Role of the Fas/Fas ligand pathway in apoptotic cell death ... - CiteSeerX

Journal of General Virology (1997), 78, 3277–3285. Printed in Great Britain ...........................................................................................................................................................................................................................................................................................

Role of the Fas/Fas ligand pathway in apoptotic cell death induced by the human T cell lymphotropic virus type I Tax transactivator Xiaolin Chen,1 Vladimir Zachar,1, 2 Milan Zdravkovic,1 Min Guo,3 Peter Ebbesen1 and Xiangdong Liu1 1

Department of Virus and Cancer, Danish Cancer Society, Gustav Wieds Vej 10, DK-8000 Aarhus C, Denmark Institute of Virology, Slovak Academy of Sciences, Bratislava, Slovak Republic 3 Electron Microscopy Laboratory, Institute of Pathology, Aarhus University, Denmark 2

Two distinct human diseases have been described in association with human T cell lymphotropic virus type I (HTLV-I) infection : adult T cell leukaemia and tropical spastic paraparesis/HTLV-I-associated myelopathy. Although comprehensive understanding of specific mechanisms underlying pathogenesis of either disease has not yet been achieved, the viral regulatory protein Tax is believed to play a significant role. Previous studies demonstrated the potential of Tax to transform host cells. Here, it is shown that the Tax transactivator has in addition the potential to induce T cell death by apoptosis. Using an inducible system (Jurkat cell line JPX-9), significant apoptotic cell death upon Tax expression was observed. In an attempt to detect the cellular genes mediating this effect, it was found that

Introduction Mechanisms involved in the pathogenesis of human T cell lymphotropic virus type I (HTLV-I) infection have been subject to intensive research in recent years. Although several viral proteins have been proposed to be involved, the prevailing body of data suggests a major role for the transactivating protein Tax (Green et al., 1989 ; Grossman et al., 1995 ; Nerenberg et al., 1987, 1991). The Tax transactivator is a 40 kDa product of the pX genomic region located in the proximity of the 3« end long terminal repeat (LTR). Tax is indispensable for the virus life cycle by virtue of its effect in trans on LTR transcriptional activation (Cann et al., 1985 ; Sodroski et al., 1984). The effect of Tax is not mediated through Author for correspondence : Xiangdong Liu. Fax 45 86 19 54 15. e-mail liu!virus.aau.dk The GenBank accession number of the nucleotide sequence of the human FasL promoter region reported in this paper is AF027385.

0001-5013 # 1997 SGM

induction of Tax was associated with marked upregulation of the Fas ligand (FasL) gene. Taxinduced apoptosis was inhibited when the Fas/FasL pathway was interrupted by YVAD-cmk, the inhibitor of ICE-like proteases. Transient expression experiments provided additional support for the putative role of endogenous FasL in Tax-induced apoptosis. Upon cotransfection with Tax-expressing plasmid, the transcriptional activity of the FasL promoter was found to be significantly upregulated in Jurkat cells and several other cell lines, as measured by reporter gene expression. Furthermore, cotransfection using different Tax mutants demonstrated that both CREB and NF-κB activation domains of Tax protein were required for the transactivation to take effect.

direct interaction with the transcriptional regulatory elements in the promoter region ; rather, it is accomplished through at least three host-related transcription factor pathways. They include members of the cAMP response element binding protein and activating transcription factor family (CREB}ATF) and NF-κB}Rel proteins (Arima et al., 1991 ; Fujii et al., 1992 ; Leung & Nabel, 1988 ; Maruyama et al., 1987 ; Zhao & Giam, 1992). As a consequence, the Tax protein appears to be a powerful transcriptional transactivator of a variety of other viral and cellular genes, most importantly human immunodeficiency virus (HIV) LTR, IL-2, IL-2Rα, GM-CSF, and c-fos (Inoue et al., 1986 ; Nagata et al., 1989 ; Nimer et al., 1989 ; Zimmermann et al., 1991). Such pleiotropic activity might result in the widespread dysregulation of gene expression believed to form the basis of HTLV-I pathogenic potential (Smith & Greene, 1991). Although the previously described transactivating effects of Tax may bear specific relevance to direct neoplastic transformation of T cells, the induction of genes involved in

DCHH

X. Chen and others 15 10–6 × Cell concn (viable cells/ml)

(a)

JPX/M + CdCl2 JPX/M

12

JPX-9 9

JPX-9 + CdCl2

6

3

0 0

24

48

72

96

120

Length of culture (h)

(b)

JPX/M

JPX-9

100

100 G0/G1

Cell number

0h

G0/G1

G2

G2

S

S

0

0 0

200

400

600

800

200

400

1000

Cell number

G0/G1

G0/G1

G2 S

S

G2

0

0 0

200

400

600

800

0

1000

200

400

600

800

1000

800

1000

100

Cell number

100

48 h

800

600

100

100

24 h

0

1000

G0/G1

S

G0/G1

G2

G2

S 0

0 0

200

400

600

800

Relative fluorescence intensity

1000

0

200

400

600

Relative fluorescence intensity

Fig. 1. Induction of cell death in Jurkat cells by Tax transactivator. (a) Jurkat JPX-9 cells, stably transfected with the inducible tax gene, and control JPX/M cells, harbouring a nonfunctional mutant of the tax gene, were induced to express the Tax protein with 10 µM CdCl2. Cell viability was determined by the trypan blue dye exclusion method just prior to induction and later at 24 h intervals. (b) The distribution of the cells undergoing different stages of cell cycle (G0/G1, S and G2) was determined by flow cytometric analysis. At the time of Tax induction, and 24 and 48 h later, cells were stained with propidium iodide and analysed in a Becton Dickinson FACStar Plus.

DCHI

HTLV-I Tax protein and apoptosis

apoptosis is another aspect that warrants investigation. Notably, in the face of a high rate of apoptosis among adult T cell leukaemia (ATL) cells in vitro, the notion that one or several HTLV-I gene products may be involved in this process seems plausible (Tsuda et al., 1993). The present study was undertaken to delineate functional involvement of Tax in apoptosis using a Tax-inducible CD4+ T cell line (Jurkat JPX-9) as a model.

Methods + Cells lines and induction of Tax expression. Jurkat cells (TIB 152 ; American Type Culture Collection, Rockville, Md, USA), and Taxinducible JPX-9 and control JPX}M cells (Nagata et al., 1989) were grown to a density of 5¬10& cells}ml in 1640 RPMI medium supplemented with 10 % foetal calf serum, glutamine and antibiotics. Expression of biologically active Tax or a non-functional Tax mutant was induced by addition of CdCl to 10 µM final concentration. Following induction, the # medium containing CdCl was replenished every 24–36 h and the # cultures were maintained for a period of 6 days. Aliquots were withdrawn at regular 24 h intervals and, after viability had been determined by the dye exclusion method, the cells were further processed for DNA fragmentation analysis or RNA isolation. + Analysis of DNA fragmentation by agarose gel electrophoresis, flow cytometry and electron microscopy. For analysis by electrophoresis in agarose gel, 5¬10' cells were processed to obtain the cytosolic DNA. Cells were first lysed with 10 mM Tris}HCl pH 7±5, 0±2 % Triton X-100, and after removal of nuclei by centrifugation, the cytosolic fraction was extracted with phenol–chloroform–isoamyl alcohol (25 : 24 : 1) and treated with RNase A (0±6 mg}ml) at 37 °C for 30 min. After precipitation, the samples were electrophoresed in a 2 % agarose gel and visualized by ethidium-bromide staining. Cells used in the flow cytometric analysis were washed with PBS and fixed with 70 % ice-cold ethanol for 10 min. After fixation, the cells were washed once again, resuspended in PBS with 0±1 mg}ml propidium iodide and finally treated with RNase A (100 units}ml) for 30 min at room temperature (Nicoletti et al., 1991). Individual samples (10% cells) were then analysed in a FACStar Plus (Becton Dickinson) using a 488 nm argon laser for excitation and gating on forward versus side scatter. For electron microscopy, cells harvested 48 h after CdCl induction # were fixed with glutaraldehyde–OsO , stained with uranyl acetate–lead % citrate, and examined with a Phillips CM10 transmission electron microscope at 80 kV. + Inhibition of Tax-induced apoptosis. 5¬10& JPX-9 cells were seeded per well in a 24-well plate and incubated with 600 nM IL-1β converting enzyme (ICE)-like inhibitor Acetyl-Tyr-Val-Ala-Asp-chloromethylketone (YVAD-cmk, Calbiochem) for 2 h, then 10 µM CdCl was # added to induce tax expression. After 48 h incubation, the cells were harvested for DNA preparation as described previously (Liu et al., 1995). In parallel, the cells were treated with 250 ng}ml anti-Fas antibody (clone CH-11, MBL) and a 1 µg DNA aliquot was labelled with [α-$#P]dCTP using Rosl’s method for detection of apoptosis (Rosl, 1992). The electrophoretic patterns of chromosomal DNAs were visualized with InstantImager (Packard). + Northern blotting and RT–PCR. Total RNA was isolated using the acid–phenol extraction method (Chomczynski & Sacchi, 1987) ;

samples of 5 µg were then fractionated in formaldehyde agarose gels and transferred to PVDF-N membranes (Millipore). The random-primed hybridization probes specific for tax, Fas and Fas ligand (FasL) genes were prepared using pSGTax (provided by Dr M. Seiki, Kanazawa University, Japan), pBLF58-1 (Itoh et al., 1991) and pBX-hFL1 (Takahashi et al., 1994) plasmids, respectively. Hybridization was performed according to the standard protocol (Sambrook et al., 1989). To control for the specificity of Tax mRNA detection, the expression of the glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene was determined using a commercially available probe (Clontech). In order to detect the expression of Fas and FasL genes at the transcriptional level by PCR, 0±2 µg of poly(A)+ RNA was reversetranscribed using SuperScript II RNase H− Reverse Transcriptase (Life Technologies) in 20 µl final volume. PCR amplification was then performed using 1}10 of the first strand cDNA yield. The optimal amplimers were designed using PrimerSelect of the program package Lasergene (DNAStar) ; for the Fas-specific amplification the upstream 5« GAGTGAGGGAAGCGGTTTACGAGT and downstream 5« AGGGCACGCAGTCTGGTTCATC primers were selected to bind a 650 bp long amplicon, and for the FasL amplification the amplicon (343 bp) was determined by the upstream 5« GGATTGGGCCTGGGGATGTTTCA and downstream 5« TGTGGCTCAGGGGCAGGTTGTTG primers. After 30 cycles, the PCR products were separated in 1 % agarose gel, transferred to a PVDF-N membrane and hybridized with Fas- and FasLspecific probes (provided by Dr Nagata, Osaka Bioscience Institute, Osaka, Japan) by Northern blot analysis as described above. + Construction of the Fas ligand reporter plasmid and transient expression assay. The human FasL promoter has been previously cloned in the pBL-hFL5H3-1 plasmid (Takahashi et al., 1994). In order to enable subcloning and subsequent analysis of the promoter, we determined the promoter sequence by automated cycle sequencing with dye primers (Thermo Sequenase sequencing kit, Amersham) using the ALFexpress system (Phamacia). The 1508 bp FasL promoter was then amplified using the 27 bp forward primer 5« GAAGATCTCCATGTATTTCATCTGGCA and the 31 bp reverse primer 5« CCCAAGCTTGGCAGGTGGTGAGTCAGGCCAG and subcloned into the pGL3Basic luciferase (Luc) reporter plasmid (Promega) (pFasL-luc). FasL transcriptional activation was then tested by cotransfecting Jurkat cells with the Tax-expressing plasmid pCMVTax and a series of Tax mutant plasmids pCMVM7 (defective in induction of both NF-κB and CREB} ATF pathways), pCMVM22 (defective in induction of the NF-κB pathway) and pCMVM47 (defective in induction of the CREB}ATF pathway) (provided by Dr W. Greene, Gladstone Institute of Virology and Immunology, San Francisco, USA) (Smith & Greene, 1990). All transfection experiments were performed in triplicate by applying a preformed mixture containing 4 µl liposome reagent DMRIE-C (GibcoBRL) and 2 µg of each plasmid to 2¬10' cells for 5 h. The transfection was terminated by adding fresh medium and the cells were further cultured for 48 h, after which luciferase was extracted according to the manufacturer’s instructions (Promega). Luc activity was determined by a bioluminescent assay using an automated microplate luminometer (Luminoscan, Labsystems). Light output in individual samples was normalized on the basis of protein content, which was determined by the BCA protein assay (Pierce). The transfection of JEG-3 cells was described previously (Zachar et al., 1994). Tax-inducible JPX-9 cells were transfected with a single plasmid only, the FasL reporter construct or control pGL3Basic plasmid. The transfection procedure was identical to that described above for Jurkat cells, except that after transfection cells were grown in the presence of 10 µM CdCl . #

DCHJ

X. Chen and others (a)

Results Induction of apoptosis in JPX-9 cells by Tax and Fasspecific antibody

To investigate the effect of Tax on apoptosis, we used the CD4+ Jurkat cell lines JPX-9 and JPX}M stably transfected with the wild-type and mutated tax genes, respectively, under the control of the inducible metallothionein promoter (Nagata et al., 1989). In JPX}M cells the tax gene was rendered inactive by introducing a frameshift mutation in the vicinity of the 3« end of the reading frame. The induction of Tax was achieved with CdCl , which was added to cultures at the minimum con# centration (10 µM) sufficient to obtain effective induction of Tax and still show no cytotoxic effect. The expression of Tax protein proved to have a dramatic effect on cell viability. While JPX}M cells grew exponentially over a period of 5 days after induction, the number of JPX-9 cells decreased gradually, with only 15 % cells remaining at the end of experiment (Fig. 1 a). In line with these data, the flow cytometric analysis demonstrated profound changes in the distribution of cells in all stages of cell cycle (Fig. 1 b). The proportion of living JPX-9 cells, expressed as a sum of the cells in G }G , S and G phases, diminished from 75 % to 32±6 % in ! " # the 48 h after induction, whereas in the control JPX}M cells this proportion changed negligibly, from 87±9 % to 82±2 %. In the ensuing experiments, we aimed to characterize structural changes in the chromosomal DNA which were associated with Tax-induced cell death. After induction with CdCl , gel electrophoretic analysis demonstrated a ladder # banding pattern suggestive of internucleosomal DNA fragmentation characteristic of apoptosis exclusively in the JPX-9 cells (Fig. 2 a). Furthermore, functionality of the Fas-specific apoptotic pathway was verified by parallel treatment of JPX}M and JPX-9 cells with anti-Fas antibody (250 ng}ml, clone CH11). After 9 h, significant fragmentation of chromosomal DNA was detectable in both cell lines by gel electrophoresis (Fig. 2 b). Transmission electron microscopy provided further evidence for apoptosis in JPX-9 cells (Fig. 2 c). A characteristic morphological picture with prominent nuclear condensation and segmentation, and cytoplasmic vacuolization became apparent 48 h after Tax induction. None of these changes could be seen in control JPX}M cells.

Tax-induced expression of the FasL gene in JPX-9 cells

The pleiotropic effect of Tax on gene modulation has been proposed to be mediated through regulation of major transcriptional pathways. Apoptosis thus could be triggered in response to Tax by one or several genes directly involved in programmed cell death. Previous reports (Nataga et al., 1989) and our own studies (unpublished data) suggest that trans-

DCIA

(b)

(c)

Fig. 2. Analysis of apoptotic cell death in JPX-9 and JPX/M cells. (a) Fragmentation of cytosolic DNA in JPX-9 cells expressing Tax and control JPX/M cells 12, 36 and 48 h after induction was assessed by size fractionation in agarose gel and ethidium-bromide staining. (b) Fragmentation of cytosolic DNA after JPX/M and JPX-9 cells had been treated with 250 ng/ml anti-Fas antibody (clone CH-11) for 9 h. (c) Transmission electron microscopy of JPX-9 and JPX/M cells revealed chromatin condensation, segmentation of nuclei and cytoplasmic vacuolization in JPX-9 cells 48 h after induction of Tax.

criptional expression of TNF-α, c-Myc, Bcl-2, IRF-1, IRF-2 or ICE is not affected by Tax in JPX-9 cells. However, the Fas}FasL pathway which was found to induce apoptosis as a result of phorbol myristyl acetate (PMA) and ionomycin stimulation or T cell receptor engagement in T lymphocytes (Alderson et al., 1995 ; Dhein et al., 1995 ; Suda et al., 1995) could also be operative in Jurkat cells. The representative results from RT–PCR analysis of FasL expression in JPX-9 and JPX}M cells demonstrated that specific transcripts first became detectable at 4 h and reached maximum levels 24 h after Tax induction in JPX-9 cells (Fig. 3). Notably, the Fas gene remained expressed at constitutive levels and did not respond to Tax transactivation. Cumulatively, these data provided initial


Fig. 3. Expression of Fas and FasL at the transcriptional level in JPX-9 cells after induction of Tax transactivator. JPX-9 cells expressing Tax and control JPX/M cells expressing a nonfunctional mutant of Tax were analysed for Fas and FasL expression by RT–PCR at the indicated intervals after induction with 10 µM CdCl2. The amounts of Tax- and G3PDH-specific transcripts were determined by Northern blotting. The expression of the G3PDH gene was determined for standardization purposes.

(a)

(b)

evidence suggesting involvement of the Fas}FasL pathway in Tax-induced apoptosis.

Inhibition of Tax-induced apoptosis by the ICE inhibitor YVAD-cmk

To establish the causal role for Fas}FasL in Tax-induced apoptosis we investigated the effect of inhibition of ICE-like proteases which have been found indispensable for Fas}FasL to exert its effect (Enarl et al., 1995 ; Los et al., 1995). The process through which activity of ICE-like proteases are stimulated after Fas activation is apparently not dependent on de novo synthesis of RNA and can be specifically inhibited by YVADcmk. Previously, this inhibitor has been shown to block efficiently apoptosis which was triggered by anti-Fas antibody in cultures of Jurkat cells (Enarl et al., 1995). By using YVAD-cmk, we were able to inhibit completely Tax-induced apoptosis, as is indicated by decreased DNA fragmentation in Fig. 4 (b). In the parallel experiment in which apoptosis was induced by anti-Fas antibody CH-11 (250 ng}ml), similar inhibition was obtained (Fig. 4 a). These data thus provide strong evidence for involvement of the Fas}FasL pathway in Tax-induced apoptosis. Fig. 4. Inhibition of apoptosis in JPX-9 cells by YVAD-cmk ICE inhibitor. (a) Cells treated or untreated with 600 nM YVAD-cmk were incubated with anti-Fas antibody for 3 h. Fragmentation of cytosolic DNA was assessed by size fractionation in agarose gel and exposure in InstantImager (Packard). (b) Cells treated or untreated with 600 nM YVAD-cmk were incubated in the presence of 10 µM CdCl2 for 48 h to induce Tax expression.

Transactivation of the FasL promoter by Tax

In an attempt to determine the extent to which Fas ligand expression is subject to Tax regulation, we performed a series of transient transfection assays. To this end, we employed

DCIB

X. Chen and others

Fig. 5. Nucleotide sequence of the human FasL promoter region. The numbering system starts at the last base of the ATG initiation codon and the potential cis-acting elements are underlined.

pFasL-luc, a reporter construct featuring the Luc gene under the control of the 1508 bp FasL promoter sequence (Fig. 5). In addition to the motifs present in the 500 bp region previously characterized by Takahashi et al. (1994), the upstream 1 kb segment revealed numerous cis-regulatory transcriptional elements. Upon cotransfecting with pCMVTax, expressing the wild-type tax gene, in Jurkat and JEG-3 cells the basal activity of FasL promoter increased 26- and 17-fold, respectively (Fig. 6). Moreover, similar results were obtained when several other non-lymphocytic cell lines (COS-7, NIH-3T3 and SK-N-SH) were used to test the effect of host cell-specific factors on FasL transactivation by Tax (data not shown). In addition, activation of the FasL promoter comparable to that in Jurkat cells could also be seen in the JPX-9 cells which were induced to express Tax using CdCl (data not shown). # A further series of transient expression experiments was aimed to determine in more detail the molecular basis of Tax interaction with the FasL promoter. The Tax protein exhibits two discrete domains, each involved in activation of a specific transcriptional regulatory pathway. One of these pathways is mediated via the CREB}ATF family of transcription factors,

DCIC

the other via the Rel-related family of κB enhancer-binding proteins (Arima et al., 1991 ; Fujii et al., 1992 ; Leung et al., 1988 ; Maruyama et al., 1987 ; Zhao & Giam, 1992). We employed Tax variants which were defective in NF-κB (pCMVM22), CREB}ATF (pCMVM47) or both NF-κB and CREB}ATF (pCMVM7) activition domains (Smith & Greene, 1990) to explore the transcriptional pathways. A mutation within the putative zinc finger domain which rendered Tax inactive in both CREB}ATF and NF-κB pathways (M7) totally abolished the transactivating effect of Tax in Jurkat cells (Fig. 6 a). Furthermore, the mutant M22 with the CREB}ATF but not NF-κB}Rel activity exhibited about 27 % of the full Tax transactivation potential, and the Tax mutant M47 which retained NF-κB but not CREB}ATF activity showed only 12 % of Tax transactivation activity. Importantly, however, the original level of Tax transactivation could be restored in a synergistic fashion with the M22 and M47 mutants being co-expressed. Similar results were obtained when these experiments were repeated using JEG-3 as host cells. Here again, both M22 and M47 variants proved completely inactive in transactivation, whereas the original


Luciferase activity (light units)

40

120

(a)

(b)

100 30 80 20

60 40

10 20 0

Control Tax

M7

M22 M47

M22 + M47

0

Control Tax

M7

M22 M47

M22 + M47

Fig. 6. Transactivation of the FasL promoter in Jurkat (a) and JEG-3 (b) cells by Tax and its mutants activating distinct transcriptional pathways. The luciferase reporter vector pFasL-luc containing the FasL promoter region extending 1508 bp upstream from the initiation codon was cotransfected with the wild-type Tax expression plasmid pCMVTax and different Tax mutant plasmids. The M7 mutant is deficient in induction of both NF-κB and CREB/ATF pathways, M22 is deficient in induction of the NF-κB pathway and M47 is deficient in induction of the CREB/ATF pathway. The transient expression of the reporter gene was determined using a standard luciferase bioluminescence assay after the samples had been normalized for protein content. The bars represent the mean³SEM of three experiments.

activity could be restored upon their co-expression (Fig. 6 b). Thus it appears that an effect mediated by both activation domains is indispensable for effective FasL transactivation by Tax.

Discussion Infection with HTLV-I and the associated pathogenesis has been subject to growing interest in recent years, but a comprehensive understanding of the pathogenic mechanisms is still elusive. In an effort to define a role for viral proteins in development of the disease process, attention has been focused on the Tax transactivator. Tax has a potential to transactivate numerous early response genes that are normally transiently induced following antigenic or mitogenic activation of T cells (Kelly et al., 1992). Thus it appears plausible that prolonged transactivation by Tax might result in cell immortalization. In addition, the demonstration of neoplasms of mesenchymal origin in tax-transgenic mice appears to further support the pathogenic role of Tax (Green et al., 1989 ; Grossman et al., 1995 ; Nerenberg et al., 1987, 1991). However, transformed T cells have never been observed in these experiments despite the fact that CD4+ T cells are a major target for HTLV-I during infection in vivo. Observations from patients with ATL also seem to challenge the importance of Tax for malignant transformation. Intriguingly, Tax was found to be expressed in these patients at significantly lower levels than in asymptomatic carriers or tropical spastic paraparesis}HTLV-I-associated myelopathy patients (Furukawa et al., 1995 ; Gessain et al., 1985). Furthermore, the latest data show that HTLV-I gene expression is not indispensable for the maintenance of neoplastic cell growth in the culture and that expression of the

tax gene is not sufficient to induce neoplasia in hu-SCID mice (Imada et al., 1995). Recent evidence suggests that, in addition to its transforming capacity, the Tax protein may also be involved in triggering apoptotic cell death. Initially, apoptosis was observed in cultures of primary ATL cells and Tax-transformed Rat-1 fibroblasts as a result of serum deprivation (Tsuda et al., 1993 ; Yamada et al., 1994). Subsequently, Chlichlia et al. (1995) demonstrated apoptosis in T cells expressing Tax following CD3 stimulation. In the present report, we have shown that Tax alone can induce apoptotic cell death in the CD4+ Jurkat T cell line and, furthermore, we have provided evidence that implicates the Fas}FasL pathway in this process. The Fas}FasL pathway is thought to play a central physiological role in the control of immunological homeostasis through elimination of mature or activated T cells and maintainance of self-tolerance (Alderson et al., 1995 ; Nagata & Golstein, 1995 ; Zheng et al., 1995). In the light of our findings, it is plausible that the Fas}FasL pathway also plays a prominent part in the pathogenesis of ATL. Fas antigen is preferentially expressed on the surface of CD4+ and CD45RO+ cells which are a major target for in vivo HTLV-I infection, thereby providing a receptor pool which effectively may be activated by FasL induced as a result of virus infection (Debatin et al., 1990 ; Miyawaki et al., 1992 ; Nagatani et al., 1990 ; Richardson et al., 1990 ; Shirono et al., 1989 ; Worner et al., 1990). Elimination of infected cells through apoptosis triggered by Fas–FasL interaction could provide an explanation for longterm latency of HTLV-I infection and a characteristically low frequency of cells expressing virus in infected individuals. On the other hand, the malignantly proliferative T cell phenotype which expresses high levels of Fas antigen (Debatin et al., 1990)

DCID

X. Chen and others

would be expected to be defective in FasL expression. Indeed, our analysis of multiple HTLV-I-transformed T cell lines failed to provide any evidence of FasL expression (unpublished observations). Strikingly, the control of FasL induction by Tax appears to be accomplished through a series of regulatory interactions. Although the data presented clearly implicate the NF-κB and CREB}ATF activation pathways of the Tax transactivator, they do not provide a complete picture of the mechanisms involved. The absence of binding sites for NF-κB and CREB}ATF transcription factors suggests that intermediate genes are induced in order to interact with the FasL promoter. In conclusion, the significance of mechanisms eliciting apoptotic cell death during HTLV-I infection should be comprehensively explored. By the same token, more advanced studies of the elements responsive to Tax transactivation in the FasL promoter are warranted. We are grateful to Dr Masataka Nakamura for providing us with JPX9 and JPX}M cells, to Dr Shigekazu Nagata for plasmids pBL-hFL5H3-1, pBX-hFL1 and pBLF58-1, and to Dr Warner C. Greene for plasmids pCMV4Tax, M7, M22 and M47. We also thank Dr Michael Strauss for encouragement and advice. This work was supported by the Danish Cancer Society grants no. 95 215 54 and no. 96 215 56 to X. D. L. and in part by EU grant PL 941593. The Aarhus group is a member of the HTLV European Research Network, which is the concerted action programme of the ECC.

Fujii, M., Tsuchiya, H., Chuhjo, T., Akizawa, T. & Seiki, M. (1992).

Interaction of HTLV-1 Tax1 with p67SRF causes the aberrant induction of cellular immediate early genes through CArG boxes. Genes & Development 6, 2066–2076. Furukawa, Y., Osame, M., Kubota, R., Tara, M. & Yoshida, M. (1995).

Human T-cell leukemia virus type-1 (HTLV-1) Tax is expressed at the same level in infected cells of HTLV-1-associated myelopathy or tropical spastic paraparesis patients as in asymptomatic carriers but at a lower level in adult T-cell leukemia cells. Blood 85, 1865–1870. Gessain, A., Barin, F., Vernant, J. C., Gout, O., Maurs, L., Calender, A. & de The, G. (1985). Antibodies to human T-lymphotropic virus type-

I in patients with tropical spastic paraparesis. Lancet 2, 407–410. Green, J. E., Hinrichs, S. H., Vogel, J. & Jay, G. (1989). Exocrinopathy

resembling Sjogren’s syndrome in HTLV-1 tax transgenic mice. Nature 341, 72–74. Grossman, W. J., Kimata, J. T., Wong, F. H., Zutter, M., Ley, T. J. & Ratner, L. (1995). Development of leukemia in mice transgenic for the

tax gene of human T-cell leukemia virus type I. Proceedings of the National Academy of Sciences, USA 92, 1057–1061. Imada, K., Takaori-Kondo, A., Akagi, T., Shimotohno, K., Sugamura, K., Hattori, T., Yamabe, H., Okuma, M. & Uchiyama, T. (1995).

Tumorigenicity of human T-cell leukemia virus type I-infected cell lines in severe combined immunodeficient mice and characterization of the cells proliferating in vivo. Blood 86, 2350–2357. Inoue, J., Seiki, M., Taniguchi, T., Tsuru, S. & Yoshida, M. (1986).

Induction of interleukin 2 receptor gene expression by p40x encoded by human T-cell leukemia virus type 1. EMBO Journal 5, 2883–2888. Itoh, N., Yonehara, S., Ishii, A., Yonehara, M., Mizushima, S., Sameshima, M., Hase, A., Seto, Y. & Nagata, S. (1991). The

polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 66, 233–243.

References Alderson, M. R., Tough, T. W., David-Smith, T., Braddy, S., Falk, B., Schooley, K. A., Goodwin, R. G., Smith, C. A., Ramsdell, F. & Lynch, D. H. (1995). Fas ligand mediates activation-induced cell death in human

Kelly, K., Davis, P., Mitsuya, H., Irving, S., Wright, J., Grassmann, R., Fleckenstein, B., Wano, Y., Greene, W. C. & Siebenlist, U. (1992). A

Arima, N., Molitor, J. A., Smith, M. R., Kim, J. H., Daitoku, Y. & Greene, W. C. (1991). Human T-cell leukemia virus type I Tax induces expression

high proportion of early response genes are constitutively activated in T cells by HTLV-I. Oncogene 7, 1463–1470. Leung, K. & Nabel, G. J. (1988). HTLV-1 transactivator induces interleukin-2 receptor expression through an NF-kappa B-like factor. Nature 333, 776–778.

of the Rel-related family of kappa B enhancer-binding proteins : evidence for a pretranslational component of regulation. Journal of Virology 65, 6892–6899.

Liu, X., Zachar, V., Nørskov-Lauritsen, N., Aboagye-Mathiesen, G., Zdravkovic, M., Mosborg-Petersen, P., Dalsgaard, A. M., Hager, H. & Ebbesen, P. (1995). Cell-mediated transmission of human T cell

Cann, A. J., Rosenblatt, J. D., Wachsman, W., Shah, N. P. & Chen, I. S. (1985). Identification of the gene responsible for human T-cell leukaemia

lymphotropic virus type I to human malignant trophoblastic cells results in long-term persistent infection. Journal of General Virology 76, 167–173.

virus transcriptional regulation. Nature 318, 571–574.

Los, M., Van de Craen, M., Penning, L. C., Schenk, H., Westendorp, M., Baeuerle, P. A., Droge, W., Krammer, P. H., Flers, W. & SchulzeOsthoff, K. (1995). Requirement of an ICE}CED-3 protease for

T lymphocytes. Journal of Experimental Medicine 181, 781–786.

Chlichlia, K., Moldenhauer, G., Daniel, P. T., Busslinger, M., Gazzolo, L., Schirrmacher, V. & Khazaie, K. (1995). Immediate effects of

Fas}APO-1-mediated apoptosis. Nature 375, 81–83.

reversible HTLV-1 tax function : T-cell activation and apoptosis. Oncogene 10, 269–277. Chomczynski, P. & Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Analytical Biochemistry 162, 156–159.

aberrant activation of the interleukin-2 autocrine loop by HTLV-1encoded p40x and T3}Ti complex triggering. Cell 48, 343–350.

Debatin, K. M., Goldmann, C. K., Bamford, R., Waldmann, T. A. & Krammer, P. H. (1990). Monoclonal-antibody-mediated apoptosis in

Miyawaki, T., Uehara, T., Nibu, R., Tsuji, T., Yachie, A., Yonehara, S. & Taniguguchi, N. (1992). Differential expression of apoptosis-related Fas

adult T-cell leukaemia. Lancet 335, 497–500.

Maruyama, M., Shibuya, H., Harada, H., Hatakeyama, M., Seiki, M., Fujita, T., Inoue, J., Yoshida, M. & Taniguchi, T. (1987). Evidence for

Nature 373, 438–441.

antigen on lymphocyte subpopulations in human peripheral blood. Journal of Immunology 149, 3753–3758. Nagata, S. & Golstein, P. (1995). The Fas death factor. Science 267, 1449–1456.

Enarl, M., Hug, H. & Nagata, S. (1995). Involvement of an ICE-like

Nagata, K., Ohtani, K., Nakamura, M. & Sugamura, K. (1989).

protease in Fas-mediated apoptosis. Nature 375, 78–81.

Activation of endogenous c-fos proto-oncogene expression by human T-

Dhein, J., Walczak, H., Baumler, C., Debatin, K. M. & Krammer, P. H. (1995). Autocrine T-cell suicide mediated by APO-1}(Fas}CD95).

DCIE

HTLV-I Tax protein and apoptosis cell leukemia virus type I-encoded p40tax protein in the human T-cell line, Jurkat. Journal of Virology 63, 3220–3226. Nagatani, T., Matsuzaki, T., Iemoto, G., Kim, S., Baba, N., Miyamoto, H. & Nakajima, H. (1990). Comparative study of cutaneous T-cell

Sodroski, J. G., Rosen, C. A. & Haseltine, W. A. (1984). Trans-acting

transcriptional activation of the long terminal repeat of human T lymphotropic viruses in infected cells. Science 225, 381–385. Suda, T., Okazaki, T., Naito, Y., Yokata, N., Arai, N., Ozaki, S., Nakao, K. & Nagata, S. (1995). Expression of the Fas ligand in cells of T cell

lymphoma and adult T-cell leukemia}lymphoma : clinical, histopathologic, and immunohistochemical analyses. Cancer 66, 2380–2386.

lineage. Journal of Immunology 154, 3806–3813.

Nerenberg, M., Hinrichs, S. H., Reynolds, R. K., Khoury, G. & Jay, G. (1987). The tat gene of human T-lymphotropic virus type 1 induces

Takahashi, T., Tanaka, M., Inazawa, J., Abe, T., Suda, T. & Nagata, S. (1994). Human Fas ligand : gene structure, chromosomal location and

mesenchymal tumors in transgenic mice. Science 237, 1324–1329.

species specificity. International Immunology 6, 1567–1574. Tsuda, H., Huang, R. W. & Takatsuki, K. (1993). Interleukin-2 prevents programmed cell death in adult T-cell leukemia cells. Japanese Journal of Cancer Research 84, 431–437. Worner, I., Matutes, E., Beverley, P. C. L. & Catovsky, D. (1990). The distribution of CD45R, CD29 and CD45RO (UCHL-1) antigens in mature CD4 positive T-cell leukaemias. British Journal of Haematology 74, 4399–4444.

Nerenberg, M. I., Minor, T., Price, J., Ernst, D. N., Shinohara, T. & Schwarz, H. (1991). Transgenic thymocytes are refractory to trans-

formation by the human T-cell leukemia virus type I tax gene. Journal of Virology 65, 3349–3353. Nicoletti, I., Migliorati, G., Pagliacci, M. C., Grignani, F. & Riccardi, C. (1991). A rapid and simple method for measuring thymocyte apoptosis

by propidium iodide staining and flow cytometry. Journal of Immunological Methods 139, 271–279. Nimer, S. D., Gasson, J. C., Hu, K., Smalberg, I., Williams, J. L., Chen, I. S. & Rosenblatt, J. D. (1989). Activation of the GM-CSF promoter by

Yamada, T., Yamaoka, S., Goto, T., Nakai, M., Tsujimoto, Y. & Hatanaka, M. (1994). The human T-cell leukemia virus type I Tax

HTLV-I and -II tax proteins. Oncogene 4, 671–676.

protein induces apoptosis which is blocked by the Bcl-2 protein. Journal of Virology 68, 3374–3379.

Richardson, J. H., Edwards, A. J., Cruickshank, J. K., Rudge, P. & Dalgleish, A. G. (1990). In vivo cellular tropism of human T-cell

Zachar, V., Ebbesen, P., Thomas, R. A., Zacharova, V. & Goustin, A. S. (1994). Basal and Tat-transactivated expression from the human

leukemia virus type 1. Journal of Virology 64, 5682–5687.

immunodeficiency virus type 1 long terminal repeat in human placental trophoblast rules out promoter-enhancer activation as the partial block to viral replication. Journal of General Virology 75, 1461–1468. Zhao, L. J. & Giam, C. Z. (1992). Human T-cell lymphotropic virus type I (HTLV-I) transcriptional activator, Tax, enhances CREB binding to HTLV-I 21-base-pair repeats by protein–protein interaction. Proceedings of the National Academy of Sciences, USA 89, 7070–7074.

Rosl, F. (1992). A simple and rapid method for detection of apoptosis in

human cells. Nucleic Acids Research 20, 5243. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning : A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY : Cold Spring Harbor Laboratory. Shirono, K., Hattori, T., Hata, H., Nishimura, H. & Takatsuki, K. (1989).

Profiles of expression of activated cell antigens on peripheral blood and lymph node cells from different clinical stages of adult T-cell leukemia. Blood 73, 1664–1671. Smith, M. R. & Greene, W. C. (1990). Identification of HTLV-I tax transactivator mutants exhibiting novel transcriptional phenotypes. Genes & Development 4, 1875–1885. Smith, M. R. & Greene, W. C. (1991). Molecular biology of the type I human T-cell leukemia virus (HTLV-I) and adult T-cell leukemia. Journal of Clinical Investigation 87, 761–766.

Zheng, L., Fisher, G., Miller, R. E., Peschon, J., Lynch, D. H. & Lenardo, M. J. (1995). Induction of apoptosis in mature T cells by tumour necrosis

factor. Nature 377, 348–351. Zimmermann, K., Dobrovnik, M., Ballaun, C., Bevec, D., Hauber, J. & Bohnlein, E. (1991). Trans-activation of the HIV-1 LTR by the HIV-1

Tat and HTLV-I Tax proteins is mediated by different cis-acting sequences. Virology 182, 874–878. Received 13 June 1997 ; Accepted 3 September 1997

DCIF