RNA Editing of the Soybean Mitochondrial afp9 Transcript - NCBI

2 downloads 0 Views 159KB Size Report
Plant Physiol. (1993) 103: 1457-1458. Plant Gene Register. RNA Editing of the Soybean Mitochondrial afp9 Transcript. Adam S. Pesce and Elizabeth A. Grabau*.

Plant Physiol. (1993)103: 1457-1458

Plant Gene Register

RNA Editing of the Soybean Mitochondrial afp9 Transcript Adam S. Pesce and Elizabeth A. Grabau* Department of Plant Pathology, Physiology, and Weed Science, Virginia Polytechnic lnstitute and State University, Blacksburg, Virginia 24061

Subunit 9 of the ATPase complex is a membrane-associated protein subunit involved in the proton-translocating Fo portion of the ATPase in mitochondria. In higher plants, the atp9 gene is in the mitochondrial genome. RNA editing has been demonstrated for severa1 plant atp9 genes, including Oenothera (Schuster and Brennicke, 1990),wheat (Begu et al., 1990; Nowak and Kiick, 1990),sorghum (Salazar et al., 1991), and petunia (Wintz and Hanson, 1991).RNA editing involves the alteration of mRNA sequence relative to the DNA template. Such changes can arise from specific base substitutions, insertions, or deletions; however, only substitutions have been reported in plant mitochondria (for a recent review, see Bonnard et al. [1992] and refs. therein). A common substitution in a wide variety of plant mitochondrial mRNAs is a Cto-U base change. Such substitutions may function in conservation of the protein sequence (Covello and Gray, 1989; Gualberto et al., 1989). RNA editing also appears to occur in transcripts from the soybean (Glycine max t.)afp9 gene. Sequence analysis of soybean afp9 cDNA clones revealed two nucleotides that differed from the previously sequenced genomic clone (Grabau et al., 1990) through C-to-T nucleotide substitution (Table I). The sites are located at nucleotide positions 20 and 50 of the coding sequence, which correspond to amino acids 7 and 17, respectively. Both of these changes involve C-to-U substitutions that convert Ser codons (UCA) to Leu codons (UUA) in the mRNA. Eleven cDNA clones were sequenced from three separate DNA amplifications and a11 contained the same two nucleotide differences relative to the genomic sequence, suggesting that editing in soybean is complete, as has been reported for Oenothera (Schuster and Brennicke, 1990) and another dicotyledon, petunia (Wintz and Hanson, 1991). In contrast, some clones containing only a subset of the total edited nucleotides (partia1 editing) have been found in monocotyledons (Begu et al., 1990; Salazar et al., 1991). Direct amino acid sequencing of wheat ATP9 provided evidente that edited mRNAs function in translation into the protein product (Graves et al., 1990).

Table 1. Characteristics of the atp9 cDNA from soybean

Organism: Clycine max L. cv Williams 82. Function: Part of the Fo portion of the ATP synthase complex (membranelocalized proton-translocating portion of the complex). Editing Sites: C- to -U substitutions at nucleotide positions 20 and 50.

Cloning Techniques: Reverse transcription was performed with total soybean RNA. Amplification of cDNA via the polymerase chain reaction was performed using Taq DNA polymerase and primers generated from the atp9 genomic sequence. The primers contained BamHl restriction sites at their 5’ ends to facilitate cloning into pTZ19R. cDNA clones were sequenced using the Sequenase system- (United States Biochemical). Upstream primer, 5‘- GCAGGATCCAAGAGCGTCACGAGACTT; downstream primer, 5’-CCTCGATCCACAGACTACACCTTTCAA.

Sequence Identification: DNA, cDNA, and predicted protein sequences were compared with other plant sequences. The soybean sequence displays 82% homology to wheat at the genomic DNA level; however, the homology increases to 88% when R N A editing of both plant mRNAs is taken into account. Sequence homology to wheat is 100% at the amino acid level as deduced from edited sequences.

Figure 1 shows an alignment of amino acid sequences deduced from atp9 cDNA and genomic sequences for plants in which editing has been found. This alignment illustrates the contribution of editing to conservation of ATP9 protein sequences among different plant species (Salazar et al., 1991). Fewer sites are edited in soybean (2 sites, both of which result in amino acid replacements) than in the other four species (4 to 10 sites involving C-to-U substitutions, not a11 of which result in amino acid replacements). In atp9 cDNA Abbreviations: atp9, ATPase subunit 9 gene; ATP9, ATPase subunit 9 protein.

* Corresponding author; fax 1-703-231-7477.

1457

Pesce and Grabau

1458 A.

Plant Physiol. Vol. 103, 1993

Amino acid eequence predicted from cDNA:

----* s--- RSHKKS S---RSHKKKGKFKLK S---QVR ---RSVK

Figure 1. Alignment of ATP9 amino acid sequences deduced from cDNA and genomic sequences. A, Sequence deduced from cDNA; B, sequence deduced from genomic DNA. ATP9 amino acid sequence predicted from the soybean cDNA was used for comparison. ldentical amino acids are indicated by a dash (-). Termination codons are shown by an asterisk (*). The number of edits resulting in amino acid replacements or the creation of termination codons from the total of all C-to-U nucleotide substitutions are shown to the right of the sequences in A.

clones from Oenothera (Schuster and Brennicke, 1990), wheat (Begu et al., 1990; Nowak and Kück, 1990), petunia (Wintz and Hanson, 1991), and sorghum (Salazar et al., 1991), editing also creates termination codons UGA or UAA from CGA or CAA codons to maintain carboxy-terminal conservation. Received June 18, 1993; accepted July 19, 1993. Copyright Clearance Center: 0032-0889/93/103/1457/02. The GenBank accession number for the sequence reported in this article is L17319. LITERATURE ClTED

Begu D, Graves PV, Domec C, Arselin G, Litvak S, Araya A (1990) RNA editing of wheat mitochondrial ATP synthase subunit 9: direct protein and cDNA sequencing. Plant C e l l 2 1283-1290

Bonnard G, Gualberto JM, Lamattina L, Grienenberger JM (1992) RNA editing in plant mitochondria. Crit Rev Plant Sci 1 0 503-524

Covello PS, Gray MW (1989) RNA editing in plant mitochondria. Nature 341: 662-666 Grabau EA, Asleson CM, Gengenbach BG (1990) Nucleotide sequence and transcription of the soybean mitochondrial ATPase subunit 9 gene. Plant Mo1 Bioll5 183-186

Graves PV, Begu D, Velours J, Neau E, Belloc F, Litvak S, Araya A (1990) Direct protein sequencing of wheat mitochondrial ATP synthase subunit 9 confirms RNA editing in plants. J Mo1 Biol214 1-6

Gualberto JM, Lamattina L, Bonnard G, Weil JH, Grienenberger JM (1989) RNA editing in wheat mitochondria results in the conservation of protein sequences. Nature 341: 660-662 Nowak C, Kück U (1990) RNA editing of the mitochondrial atp9 transcript from wheat. Nucleic Acids Res 18: 7164 Salazar RA, Pring DR, Kempken F (1991) Editing of mitochondrial atp9 transcripts from two sorghum lines. Curr Genet 2 0 483-486 Schuster W, Brennicke A (1990) RNA editing of ATPase subunit 9 transcripts of Oenothera mitochondria. FEBS Lett 268: 252-256 Wintz H, Hanson MR (1991) A termination codon is created by RNA editing in the petunia mitochondrial atp9 gene transcript. Curr Genet 19: 61-64

Suggest Documents