RPL10L Is Required for Male Meiotic Division by ...

Report

RPL10L Is Required for Male Meiotic Division by Compensating for RPL10 during Meiotic Sex Chromosome Inactivation in Mice Highlights d

d

d

d

Rpl10l is essential for the transition from prophase to metaphase in male meiosis I Rpl10l expression compensates for Rpl10 silencing resulting from MSCI

Authors Long Jiang, Tao Li, Xingxia Zhang, ..., P. Jeremy Wang, Yuanwei Zhang, Qinghua Shi

Correspondence

Ectopically expressed RPL10L can substitute for RPL10 in cultured somatic cells

[email protected] (Y.Z.), [email protected] (Q.S.)

Rpl10 transgenic expression restores spermatogenesis and fertility of Rpl10l / males

In Brief

Jiang et al., 2017, Current Biology 27, 1–8 May 22, 2017 ª 2017 Elsevier Ltd. http://dx.doi.org/10.1016/j.cub.2017.04.017

Jiang et al. show that RPL10L is required for the transition from prophase to metaphase in male meiosis I by compensating for RPL10 inactivation resulting from MSCI. The authors provide direct evidence for an X-to-autosome retrogene compensatory hypothesis and novel insight into the functions of these retrogenes in spermatogenesis.

Please cite this article in press as: Jiang et al., RPL10L Is Required for Male Meiotic Division by Compensating for RPL10 during Meiotic Sex Chromosome Inactivation in Mice, Current Biology (2017), http://dx.doi.org/10.1016/j.cub.2017.04.017

Current Biology

Report RPL10L Is Required for Male Meiotic Division by Compensating for RPL10 during Meiotic Sex Chromosome Inactivation in Mice Long Jiang,1,7 Tao Li,1,7 Xingxia Zhang,1 Beibei Zhang,1 Changping Yu,1 Yang Li,1 Suixing Fan,1 Xiaohua Jiang,1 Teka Khan,1 Qiaomei Hao,1 Peng Xu,1 Daita Nadano,2 Mahmoud Huleihel,3 Eitan Lunenfeld,4 P. Jeremy Wang,5 Yuanwei Zhang,1,* and Qinghua Shi1,6,8,* 1USTC-SJH Joint Center for Human Reproduction and Genetics, The CAS Key Laboratory of Innate Immunity and Chronic Diseases, Hefei National Laboratory for Physical Sciences at Microscale, CAS Center for Excellence in Molecular Cell Science, School of Life Sciences, University of Science and Technology of China, Hefei, 230027 Anhui, China 2Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, Japan 3The Shraga Segal Department of Microbiology, Immunology and Genetics, The Center of Advanced Research and Education in Reproduction (CARER), Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84990, Israel 4The Center of Advanced Research and Education in Reproduction (CARER), Faculty of Health Sciences, Fertility and IVF Unit, Department of OB/GYN, Soroka Medical Center and Faculty of Health Sciences, Ben-Gurion University of Negev, Beer-Sheva 84990, Israel 5Department of Biomedical Sciences, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA 19104, USA 6Collaborative Innovation Center of Genetics and Development, School of Life Sciences, Fudan University, Shanghai 200438, China 7These authors contributed equally 8Lead Contact *Correspondence: [email protected] (Y.Z.), [email protected] (Q.S.) http://dx.doi.org/10.1016/j.cub.2017.04.017

SUMMARY

The mammalian sex chromosomes have undergone profound changes during their evolution from an ancestral pair of autosomes [1–4]. Specifically, the X chromosome has acquired a paradoxical sexbiased function by redistributing gene contents [5, 6] and has generated a disproportionately high number of retrogenes that are located on autosomes and exhibit male-biased expression patterns [6]. Several selection-based models have been proposed to explain this phenomenon, including a model of sexual antagonism driving X inactivation (SAXI) [6–8] and a compensatory mechanism based on meiotic sex chromosome inactivation (MSCI) [6, 8–11]. However, experimental evidence correlating the function of X-chromosome-derived autosomal retrogenes with evolutionary forces remains limited [12–17]. Here, we show that the deficiency of Rpl10l, a murine autosomal retrogene of Rpl10 with testis-specific expression, disturbs ribosome biogenesis in late-prophase spermatocytes and prohibits the transition from prophase into metaphase of the first meiotic division, resulting in male infertility. Rpl10l expression compensates for the lack of Rpl10, which exhibits a broad expression pattern but is subject to MSCI during spermatogenesis. Importantly, ectopic expression of RPL10L prevents the death of cultured RPL10deficient somatic cells, and Rpl10l-promoter-driven transgenic expression of Rpl10 in spermatocytes restores spermatogenesis and fertility in Rpl10l-deficient mice. Our results demonstrate that Rpl10l plays

an essential role during the meiotic stage of spermatogenesis by compensating for MSCI-mediated transcriptional silencing of Rpl10. These data provide direct evidence for the compensatory hypothesis and add novel insight into the evolution of X-chromosome-derived autosomal retrogenes and their role in male fertility. RESULTS AND DISCUSSION Rpl10l-Deficient Mice Exhibit Spermatogenic Failure and Male Infertility The X chromosome evolved dramatically after the divergence of eutherian and metatherian mammals, with two major bursts of gene origination events that resulted in a substantial increase in its contribution to the genome [5]. Concomitantly, a disproportionally high number of retrogenes moved from the X chromosome to the autosomes in the eutherian and metatherian lineages [6, 10]. The observation that these autosomal retrogenes exhibit largely male-biased expression patterns suggests that evolutionary selection forces contributed to this nonrandom gene traffic [5–11]. To date, the function of only a small number of X-to-autosome retrogenes has been investigated [12–17], and insight into the forces that drive directional gene movement during mammalian evolution remains limited. RPL10L is a testis-specific retrogene originating from RPL10, an ancient X-linked ribosomal protein-encoding gene, shortly after the divergence of eutherian and metatherian lineages [5, 18]. In order to further understand the functional association between X-derived retrogenes and its parental paralogs, we selected the RPL10L and RPL10 as a model to investigate their gene expression patterns and functional roles, respectively. Consistent with previous reports [5, 18], we confirmed that RPL10L expression Current Biology 27, 1–8, May 22, 2017 ª 2017 Elsevier Ltd. 1


Figure 1. Eutherian-Specific Rpl10l Is Expressed Specifically in Mouse Testis and Is Required for Spermatogenesis and Male Fertility (A) RT-PCR analysis of Rpl10l expression in different tissues from adult mice. (B) Western blot analysis of RPL10L expression in adult mouse tissues and murine cell lines. (C) Evolution of the RPL10L retrogene in vertebrates (blue, present). Phylogenetic tree of vertebrate species with divergence time based on [5, 19, 20]. See also Table S1. (D–F) Testis morphology (D), ratios of testis weight to body weight (E), and sperm counts (F) of 12-week-old Rpl10l+/+, Rpl10l+/, and Rpl10l/ mice. For (D), see also Figure S1F. (G) H&E staining of testicular and epididymal sections from 12-week-old Rpl10l+/+, Rpl10l+/, and Rpl10l/ mice. Scale bars represent 50 mm. See also Figure S1G. Data are representative of two independent experiments in (A) and (B) and at least three independent experiments in (D) and (G). Data are presented as mean ± SEM of at least four mice in (E) and (F). ***p < 0.001; NS, p > 0.05.

is restricted to the testis in mouse and human (Figures 1A and 1B; Figure S1A) and that orthologs of RPL10L exist only in eutherians (Figure 1C; Table S1). To understand the function of Rpl10l during spermatogenesis, we generated Rpl10l-deficient mice using CRISPR/Cas9 technology and obtained two mutant strains deleting 70 bp and 59 bp from the sequence of Rpl10l gene, respectively (Figures S1B–S1D). Loss of RPL10L protein was confirmed by western blotting of testes from Rpl10l/ strains 1 and 2 mice (Figure S1E). Rpl10l+/ and Rpl10l/ mice of both strains were viable and indistinguishable in behavior from Rpl10l+/+ mice. However, Rpl10l/ males of both strains exhibited similar characteristics of testicular hypoplasia (Figures S1F and S1G). For subsequent studies, we focused on strain 1 containing a 70-bp deletion (hereinafter referred to as Rpl10l/). The testes from adult Rpl10l/ mice were substantially smaller than those from their Rpl10l+/ littermates and Rpl10l+/+ mice (Figures 1D and 1E). In addition, comparable sperm counts were observed in the cauda epididymides from Rpl10l+/+ and Rpl10l+/ mice, whereas the epididymides of Rpl10l/ animals were devoid of sperm (Figures 1F and 1G). Mating tests confirmed that Rpl10l/ males were infertile (zero litters in three mating tests with three females per male). These findings indicate that Rpl10l is essential for spermatogenesis. 2 Current Biology 27, 1–8, May 22, 2017

Rpl10l-Deficient Spermatocytes Fail in the Transition from Prophase to Metaphase of Meiosis I To determine the stage of spermatogenic arrest in Rpl10l/ mice, we examined testis tissue morphology using H&Estained sections. Various stages of spermatogenic cells were observed in the seminiferous tubules of Rpl10l+/+ and Rpl10l+/ testis tissue, whereas no spermatids and sperm were detectable in Rpl10l/ testis (Figure 1G), indicating that spermatogenesis did not proceed beyond meiosis in the absence of Rpl10l. Immunostaining for PNA, an acrosomal marker identifying spermatid and sperm [21], confirmed the absence of postmeiotic germ cells in Rpl10l/ testis (Figure 2A). To determine which step of meiosis was disrupted in Rpl10l/ mice, we investigated the progression of meiotic prophase I using the spermatocyte micro-spreading method [22]. The percentage of Rpl10l/ spermatocytes in each successive stage (leptotene, zygotene, pachytene, and diplotene) was comparable to those of Rpl10l+/ spermatocytes (Figures 2B and 2C), indicating that the progression of prophase I was not affected following the deletion of Rpl10l. We next examined the progression from prophase to metaphase of meiosis I using the meiotic delay assay [23]. Testes from adult Rpl10l/ males contained significantly fewer spermatocytes in the first meiotic metaphase (MMI) than testes from Rpl10l+/ littermates (Figure 2D), indicating that spermatogenesis was arrested at the transition from prophase I to metaphase I. This finding was confirmed by histological analysis of the first wave of spermatogenesis. Periodic acid-Schiff (PAS) staining of testicular sections revealed no obvious differences between Rpl10l/ and Rpl10l+/ testes at 15 days post-partum (dpp) (Figure S2A). In seminiferous


Figure 2. Rpl10l Deletion Causes Failure of the First Meiotic Division and Disrupts Ribosome Biogenesis (A) PNA immunostaining (red) of testicular sections from adult Rpl10l+/ and Rpl10l/ mice. Nuclei were counterstained with Hoechst 33342 (blue). (B) Immunostaining of surface-spread spermatocytes from adult Rpl10l+/ and Rpl10l/ mice for SYCP3 (red) and gH2AX (green). (C) Percentages of spermatocytes at successive stages of meiotic prophase I as shown in (B). (D) Number of MMI cells relative to 1,000 midpachytene spermatocytes per animal of the indicated genotypes. (E) Expression changes in ribosomal proteins in late-prophase Rpl10l/ versus Rpl10l+/+ spermatocytes as determined by quantitative proteomic analysis. See also Figure S2I and Table S3. (F) Western blot analysis demonstrating lower yield of ribosomes from late-prophase Rpl10l/ compared with Rpl10l+/+ spermatocytes. The RPL10 antibody (Novus Biologicals, NBP1-84037) recognizes both RPL10 and RPL10L. Data are representative of at least two independent experiments in (A), (B), and (F). Data are presented as mean ± SEM of four mice with a similar number of cells scored per animal in (C) (n, total number of cells that were scored) and presented as mean ± SEM of three mice in (D). ***p < 0.001; NS, p > 0.05. Scale bars represent 50 mm in (A) and 10 mm in (B) and (D).

tubules of Rpl10l+/ testes, MMI spermatocytes were observed at 21 dpp and 27 dpp, and elongated spermatids were seen at 27 dpp, whereas these cells were not present in Rpl10l/ testes (Figure S2A). Instead, seminiferous tubules of Rpl10l/ testes contained spermatocytes with highly condensed chromatin (Figure S2A). Furthermore, TUNEL assay showed a significant increase in the number of apoptotic spermatocytes in Rpl10l/ testes (Figures S2B–S2D). Taken together, these analyses confirm a pivotal role of RPL10L during the first meiotic division of spermatocytes. It has been reported that several X-chromosome-derived autosomal retrogenes play essential roles in spermatogenesis. Utp14b deficiency results in male infertility in adult mice due to mitotic arrest in type A spermatogonia [24, 25]. Pgk2, Cetn1, and Cstf2t are essential for late steps of spermiogenesis or sperm maturation, but their deletion does not affect meiosis [12–14]. Heterozygous deletion of Hnrnpgt leads to spermatogenic failure in mice, but the functional role of this gene remains unknown [15]. To our knowledge, Rpl10l is the first known X-chromosomederived autosomal retrogene that is required for meiotic progression during spermatogenesis. Rpl10l Deletion Disrupts Ribosome Biogenesis in LateProphase Spermatocytes To understand how Rpl10l deletion results in spermatogenic failure, we compared global protein expression profiles of lateprophase (pachytene and diplotene) Rpl10l/ and Rpl10l+/+ spermatocytes isolated by STA-PUT [26, 27]. The proportions of pachytene and diplotene spermatocytes in isolates from

Rpl10l/ testes were comparable to those from Rpl10l+/+ testes (Figures S2E–S2G). Using TMT (tandem mass tag)-based quantitative proteomic analysis, we quantified a total of 3,100 proteins with a minimum of two unique peptides. Of these, 445 proteins were downregulated (Rpl10l//Rpl10l+/+ ratio < 0.77) and 368 proteins were upregulated (Rpl10l//Rpl10l+/+ ratio > 1.3) in late-prophase Rpl10l/ versus Rpl10l+/+ spermatocytes (Table S2). Notably, the levels of several proteins known to be necessary for the progression from prophase to metaphase of male mouse meiosis I—including NEK2, HSPA2, CCNA1, PLK1, and CKS2 [28–33]—were decreased (Figure S2H; Table S2). These disturbances in protein levels were likely associated with spermatogenic failure and apoptosis of spermatocytes in Rpl10l/ mice. Because RPL10L is a ribosomal component in mouse spermatogenic cells [34, 35], we assessed the levels of ribosomal proteins in the quantitative proteomics data. Out of a total of 69 ribosomal proteins identified, 67 exhibited lower levels in Rpl10l/ compared with Rpl10l+/+ late-prophase spermatocytes, including 30 proteins with a more than 1.3-fold decrease and 37 proteins with a less than 1.3-fold decrease (Figures 2E and S2I; Table S3). Disturbances in ribosome biogenesis were further confirmed by a low ribosome yield from late-prophase spermatocytes of Rpl10l/ mice (Figure 2F). These observations were consistent with previous reports that deletion of a ribosomal protein abrogates ribosome biogenesis and leads to a decrease in the level of other ribosomal proteins [36–38]. These results indicate that RPL10L is essential for ribosome biogenesis and the maintenance of steady-state levels of proteins required for the progression of meiosis. Current Biology 27, 1–8, May 22, 2017 3


Figure 3. Rpl10l Appears to Compensate for Rpl10 Silencing during Spermatogenesis (A) RT-PCR analysis of Rpl10 and Rpl10l transcript levels in purified mouse spermatogenic cell populations. SG, spermatogonia (type A); PL, preleptotene spermatocytes; LZ, leptotene plus zygotene spermatocytes; pPD, pubertal pachytene plus diplotene spermatocytes; aPD, adult pachytene plus diplotene spermatocytes; RS, round spermatids. Cell population analysis is as described in Figures S3C and S3D. (B) Representative images of crystal-violet-stained 293T clones after co-transfection with expression vectors encoding CRISPR/Cas9 system components and EGFP-tagged proteins (as indicated), followed by puromycin and blasticidin selection for 12 days. (C) EGFP expression in cells surviving after cotransfection of RPL10-targeted CRISPR/Cas9 and RPL10-EGFP or RPL10L-EGFP expression vectors as shown in (B). Scale bars, 50 mm. (D) Western blot analysis of RPL10 and RPL10L in cell lysates and purified ribosomes from surviving cells shown in (C). 293T cells serve as the positive control for endogenous RPL10. The RPL10 antibody (Novus Biologicals, NBP1-84037) recognizes both RPL10 and RPL10L. (E and F) Flow-cytometric cell-cycle analysis of surviving cells shown in (C). Representative flowcytometry histograms are presented in (E), and frequencies of cell subpopulations in cell-cycle phases G0/G1, S, and G2/M are presented in (F). Data are representative of two or three independent experiments in (A)–(E) and are presented as mean ± SEM of three independent experiments, with biological duplicates in (F). NS, p > 0.05.

Rpl10 Expression Is Subject to Meiotic Sex Chromosome Inactivation Rpl10, the ancient progenitor gene of Rpl10l, is highly conserved from yeast to human and locates on the X chromosome in vertebrates. Given that the X chromosome tends to be feminized by enriching female-biased genes and dislodging the male-biased genes due to its longer stay time in females according to the SAXI hypothesis [5–8, 39, 40], we assessed the expression pattern of Rpl10 in both sexes. RT-PCR and qPCR results revealed that Rpl10 is broadly expressed in different tissues with similar expression levels between male and female mice, except for a relatively lower expression in testis (Figures S3A and S3B). Considering that Rpl10 may be subject to meiotic sex chromosome inactivation (MSCI), which results in the transcriptional silencing of most protein-coding genes on the sex chromosomes from the pachytene stage until spermiogenesis [11, 41–44], we examined the expression dynamics of Rpl10 in mouse germ cell populations isolated by STA-PUT (Figures S3C and S3D). RT-PCR analysis showed that the expression level of Rpl10 was comparable in spermatogonia and early spermatocytes (preleptotene to zygotene) but sharply reduced in late spermatocytes (pachytene and diplotene) and round spermatids (Figure 3A), indicating transcriptional silencing of Rpl10 during and after MSCI. Silencing 4 Current Biology 27, 1–8, May 22, 2017

of Rpl10 may explain the relatively lower expression level detected in testis. RPL10 Is Essential for Ribosome Biogenesis and Cell Proliferation RPL10 is one of the last proteins to assemble into the nascent 60S subunit of ribosome and is essential for protein synthesis and population-replicative lifespan in yeast [45–47]. In human and mouse, assembly of the RPL10 protein into the 60S subunit only occurs in the cytoplasm [34, 35, 48]. To investigate the effect of RPL10 knockdown on ribosome biogenesis in mammalian cells, we analyzed polysome profiles from extracts of cultured human cells transfected with RPL10-targeted small interfering RNAs (siRNAs). Knockdown of RPL10 resulted in decreased levels of 60S ribosomal subunits, 80S ribosomes, and polysomes (Figure S3E), indicating a disturbance of ribosome biogenesis. As expected, the levels of other ribosomal proteins were decreased in RPL10-knockdown cells (Figure S3F), ultimately resulting in G1 cell-cycle arrest (Figure S3G). To further determine the effect of RPL10 deletion in cell proliferation, we generated a cell line that lacked endogenous RPL10 and stably expressed tetracycline-inducible (Tet-On) RPL10-EGFP and performed clone formation assays. An abundance of clones survived in cultures treated with doxycycline, while no clones were observed in the


non-doxycycline group (Figures S3H and S3I). These results, together with its expression pattern, indicate that RPL10 plays a housekeeping role in ribosome biogenesis and cell proliferation. Rpl10l Expression Compensates for Rpl10 Silencing during Spermatogenesis The MSCI-based compensatory hypothesis—i.e., the autosomal retrogenes with male-biased function in late spermatogenesis can compensate for the housekeeping function of their X-linked parental genes—is widely accepted as an explanation for the formation of X-chromosome-derived autosomal retrogenes [6, 8–11]. According to this hypothesis, an increase in Rpl10l expression should be observed specifically during and after meiosis when Rpl10 is silenced by MSCI. To test this hypothesis, we assessed mRNA levels of Rpl10l in purified male mouse germ cells of different developmental stages by RT-PCR. Rpl10l was highly expressed in late spermatocytes (pachytene and diplotene) and round spermatids but weakly expressed in spermatogonia and early spermatocytes (Figure 3A), exhibiting a strikingly mutually complementary expression pattern with Rpl10 in male germ cells. This observation is consistent with a previous report that RPL10L staining was observed in spermatogenic cells located in the seminiferous lumen but not in monolayer cells attached to the basement membrane of seminiferous tubules [35]. Thus, we propose that Rpl10l compensates for Rpl10 silencing during spermatogenesis. Ectopically Expressed RPL10L Can Substitute for RPL10 in Cultured Human Cells To substantiate that RPL10L can compensate for RPL10 function, we performed a rescue experiment in human cultured cells in which endogenous RPL10 was disrupted using the CRISPR/ Cas9 method. To this end, we co-transfected 293T cells with CRISPR/Cas9 and RPL10-targeted single-guide RNA (sgRNA) vectors, in combination with either EGFP, RPL10-EGFP, or RPL10L-EGFP expression vectors. After 12 days of puromycin and blasticidin treatment to select for cell clones retaining both Cas9 and sgRNA constructs, cell cultures transfected with RPL10-EGFP contained multiple surviving cell clones, indicating that ectopic RPL10 compensated for the endogenous gene product as expected (Figure 3B). Interestingly, a similar number of clones survived in cultures transfected with RPL10L-EGFP (Figure 3B). To confirm that the surviving cells were rescued by RPL10L-EGFP expression, we evaluated these clones for GFP fluorescence by microscopy and assessed the expression of endogenous RPL10 and ectopic expression of RPL10L-EGFP by western blotting. All surviving cells expressed RPL10LEGFP in the cytoplasm and lacked endogenous RPL10 (Figures 3C and 3D), indicating that ectopically expressed RPL10L prevented the death of RPL10-deficient cells. More importantly, cell-cycle duration did not differ between cells deficient for endogenous RPL10 that were rescued by either RPL10L-EGFP or RPL10-EGFP expression (Figures 3E and 3F). These results were further confirmed by observations in cells that lacked the endogenous RPL10 and stably expressed Tet-On RPL10LEGFP. Upon exposure to doxycycline, these cells grew similarly to control cells expressing endogenous RPL10 (Figures S3J and S3K). These results indicate that ectopically expressed RPL10L can substitute for RPL10 in cultured human cells.

Transgenic Expression of Rpl10-mCherry Partly Restores Spermatogenesis and Fertility of Rpl10lDeficient Males To further substantiate that Rpl10l plays the same function with Rpl10 and compensates for Rpl10 silencing during spermatogenesis, we attempted to use the transgenic Rpl10 to rescue the spermatogenesis and fertility in Rpl10l/ mice. To achieve this purpose, we first generated a transgenic mouse strain expressing Rpl10-mCherry driven by the Rpl10l promoter (Rpl10-mCherryTG) (Figure S4A). Similar to endogenous RPL10L [35], the RPL10-mCherry protein was detectable only in pachytene spermatocytes and cells at subsequent stages of germ cell development (Figures S4B and S4C). We then intercrossed Rpl10-mCherryTG males with Rpl10l/ females. The F2 generation adult Rpl10l/;Rpl10-mCherryTG males exhibited a smaller testis size and lower sperm count than Rpl10l+/ and Rpl10l+/;Rpl10-mCherryTG littermates but had significantly larger testes and higher sperm counts compared with Rpl10l/ littermates (Figures 4A–4C). H&E staining of testicular sections from Rpl10l/;Rpl10-mCherryTG mice showed that most seminiferous tubules contained different stages of germ cells (Figure 4D), indicating that spermatogenesis was restored. This was confirmed by a dramatically increased number of MMI spermatocytes in Rpl10l/;Rpl10mCherryTG testis compared to Rpl10l/ testis (Figure 4E). Consistently, the fertility of Rpl10l/;Rpl10-mCherryTG males was restored. After mating with Rpl10l+/+ females, litters from Rpl10l/;Rpl10-mCherryTG males had fewer pups than those from Rpl10l+/;Rpl10-mCherryTG or Rpl10l+/ males (Figure 4F); similar results were observed in the next-generation Rpl10l/;Rpl10-mCherryTG males (Figure S4D). These findings indicate that transgenic Rpl10 can partly compensate for Rpl10l loss of function. Noticeably, defects in spermatogenesis were detectable in 27.21% (±7.86% SEM) of seminiferous tubules from Rpl10l/; Rpl10-mCherryTG testes (Figure S4E). Coincidently, RPL10mCherry protein expression was absent in 26.67% (±8.96% SEM) of seminiferous tubules from Rpl10l/;Rpl10-mCherryTG testes (Figure S4F), which implies that the observed partial rescue of spermatogenesis in Rpl10l/;Rpl10-mCherryTG mice may result from mosaic expression of transgenic Rpl10-mCherry in the testis. Based on previous observations [8], we can also not exclude the possibility that Rpl10l may have acquired additional functions besides compensation for Rpl10 since its divergence from Rpl10. Collectively, we have demonstrated that RPL10L plays an essential role during meiosis of spermatogenesis by compensating for its X-linked parental paralog, RPL10, during and after MSCI. First, Rpl10l is required for meiotic progression during spermatogenesis. Second, Rpl10l exhibited a strikingly mutually complementary expression pattern with Rpl10 in male germ cells. Third, RPL10L can substitute for RPL10 in cultured human cells, and vice versa—Rpl10 can complement Rpl10l in mice. Based on these results and the known evolution of RPL10L, our study substantiates the hypothesis that MSCI plays a critical role for the selective fixation of X-derived autosomal retrogenes in mammals and provides novel insight into these retrogenes’ functions in male fertility. Current Biology 27, 1–8, May 22, 2017 5


Figure 4. Spermatogenesis and Fertility of Rpl10l-Deficient Mice Can Be Restored by Transgenic Expression of Rpl10 (A–D) Testis morphology (A), ratios of testis weight to body weight (B), sperm counts (C), and H&E-stained testicular and epididymal sections (D) from 12-week-old Rpl10l+/, Rpl10l+/;Rpl10mCherryTG, Rpl10l/, and Rpl10l/;Rpl10mCherryTG mice. Scale bars in (D) represent 50 mm. (E) Number of MMI cells relative to 1,000 midpachytene cells per animal of the indicated genotypes. (F) Litter sizes in mating tests of male mice of the indicated genotype. Each male was mated with three wild-type females. Each dot represents one litter. See also Figure S4D. Data are representative of three independent experiments in (A) and (D), presented as mean ± SEM of three or four mice in (B), (C), and (E), and presented as mean ± SEM of scored litters from three males per genotype in (F). *p < 0.05; ***p < 0.001; NS, p > 0.05.

B

STAR+METHODS

Separation of mouse spermatogenic cells Fertility test B Histology B Sperm counting B Meiotic delay assay B Spermatocyte micro-spreading and immunostaining B TUNEL assay B Immunostaining of testis sections QUANTIFICATION AND STATISTICAL ANALYSES B Quantitative proteomic analysis B Statistical analysis DATA AND SOFTWARE AVAILABILITY B

Detailed methods are provided in the online version of this paper and include the following: d d d

d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Mice B Cell culture METHOD DETAILS B Plasmids B Transfection and RNAi B RNA extraction, RT-PCR and qPCR B Ribosome purification B Protein samples and western blot analysis B Polysome profiling analysis B Flow cytometry

6 Current Biology 27, 1–8, May 22, 2017

d

d

SUPPLEMENTAL INFORMATION Supplemental Information includes four figures and four tables and can be found with this article online at http://dx.doi.org/10.1016/j.cub.2017. 04.017.


AUTHOR CONTRIBUTIONS

11. Turner, J.M. (2015). Meiotic silencing in mammals. Annu. Rev. Genet. 49, 395–412.

L.J., T.L., and Q.S. designed the research. L.J. and T.L. carried out and analyzed all experiments, with assistance from X.Z. and B.Z. for immunostaining and fertility testing; C.Y., Y.L., and S.F. for plasmid construction and genetargeted mice; and X.J. and Y.Z. for analysis of proteomics data. D.N. provided the mouse RPL10L antibody. L.J. and Q.S. wrote the manuscript. T.K., Q.H., P.X., D.N., M.H., E.L., P.J.W., and Y.Z. provided critical suggestions for experiment design. All authors read and edited the manuscript. Q.S. supervised the project.

12. Danshina, P.V., Geyer, C.B., Dai, Q., Goulding, E.H., Willis, W.D., Kitto, G.B., McCarrey, J.R., Eddy, E.M., and O’Brien, D.A. (2010). Phosphoglycerate kinase 2 (PGK2) is essential for sperm function and male fertility in mice. Biol. Reprod. 82, 136–145.

ACKNOWLEDGMENTS We thank Dr. Howard J. Cooke for valuable suggestions, Dr. Xingxu Huang for plasmids of the CRISPR/Cas9 system and suggestions, Dr. Xiaoyuan Song for the pTRIPZ vector, and Drs. Congzhao Zhou and Rongbin Zhou for allowing us to use Density Gradient Fractionation Systems and the FACSCalibur flow cytometer, respectively. We also thank Xiaoyu Zhang and Hongtao Cheng for the generation and care of genetically modified mice, and Dr. Fang Wang, Dr. Saeed Ahmad, Hanwei Jiang, and other members of the Q.S. lab for comments and advice. This work was supported by the National Key Research and Developmental Program of China (2016YFC1000600); the Strategic Priority Research Program of the Chinese Academy of Sciences (XDB19000000); the Joint NSFC-ISF Research Program, jointly funded by the National Natural Science Foundation of China and the Israel Science Foundation (31461143013); the National Basic Research Program of China (2014CB943101); the National Natural Science Foundation of China (31371519, 31501199, 31301227, and 31571555); the Major Program of Development Foundation of Hefei Centre for Physical Science and Technology (2014FXZY003); and the Fundamental Research Funds for the Central Universities (WK2070000053 and WK2340000069). Received: December 7, 2016 Revised: March 5, 2017 Accepted: April 11, 2017 Published: May 11, 2017 REFERENCES 1. Schaffner, S.F. (2004). The X chromosome in population genetics. Nat. Rev. Genet. 5, 43–51.

13. Avasthi, P., Scheel, J.F., Ying, G., Frederick, J.M., Baehr, W., and Wolfrum, U. (2013). Germline deletion of Cetn1 causes infertility in male mice. J. Cell Sci. 126, 3204–3213. 14. Tardif, S., Akrofi, A.S., Dass, B., Hardy, D.M., and MacDonald, C.C. (2010). Infertility with impaired zona pellucida adhesion of spermatozoa from mice lacking TauCstF-64. Biol. Reprod. 83, 464–472. 15. Ehrmann, I., Dalgliesh, C., Tsaousi, A., Paronetto, M.P., Heinrich, B., Kist, R., Cairns, P., Li, W., Mueller, C., Jackson, M., et al. (2008). Haploinsufficiency of the germ cell-specific nuclear RNA binding protein hnRNP G-T prevents functional spermatogenesis in the mouse. Hum. Mol. Genet. 17, 2803–2818. 16. Banks, K.G., Johnson, K.A., Lerner, C.P., Mahaffey, C.L., Bronson, R.T., and Simpson, E.M. (2003). Retroposon compensatory mechanism hypothesis not supported: Zfa knockout mice are fertile. Genomics 82, 254–260. 17. Bradley, J., Baltus, A., Skaletsky, H., Royce-Tolland, M., Dewar, K., and Page, D.C. (2004). An X-to-autosome retrogene is required for spermatogenesis in mice. Nat. Genet. 36, 872–876. 18. Uechi, T., Maeda, N., Tanaka, T., and Kenmochi, N. (2002). Functional second genes generated by retrotransposition of the X-linked ribosomal protein genes. Nucleic Acids Res. 30, 5369–5375. 19. Springer, M.S., and Murphy, W.J. (2007). Mammalian evolution and biomedicine: new views from phylogeny. Biol. Rev. Camb. Philos. Soc. 82, 375–392. 20. Kumar, S., and Hedges, S.B. (1998). A molecular timescale for vertebrate evolution. Nature 392, 917–920. 21. Kanemori, Y., Koga, Y., Sudo, M., Kang, W., Kashiwabara, S., Ikawa, M., Hasuwa, H., Nagashima, K., Ishikawa, Y., Ogonuki, N., et al. (2016). Biogenesis of sperm acrosome is regulated by pre-mRNA alternative splicing of Acrbp in the mouse. Proc. Natl. Acad. Sci. USA 113, E3696– E3705.

2. Marshall Graves, J.A. (2002). Sex chromosomes and sex determination in weird mammals. Cytogenet. Genome Res. 96, 161–168.

22. Yang, Q., Zhang, D., Leng, M., Yang, L., Zhong, L., Cooke, H.J., and Shi, Q. (2011). Synapsis and meiotic recombination in male Chinese muntjac (Muntiacus reevesi). PLoS ONE 6, e19255.

3. Skaletsky, H., Kuroda-Kawaguchi, T., Minx, P.J., Cordum, H.S., Hillier, L., Brown, L.G., Repping, S., Pyntikova, T., Ali, J., Bieri, T., et al. (2003). The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423, 825–837.

23. Jiang, X., Ma, T., Zhang, Y., Zhang, H., Yin, S., Zheng, W., Wang, L., Wang, Z., Khan, M., Sheikh, S.W., et al. (2015). Specific deletion of Cdh2 in Sertoli cells leads to altered meiotic progression and subfertility of mice. Biol. Reprod. 92, 79.

4. Lahn, B.T., Pearson, N.M., and Jegalian, K. (2001). The human Y chromosome, in the light of evolution. Nat. Rev. Genet. 2, 207–216.

24. Beamer, W.G., Cunliffe-Beamer, T.L., Shultz, K.L., Langley, S.H., and Roderick, T.H. (1988). Juvenile spermatogonial depletion (jsd): a genetic defect of germ cell proliferation of male mice. Biol. Reprod. 38, 899–908.

5. Zhang, Y.E., Vibranovski, M.D., Landback, P., Marais, G.A., and Long, M. (2010). Chromosomal redistribution of male-biased genes in mammalian evolution with two bursts of gene gain on the X chromosome. PLoS Biol. 8, e1000494. 6. Emerson, J.J., Kaessmann, H., Betra´n, E., and Long, M. (2004). Extensive gene traffic on the mammalian X chromosome. Science 303, 537–540. 7. Wu, C.I., and Xu, E.Y. (2003). Sexual antagonism and X inactivation–the SAXI hypothesis. Trends Genet. 19, 243–247. 8. Shiao, M.S., Khil, P., Camerini-Otero, R.D., Shiroishi, T., Moriwaki, K., Yu, H.T., and Long, M. (2007). Origins of new male germ-line functions from Xderived autosomal retrogenes in the mouse. Mol. Biol. Evol. 24, 2242– 2253. 9. Wang, P.J. (2004). X chromosomes, retrogenes and their role in male reproduction. Trends Endocrinol. Metab. 15, 79–83. gou, B., 10. Potrzebowski, L., Vinckenbosch, N., Marques, A.C., Chalmel, F., Je and Kaessmann, H. (2008). Chromosomal gene movements reflect the recent origin and biology of therian sex chromosomes. PLoS Biol. 6, e80.

25. Rohozinski, J., and Bishop, C.E. (2004). The mouse juvenile spermatogonial depletion (jsd) phenotype is due to a mutation in the X-derived retrogene, mUtp14b. Proc. Natl. Acad. Sci. USA 101, 11695–11700. 26. Bryant, J.M., Meyer-Ficca, M.L., Dang, V.M., Berger, S.L., and Meyer, R.G. (2013). Separation of spermatogenic cell types using STA-PUT velocity sedimentation. J. Vis. Exp. (80), e50648. 27. Wang, P.J., Page, D.C., and McCarrey, J.R. (2005). Differential expression of sex-linked and autosomal germ-cell-specific genes during spermatogenesis in the mouse. Hum. Mol. Genet. 14, 2911–2918. 28. Di Agostino, S., Rossi, P., Geremia, R., and Sette, C. (2002). The MAPK pathway triggers activation of Nek2 during chromosome condensation in mouse spermatocytes. Development 129, 1715–1727. 29. Di Agostino, S., Fedele, M., Chieffi, P., Fusco, A., Rossi, P., Geremia, R., and Sette, C. (2004). Phosphorylation of high-mobility group protein A2 by Nek2 kinase during the first meiotic division in mouse spermatocytes. Mol. Biol. Cell 15, 1224–1232.

Current Biology 27, 1–8, May 22, 2017 7


30. Zhu, D., Dix, D.J., and Eddy, E.M. (1997). HSP70-2 is required for CDC2 kinase activity in meiosis I of mouse spermatocytes. Development 124, 3007–3014. 31. Liu, D., Matzuk, M.M., Sung, W.K., Guo, Q., Wang, P., and Wolgemuth, D.J. (1998). Cyclin A1 is required for meiosis in the male mouse. Nat. Genet. 20, 377–380. 32. Kim, J., Ishiguro, K., Nambu, A., Akiyoshi, B., Yokobayashi, S., Kagami, A., Ishiguro, T., Pendas, A.M., Takeda, N., Sakakibara, Y., et al. (2015). Meikin is a conserved regulator of meiosis-I-specific kinetochore function. Nature 517, 466–471. 33. Spruck, C.H., de Miguel, M.P., Smith, A.P., Ryan, A., Stein, P., Schultz, R.M., Lincoln, A.J., Donovan, P.J., and Reed, S.I. (2003). Requirement of Cks2 for the first metaphase/anaphase transition of mammalian meiosis. Science 300, 647–650. 34. Sugihara, Y., Honda, H., Iida, T., Morinaga, T., Hino, S., Okajima, T., Matsuda, T., and Nadano, D. (2010). Proteomic analysis of rodent ribosomes revealed heterogeneity including ribosomal proteins L10-like, L22-like 1, and L39-like. J. Proteome Res. 9, 1351–1366. 35. Sugihara, Y., Sadohara, E., Yonezawa, K., Kugo, M., Oshima, K., Matsuda, T., and Nadano, D. (2013). Identification and expression of an autosomal paralogue of ribosomal protein S4, X-linked, in mice: potential involvement of testis-specific ribosomal proteins in translation and spermatogenesis. Gene 521, 91–99. 36. Volarevic, S., Stewart, M.J., Ledermann, B., Zilberman, F., Terracciano, L., Montini, E., Grompe, M., Kozma, S.C., and Thomas, G. (2000). Proliferation, but not growth, blocked by conditional deletion of 40S ribosomal protein S6. Science 288, 2045–2047. 37. Robledo, S., Idol, R.A., Crimmins, D.L., Ladenson, J.H., Mason, P.J., and Bessler, M. (2008). The role of human ribosomal proteins in the maturation of rRNA and ribosome production. RNA 14, 1918–1929. 38. Kirn-Safran, C.B., Oristian, D.S., Focht, R.J., Parker, S.G., Vivian, J.L., and Carson, D.D. (2007). Global growth deficiencies in mice lacking the ribosomal protein HIP/RPL29. Dev. Dyn. 236, 447–460. 39. Carrel, L., and Willard, H.F. (2005). X-inactivation profile reveals extensive variability in X-linked gene expression in females. Nature 434, 400–404. 40. Khil, P.P., Smirnova, N.A., Romanienko, P.J., and Camerini-Otero, R.D. (2004). The mouse X chromosome is enriched for sex-biased genes not subject to selection by meiotic sex chromosome inactivation. Nat. Genet. 36, 642–646. 41. Turner, J.M. (2007). Meiotic sex chromosome inactivation. Development 134, 1823–1831. 42. Cloutier, J.M., and Turner, J.M. (2010). Meiotic sex chromosome inactivation. Curr. Biol. 20, R962–R963.

8 Current Biology 27, 1–8, May 22, 2017

43. Yan, W., and McCarrey, J.R. (2009). Sex chromosome inactivation in the male. Epigenetics 4, 452–456. 44. Sosa, E., Flores, L., Yan, W., and McCarrey, J.R. (2015). Escape of X-linked miRNA genes from meiotic sex chromosome inactivation. Development 142, 3791–3800. 45. Hedges, J., West, M., and Johnson, A.W. (2005). Release of the export adapter, Nmd3p, from the 60S ribosomal subunit requires Rpl10p and the cytoplasmic GTPase Lsg1p. EMBO J. 24, 567–579. 46. West, M., Hedges, J.B., Chen, A., and Johnson, A.W. (2005). Defining the order in which Nmd3p and Rpl10p load onto nascent 60S ribosomal subunits. Mol. Cell. Biol. 25, 3802–3813. 47. Chiocchetti, A., Zhou, J., Zhu, H., Karl, T., Haubenreisser, O., Rinnerthaler, M., Heeren, G., Oender, K., Bauer, J., Hintner, H., et al. (2007). Ribosomal proteins Rpl10 and Rps6 are potent regulators of yeast replicative life span. Exp. Gerontol. 42, 275–286. 48. Nguyen, Y.H., Mills, A.A., and Stanbridge, E.J. (1998). Assembly of the QM protein onto the 60S ribosomal subunit occurs in the cytoplasm. J. Cell. Biochem. 68, 281–285. 49. Shen, B., Zhang, J., Wu, H., Wang, J., Ma, K., Li, Z., Zhang, X., Zhang, P., and Huang, X. (2013). Generation of gene-modified mice via Cas9/RNAmediated gene targeting. Cell Res. 23, 720–723. 50. Shen, B., Zhang, W., Zhang, J., Zhou, J., Wang, J., Chen, L., Wang, L., Hodgkins, A., Iyer, V., Huang, X., and Skarnes, W.C. (2014). Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nat. Methods 11, 399–402. 51. Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., and Jaenisch, R. (2013). One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910–918. 52. Ittner, L.M., and Go¨tz, J. (2007). Pronuclear injection for the production of transgenic mice. Nat. Protoc. 2, 1206–1215. 53. Belin, S., Hacot, S., Daudignon, L., Therizols, G., Pourpe, S., Mertani, H.C., Rosa-Calatrava, M., and Diaz, J.J. (2010). Purification of ribosomes from human cell lines. Curr. Protoc. Cell Biol. Chapter 3. Unit 3.40. 54. Gandin, V., Sikstro¨m, K., Alain, T., Morita, M., McLaughlan, S., Larsson, O., and Topisirovic, I. (2014). Polysome fractionation and analysis of mammalian translatomes on a genome-wide scale. J. Vis. Exp. (87), e51455. 55. Peters, A.H., Plug, A.W., van Vugt, M.J., and de Boer, P. (1997). A dryingdown technique for the spreading of mammalian meiocytes from the male and female germline. Chromosome Res. 5, 66–68.


STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Antibodies Rabbit polyclonal anti-RPL10

Novus

Cat# NBP1-84037; RRID: AB_11007661

Rabbit polyclonal anti-gH2AX

Novus

Cat# NB100-384; RRID: AB_10002815

Rabbit polyclonal anti-RPL4

Proteintech Group

Cat# 11302-1-AP; RRID: AB_2181909


Proteintech Group

Cat# 16277-1-AP; RRID: AB_2181292


Proteintech Group

Cat# 14701-1-AP; RRID: AB_2181587


Proteintech Group

Cat# 16497-1-AP; RRID: AB_2181772

Rabbit polyclonal anti-RPS3

Proteintech Group

Cat# 11990-1-AP; RRID: AB_2180758

Rabbit polyclonal anti-RPS15

Proteintech Group

Cat# 14957-1-AP; RRID: AB_2180163

Rabbit polyclonal anti-NEK2

Proteintech Group

Cat# 24171-1-AP

Rabbit polyclonal anti-HSPA2

Proteintech Group

Cat# 12797-1-AP; RRID: AB_2119687

Rabbit polyclonal anti-CCNA1

Proteintech Group

Cat# 13295-1-AP; RRID: AB_2071993

Rabbit polyclonal anti-CKS2

Proteintech Group

Cat# 15616-1-AP; RRID: AB_2260671

Rabbit polyclonal anti-mCherry

Abcam

Cat# ab167453; RRID: AB_2571870

Rabbit polyclonal anti-b-Actin

Abcam

Cat# ab8227; RRID: AB_2305186

Mouse monoclonal anti-SYCP3

Abcam

Cat# ab97672; RRID: AB_10678841

Mouse monoclonal anti-PLK1

Abcam

Cat# ab17056; RRID: AB_443612

Mouse monoclonal anti-gH2AX

Millipore

Cat# 05-636; RRID: AB_309864

Rabbit polyclonal anti-PLZF

Santa Cruz

Cat# sc-22839; RRID: AB_2304760

Lectin PNA Conjugate (Alexa Fluor 568)

Thermo Fisher

Cat# L-32458

Goat Anti-Mouse IgG1 (Alexa Fluor 488)

Thermo Fisher

Cat# A-21121; RRID: AB_141514

Donkey Anti-Rabbit IgG H&L (Alexa Fluor 555)

Thermo Fisher

Cat# A-31572; RRID: AB_162543

Donkey Anti-Rabbit IgG H&L (HRP)

Abcam

Cat# ab6802; RRID: AB_955445

Goat Anti-Mouse IgG H&L (HRP)

Abcam

Cat# ab6789 RRID: AB_955439

Rabbit polyclonal anti-RPL10L

This study; [35]

N/A

TransGen Biotech

Cat# CD201

Puromycin

Sigma

Cat# P9620

Blasticidin S hydrochloride

Sigma

Cat# 15205

Doxycycline

Sigma

Cat# D9891

Protease inhibtor cocktails

Roch

Cat# 04693159001

RNasin Ribonuclease Inhibitors

Promega

Cat# N2511

Cycloheximide

Sigma

Cat# C7698

RNase OUT

Invitrogen

Cat# 10777-019

PMSF Protease Inhibitor

Thermo Fisher

Cat# 36978

RNase A

Thermo Fisher

Cat# EN0531

VECTASHIELD Antifade Mounting Medium

Vector

Cat# H-1000

Bacterial and Virus Strains Trans5a Chemically Competent Cell Chemicals, Peptides, and Recombinant Proteins

Critical Commercial Assays ClonExpress MultiS One Step Cloning Kit

Vazyme

Cat# C113

PrimeScript RT reagent kit with gDNA Eraser

TaKaRa

Cat# RR047A

In Situ Cell Death Detection Kit

Roche

Cat# 11684817910

Experimental Models: Cell Lines HEK293T

ATCC

Cat# CRL-3216; RRID: CVCL_0063

A549

ATCC

Cat# CCL-185; RRID: CVCL_0023 (Continued on next page)

Current Biology 27, 1–8.e1–e6, May 22, 2017 e1


Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

HeLa

ATCC

Cat# CCL-2; RRID: CVCL_0030

U-2 OS

ATCC

Cat# HTB-96; RRID: CVCL_0042

HCT116

ATCC

Cat# CCL-247; RRID: CVCL_0291

NIH/3T3

ATCC

Cat# CRL-1658; RRID: CVCL_0594

Mouse primary embryonic fibroblasts

This study

N/A

C57BL/6 mouse

Beijing Vital River Laboratory Animal Technology Co.

Cat# 213

DBA/2 mouse


Cat# 214

ICR mouse


Cat# 201

Rpl10l knockout mouse

This study

N/A

Rpl10-mCherry transgenic mouse

This study

N/A

Oligos for plasmids construction, sgRNA, genotyping, RT-PCR and qPCR listed in Table S4

This study

N/A

Human RPL10 siRNA 50 -GTCATCCGCATCAACA AGAT-30

This study

N/A

pST1374-NLS-flag-linker-Cas9

Gift from Dr. Xingxu Huang [49]

Addgene, 44758

pUC57-sgRNA


Addgene, 51132

pGL3-U6-sgRNA-PGK-puromycin


Addgene, 51133

pTRIPZ vector (Tet on)

Gift from Dr. Xiaoyuan Song

N/A

Zhang Lab at MIT

http://crispr.mit.edu/

Experimental Models: Organisms/Strains

Oligonucleotides

Recombinant DNA

Software and Algorithms CRISPR DESIGN Other

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Dr. Qinghua Shi ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Mice The care and breeding of mice and all animal experiments were conducted according to the guidelines and approved by the Institutional Animal Care Committee of the University of Science and Technology of China. The C57BL/6, DBA/2 and ICR mouse strains were purchased from Beijing Vital River Laboratory Animal Technology Co. Rpl10l mutant mice were generated using CRISPR/Cas9 genome editing as previously described [51]. To generate Rpl10l mutants, we co-injected Cas9 mRNAs and two single guide RNAs targeting exon 1 that were prepared as previously described [50] into B6D2F1 (C57BL/6 3 DBA/2) zygotes, followed by embryo transfer into pseudo pregnant ICR females. Genomic DNA was extracted from tail biopsies from founder mice using the TIANamp Genomic DNA Kit (TIANGEN DP304) and analyzed using the EasyTaq system (TransGen Biotech, AP111) and Sanger sequencing with primers Rpl10l-Check-FW and Rpl10l-Check-RV. We crossed female founders to C57BL/6 mice. Founder female #10 had deletions in both Rpl10l alleles (70 and 72 bp, respectively), and founder female #12 had a 59 bp deletion in one allele. For subsequent experiments, we used F2 generation animals that were homozygous for the 70 bp deletion (strain 1) and the 59 bp deletion (strain 2). To generate Rpl10-mCherry transgenic mice, the pmRpl10l-mRPL10-mCherry vector was digested with ApaLI and purified using the MinElute PCR Purification Kit (QIAGEN, 28004). Linearized DNA was microinjected into B6D2F1 mouse zygotes following standard protocols [52]. Founders were genotyped by EsayTaq PCR system using two sets of primer pairs, which were Rpl10mCherryTG-FW1 and Rpl10-mCherryTG-RV1, and Rpl10-mCherryTG-FW2 and Rpl10-mCherryTG-RV2. Transgenic founder males were intercrossed with Rpl10l/ females (Strain 1), and their offspring (F2 generation) was used for experiments. Primers for genotyping listed in Table S4. e2 Current Biology 27, 1–8.e1–e6, May 22, 2017


Cell culture HEK293T (ATCC, CRL-3216), A549 (ATCC, CCL-185), HeLa (ATCC, CCL-2), U-2 OS (ATCC, HTB-96), HCT116 (ATCC, CCL-247), NIH/3T3 (ATCC, CRL-1658) and mouse primary embryonic fibroblasts (MEF) cells were cultured in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% FBS (GIBCO, 15140122), 100 U/ml penicillin and 100 mg/ml streptomycin (GIBCO, 16000044) and maintained at 5% CO2, ambient O2. 293T cells with endogenous RPL10 knockout and stable expression of Tet-On inducible RPL10-EGFP were generated by co-transfection of the following plasmids: pST1374-NLS-flag-linker-Cas9, the RPL10-targeting sgRNA expression plasmid based on the pGL3-U6-sgRNA-PGK-puromycin vector, and pTRIPZ-RPL10-EGFP. After selection in medium supplemented with 2 mg/ml puromycin, 2 mg/ml blasticidin, and 500 ng/ml doxycycline for 2 weeks, GFP-positive clones were isolated and cultured in medium containing 500 ng/ml doxycycline. Protein expression was validated by western blot analysis. Using the same method, we also generated 293T cells with endogenous RPL10 knockout and stable expression of Tet-On inducible RPL10L-EGFP. Control cell lines expressing endogenous RPL10 were produced by transfection of empty pGL3-U6-sgRNA-PGK-puromycin vector. METHOD DETAILS Plasmids The RPL10-EGFP expression vector driven by the human RPL10 promoter (phRPL10-RPL10-EGFP) was constructed as follows. The upstream 1.4 kb DNA fragment of the human RPL10 open reading frame was amplified using primers phRPL10-FW and phRPL10-RV. The human RPL10 coding sequence (CDS) was cloned from total RNAs extracted from 293T cells by RT-PCR with primers hRPL10-FW and hRPL10-RV. The backbone sequence was amplified from pEGFP-N1 with primers EGFP-BB-FW and EGFP-BB-RV. After purification by agarose gel electrophoresis and gel extraction, the three fragments were mixed and ligated using a ClonExpress MultiS One Step Cloning Kit (Vazyme, C113) according to the manufacturer’s protocol. Vectors phRPL10-RPL10LEGFP and phRPL10-EGFP were generated using the same approach. Because human RPL10L is intronless, the RPL10L CDS was cloned from genomic DNA extracted from 293T cells. To obtain Tet-On inducible human RPL10 or RPL10L expression constructs, RPL10-EGFP and RPL10L-EGFP fragments were amplified from phRPL10-RPL10-EGFP and phRPL10-RPL10L-EGFP vector, respectively, and inserted into pTRIPZ vector (a kind gift from Dr. Xiaoyuan Song) using AgeI and MluI restriction sites. The DNA construct used for Rpl10-mCherry transgenic mice was constructed using the ClonExpress MultiS One Step Cloning Kit (Vazyme, C113) as described above. The upstream 2 kb DNA fragment of mouse Rpl10l open reading frame was amplified using primers pmRpl10l-FW and pmRpl10l-RV. Mouse Rpl10 CDS was cloned from total RNAs extracted from testis by RT-PCR with primers mRPL10-FW and mRPL10-RV. The backbone sequence was amplified from pmCherry-N1, which was modified from pEGFP-N1 with primers mCherry-BB-FW and mCherry-BB-RV. To remove the ApaLI site in mCherry, a synonymous mutation (GTA) was introduced to replace the codon (GTG) of amino acid 21 of mCherry. The pST1374-NLS-flag-linker-Cas9 (Addgene, 44758) [49], pUC57-sgRNA (Addgene, 51132) [50] and pGL3-U6-sgRNA-PGK-puromycin (Addgene, 51133) [50] vectors were kind gifts from Prof. Xingxu Huang. To generate sgRNA expression plasmids, paired synthetic oligonucleotides were annealed and cloned into the BsaI site of pUC57-sgRNA or pGL3-U6-sgRNA-PGK-puromycin vector. The Takara PrimeStar system (R044A) was used for PCR. All plasmids were validated by Sanger sequencing. Primers for plasmids construction and sgRNA listed in Table S4. Transfection and RNAi Cells were passaged 2-3 times after thawing and should be transfected at 70%–80% confluency. Transfection of plasmid or siRNAs was performed using lipofectamine 3000 (Invitrogen). The target sequence of the human RPL10 siRNA was 50 -GTCATCCGCATCA ACAAGAT-30 . RNA extraction, RT-PCR and qPCR Total RNAs were extracted using TRIzol reagents (Takara, 9109) and cDNAs were synthesized from total RNAs using the PrimeScript RT reagent kit (TaKaRa, RR047A) according to the manufacturer’s protocol. EasyTaq DNA Polymerase (TransGen Biotech, AP111) was used for RT-PCR. The PCR reactions were performed using the following cycle conditions: 3 min at 94 C, followed by 2530 cycles of 30 s at 94 C, 30 s at 60 C, and 30 s at 72 C. FastStart Universal SYBR Green Master (Rox) (Roche, 04913850001) was used for quantitative real-time PCR in a StepOne Real Time PCR System (Applied Biosystems). The PCR reactions were performed using the following cycle conditions: 10 s at 95 C, followed by 40 cycles of 5 s at 95 C, and 30 s at 60 C. The gene encoding betaActin (Actb) was used as an internal control. Changes in gene expression were determined using the comparative CT method. Primers for RT-PCR and qPCR listed in Table S4. Ribosome purification Ribosome purification was performed as previously described [53]. In brief, 1 3 107 cultured human cells or 5 3 106 purified late prophase spermatocytes of mice were harvested and resuspended in 300 mL buffer A (250 mM sucrose, 250 mM KCl, 5 mM MgCl2, and 50 mM Tris-HCl (pH 7.4)) containing 5mM PMSF and 50U RNase OUT, and lysed in 0.7% NP-40 for 15 min on ice. Nuclei and Current Biology 27, 1–8.e1–e6, May 22, 2017 e3


mitochondria were removed by two successive centrifugations at 750 3 g and 12000 3 g, respectively. The concentration of KCl in the supernatants was adjusted to 500 mM, and samples were deposited above a 1 M sucrose cushion containing 500 mM KCl. Ribosome pellets were obtained after ultracentrifugation at 75,000 rpm for 2 hr at 4 C in a TL100.3 ultracentrifuge (Beckman) and resuspended in 1 3 SDS sample buffer, boiled for 10 min, and analyzed by western blot. Protein samples and western blot analysis Cells were washed with ice-cold PBS and lysed in 1 3 SDS sample buffer (100 mM Tris-HCl pH 7.4, 2% SDS, 15% glycerol, 0.1% bromophenol blue and 5 mM dithiothreitol [DTT]). Cell lysates were denatured for 10 min and analyzed by western blot. Protein samples were separated by SDS-PAGE and transferred to 0.45 mm pore size immobilon-P membranes (Millipore, IPVH00010) using a Tanon vertical electrophoresis and blotting apparatus (Tanon). Membranes were blocked in TBST buffer (50 mM Tris, pH 7.4, 150 mM NaCl and 0.5% Tween-20) containing 5% nonfat milk for 1 hr and incubated with primary antibodies diluted in TBST buffer containing 5% nonfat milk at 4 C overnight. Following incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam) for 1 hr, western blots were developed with chemiluminescence (GE Healthcare, ImageQuant LAS 4000). Primary antibodies were: anti-RPL10 (Novus Biological, NBP1-84037), anti-RPL4 (Proteintech, 11302-1-AP), anti-RPL11 (Proteintech, 16277-1-AP), anti-RPL19 (Proteintech, 14701-1-AP), anti-RPL31 (Proteintech, 16497-1-AP), anti-RPS3 (Proteintech, 11990-1-AP), anti-RPS15 (Proteintech, 14957-1-AP), anti-NEK2 (Proteintech, 24171-1-AP), anti-HSPA2 (Proteintech, 127971-AP), anti-CCNA1 (Proteintech, 13295-1-AP), anti-CKS2 (Proteintech, 15616-1-AP), anti-PLK1 (Abcam, ab17056), anti-b-actin (Abcam, ab8227) and Anti-mouse RPL10L [35]. Polysome profiling analysis Polysome profiling analysis was performed as described previously [54]. Briefly, cultured cells were treated with 100 mg/ml cycloheximide for 5 min at 37 C in 5% CO2, then washed twice with 10 mL of ice-cold 1 3 PBS containing 100 mg/ml cycloheximide. The cells were scraped off gently in 5 mL of ice-cold 1 3 PBS containing 100 mg/ml cycloheximide and were collected by centrifugation at 200 3 g for 5 min at 4 C. After resuspension in 425 mL of hypotonic buffer (5 mM Tris-HCl (pH 7.5), 2.5 mM MgCl2, 1.5 mM KCl and 1 3 Protease inhibitor cocktails), lysates were centrifuged at 16,000 3 g for 7 min at 4 C. Supernatants were applied to a 10%–50% sucrose gradient (containing 10 mg/ml cycloheximide, 0.1 3 Protease inhibitor cocktails and 10 units/ml RNasin) and centrifuged in a SW41 rotor at 40,000 rpm for 2 hr at 4 C. Analysis and fractionation of polysome profiles was performed using a Density Gradient Fractionation Systems (Teledyne ISCO). Flow cytometry Cells were collected and incubated in 70% ice-cold methanol for 30 min, treated with RNase A (ThermoFisher, EN0531) and stained with propidium iodide (ThermoFisher, P1304MP), followed by analysis using a FACS Calibur flow cytometer (BD). Separation of mouse spermatogenic cells Spermatogenic cell populations were isolated using the STA-PUT method based on sedimentation velocity at unit gravity as previously described [26, 27]. Spermatogonia were isolated from 8 dpp mice. Preleptotene cells, leptotene and zygotene spermatocytes, and puberal pachytene spermatocytes were isolated from 18 dpp mice. Adult pachytene spermatocytes and round spermatids were isolated from adult mice (50-70 dpp). Fertility test Three adult males of each genotype were used for fertility test. Each male was mated with three wild-type C57BL/6 females. All the females were monitored for pregnancy. Litter dates, number of pups and sex ratios were recorded for all the resulting litters. Histology Testis sections were prepared as described [23]. For histological analysis, testes were fixed in 4% paraformaldehyde or Bouin’s fixative overnight at 4 C. Samples were dehydrated through a graded series of ethanol, embedded in paraffin, serially sectioned, and stained with hematoxylin and eosin or periodic acid-Schiff. Slides were examined by light microscopy. Sperm counting Male mice were sacrificed by cervical dislocation. Epididymides, along with the vas deferens, were dissected and cut into small pieces in a tube containing 1 mL Dulbecco’s Modified Eagle Medium (DMEM). Sperm were allowed to release into the medium during incubation at 37 C in a 5% CO2 humidified incubator for 30 min. Sperm counts were determined using a hemocytometer. Meiotic delay assay Meiotic preparations were made as previously described [23]. Briefly, single-cell suspensions were prepared from isolated seminiferous tubule fragments in 2.2% (w/v) trisodium citrate dihydrate (isotonic solution) and centrifuged for 10 min at 800 rpm, followed by treatment with 0.9% (w/v) trisodium citrate dihydrate (hypotonic solution) for 12 min at 37 C and fixation in Carnoy’s solution (75% methanol, 25% acetic acid) at 4 C. After three washes in fixative, chromosome preparations were made by dropping the cell

e4 Current Biology 27, 1–8.e1–e6, May 22, 2017


suspension onto cold slides. Slides were dried and stained with Giemsa. To determine meiotic delay, first meiotic metaphases (MMI) were counted in slide areas in which 1000 mid-pachytene nuclei were counted. Spermatocyte micro-spreading and immunostaining Spermatocyte chromosome preparations and immunofluorescence were performed as described previously [22, 55], with the following modifications. Slides were either used for immunofluorescence staining immediately or stored at 80 C. For immunofluorescence, slides were blocked for 30 min with 1 3 phosphate-buffered saline (PBS) containing 3% nonfat milk. Slides were then incubated with primary antibodies against synaptonemal complex protein 3 (SYCP3) (Abcam, ab97672), gH2AX (Novus Biologicals, NB100-384), PLZF (H-300) (Santa Cruz, sc-22839) overnight at room temperature in a humidified chamber. Slides were then washed four to five times in 1 3 PBS containing 0.1% Triton X-100. Secondary antibodies (Alexa Fluor 488 Goat anti-Mouse IgG and Alexa Fluor 555 Donkey anti-Rabbit IgG, Invitrogen) were applied for 1 hr at 37 C in a humidified chamber. Both primary and secondary antibodies were diluted in 1 3 PBS containing 3% nonfat milk. After secondary antibody incubation, four to five washes were performed in PBST (1 3 PBS containing 0.1%Triton X-100) and the slides were mounted with VECTASHIELD mounting medium (H-1000, Vector Laboratories). Images were captured using a BX61 microscope (Olympus) connected to a CCD camera and analyzed using the Image-Pro Plus software (Media Cybernetic). TUNEL assay Testis sections were deparaffinized using standard methods (xylene, absolute, 95, 90, 80, and 70% ethanol and sterile water) and permeabilized with proteinase K (20 mg/ml) in 10 mM Tris-HCl (pH 7.5) for 15 min at room temperature. After two washes with 1 3 PBS, sections were blocked with 3% BSA and 10% normal donkey serum in 10 mM Tris-HCl (pH 7.5) for 30 min. Thirty ml of TUNEL reagent mix (In Situ Cell Death Detection Kit, Fluorescein, Roche, 11684795910) were applied to each slide followed by incubation for 60 min at 37 C according to the manufacturer’s protocol. Sections were then washed with PBST (0.1% Triton X-100 in 1 3 PBS) four times and mounted in VECTASHIELD mounting medium (H-1000, Vector Laboratories) containing Hoechst 33342 (Invitrogen, H21492). Images were captured using a Nikon ECLIPSE 80i microscope (Nikon) connected to a CCD camera (Hamamatsu) and analyzed using the NIS-Element Microscope imaging software (Nikon). Immunostaining of testis sections Immunostaining of testis sections was performed as described previously [23], with the following modifications. Testes were fixed in 4% paraformaldehyde for 6 hr, dehydrated in 30% sucrose (w/v) for at least 8 hr and embedded in OCT (Sakura Finetek, CA). Seven mm-thick sections were fixed for 20 min in pre-cold 4% paraformaldehyde (w/v) at room temperature and then washed twice in PBST (0.1% Triton X-100 in 1 3 PBS). Sections were blocked in antibody dilution buffer (ADB) (10% normal donkey serum, 3% bovine serum albumin (BSA), 0.05% Triton X-100 in phosphate-buffered saline [PBS]) for 30 min, followed by an overnight incubation at 4 C with primary antibodies against mCherry (Abcam, ab167453) and gH2AX (EMD Millipore, clone JBW301, 05-636), or Lectin PNA (Alexa Fluor 568 Conjugate, Invitrogen, L32458). Four washes with PBST were performed prior to secondary antibody incubation (Alexa Fluor 488 Goat anti-Mouse IgG and Alexa Fluor 555 Donkey anti-Rabbit IgG, Invitrogen) at 37 C for 1 hr. Finally, sections were mounted in VECTASHIELD mounting medium (H-1000, Vector Laboratories) containing Hoechst 33342 (Invitrogen, H21492). Images were captured using a Nikon ECLIPSE 80i microscope (Nikon) equipped with a CCD camera (Hamamatsu) and analyzed using NIS-Element Microscope imaging software (Nikon). QUANTIFICATION AND STATISTICAL ANALYSES Quantitative proteomic analysis Late prophase spermatocytes isolated from adult Rpl10l+/+ and Rpl10l/ mice were used for proteomic analysis by PTM Biolab (Hangzhou, China). Briefly, proteins were extracted from the samples by sonication in lysis buffer (8 M urea, 2 mM EDTA, 10 mM DTT and 1% Protease Inhibitor Cocktail) followed by precipitation with cold 15% TCA for 4 hr at 20 C. Approximately 100 mg protein from each sample was digested with trypsin for the following experiments. After digestion, peptides were labeled using the 6-plex TMT kit according to the manufacturer’s protocol (Rpl10l+/+-126, Rpl10l+/+-127, Rpl10l+/+-128, Rpl10l/-129, Rpl10l/-130 and Rpl10l/-131). The peptide mixtures were fractionated by high pH reverse-phase HPLC using an Agilent 300 Extend C18 column (5 mm particles, 4.6 mm ID, 250 mm length) and combined into 18 fractions. Peptide fractions were then analyzed using a Q ExactiveTM hybrid quadrupole-Orbitrap mass spectrometer (ThermoFisher Scientific). The resulting MS/MS data were processed using the Mascot search engine (v.2.3.0). Tandem mass spectra were searched against the swissprot Mus musculus database. Trypsin/P was specified as cleavage enzyme allowing up to 2 missing cleavages. Mass error was set to 10 ppm for precursor ions and 0.02 Da for fragment ions. Carbamidomethylation of Cys was specified as fixed modification and oxidation of Met was specified as variable modification. For protein quantification, TMT 6-plex was selected in Mascot. FDR was adjusted to < 1%, peptide ion score was set R 20, p value was set < 0.05 and only proteins identified with at least two unique peptides were accepted. The downregulated and upregulated proteins in late prophase Rpl10l/ versus Rpl10l+/+ spermatocytes are listed in Table S2.

Current Biology 27, 1–8.e1–e6, May 22, 2017 e5


Statistical analysis Results are presented as mean ± SEM. All statistical analyses were performed using Student’s t test. p values less than 0.05 were considered to be statistically significant. The following indications were used throughout the manuscript: *p < 0.05, **p < 0.01, ***p < 0.001, NS, p > 0.05. DATA AND SOFTWARE AVAILABILITY The online CRISPR DESIGN tool provided by Zhang’s lab at MIT (http://crispr.mit.edu/) was used to design sgRNA for gene editing. The genome sequences and information of targeted genes were searched from the Ensembl genome browser database (http://asia. ensembl.org/index.html). The information listed in Table S1 was searched from the NCBI Gene database (http://www.ncbi.nlm.nih. gov/gene).

e6 Current Biology 27, 1–8.e1–e6, May 22, 2017

Current Biology, Volume 27

Supplemental Information

RPL10L Is Required for Male Meiotic Division by Compensating for RPL10 during Meiotic Sex Chromosome Inactivation in Mice Long Jiang, Tao Li, Xingxia Zhang, Beibei Zhang, Changping Yu, Yang Li, Suixing Fan, Xiaohua Jiang, Teka Khan, Qiaomei Hao, Peng Xu, Daita Nadano, Mahmoud Huleihel, Eitan Lunenfeld, P. Jeremy Wang, Yuanwei Zhang, and Qinghua Shi

M ar k R er pl 1 St 0l+/ ra + in St 1 ra in 2

293T HCT116 Hela U-2 OS A549 Human testis H2O

CF + CR

Strain 2

RPL10L ACTB

B

CF

D Strain 1

C

A

Δ70 bp

Δ59 bp

CR

Mouse Rpl10l gene locus PAM

PAM

Target (sgRNA 1)

Target (sgRNA 2)

Reference 5’ TGTCGCCATGGGTCGTCGTCCGGCTCGCTGTTACCGGTACTGTAAGAACAAGCCGTACCCAAAGTCCCGTTTCTGCCGAGGCGTCCCCG 3’ 3’ ACAGCGGTACCCAGCAGCAGGCCGAGCGACAATGGCCATGACATTCTTGTTCGGCATGGGTTTCAGGGCAAAGACGGCTCCGCAGGGGC 5’ Strain 1 (Δ70) 5’ TGTCG‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐CCGAGGCGTCCCCG 3’

Strain 2 (Δ59) 5’ TGTCGCCATGGG‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐TCTGCCGAGGCGTCCCCG 3’ Start codon

G

Testis

Cauda epididymis

RPL10L β-Actin

Strain 1

R pl 1 St 0l+/ ra + in St 1 ra in 2

E

Strain 2

R pl 10 l+ /+ St ra in St 1 ra in 2

F

1 mm

Figure S1. Rpl10l plays an essential role in mouse spermatogenesis. Related to Figure 1. (A) RT-PCR analysis of RPL10L expression in human cell lines and testis tissue. (B-D) Knockout strategy and genotyping of Rpl10l mutant mice. Diagram of the mouse Rpl10l locus based on Ensembl data (transcript ENSMUST00000081908), with blue and white bars representing coding exon and noncoding regions, respectively. The green ATG is the start codon of Rpl10l. PAM, protospacer adjacent motif. CF and CR, genotyping primers (B). Two mutant mouse strains with deletions in Rpl10l (Δ70 bp and Δ59 bp) were confirmed by PCR (C) and Sanger sequencing (D). (E) Western blot analysis of RPL10L expression in testes from adult mice of the indicated genotypes. (F-G) Testis morphology (F) and H&E stained testicular and epididymal sections (G) from adult mice of the indicated genotypes. Scale bars in (G) represent 50 μm. Data are representative of at least two independent experiments in (A, C-G).

E

Rpl10l-/-

Rpl10l+/+

Rpl10l-/-

Rpl10l+/+

Rpl10l-/-

Brightfield

Rpl10l+/-

15 dpp

Pachytene spermatocytes Diplotene spermatocytes Other cells

140 120 100 80 60 40 20 0

C

H

Rpl10l-/-

D

TUNEL / Hoechst

100

Number of apoptotic cells per tubule

Rpl10l+/-

% of tubules containing apoptotic cells

B

80

***

60 40

R pl 10 l+ /+ R pl 10 l- / -

R pl 10 l+ /

+

27 dpp

Percentage of the isolated late prophase spermatocytes

G

I

R pl 10 l+ /+ R pl 10 l-/ -

21 dpp

SYCP3 / γH2AX/ Hoechst

F

R pl 10 l-/ -

A

NEK2

RPL19

HSPA2

RPL31

CCNA1

RPS15

PLK1

RPS3

CKS2

β-Actin

20 0

Rpl10l+/- Rpl10l-/(n=367) (n=508) 3

***

2 1 0 Rpl10l+/- Rpl10l-/(n=367) (n=508)

β-Actin

Figure S2. Rpl10l is required for meiotic progression during spermatogenesis. Related to Figure 2. (A) PAS-stained testicular sections from Rpl10l+/- and Rpl10l-/- mice at postnatal days (dpp) 15, 21 and 27. Black arrowheads indicate metaphase spermatocytes; red arrowheads indicate spermatocytes with highly condensed chromatin. (B-D) TUNEL assay on testis sections from adult Rpl10l+/- and Rpl10l-/- mice. Red, TUNEL-positive cells. Nuclei were counterstained with Hoechst 33342 (blue). (E-G) Cellular morphology (E), immunostaining (F) and purity (G) of late prophase spermatocytes isolated from adult Rpl10l+/+ and Rpl10l-/- mice. (H-I) Western blot analysis of proteins required for the first meiotic division (H), and of the indicated ribosomal proteins (I) in cell lysates from late prophase spermatocytes of Rpl10l+/+ and Rpl10l-/- mice. See also Table S2 or Table S3. Data are representative of at least two independent experiments in (A, E-I), representative of four independent experiments in (B), and are presented as mean±SEM of four mice with similar numbers of tubules scored per animal in (C and D; n, total number of tubules that were scored). ***p < 0.001. Scale bars represent 20 μm in (A), (E) and (F), and 50 μm in (B).

Rpl10 Actb

C

SG

pPD

% of total cells

N C

A254

NC siRNA

60S 40S 80S

RPL10

Polysome

RPL11 Sedimentation

A254

RPL10 siRNA

RPL31

40S 60S 80S

0.6 0.4 0.2 0.0

SG (69.5%)

PL (77.5%)

LZ (83.5%)

SYCP3 / γH2AX / Hoechst




PNA / Hoechst

100 80

NC siRNA RPL10 siRNA

***

60

I

(1) (2) (3) RPL10-EGFP

***

40

Endogenous RPL10

*

20 0

RS (86.3%)

aPD (84.8%)

G0/G1

S

β-Actin

G2/M

Stably expressing Tet-On inducible RPL10-EGFP RPL10-WT RPL10-KO + Doxycycline - Doxycycline + Doxycycline - Doxycycline

RPS3 Polysome

RPS15 β-Actin

Sedimentation

J

H

RPL19

0.8

pPD (87.0%)

G si R N R PL A 10 si R N A

F

Male Female

1.0

PLZF / Hoechst

RS

aPD

E

D

LZ

PL

1.2

H ea rt Li ve Sp r le en Lu n Ki g dn e M y us cl e Br ai n Te st i O s va ry

B

Female

Heart Liver Spleen Lung Kidney Muscle Brain Testis H2O Heart Liver Spleen Lung Kidney Muscle Brain Ovary

Male

Relative mRNA level of Rpl10 (normalized to Actb)

A

(1)

Stably expressing Tet-On inducible RPL10L-EGFP RPL10-WT RPL10-KO + Doxycycline - Doxycycline + Doxycycline - Doxycycline

(2)

K

(3)

(a) (b) (c) RPL10L-EGFP Endogenous RPL10

(a)

(b)

(c)

β-Actin

Figure S3. RPL10 plays a housekeeping role in ribosome biogenesis and cell proliferation and can be replaced by ectopically expressed RPL10L in cultured human cells. Related to Figure 3. (A-B) RT-PCR (A) and quantitative real-time PCR (B) analysis of Rpl10 expression in tissues from adult mice. (C-D) Cellular morphology (C), immunostaining and purity (%) (D) of spermatogenic cell populations purified from testes of mice. SG, spermatogonia (Type A); PL, preleptotene spermatocytes; LZ, leptotene plus zygotene spermatocytes; pPD, pubertal pachytene plus diplotene spermatocytes; aPD, adult pachytene plus diplotene spermatocytes; RS, round spermatids. Scale bars represent 10 μm. These cells were used in Figure 3A. (E) Polysome profiles from extracts of A549 cells transfected with the indicated siRNAs for 48 h. NC, nonsense control. (F) Western blot analysis of RPL10 and other ribosomal proteins in A549 cells transfected with the indicated siRNAs for 48 h. NC, nonsense control. (G) Flow cytometric cell cycle analysis of A549 cells transfected with the indicated siRNAs for 48 h. NC, nonsense control. (H) Representative images of crystal violet stained 293T cells stably expressing of inducible RPL10EGFP that with wild-type (WT) or knockout (KO) endogenous RPL10 as indicated after doxycycline (500 ng/ml) or 1×PBS (phosphate-buffered saline) treatment for 10 days. Per plate, 500 cells were seeded prior to treatment. (I) Western blot analysis of RPL10 in lysates of cells (1)-(3) shown in Figure S3H. (J) Representative images of crystal violet stained 293T cells stably expressing of inducible RPL10LEGFP that with wild-type (WT) or knockout (KO) endogenous RPL10 as indicated after doxycycline (500 ng/ml) or 1×PBS (phosphate-buffered saline) treatment for 10 days. Per plate, 500 cells were seeded prior to treatment. (K) Western blot analysis of RPL10 or RPL10L in lysates from cells (a)-(c) shown in Figure S3J. Data are representative of two independent experimentsin (A, C-F, H-K) and from three independent experiments with biological duplicates in (B, mean±SEM of n=6). Data are presented as mean±SEM of three independent experiments in (G). *p < 0.05, ***p < 0.001. The RPL10 antibody (Novus Biological, NBP1-84037) used in (F), (I) and (K) recognizes both RPL10 and RPL10L.

A

B 2 kb

Transgenic construct

C

Male

Female

Heart Liver Spleen Lung Kidney Muscle Brain Testis H2O Heart Liver Spleen Lung Kidney Muscle Brain Ovary

Mouse Rpl10l gene locus

Rpl10mCherry

Rpl10l Mouse Linker Promoter Rpl10 CDS mCherry SV40pA

Actb

RPL10-mCherry

γH2AX

RPL10-mCherry / γH2AX / Hoechst

D

Pups per litter

10

*

8 6 4 2

TG

R pl 10 R -m p C l10 he l+ R pl rry /-; 10 T -m Rp G C l10 he l rry -/-;

0

E

F

Rpl10l-/-;Rpl10-mCherryTG

Rpl10l-/-;Rpl10-mCherryTG

★

★

★

★

RPL10-mCherry / Hoechst

Figure S4. Transgenic expression of Rpl10-mCherry under the control of the Rpl10l promoter partly rescues spermatogenesis and fertility in Rpl10l-deficient male mice. Related to Figure 4. (A) Transgenic strategy for Rpl10-mCherry expression in mice. (B) RT-PCR analysis of Rpl10-mCherry expression in tissues from adult transgenic mice. (C) Immunostaining for mCherry (red) and γH2AX (green) in testicular sections from adult transgenic mice. (D) Litter sizes in mating tests of male mice of the indicated genotype. These males were F1 generation of intercrosses between Rpl10l-/-;Rpl10-mCherryTG males and Rpl10l+/- females. Each male was mated with three wild-type females. Each dot represents one litter. (E-F) H&E staining (E) and immunostaining for mCherry (F) in testicular sections of 12-week-old Rpl10l-/-;Rpl10-mCherryTG mice. Black asterisks in (E) mark abnormal seminiferous tubules. White asterisks in (F) indicate seminiferous tubules lacking RPL10-mCherry expression. Data are representative of two or three independent experiments in (B-C, E-F) and are presented as mean±SEM of scored litters from three males per genotype in (D). Scale bars in (C), (E), and (F) represent 50 μm.

List number

Taxonomy ID

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33

9483 9541 9544 9555 9593 9597 9598 9601 9606 9615 9685 9796 9913 9940 9986 10090 10116 60711 9823 61853 79684 9925 29073 29078 1230840 9371 9531 9545 9568 9646 9669 9733 9785

Organism name Callithrix jacchus Macaca fascicularis Macaca mulatta Papio anubis Gorilla gorilla Pan paniscus Pan troglodytes Pongo abelii Homo sapiens Canis lupus familiaris Felis catus Equus caballus Bos taurus Ovis aries Oryctolagus cuniculus Mus musculus Rattus norvegicus Chlorocebus sabaeus Sus scrofa Nomascus leucogenys Microtus ochrogaster Capra hircus Ursus maritimus Eptesicus fuscus Orycteropus afer afer Echinops telfairi Cercocebus atys Macaca nemestrina Mandrillus leucophaeus Ailuropoda melanoleuca Mustela putorius furo Orcinus orca Loxodonta africana

Gene ID 100398751 101925609 702986 101022111 101125892 100987659 467447 100454738 140801 490672 101089777 100064278 538748 101120838 100347681 238217 299106 103228917 100514266 100585361 101983368 102170700 103665627 103294932 103199421 101663883 105599030 105481881 105546542 100481204 101693135 101279300 100662375

RPL10L Chromosome 10 7 7 7 14 14 14 14 14 8 B3 1 10 7 17 12 6 24 1 1a 1 10 Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

Exon count 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 2 1 Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

Gene ID 100415355 101867181 700795 100137264 101136536 100982236 465944 100172946 6134 481085 101083663 100146244 286790 106990097 100328757 110954 81764 103247433 733593 100598425 102002915 102184991 103679662 103302228 103211225 101650631 105579731 105467951 105534269 100468790 101690567 101275068 100674477

RPL10 Chromosome X X X X X X X X X X X X X X X X X X 15 X Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

Exon count 6 6 8 6 8 7 6 7 7 6 6 6 6 6 Unknown 7 7 5 Unknown 8 Unknown Unknown 6 6 6 Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64

9793 9837 9838 9978 9994 10020 27679 30538 30611 32536 34839 37293 42254 43179 51337 59463 61622 73337 74533 109478 127582 132908 143302 225400 230844 291302 336983 61621 9974 885580 9708

Equus asinus Camelus bactrianus Camelus dromedarius Ochotona princeps Marmota marmota marmota Dipodomys ordii Saimiri boliviensis Vicugna pacos Otolemur garnettii Acinonyx jubatus Chinchilla lanigera Aotus nancymaae Sorex araneus Ictidomys tridecemlineatus Jaculus jaculus Myotis lucifugus Rhinopithecus roxellana Ceratotherium simum simum Panthera tigris altaica Myotis brandtii Trichechus manatus latirostris Pteropus vampyrus Condylura cristata Myotis davidii Peromyscus maniculatus bairdii Miniopterus natalensis Colobus angolensis palliatus Rhinopithecus bieti Manis javanica Fukomys damarensis Odobenus rosmarus divergens

106827669 105078450 105086460 101523357 107145171 105982631 101027564 102544369 100947886 106985084 102005675 105719923 101542145 101955214 101610563 102423387 104672121 101402461 102956357 102243966 101342791 105302820 101635893 102763186 102906432 107529553 105515282 108540502 108396582 104868007 101365419

Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

106826659 105076062 105106491 101525563 107160308 106000161 101040117 102535899 100954483 106987320 102028809 105727260 101539056 101975002 101601105 102442647 104667036 101394276 102957760 102257301 101344695 105302495 101631323 102751929 102923570 107544155 105521640 108518769 108408740 104872587

Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

Table S1. RPL10L orthologs and their corresponding RPL10 paralogs. Related to Figure 1C and STAR Methods heading "DATA AND SOFTWARE AVAILABILITY".

List number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35

Protein accession P47964 P62900 Q9CZX8 P62858 P83882 P62843 P62270 P97461 P63276 Q6ZWN5 P62751 P47955 P62281 P62911 P84099 O09167 P62855 P14131 Q9JJI8 P47963 P62908 P63323 P62267 P62849 O55142 Q9CPR4 P62242 P62754 P62717 P62274 P62264 P97351 P62301 P62889 Q9CZM2

Protein description 60S ribosomal protein L36 60S ribosomal protein L31 40S ribosomal protein S19 40S ribosomal protein S28 60S ribosomal protein L36a 40S ribosomal protein S15 40S ribosomal protein S18 40S ribosomal protein S5 40S ribosomal protein S17 40S ribosomal protein S9 60S ribosomal protein L23a 60S acidic ribosomal protein P1 40S ribosomal protein S11 60S ribosomal protein L32 60S ribosomal protein L19 60S ribosomal protein L21 40S ribosomal protein S26 40S ribosomal protein S16 60S ribosomal protein L38 60S ribosomal protein L13 40S ribosomal protein S3 40S ribosomal protein S12 40S ribosomal protein S23 40S ribosomal protein S24 60S ribosomal protein L35a 60S ribosomal protein L17 40S ribosomal protein S8 40S ribosomal protein S6 60S ribosomal protein L18a 40S ribosomal protein S29 40S ribosomal protein S14 40S ribosomal protein S3a 40S ribosomal protein S13 60S ribosomal protein L30 60S ribosomal protein L15

Gene name Rpl36 Rpl31 Rps19 Rps28 Rpl36a Rps15 Rps18 Rps5 Rps17 Rps9 Rpl23a Rplp1 Rps11 Rpl32 Rpl19 Rpl21 Rps26 Rps16 Rpl38 Rpl13 Rps3 Rps12 Rps23 Rps24 Rpl35a Rpl17 Rps8 Rps6 Rpl18a Rps29 Rps14 Rps3a Rps13 Rpl30 Rpl15

Rpl10l -/- /Rpl10l +/+ ratio Rpl10l -/- /Rpl10l +/+ p value 0.625575725 0.0000192 0.648351648 0.00104469 0.668798665 0.000187435 0.684166199 0.0000456 0.688045007 0.0000655 0.689664883 0.000661864 0.693958216 0.00000951 0.695873375 0.0000589 0.695873375 0.0000151 0.70261067 0.0000348 0.703093954 0.00000588 0.703377803 0.0000456 0.707171315 0.00000267 0.709199658 0.0000805 0.722939994 0.000230418 0.732101617 0.000158687 0.739130435 0.002862944 0.740139211 0.0000238 0.740644038 0.0000449 0.740644038 0.001512279 0.741364296 0.00000401 0.742666279 0.000341722 0.748761294 0.0000269 0.749781277 0.00033247 0.751094252 0.0000136 0.751532847 0.003376503 0.752044393 0.000843665 0.758721782 0.000079 0.765744556 0.0000421 0.767825575 0.000101194 0.772525849 0.000221425 0.773573751 0.000019 0.774098167 0.000357621 0.775147929 0.00000963 0.783888228 0.0000996

Regulated type Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down (< 0.77) Down Down Down Down Down

36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69

P41105 P62702 P60867 P25444 P62082 P61358 P19253 Q9CQR2 P62245 P61255 P27659 Q9CXW4 P14148 P62830 P51410 P35980 P35979 Q9D1R9 P14115 Q8BP67 P53026 P14869 P12970 P47962 P63325 P47911 P61514 Q9D8E6 P14206 P67984 P62918 Q9CR57 P62983 P47915

60S ribosomal protein L28 40S ribosomal protein S4, X isoform 40S ribosomal protein S20 40S ribosomal protein S2 40S ribosomal protein S7 60S ribosomal protein L27 60S ribosomal protein L13a 40S ribosomal protein S21 40S ribosomal protein S15a 60S ribosomal protein L26 60S ribosomal protein L3 60S ribosomal protein L11 60S ribosomal protein L7 60S ribosomal protein L23 60S ribosomal protein L9 60S ribosomal protein L18 60S ribosomal protein L12 60S ribosomal protein L34 60S ribosomal protein L27a 60S ribosomal protein L24 60S ribosomal protein L10a 60S acidic ribosomal protein P0 60S ribosomal protein L7a 60S ribosomal protein L5 40S ribosomal protein S10 60S ribosomal protein L6 60S ribosomal protein L37a 60S ribosomal protein L4 40S ribosomal protein SA 60S ribosomal protein L22 60S ribosomal protein L8 60S ribosomal protein L14 Ubiquitin-40S ribosomal protein S27a 60S ribosomal protein L29

Rpl28 Rps4x Rps20 Rps2 Rps7 Rpl27 Rpl13a Rps21 Rps15a Rpl26 Rpl3 Rpl11 Rpl7 Rpl23 Rpl9 Rpl18 Rpl12 Rpl34 Rpl27a Rpl24 Rpl10a Rplp0 Rpl7a Rpl5 Rps10 Rpl6 Rpl37a Rpl4 Rpsa Rpl22 Rpl8 Rpl14 Rps27a Rpl29

0.78412132 0.78784267 0.78784267 0.788375559 0.803968731 0.806140879 0.810745548 0.81134923 0.812141347 0.815184513 0.815733737 0.819836215 0.822046766 0.825068451 0.82790131 0.828153565 0.830079317 0.830689445 0.842493092 0.845325953 0.847243609 0.848736907 0.857585139 0.857585139 0.860465116 0.861042184 0.864201367 0.865982587 0.874141162 0.878522229 0.898449858 0.901426307 1.092398884 1.277524677

0.000209628 0.001029593 0.000181524 0.000143957 0.0000141 0.000148388 0.002967669 0.000305398 0.000196408 0.000833797 0.001359643 0.001601991 0.00000326 0.000112934 0.000194796 0.002453143 0.0000682 0.00073962 0.00023044 0.000151771 0.000586474 0.0000101 0.0000648 0.000100996 0.001721173 0.011985561 0.0002054 0.0000428 0.000126147 0.001580554 0.00029467 0.002673552 0.002095343 0.000276405

Table S3. Quantitation of ribosomal proteins in late prophase Rpl10l -/- versus Rpl10l +/+ spermatocytes. Related to Figure 2E.

Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Up Up

Name

Sequence

Note

Source

phRPL10-FW

ACCGTATTACCGCCATGCATCTGAGATCACAGGCGTGAGC

phRPL10-RPL10-EGFP vector

This study

phRPL10-RV

GGCGACACCAGGATCTTCAG


This study

hRPL10-FW

CTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCCG


This study

hRPL10-RV

TCCTGCAGCTCCACCGCTCGATGAGTGCAGGGCCCGCCACT


This study

EGFP-BB-FW

TCGAGCGGTGGAGCTGCAGGAATGGTGAGCAAGGGCGAGGA


This study

EGFP-BB-RV

ATGCATGGCGGTAATACGGT


This study

phRPL10-FW

ACCGTATTACCGCCATGCATCTGAGATCACAGGCGTGAGC

phRPL10-RPL10L-EGFP vector

This study

phRPL10-RV

GGCGACACCAGGATCTTCAG


This study

hRPL10L-FW

CTGAAGATCCTGGTGTCGCCATGGGGCGCCGTCCAGCTCG


This study

hRPL10L-RV

TCCTGCAGCTCCACCGCTCGATGAGTGCAGAACCCGCCACT


This study

EGFP-BB-FW

TCGAGCGGTGGAGCTGCAGGAATGGTGAGCAAGGGCGAGGA


This study

EGFP-BB-RV


This study

pTRIPZ-RPL10-EGFP vector

This study

MluI-EGFP-RV

ATGCATGGCGGTAATACGGT CGCACCGGTCGCCACCATGGGCCGCCGCCCCGCCCGTTGTTA CCGATATTGTAAGA TAGGACGCGTTTACTTGTACAGCTCGTCCA

pTRIPZ-RPL10-EGFP vector

This study

AgeI-RPL10L-FW

CGCACCGGTCGCCACCATGGGGCGCCGTCCAGCTCG

pTRIPZ-RPL10L-EGFP vector

This study

MluI-EGFP-RV

TAGGACGCGTTTACTTGTACAGCTCGTCCA

pTRIPZ-RPL10L-EGFP vector

This study

pmRpl10l-FW

GATAACCGTATTACCGCCATTCCCTTCATCCTCTAATTCC

pmRpl10l-mRPL10-mCherry vector

This study

pmRpl10l-RV

GGCGACAGCAGGAACCTCAG


This study

mRPL10-FW

CTGAGGTTCCTGCTGTCGCCATGGGCCGCCGCCCCGCCCG


This study

mRPL10-RV

TCCTGCAGCTCCACCGCTCGAGGAATGCAGGGCTCTCCACT


This study

mCherry-BB-FW

Same with EGFP-BB-FW


This study

mCherry-BB-RV RPL10 -sg1-Top

Same with EGFP-BB-RV

pmRpl10l-mRPL15-mCherry vector Human RPL10 target sgRNA1

This study

CCGGACTACTTACCAGGGACACCT

RPL10 -sg1-Bottom

AAACAGGTGTCCCTGGTAAGTAGT

Human RPL10 target sgRNA1

This study

RPL10 -sg2-Top

CCGGAATCCTGCCTTACCTTCAG


This study

RPL10 -sg2-Bottom

AAACCTGAAGGTAAGGCAGGATT


This study

Rpl10l -sg1-Top

TAGGCGAGCCGGACGACGACCCA

Mouse Rpl10l target sgRNA1

This study

Rpl10l -sg1-Bottom

AAACTGGGTCGTCGTCCGGCTCG


This study

AgeI-RPL10-FW

This study

Rpl10l -sg2-Top

TAGGGGACGCCTCGGCAGAAAC


This study

Rpl10l -sg2-Bottom

AAACGTTTCTGCCGAGGCGTCC


This study

Rpl10l -Check-FW

TGGGCTTTCTTCGGCCTGAA

Genotyping for Rpl10l mutant mice

This study

Rpl10l -Check-RV

GCACGACAGCATCTTGTTGA

Genotyping for Rpl10l mutant mice

This study

Rpl10-mCherry

TG

-FW1

ACGGTTCCTGGCCTTTTGCT

Genotyping for Rpl10-mCherry transgene mice

This study

Rpl10-mCherry

TG

-RV1

GGATTTCTGAGTTCGAGGCC


This study

Rpl10-mCherry

TG

-FW2

GAGTTGTGGCAAGGATGGCT


This study

Rpl10-mCherry -RV2 Mouse Rpl10 FW

CCTTGCTCACCATTCCTGCA


This study

CAGGTCATCATGTCCATCCGAA

RT-PCR and qPCR

This study

Mouse Rpl10 RV

ACGATTTGGTAGGGTATAGGAGAAC

RT-PCR and qPCR

This study

Mouse Rpl10l FW

CATCGGCCAGGTCATCATGT

RT-PCR

This study

Mouse Rpl10l RV

CATCTGTACTTCTTTTCTGCCAGC

RT-PCR

This study

Mouse Actb FW

AGAAGAGCTATGAGCTGCCT

RT-PCR and qPCR

[S1]

Mouse Actb RV

TCATCGTACTCCTGCTTGCT

RT-PCR and qPCR

[S1]

Mouse Pgk2 FW

AAGTTTGATGAGAATGCTAAAGT

RT-PCR

[S1]

Mouse Pgk2 RV

CCTCCTCCTATAATGGTGACA

RT-PCR

[S1]

Mouse Prm1 FW

ACAAAATTCCACCTGCTCACA

RT-PCR

[S1]

Mouse Prm1 RV

GTTTTTCATCGGACGGTGGC

RT-PCR

[S1]

Mouse Tex11 FW

TATCAGATTCCCTGGAACTGG

RT-PCR

[S2]

Mouse Tex11 RV

GCACCCTCAAAACAAGCTATG

RT-PCR

[S2]

CAGGTCATCATGTCCATCCGAA

RT-PCR

This study

Rpl10-mCherry TG RV Human RPL10 FW

CCTTGCTCACCATTCCTGCA

RT-PCR

This study

AGGGTTCACATTGGCCAAGTT

RT-PCR

[S3]

Human RPL10 RV

TAAGAGGGGGGCAGCACA

RT-PCR

[S3]

Human RPL10L FW

GGGTCCACATTGGTCAAGTC

RT-PCR

[S3]

Human RPL10L RV

CCCAAGGAGACAGTACTGCC

RT-PCR

[S3]

Human ACTB FW

AATGAGCTGCGTGTGGCTC

RT-PCR

This study

HumanACTB RV

ATAGCACAGCCTGGATAGCAAC

RT-PCR

This study

TG

Rpl10-mCherry

TG

FW

Table S4. List of oligonucleotides used in this study. Related to Key Resources Table subheading “Oligonucleotides”.

Supplemental References S1.

Yang, F., Skaletsky, H., and Wang, P.J. (2007). Ubl4b, an X-derived retrogene, is specifically expressed in post-meiotic germ cells in mammals. Gene Expr Patterns 7, 131-136.

S2.

Wang, P.J., Page, D.C., and McCarrey, J.R. (2005). Differential expression of sex-linked and autosomal germ-cell-specific genes during spermatogenesis in the mouse. Hum Mol Genet 14, 2911-2918.

S3.

Rohozinski, J., Anderson, M.L., Broaddus, R.E., Edwards, C.L., and Bishop, C.E. (2009). Spermatogenesis associated retrogenes are expressed in the human ovary and ovarian cancers. PLoS One 4, e5064.