:7963–7968. 3. Boshoff, C., T. F. Schulz, M. M. Kennedy, A. K. Graham, C. Fisher, A. Thomas, J. O. McGee, R. A. Weiss, and J. J. O’Leary. 1995. Kaposi’s sarcoma-associated herpesvirus infects endothelial and spindle cells. Nat. Med. 1:1274–1278. 4. Cesarman, E., Y. Chang, P. S. Moore, J. W. Said, and D. M. Knowles. 1995. Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body cavity-based lymphomas. N. Engl. J. Med. 332:1186–1191. 5. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science 266:1865–1869. 6. Desrosiers, R. C., V. G. Sasseville, S. C. Czajak, X. Zhang, K. G. Mansfield, A. Kaur, R. P. Johnson, A. A. Lackner, and J. U. Jung. 1997. A herpesvirus of rhesus monkeys related to the human Kaposi’s sarcoma-associated herpesvirus. J. Virol. 71:9764–9769. 7. Rangan, S. R., L. N. Martin, B. E. Bozelka, N. Wang, and B. J. Gormus. 1986. Epstein-Barr virus-related herpesvirus from a rhesus monkey (Macaca mulatta) with malignant lymphoma. Int. J. Cancer 38:425–432. 8. Searles, R. P., E. P. Bergquam, M. K. Axthelm, and S. W. Wong. 1999. Sequence and genomic analysis of a rhesus macaque rhadinovirus with similarity to Kaposi’s sarcoma-associated herpesvirus/human herpesvirus 8. J. Virol. 73:3040–3053. 9. Soulier, J., L. Grollet, E. Oksenhendler, P. Cacoub, D. Cazals-Hatem, P. Babinet, M. F. d’Agay, J. P. Clauvel, M. Raphael, L. Degos, et al. 1995. Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman’s disease. Blood 86:1276–1280. 10. Sunil-Chandra, N. P., S. Efstathiou, and A. A. Nash. 1992. Murine gammaherpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo. J. Gen. Virol. 73:3275–3279. 11. Swanson, R., E. Bergquam, and S. W. Wong. 1998. Characterization of rhesus cytomegalovirus genes associated with anti-viral susceptibility. Virology 240:338–348. 12. Whitby, D., M. R. Howard, M. Tenant-Flowers, N. S. Brink, A. Copas, C. Boshoff, T. Hatzioannou, F. E. Suggett, D. M. Aldam, A. S. Denton, et al. 1995. Detection of Kaposi’s sarcoma-associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposi’s sarcoma. Lancet 346:799–802. 13. Wong, S. W., E. P. Bergquam, R. M. Swanson, F. W. Lee, S. M. Shiigi, N. A. Avery, J. W. Fanton, and M. K. Axthelm. Induction of B-cell hyperplasia in SIV-infected monkeys with the simian homologue of Kaposi’s sarcomaassociated herpesvirus. Submitted for publication.
