Netherlands and financed by Tate and Lyle Ingredients Americas. The Industrial. Microbiology section is part of the Kluyver Centre for Genomics of Industrial.
Metabolic engineering of Saccharomyces cerevisiae for C4-dicarboxylic acid production
Rintze Meindert Zelle 2011
Metabolic engineering of Saccharomyces cerevisiae for C4-dicarboxylic acid production Proefschrift
ter verkrijging van de graad van doctor aan de Technische Universiteit Delft, op gezag van de Rector Magnificus prof. ir. K.Ch.A.M. Luyben, voorzitter van het College voor Promoties, in het openbaar te verdedigen op maandag 21 maart 2011 om 15:00 uur
door
Rintze Meindert ZELLE
ingenieur in Life Science and Technology geboren te Delft.
Dit proefschrift is goedgekeurd door de promotor: Prof. dr. J.T. Pronk Copromotor: Dr. ir. A.J.A. van Maris Samenstelling promotiecommissie: Rector Magnificus, Prof. dr. J.T. Pronk, Dr. ir. A.J.A. van Maris, Prof. dr. ir. J.J. Heijnen, Prof. dr. C. Gancedo, Prof. dr. J.B. Nielsen, Prof. dr. J. van der Oost, Dr. M. Wubbolts, Prof. dr. J.H. de Winde,
voorzitter Technische Universiteit Delft, promotor Technische Universiteit Delft, copromotor Technische Universiteit Delft Universidad Autónoma de Madrid, Madrid, Spanje Chalmers University of Technology, Göteborg, Zweden Wageningen University DSM Technische Universiteit Delft, reservelid
The studies presented in this thesis were performed at the Industrial Microbiology section, Department of Biotechnology, Delft University of Technology, the Netherlands and financed by Tate and Lyle Ingredients Americas. The Industrial Microbiology section is part of the Kluyver Centre for Genomics of Industrial Fermentation, which is supported by the Netherlands Genomics Initiative. The cover shows the painting “A Woman Peeling Apples” (c. 1663) by the Dutch painter Pieter de Hooch, which is on display at the Wallace Collection in London, United Kingdom. ISBN 978-94-91211-05-8
Table of Contents Chapter 1............................................................................................... 7 Introduction
Chapter 2............................................................................................. 35 Malic acid production by Saccharomyces cerevisiae: engineering of pyruvate carboxylation, oxaloacetate reduction, and malate export
Chapter 3............................................................................................. 67 Key process conditions for production of C4-dicarboxylic acids in bioreactor batch cultures of an engineered Saccharomyces cerevisiae strain
Chapter 4............................................................................................. 89 Phospho-enol-pyruvate carboxykinase as the sole anaplerotic enzyme in Saccharomyces cerevisiae
Chapter 5...........................................................................................111 Anaplerotic role for cytosolic malic enzyme in engineered Saccharomyces cerevisiae strains
Summary............................................................................................131 Samenvatting.....................................................................................135 Curriculum Vitae – English ............................................................140 Curriculum Vitae – Nederlands......................................................141 List of Publications ..........................................................................142 Acknowledgements..........................................................................143
Chapter 1 Introduction Rintze M. Zelle, Derek A. Abbott, Jack T. Pronk, and Antonius J. A. van Maris Based on Abbott D. A., R. M. Zelle, J. T. Pronk, and A. J. A. van Maris. 2009. Metabolic engineering of Saccharomyces cerevisiae for production of carboxylic acids: current status and challenges. FEMS Yeast Research, December 2009, Vol. 9, No. 8, p. 1123-1136 (doi:10.1111/j.15671364.2009.00537.x)
Chapter 1
World marketed energy use by fuel type (in 1015 BTU)
8
Global energy use has grown steadily over the last several decades, and is expected to continue to do so for the foreseeable future (Fig. 1.1). Oil prices, temporarily lowered by the 2008-2009 global economic downturn, can be expected to increase again, driven by increasing demand, oil depletion, increasing cost of oil recovery, and the introduction of political instruments such as cap-and-trade to limit carbon dioxide emissions. The forecast of high oil prices has become a strong stimulus to find alternatives for oil in the production of commodity chemicals. Fortunately, chemicals produced from biomass-derived feedstocks via (bio)catalysis can often directly or functionally substitute for petroleum-derived chemicals. Both the United States Department of Energy and the European Commission-funded BREW project identified C4-dicarboxylic acids (malic, succinic and fumaric acid) as key chemical building blocks that can be derived from biomass (72, 115). These relatively simple acids can, at least in theory, be produced efficiently from sugars, while offering multiple functional groups that can be targeted in further enzymic or chemical catalysis. These C4-acids are currently mainly produced by petrochemistry for use in the food and pharmaceutical industries. If biotechnological production of these platform chemicals can be realized at a commercial scale, their market size is anticipated to grow by over 10-fold, to annual volumes of hundreds of thousands metric tons (65, 89). In order to compete with petrochemistry, a microbial production process must meet challenging requirements in terms of product yield on substrate,
250
history
projections
Liquids Coal
200
Natural Gas
150
Renewables
100 50 0 1990
Nuclear
2000
2010
2020
2030
Year Figure 1.1 Historic and projected global energy use by fuel type. Data from the International Energy Outlook 2010 of the U.S. Energy Information Administration (1).
Introduction productivity and titers. Since these demands generally differ from the selective pressures that microorganisms have faced during their evolutionary history in natural environments, microbial strain improvement is a key element in the design and optimization of biotechnological processes. Traditionally, microbial strain improvement has relied heavily on “classical” methods [e.g. the use of non-targeted mutagenesis, combined with high-throughput analysis to select for betterperforming mutants (106)]. While classical strain improvement continues to be of great importance in industrial biotechnology, it is increasingly being complemented by metabolic engineering. This targeted approach for microbial strain improvement has been defined as “the improvement of cellular activities by manipulation of enzymatic, transport, and regulatory functions of the cell with the use of recombinant DNA technology” (8). Microbial fermentation is already used for the commercial production of the organic acids citrate, lactate and acetate (89). The microorganisms used in these processes (respectively Aspergillus niger, lactic acid and acetic acid bacteria) are natural producers, although production strains are generally heavily optimized. Natural producers have been also been identified for C4-dicarboxylic acids: succinate producers include Actinobacillus succinogenes, Anaerobiospirillum succiniciproducens and Mannheimia succiniproducens (97), fumarate is formed by various Rhizopus species (87), and malate is produced by several fungi (116), foremost Aspergillus flavus (9, 74). However, none of these organisms are currently used in industry. Although these natural producers may seem logical starting points for strain improvement, secondary strain properties often prove problematic. Some prokaryotes have complex medium requirements, which increase medium cost and complicate downstream processing. Furthermore, prokaryotic organisms are generally unable to grow and produce organic acids at the low pH values where these compounds occur predominantly in their undissociated form (malate: pKa = 3.40, 5.11; succinate: pKa = 4.21, 5.64; fumarate: pKa = 3.02, 4.38). Although fermentations can be performed at a high pH by base addition, the fermentation broth often has to be acidified again in downstream processing, which results in significant byproduct formation (e.g. gypsum). Filamentous fungi, such as Aspergillus species, can be difficult to cultivate because their morphology can strongly affect growth and production characteristics. Moreover, the malate-producing A. flavus can produce aflatoxins, presenting additional problems in process and product safety (26, 43). These restrictions provide strong incentives to integrate and optimize C4-acid production pathways in other, more flexible microorganisms via metabolic engineering approaches. The two main “platform” microorganisms used for metabolic engineering are Escherichia coli (32, 95, 114) and Saccharomyces cerevisiae (68, 69). These
9
Chapter 1
10
microorganisms also serve as popular laboratory models for fundamental research on prokaryotes and eukaryotes, respectively. As a consequence, these two species share an excellent accessibility to genetic modification, and their physiology and genomes have been extensively characterized. Over the last decade, E. coli has received a remarkable amount of attention as a platform for succinate production (20, 22, 28, 46, 48, 51, 52, 55, 98, 99, 111, 112, 117, 118), although malic acid production has been targeted as well (51, 67). While engineering of E. coli for succinic acid production has proven successful on a laboratory scale, with yields close to the theoretical maximum, cultivation of E. coli requires a near-neutral pH (113). As such, S. cerevisiae, which grows well under acidic conditions, remains an attractive alternative as a biocatalyst for C4-acid production. S. cerevisiae is already used in a wide array of industrial applications, ranging from new and traditional food applications to the production of primary metabolites and biomass-derived products (27, 109). Although many of these processes still rely on wild-type strains or strains that have been optimized via classical strain improvement, a huge international research effort is currently underway to optimize S. cerevisiae via metabolic engineering for the production of ethanol from lignocellulosic biomass by expanding its substrate range, reducing byproduct formation and improving robustness in plant biomass hydrolysates [as recently reviewed in (5, 21, 40, 59)]. Other targets for yeast metabolic engineering include the expansion of its product range [e.g. by engineering S. cerevisiae for production of heterologous proteins or low-molecular-weight drugs (15, 81, 86, 101)], quality improvement of alcoholic beverages [e.g. the degradation of malic acid in wine (18), the degradation of diacetyl in beer (12)] and improvement of strain properties such as freeze tolerance, which is relevant for bread production (102). In the following sections, we will review the progress made in the metabolic engineering of S. cerevisiae for production of the C4-dicarboxylic acids malate, succinate and fumarate. These acids, which are intermediates of central carbon metabolism, are only excreted in small amounts by wild-type S. cerevisiae strains. The challenge in metabolic engineering of S. cerevisiae for the efficient production of C4dicarboxylic acids involves at least three levels: (1) elimination of alcoholic fermentation, which, irrespective of the availability of oxygen, is the major route of sugar dissimilation in batch cultures of wild-type S. cerevisiae; (2) engineering fast and efficient metabolic pathways that link the high-capacity glycolytic pathway in S. cerevisiae to the product of choice, taking into account redox and free-energy constraints, and (3) engineering of product export.
Introduction
Elimination of alcoholic fermentation Even under fully aerobic conditions, high glycolytic fluxes in wild-type S. cerevisiae strains are intrinsically linked to alcoholic fermentation (25, 82, 105). Therefore, to avoid reduced product yields as a result of ethanol co-production, any metabolic engineering strategy for high-yield production of organic acids with S. cerevisiae must focus on reducing or eliminating ethanol formation. Apart from limiting ethanol formation in response to glucose excess by intervening in cellular regulation and hexose transport (11, 24, 56), the pathway where the central carbon intermediate pyruvate is converted into ethanol only offers two targets for abolishing ethanol production via gene deletion: pyruvate decarboxylase and alcohol dehydrogenase. Initial attempts to eliminate alcoholic fermentation in S. cerevisiae focused on alcohol dehydrogenase. However, deletion of four structural genes for alcohol dehydrogenase (ADH1 to ADH4) did not result in the elimination of ethanol production and caused the accumulation of glycerol and toxic acetaldehyde (29). Skory (96) described the deletion of the ADH1 gene (encoding the major alcohol dehydrogenase) in an S. cerevisiae strain overexpressing lactate dehydrogenase (LDH). However, despite lower ethanol titers, the deletion also resulted in lower lactate yields (when compared with the control strain expressing LDH and the native ADH1) in favor of glycerol production, which indicated a redox cofactor imbalance (25). Furthermore, the adh1 strain grew poorly, which was attributed to toxic intracellular accumulation of acetaldehyde (96). The alternative is to block ethanol formation one step upstream of alcohol dehydrogenase by eliminating pyruvate decarboxylase activity. S. cerevisiae contains three structural genes, PDC1, 5 and 6, that encode functional pyruvate decarboxylase isozymes (44). While deletion of all three genes completely eliminates alcoholic fermentation, pyruvate decarboxylase-negative (Pdc-) strains grow poorly in complex media and produce large amounts of pyruvate (36). In synthetic media, pdc1,5,6 deletion mutants even fail to grow on glucose as the sole carbon source and are hypersensitive to high glucose concentrations (35, 36). When aerobic, glucoselimited chemostat cultures were used to circumvent the glucose sensitivity of Pdcstrains, growth on glucose could be restored by the addition of small amounts of ethanol or acetate (34, 35). Based on these observations, the inability to grow on glucose as a sole carbon source was attributed to a biosynthetic role of pyruvate decarboxylase in the synthesis of cytosolic acetyl-CoA (35), an essential precursor for lysine and lipid synthesis. Intriguingly, this suggests that mitochondrial acetylCoA, produced via pyruvate dehydrogenase, cannot be transported to the cytosol in S. cerevisiae. Consistent with this hypothesis, overexpression of the GLY1-encoded
11
Chapter 1
12
cytosolic threonine aldolase, which splits threonine into glycine and acetaldehyde and thus provides an alternative route to cytosolic acetyl-CoA, restored growth of Pdc- S. cerevisiae on glucose as the sole carbon source (62). The requirement for C2-compounds and high glucose sensitivity represented major impediments for the use of Pdc- strains for the production of organic acids. Although glucose sensitivity has been observed in Pdc- strains constructed in different S. cerevisiae genetic backgrounds (34, 62), its molecular basis remains unknown. However, by applying evolutionary engineering—which does not require a direct insight into the molecular basis of a selectable trait (90)—both undesirable phenotypes of Pdc- S. cerevisiae could be addressed (60). First, the C2dependence was successfully eliminated by progressively reducing acetate co-feeding during prolonged glucose-limited chemostat cultivation. Subsequently, spontaneous mutants with decreased glucose sensitivity were selected by serial transfers in shake flasks, with increasing concentrations of glucose as the sole carbon source. This two-stage evolutionary engineering strategy eventually yielded a Pdc- S. cerevisiae single colony isolate, denoted TAM (Fig. 1.2), which showed a maximum specific growth rate of 0.20 h-1 on synthetic medium with glucose as the sole carbon source. Aerobic batch fermentation of this strain at pH 5 with repeated glucose feeding, without any medium or process optimization, yielded pyruvate concentrations of up to 135 g l-1 at a yield of 0.54 g (g glucose)-1 (60). These high titers and yields highlighted the potential of Pdc- S. cerevisiae strains for the production of organic acids, especially those for which pyruvate is an intermediate metabolite.
Figure 1.2 Growth of (a) Pdc- Saccharomyces cerevisiae, (b) Pdc- S. cerevisiae selected for C2-independence, (c) Pdc- S. cerevisiae selected for C2-independence and glucose tolerance (TAM) and (d) CEN.PK 113-7D (S. cerevisiae reference strain) on media containing ethanol (2% v/v, left panel) or glucose (2% w/v, right panel) as the sole carbon source. Figure reprinted from (60) with permission from the American Society for Microbiology.
Introduction
Production of C4-acids: towards net CO2 fixation Efficient metabolic pathways for production of C4-dicarboxylic acids involve the carboxylation of a C3-compound (pyruvate or phospho-enol-pyruvate) to a C4-acid (oxaloacetate or malate), leading to net fixation of CO2. By using these carboxylation reactions, malate and fumarate, compounds with the same degree of reduction as glucose, can theoretically be produced at maximum yields of 2 mol (mol glucose)-1 [corresponding to 1.49 and 1.29 g (g glucose)-1, respectively] when external CO2 is supplied. As succinate is more reduced than glucose, a theoretical yield of 2 mol (mol glucose)-1 is only possible when, in addition to CO2, also reducing equivalents (electrons or NADH) are supplied. Without an external electron donor, part of the glucose must be oxidized to CO2, which lowers the maximum yield to 1.71 mol succinate (mol glucose)-1 (or 1.12 g g-1). During growth of wild-type microorganisms on glucose, the carboxylation reactions mentioned above play a key role in anaplerosis: the replenishment of intermediates of the citric acid cycle, such as oxaloacetate and α-ketoglutarate, that are withdrawn from the cycle to synthesize amino acids and nucleotides (53). Although a variety of anaplerotic enzymes exists [the situation in bacteria is reviewed by Sauer & Eikmanns (91)], wild-type S. cerevisiae strains rely solely on pyruvate carboxylase when grown on glucose (16, 53, 84, 100). An alternative pathway in yeast, the (non-carboxylating) glyoxylate cycle, is active during growth on C2-compounds such as ethanol and during growth on oleate, but synthesis of its key enzymes is repressed by glucose (30, 33, 41, 92). As the S. cerevisiae pyruvate carboxylase isozymes Pyc1p and Pyc2p are cytosolic (100, 110), transport mechanisms are in place to transport C4-acids over the mitochondrial membrane (71).
Malate Wild-type S. cerevisiae strains produce low amounts of malate with maximum titers of only 1-2 g l-1 (31, 93). In comparison, a titer of 113 g l-1 at a yield of 1.26 mol malate (mol glucose)-1 has been obtained with wild-type A. flavus (9). However, some progress has been made in metabolic engineering studies aimed at improving malate production by S. cerevisiae. In an early effort, malate titers of up to 6 g l-1 were obtained by overexpressing fumarase (75), although this improvement was attributed to increased malate dehydrogenase (Mdh) activities. The role of Mdh activity was studied further, and overexpression of the cytosolic isozyme Mdh2 resulted in titers of 12 g l-1 malate (76). These experiments were performed in galactose-grown cultures, as glucose is known to inactivate Mdh2p and to repress
13
Chapter 1
14
MDH2 transcription (10, 66). However, despite numerous attempts in different strain backgrounds, Delft yeast researchers have been unable to reproduce the described effect of Mdh2 overexpression on malate production (J.T. Pronk & J.P. van Dijken, unpublished data). Especially for white wines from temperate regions, it is desirable to have the wine yeast degrade the malate present in the grape must to reduce wine acidity and improve the taste profile (108). However, based on physiological studies and the genome sequence of S. cerevisiae, it was concluded that S. cerevisiae does not contain an efficient plasma membrane malate transporter (6, 107). Interestingly, SpMAE1, a malate transporter gene from the yeast Schizosaccharomyces pombe (not to be confused with the MAE1 gene in S. cerevisiae, which encodes malic enzyme), was shown to facilitate malate import and conversion in S. cerevisiae (108). Based on this result, malolactic fermentation was successfully engineered into an S. cerevisiae wine strain (47). The importance of malate import in the metabolic engineering for malate consumption suggests that malate export might be similarly important for engineering of S. cerevisiae for malate production.
Succinate While succinate is an important flavor compound in sake, concentrations obtained with sake strains of S. cerevisiae are low at about 1 g l-1 (7, 42, 97). Furthermore, despite the pursuit of several industrial and academic research groups to metabolically engineer S. cerevisiae for succinate production, few results have so far been published in scientific journals. In an in silico optimization study with very strict boundary conditions and without taking into account CO2 addition, Patil et al. (73) calculated that a set of five deletions (the SDH-complex, ZWF1, PDC6, U133, and U221) would allow for a succinate yield of 0.60 mol (mol glucose)-1. However, this prediction has not yet been verified in vivo. As indicated above, metabolic engineering of microorganisms for efficient succinate production is complicated by the higher degree of reduction of succinate compared to glucose, requiring the net input of two electrons per molecule of succinate. In S. cerevisiae, the maximum theoretical yield of 1.71 mol succinate (mol glucose)-1 (in the case no external electron donor is supplied) can be reached by redirecting part of the carbon flux through the oxidative route of the citric acid cycle. The redox equivalents thus produced (for simplicity, we assume that only NADH is formed) can counterbalance the consumption of NADH in the conversion of fumarate to succinate. However, whereas yields of up to 1.6 mol mol-1 have already been demonstrated with E. coli (51, 52), and an E. coli-based succinate production process has been commercialized (14), achieving similar yields with S.
Introduction cerevisiae is expected to require extensive metabolic engineering including cofactor engineering and rerouting of metabolism.
Fumarate Wild-type S. cerevisiae strains accumulate little fumarate (< 1 g l-1), which can be partly explained by the readily occurring conversion of fumarate to malate via fumarase (75). Indeed, S. cerevisiae has been targeted as a whole-cell catalyst for the production of malate from fumarate (83), although deletion of fumarase (encoded by FUM1) only resulted in small gains in fumarate production for growth on glucose (7, 54, 58). In contrast, titers of over 100 g l-1 have been obtained with natural fumarate producing Rhizopus species, with yields reaching 1.3 mol fumarate (mol glucose)-1 (87). Although supplanted by petrochemical production, the filamentous fungus Rhizopus oryzae was used on an industrial scale to produce fumarate during the early 1940s (38).
Energetics In the previous discussion on dicarboxylic acid production an important requirement was not addressed, namely the cellular need to conserve ATP for growth and maintenance. The importance of this can be demonstrated with a discussion of recent results obtained with S. cerevisiae engineered for lactic acid production. Because S. cerevisiae is acid tolerant, grows in simple synthetic media and is capable of anaerobic growth, it has been identified as an interesting alternative platform for production of lactic acid (57), even though wild-type S. cerevisiae strains only produce trace amounts of D-lactate, presumably via the methylglyoxal bypass (64, 84). Already over a decade ago, metabolic engineering of S. cerevisiae for lactic acid production was proposed (23, 80). The basic strategy consisted of two steps. First, one or more of the three functional genes encoding pyruvate decarboxylase (44) were deleted to reduce or eliminate alcoholic fermentation. Secondly, a heterologous lactate dehydrogenase (LDH) was introduced to convert pyruvate to lactate. This approach resulted in strains that produced lactic acid from glucose and, depending on the degree to which pyruvate decarboxylase activity had been reduced, lactate was either the main fermentation product or a side product to ethanol (3, 49, 50, 63, 79, 88). Lactate production by these strains was observed under fully aerobic conditions with excess glucose (63, 79), at approximately half the rate observed for ethanol formation by wild-type strains under similar conditions. However, the apparent simplicity of this approach proved to be deceptive.
15
Chapter 1
200
100
150
75
100
50
50
25
0 0
50
100
150
Time (h)
200
0 250
6
60 50
5 40 30
4
pH
125
Lactate (g l -1)
250
Lactate/Pyruvate (g l -1)
Glucose (g l -1)
16
Stoichiometrically, conversion of glucose to lactate is equivalent to the production of ethanol and CO2 via the native yeast pathway. In both cases, conversion of 1 mol glucose via glycolysis yields 2 mol pyruvate, which is coupled to the formation of 2 mol ATP and NADH. The NADH generated in glycolysis is then reoxidized to NAD+ by the formation of either lactate or ethanol plus CO2. Based on these considerations alone, it seemed possible to simply replace alcoholic fermentation by lactate fermentation and thereby enable efficient anaerobic, homolactic growth of S. cerevisiae. However, engineered “homolactic” S. cerevisiae strains could not sustain high rates of lactate production under anaerobic conditions and failed to grow unless cultures were aerated (63). This was exemplified by the introduction of an LDH expression vector in the Pdc- TAM strain, which circumvented the C2-requirement and glucose sensitivity of unevolved Pdc- S. cerevisiae strains. Lactate titers of up to 110 g l-1 could be obtained with the resulting strain in 1-liter batch fermentations, but only if the culture was aerated (Fig. 1.3; left panel). Highlighting the ability of S. cerevisiae to produce organic acids at low pH, lactate titers of over 50 g l-1 have been achieved with an evolved Pdc- S. cerevisiae strain in aerobic shake flask cultures at a final pH of 3 (Fig. 1.3; right panel). At this pH, lactic acid will be predominantly present in its undissociated form. Based on an analysis of the growth energetics of oxygen-limited chemostat
20 3 10 0
2 0
10
20
30
40
Time (h)
Figure 1.3 Left panel: lactate (●) and pyruvate (□) production and glucose consumption (○) in Saccharomyces cerevisiae TAM strain expressing a bacterial LDH. The pH of the aerated batch culture was controlled at pH 5.0 with automated addition of 10 M KOH (A.J.A. van Maris et al., unpublished data). Right panel: lactate production (●) and pH (■) in shake flask cultures of an evolved Pdc- S. cerevisiae strain expressing a bacterial LDH (J. Lievense, personal communication).
Introduction cultures of an engineered lactate-producing S. cerevisiae strain, it has been proposed that energy-dependent export of lactic acid (or of the lactate anion and a proton) uses the ATP formed in glycolysis, thereby reducing the net ATP yield of homolactic fermentation to 0 (61, 63). An energy requirement for the export of lactate would represent a clear difference with ethanol, which is generally accepted to exit yeast cells via passive diffusion (39). Because ATP is required for cellular maintenance, the absence of net synthesis of ATP in anaerobic, homolactic cultures can be expected to result in depletion of intracellular ATP (63). Indeed, measurements confirmed a rapid decrease in the intracellular ATP concentration and, coupled to this, a decreasing energy charge after a switch to anaerobic conditions (2). Compared to lactate formation, production of the dicarboxylates malate, succinate and fumarate is even more energetically challenging. As pyruvate carboxylase consumes ATP, formation of intracellular malate or fumarate from glucose via glycolysis and pyruvate kinase, pyruvate carboxylase and malate dehydrogenase (and fumarase) has a net ATP yield of 0. As succinate is more reduced than glucose, a slightly positive ATP yield of 1/3 ATP per succinate can be obtained in S. cerevisiae by balancing the anaplerotic reductive pathway (ATP neutral and consuming 1 NADH per succinate) against the oxidative route through the citric acid cycle (producing 2 ATP and 5 NADH per succinate). However, cellular energy requirements for acid export are likely to result in overall negative ATP yields for all three C4-acids. The transporters that export dicarboxylic acids in S. cerevisiae have not yet been identified, although evidence exists for the presence of a succinate transporter (4, 13). However, as with lactate, efficient export of C4-acids at acidic pH values is likely to be thermodynamically limited to transport mechanisms that consume ATP (either directly, via ABCtransporters, or indirectly, via ATPase-coupled transport). Efficient production of these acids with S. cerevisiae thus depends on either aerobic culture conditions to allow part of the substrate to be respired, or on metabolic engineering using alternative production pathways which conserve more ATP.
Transport mechanisms To understand why export of organic acids generally requires an ATP investment, some understanding of export thermodynamics is required. Weak organic acids in solution exist in pH-dependent equilibrium between undissociated (protonated) and dissociated states. For monocarboxylates, the proportion of anion and undissociated acid is a function of the pKa of the acid and the pH of the environment. With one pKa per carboxyl group, dicarboxylic acids exist in equilibriums between three
17
Chapter 1
18
differentially charged species, HHA, HA- and A2-. These equilibriums can be described by the Henderson-Hasselbalch equation (Fig. 1.4). At low extracellular pH weak acids occur predominantly in the undissociated form, which is desirable for the overall production and recovery of organic acids. However, despite the advantages for downstream processing, these uncharged species have relatively high membrane permeability and are therefore capable of (re)-entering the cell via passive diffusion. The high pH of the yeast cytosol (pH 6-7) causes dissociation of the bulk of the acid, releasing protons and anions. In contrast to undissociated acids, charged acid anions and protons do not readily diffuse across the membrane and accumulate in the cell. Consequently, a vast array of export mechanisms exists in S. cerevisiae (and other microorganisms) to maintain pH and ion homeostasis (19). In all cases, transport is coupled to (and restricted by) gradients of charge, pH and concentration of different acid species, which are maintained by the selectively permeable plasma membrane. When concentration gradients alone are not enough to create a sufficient driving force, additional free energy can be provided by the proton motive force or, in the case of primary transport, by ATP hydrolysis. The electrochemical proton gradient, or proton motive force (pmf), consists of the pH gradient (∆pH = pHin - pHout) and the electrical potential difference (charge gradient; ∆ψ = ψin - ψout). It can be expressed in volts and is summarized as pmf = ∆ψ - Z∆pH, where Z represents ln10 R T/F. The Monocarboxylic Acids
Dicarboxylic Acids
HA A - +H+
HHA HA - +H+ A 2- +2H+
A − pH = pKa + log HA
HA - A 2- pKa1 + log = pH = pKa2 + log - HA HHA
[HA] =
[Total acid] 10(pH-pKa) + 1
[HHA]=
[Total acid] * (10-pH )2 ((10-pH )2 + 10(-pH - pKa1) + 10(-pKa1 - pKa2) )
Figure 1.4 The distribution between undissociated acid (HA or HHA) and dissociated anions (A-, HA- and A2-) and protons (top equations) is determined by the pH of the environment and the pKa of the carboxylate groups as described by the HendersonHasselbalch equation (middle equations). These equations can be reformulating to determine the proportion of undissociated acid at any pH (bottom equations).
Introduction parameters R, T and F respectively indicate the universal gas constant, the temperature and Faraday’s constant. The cytosol is typically more alkaline and negatively charged than the extracellular environment. The pmf is generated by the outward translocation of protons and positive charges (protons or other cations) or the inward translocation of negative charges (hydroxide or other anions). The activity of the plasma membrane H+-ATPase is crucial for the generation of pmf, but translocation of other cations and anions is also important. Once generated, the pmf serves as a source of free energy for cellular processes such as organic acid export across the plasma membrane. For the simplest mode of export, passive or facilitated diffusion of the undissociated acid, transport is only driven by the concentration gradient of the undissociated acid as neither the charge (∆ψ) nor pH gradients (∆pH) are involved (Fig. 1.5). When the extracellular acid concentration is low (e.g. early in the acid production process, or when in situ product removal is applied), intracellular acid accumulation can be sufficient to create an outward driving force. In addition, nearneutral extracellular pH values allow for diffusion of the undissociated acid, since at increasing extracellular pH the proportion of undissociated acid will decrease (Fig. 1.4) and relatively low ratios of intracellular/extracellular total acid are required to create an outward driving force. Symport of acid anions and protons (assuming net zero charge transport and constant intra- and extracellular pH) is also not influenced by the charge and pH gradients and is thermodynamically, but not necessarily kinetically, equivalent to diffusion of undissociated acid (61). With an increasing extracellular acid concentration or decreasing extracellular pH, the concentration of intracellular total acid (dissociated and undissociated acid species) must increase to maintain the same outward driving force. Depending on the pKa of the acid, concentration gradients of approximately 100:1 and larger are required at an extracellular pH of 3 if export solely occurs via (facilitated) diffusion of the undissociated acid (61). Given the toxicity associated with intracellular accumulation of organic acids and the restrictions on intracellular osmotic pressure, the extracellular titers required for economical production cannot be achieved with mechanisms solely driven by the concentration gradient of the undissociated acid. (Facilitated) diffusion of the anion is more favorable, as the fraction of acid present as anion can be several magnitudes lower at low extracellular pH than at the higher cytosol pH (as described by the Henderson-Hasselbalch equation). However, to prevent pmf dissipation and to maintain intracellular pH, anion uniport must be accompanied by a proton efflux via H+-ATPase (encoded by PMA1) to achieve a zero net charge translocation, which comes at the expense of 1
19
Chapter 1
Diffusion
HA
Facilitated Diffusion
HA
Symport
A- + H+ ATP
ABC (undissociated)
20
HA ADP
Uniport (anion)
ATP
Figure 1.5 Possible transport mechanisms for export of weak monocarboxylic acids from S. cerevisiae. To maintain ∆pH and ∆ψ, uniport, antiport with protons and ATPdependent export of anionic species must be balanced by H+ efflux by the plasma membrane H+-ATPase.
AH+
ADP
Antiport
HA
H+ ATP
H+
ADP
ATP
A-
ABC (anion)
ADP ATP
H+ ADP
Environment
Cytosol
ATP per H+ (17, 94). Similarly, 2 ATP have to be invested for each dicarboxylic acid molecule that is exported when the divalent anion is the transported species. Transport of organic acids via primary transport provides another export mechanism. Although the stoichiometry of ATP-dependent export of undissociated acid is equivalent to anion uniport coupled to H+ efflux in terms of ATP consumption, the former uses the free energy of ATP hydrolysis more efficiently and allows for transport against more extreme concentration gradients (61). The charge balance and pH (and therefore the pmf) are not influenced by the translocation of undissociated acid. However, ATP-binding cassette (ABC) transporters require at least 1 ATP per transport event (103, 104). Finally, the most energetically demanding monovalent anion transport mechanism is ATP-coupled export of the acid anion in combination with H+ efflux by the plasma membrane
Introduction ATPase at a cost of 2 ATP per anion/proton pair. A well-documented example of this mechanism is the primary transport of acid anions by the ABC-transporter Pdr12p (45, 77, 78). As the mechanism of acid export, and the related energetics, can have a huge impact on the net ATP yield and maximum product titers, it not only represents a key kinetic constraint, but also imposes upper limits on the yields that can be achieved in the metabolic engineering of microorganisms for the production of organic acids, especially at low pH and high product titers. Given the current limitation in the knowledge and understanding of organic acid exporters in S. cerevisiae, engineering the appropriate export system is a complex challenge. Identification and elimination of inefficient endogenous transport systems is likely to represent a key first step in engineering more efficient transport. However, even the seemingly simple task of identifying the genetic determinants of endogenous transport is complicated by the redundancy of proteins and transport systems [e.g. 20 genes encode for hexose transporters, as reviewed by Özcan & Johnston (70)]. Furthermore, expression of heterologous transport proteins, specifically those of prokaryotic origin, in the plasma membrane of S. cerevisiae presents another substantial hurdle due to differences in protein translocation (85) and folding (37). Consequently, engineering efficient product export likely represents the most important challenge for commercialization of organic acid production with S. cerevisiae.
21
Chapter 1
Scope of this Thesis
22
There are many incentives to reduce our reliance on fossil fuels as sources of energy and carbon. Fortunately, microorganisms possess the ability to convert renewable feedstocks to a wide variety of useful chemicals, many of which can be used as direct alternatives for chemicals produced by petrochemistry. In this thesis, we explore the use of the yeast Saccharomyces cerevisiae as a metabolic engineering platform for production of the C4-dicarboxylic acids malate and succinate. This familiar microorganism is not just a convenient model organism. Due to a good tolerance to low pH and organic acids, simple medium requirements and robust growth, it is itself a promising candidate for use in the industrial production of these acids. Chapter 1 gives an introduction to the current status in the metabolic engineering of S. cerevisiae for the production of C4-dicarboxylic acids. Two topics receive special attention: the prevention of ethanol formation during growth on glucose, and the thermodynamic limitations that act on the microbial production of dicarboxylic acids. Chapter 2 describes a study to metabolically engineer S. cerevisiae for the production of malic acid. Starting point was the evolved pyruvate-accumulating pyruvate decarboxylase-negative (Pdc-) TAM strain. In this strain, a systematic analysis was carried out to study the impact of the (over)expression of pyruvate carboxylase and a cytosolically retargeted malate dehydrogenase, which together catalyze the cytosolic conversion of pyruvate to malate, and of the expression of a heterologous malate transporter from Schizosaccharomyces pombe. Enzymatic assays and 13C-based metabolic flux analyses were used to identify by which metabolic route malate was produced in the best-performing S. cerevisiae strain, in which all three genes were (over)expressed. In chapter 2, malate-producing S. cerevisiae strains were cultivated in calcium carbonate-buffered shake flasks. This simple setup offered an attractive screening platform, but only allowed for limited cultivation control. In addition, the use of calcium carbonate is impractical for production on an industrial scale. Therefore, a bioreactor characterization was performed to investigate whether the use of calcium carbonate could be eliminated, and whether the process would scale beyond shake flasks. This research led to a systematic identification and evaluation of critical culture parameters for C4-dicarboxylic acid production, with emphasis on the impact of culture pH and availability of carbon dioxide and oxygen. The results of this study are presented in chapter 3.
Introduction The engineered yeast strains described in chapters 2 and 3 depend on respiration to produce the ATP required for growth and cellular maintenance, as they are unable to generate ATP via ethanolic fermentation, and C4-acid production via pyruvate carboxylase is ATP neutral. The need for respiration is undesirable, as aerating bioreactors is costly and less substrate is available for product formation. Interestingly, phospho-enol-pyruvate carboxykinase (PEPCK), which is only characterized as a decarboxylating, gluconeogenic enzyme in S. cerevisiae, does generate ATP in the carboxylation reaction. In chapter 4, it was investigated whether, through metabolic engineering, PEPCK can replace the anaplerotic function of pyruvate carboxylase and restore growth on glucose in pyruvate carboxylase-negative S. cerevisiae strains. In addition to direct genetic modification, this study encompassed adaptive evolution and reverse engineering of the selected phenotypes. Whereas PEPCK was already known to function as a carboxylating enzyme in various natural succinate producing microorganisms, little evidence was available for in vivo carboxylating activity by malic enzyme. In fact, the role of malic enzyme, which is ubiquitous in microorganisms, is mainly considered to be related to oxidative decarboxylation of malate. However, as for the PEPCK strategy described in chapter 4, carboxylation of pyruvate by malic enzyme would result in a higher ATP yield of C4-acid production compared to the pyruvate carboxylase-based pathway. Chapter 5 examines the requirements for an in vivo anaplerotic (carboxylating) role of malic enzyme in S. cerevisiae.
23
Chapter 1
References
24
1. Energy Information Administration. 2010. International Energy Outlook 2010. U.S. Department of Energy, Washington, DC. 2. Abbott D. A., J. van den Brink, I. M. Minneboo, J. T. Pronk, and A. J. A. van Maris. 2009. Anaerobic homolactate fermentation with Saccharomyces cerevisiae results in depletion of ATP and impaired metabolic activity. FEMS Yeast Res. 9:349-357. 3. Adachi E., M. Torigoe, M. Sugiyama, J. Nikawa, and K. Shimizu. 1998. Modification of metabolic pathways of Saccharomyces cerevisiae by the expression of lactate dehydrogenase and deletion of pyruvate decarboxylase genes for the lactic acid fermentation at low pH value. J. Ferment. Bioeng. 86:284-289. 4. Aliverdieva D. A., D. V. Mamaev, D. I. Bondarenko, and K. F. Sholtz. 2006. Properties of yeast Saccharomyces cerevisiae plasma membrane dicarboxylate transporter. Biochemistry Mosc. 71:1161-1169. 5. Almeida J. R., T. Modig, A. Petersson, B. Hähn-Hägerdal, G. Lidén, and M. F. Gorwa-Grauslund. 2007. Increased tolerance and conversion of inhibitors in lignocellulosic hydrolysates by Saccharomyces cerevisiae. J. Chem. Technol. Biotechnol. 82:340-349. 6. Ansanay V., S. Dequin, C. Camarasa, V. Schaeffer, J. Grivet, B. Blondin, J. Salmon, and P. Barre. 1996. Malolactic fermentation by engineered Saccharomyces cerevisiae as compared with engineered Schizosaccharomyces pombe. Yeast 12:215-225. 7. Arikawa Y., M. Kobayashi, R. Kodaira, M. Shimosaka, H. Muratsubaki, K. Enomoto, and M. Okazaki. 1999. Isolation of sake yeast strains possessing various levels of succinate- and/or malate-producing abilities by gene disruption or mutation. J. Biosci. Bioeng. 87:333-339. 8. Bailey J. 1991. Toward a science of metabolic engineering. Science 252:16681675. 9. Battat E., Y. Peleg, A. Bercovitz, J. S. Rokem, and I. Goldberg. 1991. Optimization of L-malic acid production by Aspergillus flavus in a stirred fermentor. Biotechnol. Bioeng. 37:1108-1116. 10. van den Berg M. A., P. de Jong-Gubbels, and H. Y. Steensma. 1998. Transient mRNA responses in chemostat cultures as a method of defining putative regulatory elements: Application to genes involved in Saccharomyces cerevisiae acetylcoenzyme A metabolism. Yeast 14:1089-1104. 11. Bill R., E. Boles, L. Gustafsson, S. Hohmann, C. Larsson, and K. Otterstedt. April 2003. Recombinant Saccharomyces cerevisiae expressing chimeric glucose transporters. U.S. Patent 7507574.
Introduction 12. Blomqvist K., M. Suihko, J. Knowles, and M. Penttila. 1991. Chromosomal integration and expression of two bacterial α-acetolactate decarboxylase genes in brewer’s yeast. Appl. Environ. Microbiol. 57:2796-2803. 13. Bonnet J. A. B. A. F., C. J. W. Koellmann, H. E. Dekkers-de Kok, and J. A. Roels. 1984. The growth of Saccharomyces cerevisiae CBS 426 on mixtures of glucose and succinic acid: a model. Biotechnol. Bioeng. 26:269-274. 14. Bozell J. J., and G. R. Petersen. 2010. Technology development for the production of biobased products from biorefinery carbohydrates—the US Department of Energy’s “Top 10” revisited. Green Chem. 12:539-554. 15. Branduardi P., C. Smeraldi, and D. Porro. 2008. Metabolically engineered yeasts: ‘potential’ industrial applications. J. Mol. Microbiol. Biotechnol. 15:31-40. 16. Brewster N. K., D. L. Val, M. E. Walker, and J. C. Wallace. 1994. Regulation of pyruvate carboxylase isozyme (PYC1, PYC2) gene expression in Saccharomyces cerevisiae during fermentative and nonfermentative growth. Arch. Biochem. Biophys. 311:62-71. 17. Burgstaller W. 1997. Transport of small ions and molecules through the plasma membrane of filamentous fungi. Crit. Rev. Microbiol. 23:1-46. 18. Canonaco F., U. Schlattner, P. S. Pruett, T. Wallimann, and U. Sauer. 2002. Functional expression of phosphagen kinase systems confers resistance to transient stresses in Saccharomyces cerevisiae by buffering the ATP pool. J. Biol. Chem. 277:31303-31309. 19. Casal M., S. Paiva, O. Queirós, and I. Soares-Silva. 2008. Transport of carboxylic acids in yeasts. FEMS Microbiol. Rev. 32:974-994. 20. Chatterjee R., C. S. Millard, K. Champion, D. P. Clark, and M. I. Donnelly. 2001. Mutation of the ptsG gene results in increased production of succinate in fermentation of glucose by Escherichia coli. Appl. Environ. Microbiol. 67:148-154. 21. Chu B. C., and H. Lee. 2007. Genetic improvement of Saccharomyces cerevisiae for xylose fermentation. Biotechnol. Adv. 25:425-441. 22. Deok K., S. Lee, and P. Kim. 2006. Influence of gluconeogenic phosphoenolpyruvate carboxykinase (PCK) expression on succinic acid fermentation in Escherichia coli under high bicarbonate condition. J. Microbiol. Biotechnol. 16:1448-1452. 23. Dequin S., and P. Barre. 1994. Mixed lactic acid-alcoholic fermentation by Saccharomyes cerevisiae expressing the Lactobacillus casei L(+)-LDH. Nat. Biotechnol. 12:173-177.
25
Chapter 1
26
24. Diderich J. A., L. M. Raamsdonk, A. L. Kruckeberg, J. A. Berden, and K. van Dam. 2001. Physiological properties of Saccharomyces cerevisiae from which hexokinase II has been deleted. Appl. Environ. Microbiol. 67:1587-1593. 25. van Dijken J. P., and W. A. Scheffers. 1986. Redox balances in the metabolism of sugars by yeasts. FEMS Microbiol. Lett. 32:199-224. 26. Do J. H., and D. Choi. 2007. Aflatoxins: detection, toxicity, and biosynthesis. Biotechnol. Bioprocess Eng. 12:585-593. 27. Donalies U. E. B., H. T. T. Nguyen, U. Stahl, and E. Nevoigt. 2008. Improvement of Saccharomyces yeast strains used in brewing, wine making and baking. Adv. Biochem. Eng. Biotechnol. 111:67-98. 28. Donnelly M., C. Millard, D. Clark, M. Chen, and J. Rathke. 1998. A novel fermentation pathway in an Escherichia coli mutant producing succinic acid, acetic acid, and ethanol. Appl. Biochem. Biotechnol. 70-72:187-198. 29. Drewke C., J. Thielen, and M. Ciriacy. 1990. Ethanol formation in adh0 mutants reveals the existence of a novel acetaldehyde-reducing activity in Saccharomyces cerevisiae. J. Bacteriol. 172:3909-3917. 30. Duntze W., D. Neumann, J. M. Gancedo, W. Atzpodien, and H. Holzer. 1969. Studies on the regulation and localization of the glyoxylate cycle enzymes in Saccharomyces cerevisiae. Eur. J. Biochem. 10:83-89. 31. Fatichenti F., G. A. Farris, P. Deiana, and S. Ceccarelli. 1984. Malic acid production and consumption by selected of Saccharomyces cerevisiae under anaerobic and aerobic conditions. Appl. Microbiol. Biotechnol. 19:427-429. 32. Feist A. M., and B. O. Palsson. 2008. The growing scope of applications of genome-scale metabolic reconstructions using Escherichia coli. Nat. Biotechnol. 26:659-667. 33. Fernández E., F. Moreno, and R. Rodicio. 1992. The ICL1 gene from Saccharomyces cerevisiae. Eur. J. Biochem. 204:983-990. 34. Flikweert M. T., M. de Swaaf, J. P. van Dijken, and J. T. Pronk. 1999. Growth requirements of pyruvate-decarboxylase-negative Saccharomyces cerevisiae. FEMS Microbiol. Lett. 174:73-79. 35. Flikweert M. T., L. van der Zanden, W. M. T. M. Janssen, H. Y. Steensma, J. P. van Dijken, and J. T. Pronk. 1996. Pyruvate decarboxylase: an indispensable enzyme for growth of Saccharomyces cerevisiae on glucose. Yeast 12:247257. 36. Flikweert M., J. van Dijken, and J. Pronk. 1997. Metabolic responses of pyruvate decarboxylase-negative Saccharomyces cerevisiae to glucose excess. Appl. Environ. Microbiol. 63:3399-3404.
Introduction 37. Gárdonyi M., and B. Hahn-Hägerdal. 2003. The Streptomyces rubiginosus xylose isomerase is misfolded when expressed in Saccharomyces cerevisiae. Enzyme Microb. Technol. 32:252-259. 38. Goldberg I., J. S. Rokem, and O. Pines. 2006. Organic acids: old metabolites, new themes. J. Chem. Technol. Biotechnol. 81:1601-1611. 39. Guijarro J. M., and R. Lagunas. 1984. Saccharomyces cerevisiae does not accumulate ethanol against a concentration gradient. J. Bacteriol. 160:874-878. 40. Hahn-Hägerdal B., K. Karhumaa, C. Fonseca, I. Spencer-Martins, and M. Gorwa-Grauslund. 2007. Towards industrial pentose-fermenting yeast strains. Appl. Microbiol. Biotechnol. 74:937-953. 41. Hartig A., M. M. Simon, T. Schuster, J. R. Daugherty, H. S. Yo, and T. G. Cooper. 1992. Differentially regulated malate synthase genes participate in carbon and nitrogen metabolism of S. cerevisiae. Nucl. Acids Res. 20:5677-5686. 42. Heerde E., and F. Radler. 1978. Metabolism of the anaerobic formation of succinic acid by Saccharomyces cerevisiae. Arch. Microbiol. 117:269-276. 43. Hesseltine C. W., O. L. Shotwell, J. J. Ellis, and R. D. Stubblefield. 1966. Aflatoxin formation by Aspergillus flavus. Bacteriol. Rev. 30:795-805. 44. Hohmann S. 1991. Characterization of PDC6, a third structural gene for pyruvate decarboxylase in Saccharomyces cerevisiae. J. Bacteriol. 173:7963-7969. 45. Holyoak C. D., D. Bracey, P. W. Piper, K. Kuchler, and P. J. Coote. 1999. The Saccharomyces cerevisiae weak-acid-inducible ABC transporter Pdr12 transports fluorescein and preservative anions from the cytosol by an energy-dependent mechanism. J. Bacteriol. 181:4644-4652. 46. Hong S. H., and S. Y. Lee. 2001. Metabolic flux analysis for succinic acid production by recombinant Escherichia coli with amplified malic enzyme activity. Biotechnol. Bioeng. 74:89-95. 47. Husnik J. I., H. Volschenk, J. Bauer, D. Colavizza, Z. Luo, and H. J. J. van Vuuren. 2006. Metabolic engineering of malolactic wine yeast. Metab. Eng. 8:315-23. 48. Isar J., L. Agarwal, S. Saran, P. Gupta, and R. K. Saxena. 2006. Effect of process parameters on succinic acid production in Escherichia coli W3110 and enzymes involved in the reductive tricarboxylic acid cycle. Can. J. Microbiol. 52:893902. 49. Ishida N., S. Saitoh, T. Ohnishi, K. Tokuhiro, E. Nagamori, K. Kitamoto, and H. Takahashi. 2006. Metabolic engineering of Saccharomyces cerevisiae for efficient production of pure L−(+)−lactic acid. Appl. Biochem. Biotechnol. 131:795807.
27
Chapter 1
28
50. Ishida N., T. Suzuki, K. Tokuhiro, E. Nagamori, T. Onishi, S. Saitoh, K. Kitamoto, and H. Takahashi. 2006. D-Lactic acid production by metabolically engineered Saccharomyces cerevisiae. J. Biosci. Bioeng. 101:172-177. 51. Jantama K., M. J. Haupt, S. A. Svoronos, X. Zhang, J. C. Moore, K. T. Shanmugam, and L. O. Ingram. 2008. Combining metabolic engineering and metabolic evolution to develop nonrecombinant strains of Escherichia coli C that produce succinate and malate. Biotechnol. Bioeng. 99:1140-1153. 52. Jantama K., X. Zhang, J. C. Moore, K. T. Shanmugam, S. A. Svoronos, and L. O. Ingram. 2008. Eliminating side products and increasing succinate yields in engineered strains of Escherichia coli C. Biotechnol. Bioeng. 101:881-893. 53. de Jong-Gubbels P., J. Bauer, P. Niederberger, I. Stückrath, P. Kötter, J. P. van Dijken, and J. T. Pronk. 1998. Physiological characterisation of a pyruvatecarboxylase-negative Saccharomyces cerevisiae mutant in batch and chemostat cultures. Antonie Van Leeuwenhoek 74:253-263. 54. Kaclíková E., T. M. Lachowicz, Y. Gbelská, and J. Šubík. 1992. Fumaric acid overproduction in yeast mutants deficient in fumarase. FEMS Microbiol. Lett. 91:101-106. 55. Kim P., M. Laivenieks, C. Vieille, and J. G. Zeikus. 2004. Effect of overexpression of Actinobacillus succinogenes phosphoenolpyruvate carboxykinase on succinate production in Escherichia coli. Appl. Environ. Microbiol. 70:1238-1241. 56. Klein C. J. L., J. J. Rasmussen, B. Rønnow, L. Olsson, and J. Nielsen. 1999. Investigation of the impact of MIG1 and MIG2 on the physiology of Saccharomyces cerevisiae. J. Biotechnol. 68:197-212. 57. Liu C., and J. C. Lievense. June 2005. Lactic acid producing yeast. Patent WO/2005/052174. 58. Magarifuchi T., K. Goto, Y. Iimura, M. Tadenuma, and G. Tamura. 1995. Effect of yeast fumarase gene (FUM1) disruption on production of malic, fumaric and succinic acids in sake mash. J. Ferment. Bioeng. 80:355-361. 59. van Maris A. J. A., D. A. Abbott, E. Bellissimi, J. van den Brink, M. Kuyper, M. A. H. Luttik, H. W. Wisselink, W. A. Scheffers, J. P. van Dijken, and J. T. Pronk. 2006. Alcoholic fermentation of carbon sources in biomass hydrolysates by Saccharomyces cerevisiae: current status. Antonie van Leeuwenhoek 90:391-418. 60. van Maris A. J. A., J. A. Geertman, A. Vermeulen, M. K. Groothuizen, A. A. Winkler, M. D. W. Piper, J. P. van Dijken, and J. T. Pronk. 2004. Directed evolution of pyruvate decarboxylase-negative Saccharomyces cerevisiae, yielding a C2independent, glucose-tolerant, and pyruvate-hyperproducing yeast. Appl. Environ. Microbiol. 70:159-166.
Introduction 61. van Maris A. J. A., W. N. Konings, J. P. van Dijken, and J. T. Pronk. 2004. Microbial export of lactic and 3-hydroxypropanoic acid: implications for industrial fermentation processes. Metab. Eng. 6:245-255. 62. van Maris A. J. A., M. A. H. Luttik, A. A. Winkler, J. P. van Dijken, and J. T. Pronk. 2003. Overproduction of threonine aldolase circumvents the biosynthetic role of pyruvate decarboxylase in glucose-limited chemostat cultures of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 69:2094-2099. 63. van Maris A. J. A., A. A. Winkler, D. Porro, J. P. van Dijken, and J. T. Pronk. 2004. Homofermentative lactate production cannot sustain anaerobic growth of engineered Saccharomyces cerevisiae: possible consequence of energydependent lactate export. Appl. Environ. Microbiol. 70:2898-2905. 64. Martins A. M. T. B. S., C. A. A. Cordeiro, and A. M. J. Ponces Freire. 2001. In situ analysis of methylglyoxal metabolism in Saccharomyces cerevisiae. FEBS Lett. 499:41-44. 65. McKinlay J. B., C. Vieille, and J. G. Zeikus. 2007. Prospects for a bio-based succinate industry. Appl. Microbiol. Biotechnol. 76:727-740. 66. Minard K. I., and L. McAlister-Henn. 1992. Glucose-induced degradation of the MDH2 isozyme of malate dehydrogenase in yeast. J. Biol. Chem. 267:1745817464. 67. Moon S. Y., S. H. Hong, T. Y. Kim, and S. Y. Lee. 2008. Metabolic engineering of Escherichia coli for the production of malic acid. Biochem. Eng. J. 40:312-320. 68. Nevoigt E. 2008. Progress in metabolic engineering of Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 72:379-412. 69. Ostergaard S., L. Olsson, and J. Nielsen. 2000. Metabolic engineering of Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 64:34-50. 70. Özcan S., and M. Johnston. 1999. Function and regulation of yeast hexose transporters. Microbiol. Mol. Biol. Rev. 63:554-569. 71. Palmieri F., G. Agrimi, E. Blanco, A. Castegna, M. A. Di Noia, V. Iacobazzi, F. M. Lasorsa, C. M. Marobbio, L. Palmieri, P. Scarcia, S. Todisco, A. Vozza, and J. Walker. 2006. Identification of mitochondrial carriers in Saccharomyces cerevisiae by transport assay of reconstituted recombinant proteins. Biochim. Biophys. Acta 1757:1249-1262. 72. Patel M. K., M. Crank, V. Dornburg, B. G. Hermann, A. L. Roes, B. Hüsing, L. Overbeek, F. Terragni, and E. Recchia. 2006. Medium and longterm opportunities and risks of the biotechnological production of bulk chemicals from renewable resources. Utrecht University, Utrecht.
29
Chapter 1
30
73. Patil K. R., I. Rocha, J. Förster, and J. Nielsen. 2005. Evolutionary programming as a platform for in silico metabolic engineering. BMC Bioinformatics 6:308. 74. Peleg Y., B. Stieglitz, and I. Goldberg. 1988. Malic acid accumulation by Aspergillus flavus. I. Biochemical aspects of acid biosynthesis. Appl. Microbiol. Biotechnol. 28:69-75. 75. Pines O., S. Even-Ram, N. Elnathan, E. Battat, O. Aharonov, D. Gibson, and I. Goldberg. 1996. The cytosolic pathway of L-malic acid synthesis in Saccharomyces cerevisiae: the role of fumarase. Appl. Microbiol. Biotechnol. 46:393-399. 76. Pines O., S. Shemesh, E. Battat, and I. Goldberg. 1997. Overexpression of cytosolic malate dehydrogenase (MDH2) causes overproduction of specific organic acids in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 48:248-255. 77. Piper P., Y. Mahé, S. Thompson, R. Pandjaitan, C. Holyoak, R. Egner, M. Mühlbauer, P. Coote, and K. Kuchler. 1998. The Pdr12 ABC transporter is required for the development of weak organic acid resistance in yeast. EMBO J. 17:4257-4265. 78. Piper P., C. O. Calderon, K. Hatzixanthis, and M. Mollapour. 2001. Weak acid adaptation: the stress response that confers yeasts with resistance to organic acid food preservatives. Microbiology 147:2635-2642. 79. Porro D., M. M. Bianchi, L. Brambilla, R. Menghini, D. Bolzani, V. Carrera, J. Lievense, C. Liu, B. M. Ranzi, L. Frontali, and L. Alberghina. 1999. Replacement of a metabolic pathway for large-scale production of lactic acid from engineered yeasts. Appl. Environ. Microbiol. 65:4211-4215. 80. Porro D., L. Brambilla, B. M. Ranzi, E. Martegani, and L. Alberghina. 1995. Development of metabolically engineered Saccharomyces cerevisiae cells for the production of lactic acid. Biotechnol. Prog. 11:294-298. 81. Porro D., M. Sauer, P. Branduardi, and D. Mattanovich. 2005. Recombinant protein production in yeasts. Mol. Biotechnol. 31:245-259. 82. Postma E., C. Verduyn, W. A. Scheffers, and J. P. van Dijken. 1989. Enzymic analysis of the Crabtree effect in glucose-limited chemostat cultures of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 55:468-477. 83. Presečki A. V., B. Zelić, and Đ. Vasić-Rački. 2007. Comparison of the Lmalic acid production by isolated fumarase and fumarase in permeabilized baker’s yeast cells. Enzyme Microb. Technol. 41:605-612. 84. Pronk J. T., H. Y. Steensma, and J. P. van Dijken. 1996. Pyruvate metabolism in Saccharomyces cerevisiae. Yeast 12:1607-1633. 85. Rapoport T. A. 2007. Protein translocation across the eukaryotic endoplasmic reticulum and bacterial plasma membranes. Nature 450:663-669.
Introduction 86. Ro D., E. M. Paradise, M. Ouellet, K. J. Fisher, K. L. Newman, J. M. Ndungu, K. A. Ho, R. A. Eachus, T. S. Ham, J. Kirby, M. C. Y. Chang, S. T. Withers, Y. Shiba, R. Sarpong, and J. D. Keasling. 2006. Production of the antimalarial drug precursor artemisinic acid in engineered yeast. Nature 440:940-3. 87. Roa Engel C. A., A. J. Straathof, T. W. Zijlmans, W. M. van Gulik, and L. A. van der Wielen. 2008. Fumaric acid production by fermentation. Appl. Microbiol. Biotechnol. 78:379-389. 88. Saitoh S., N. Ishida, T. Onishi, K. Tokuhiro, E. Nagamori, K. Kitamoto, and H. Takahashi. 2005. Genetically engineered wine yeast produces a high concentration of L-lactic acid of extremely high optical purity. Appl. Environ. Microbiol. 71:2789-2792. 89. Sauer M., D. Porro, D. Mattanovich, and P. Branduardi. 2008. Microbial production of organic acids: expanding the markets. Trends Biotechnol. 26:100-108. 90. Sauer U. 2001. Evolutionary engineering of industrially important microbial phenotypes, pp. 129-169. In T. Scheper (ed.), Metabolic Engineering. SpringerVerlag, Heidelberg-Berlin. 91. Sauer U., and B. J. Eikmanns. 2005. The PEP-pyruvate-oxaloacetate node as the switch point for carbon flux distribution in bacteria. FEMS Microbiol. Rev. 29:765-794. 92. Schöler A., and H. Schüller. 1993. Structure and regulation of the isocitrate lyase gene ICL1 from the yeast Saccharomyces cerevisiae. Curr. Genet. 23:375-381. 93. Schwartz H., and F. Radler. 1988. Formation of L(-)malate by Saccharomyces cerevisiae during fermentation. Appl. Microbiol. Biotechnol. 27:553-560. 94. Serrano R. 1991. Transport across yeast vacuolar and plasma membranes, pp. 523-585. In J.R. Broach, J.R. Pringle, and E.W. Jones (eds.), The molecular and cellular biology of the yeast Saccharomyces: genome dynamics, protein synthesis, and energetics, 1st ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 95. Shanmugam K. T., and L. O. Ingram. 2008. Engineering biocatalysts for production of commodity chemicals. J. Mol. Microbiol. Biotechnol. 15:8-15. 96. Skory C. 2003. Lactic acid production by Saccharomyces cerevisiae expressing a Rhizopus oryzae lactate dehydrogenase gene. J. Ind. Microbiol. 30:22-27. 97. Song H., and S. Y. Lee. 2006. Production of succinic acid by bacterial fermentation. Enzyme Microb. Technol. 39:352-361. 98. Stols L., and M. I. Donnelly. 1997. Production of succinic acid through overexpression of NAD+-dependent malic enzyme in an Escherichia coli mutant. Appl. Environ. Microbiol. 63:2695-2701.
31
Chapter 1
32
99. Stols L., G. Kulkarni, B. G. Harris, and M. I. Donnelly. 1997. Expression of Ascaris suum malic enzyme in a mutant Escherichia coli allows production of succinic acid from glucose. Appl. Biochem. Biotechnol. 63-65:153-158. 100. Stucka R., S. Dequin, J. Salmon, and C. Gancedo. 1991. DNA sequences in chromosomes II and VII code for pyruvate carboxylase isoenzymes in Saccharomyces cerevisiae: analysis of pyruvate carboxylase-deficient strains. Mol. Gen. Genet. 229:307-315. 101. Szczebara F. M., C. Chandelier, C. Villeret, A. Masurel, S. Bourot, C. Duport, S. Blanchard, A. Groisillier, E. Testet, P. Costaglioli, G. Cauet, E. Degryse, D. Balbuena, J. Winter, T. Achstetter, R. Spagnoli, D. Pompon, and B. Dumas. 2003. Total biosynthesis of hydrocortisone from a simple carbon source in yeast. Nat. Biotechnol. 21:143-149. 102. Tanghe A., P. Van Dijck, F. Dumortier, A. Teunissen, S. Hohmann, and J. M. Thevelein. 2002. Aquaporin expression correlates with freeze tolerance in baker’s yeast, and overexpression improves freeze tolerance in industrial strains. Appl. Environ. Microbiol. 68:5981-9. 103. van Veen H. W., C. F. Higgins, and W. N. Konings. 2001. Multidrug transport by ATP binding cassette transporters: a proposed two-cylinder engine mechanism. Res. Microbiol. 152:365-374. 104. van Veen H. W., A. Margolles, M. Muller, C. F. Higgins, and W. N. Konings. 2000. The homodimeric ATP-binding cassette transporter LmrA mediates multidrug transport by an alternating two-site (two-cylinder engine) mechanism. EMBO J. 19:2503-2514. 105. Verduyn C., T. P. L. Zomerdijk, J. P. van Dijken, and W. A. Scheffers. 1984. Continuous measurement of ethanol production by aerobic yeast suspensions with an enzyme electrode. Appl. Microbiol. Biotechnol. 19:181-185. 106. Vinci V., and G. Byng. 1999. Strain improvement by non-recombinant methods. In Manual of Industrial Microbiology and Biotechnology. American Society of Microbiology, Washington, DC. 107. Volschenk H., H. J. J. van Vuuren, and M. Viljoen-Bloom. 2003. Maloethanolic fermentation in Saccharomyces and Schizosaccharomyces. Curr. Genet. 43:379391. 108. Volschenk H., M. Viljoen, J. Grobler, B. Petzold, F. Bauer, R. E. Subden, R. A. Young, A. Lonvaud, M. Denayrolles, and H. J. van Vuuren. 1997. Engineering pathways for malate degradation in Saccharomyces cerevisiae. Nat. Biotech. 15:253-257. 109. Walker G. M. 1998. Yeast technology, pp. 265-320. In Yeast physiology and biotechnology. John Wiley & Sons Ltd, Chichester, UK.
Introduction 110. Walker M. E., D. L. Val, M. Rohde, R. J. Devenish, and J. C. Wallace. 1991. Yeast pyruvate carboxylase: Identification of two genes encoding isoenzymes. Biochem. Biophys. Res. Commun. 176:1210-1217. 111. Wang Q., X. Chen, Y. Yang, and X. Zhao. 2006. Genome-scale in silico aided metabolic analysis and flux comparisons of Escherichia coli to improve succinate production. Appl. Microbiol. Biotechnol. 73:887-894. 112. Wang W., Z. Li, J. Xie, and Q. Ye. 2009. Production of succinate by a pflB ldhA double mutant of Escherichia coli overexpressing malate dehydrogenase. Bioprocess Biosyst. Eng. 32:737-745. 113. Warnecke T., and R. Gill. 2005. Organic acid toxicity, tolerance, and production in Escherichia coli biorefining applications. Microb. Cell Fact. 4:25. 114. Wendisch V. F., M. Bott, and B. J. Eikmanns. 2006. Metabolic engineering of Escherichia coli and Corynebacterium glutamicum for biotechnological production of organic acids and amino acids. Curr. Opin. Microbiol. 9:268-274. 115. Werpy T., and G. Petersen. 2004. Top value added chemicals from biomass: I. Results of screening for potential candidates from sugars and synthesis gas. U.S. Department of Energy, Washington, DC. 116. Zelle R. M., E. de Hulster, W. A. van Winden, P. de Waard, C. Dijkema, A. A. Winkler, J. A. Geertman, J. P. van Dijken, J. T. Pronk, and A. J. A. van Maris. 2008. Malic acid production by Saccharomyces cerevisiae: engineering of pyruvate carboxylation, oxaloacetate reduction, and malate export. Appl. Environ. Microbiol. 74:2766-2777. 117. Zhang X., K. Jantama, J. C. Moore, L. R. Jarboe, K. T. Shanmugam, and L. O. Ingram. 2009. Metabolic evolution of energy-conserving pathways for succinate production in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 106:2018020185. 118. Zhang X., K. Jantama, K. T. Shanmugam, and L. O. Ingram. 2009. Reengineering Escherichia coli for succinate production in mineral salts medium. Appl. Environ. Microbiol. 75:7807-7813.
33
Chapter 2 Malic acid production by Saccharomyces cerevisiae: engineering of pyruvate carboxylation, oxaloacetate reduction, and malate export Rintze M. Zelle, Erik de Hulster, Wouter A. van Winden, Pieter de Waard, Cor Dijkema, Aaron A. Winkler, Jan-Maarten A. Geertman, Johannes P. van Dijken, Jack T. Pronk, and Antonius J. A. van Maris Published in Applied and Environmental Microbiology, May 2008, Vol. 74, No. 9, p. 2766-2777 (doi:10.1128/AEM.02591-07)
Chapter 2
Abstract
36
Malic acid is a potential biomass-derivable “building block” for chemical synthesis. Since wild-type Saccharomyces cerevisiae strains only produce low levels of malate, metabolic engineering is required to achieve efficient malate production with this yeast. A promising pathway for malate production from glucose proceeds via carboxylation of pyruvate, followed by reduction of oxaloacetate to malate. This redox- and ATP-neutral, CO2-fixing pathway has a theoretical maximum yield of 2 mol malate (mol glucose)-1. A previously engineered glucose-tolerant, C2independent pyruvate decarboxylase-negative S. cerevisiae strain was used as the platform to evaluate the impact of individual and combined introduction of three genetic modifications: (i) overexpression of the native pyruvate carboxylase encoded by PYC2, (ii) high-level expression of an allele of the MDH3 gene, of which the encoded malate dehydrogenase was retargeted to the cytosol by deletion of the Cterminal peroxisomal targeting sequence, and (iii) functional expression of the Schizosaccharomyces pombe malate transporter gene SpMAE1. While single or double modifications improved malate production, highest malate yields and titers were obtained with the simultaneous introduction of all three modifications. In glucosegrown batch cultures, the resulting engineered strain produced malate at titers of up to 59 g l-1, at a malate yield of 0.42 mol (mol glucose)-1. Metabolic flux analysis showed that metabolite labeling patterns observed upon NMR analyses of cultures grown on 13C-labeled glucose were consistent with the envisaged non-oxidative, fermentative pathway for malate production. The engineered strains still produced substantial amounts of pyruvate, indicating that the pathway efficiency can be further improved.
Malic acid producing S. cerevisiae
Introduction Malic acid, a four-carbon dicarboxylic acid, is currently mainly used as an acidulant and taste enhancer in the beverage and food industry. Racemic malic acid is synthesized petrochemically from maleic anhydride. Enantiomerically pure L-malic acid (e.g. for production of pharmaceuticals) is produced from fumarate (synthesized from maleic anhydride) by enantioselective hydration with fumarase, using either immobilized cells or isolated enzyme (7, 19). Increasing oil prices, concerns about climate change and advances in the field of metabolic engineering have fuelled renewed interest in production of organic acids by microbial fermentation (20). In 2004, the US Department of Energy included a group of 1,4dicarboxylic acids, consisting of succinic, fumaric and malic acid, in the top twelve of most interesting chemical building blocks that can be derived from biomass (60). Already in 1924, malic acid was identified as a product of yeast fermentation (8). Since then, malic acid production has been observed in a wide range of microorganisms. Fermentative production of malic acid has been most successfully demonstrated with Aspergillus flavus, achieving 63% of the maximum theoretical yield of malic acid on glucose at high production rates and titers (4). Since its potential aflatoxin production disqualified A. flavus as a producer of foodgrade chemicals (16), malic acid production was studied in other organisms, including the yeast Saccharomyces cerevisiae (Table 2.1). The highest reported malic acid concentration obtained with S. cerevisiae thus far is 12 g l-1, and was achieved by overexpression of the cytosolic isoenzyme of malate dehydrogenase (Mdh2p) (45). Recently another yeast, a natural isolate of Zygosaccharomyces rouxii, was shown to produce up to 75 g l-1 of malic acid in a complex medium containing 300 g l-1 glucose (52). Four metabolic pathways for production of L-malic acid from glucose can be identified (Fig. 2.1): I. carboxylation of pyruvate (S. cerevisiae lacks phospho-enolpyruvate carboxylase) to oxaloacetate, followed by reduction of oxaloacetate to malate. If pyruvate is produced in glycolysis, this non-oxidative pathway is ATPneutral and involves a net fixation of CO2, resulting in a maximum theoretical malate yield of 2 mol (mol glucose)-1; II. condensation of oxaloacetate and acetylCoA to citric acid, followed by its oxidation to malate via the TCA cycle. If acetylCoA is generated by pyruvate dehydrogenase and oxaloacetate by pyruvate carboxylase, conversion of glucose to malate via this oxidative pathway results in the release of 2 CO2, thus limiting the maximum theoretical malate yield to 1 mol (mol glucose)-1; III. formation of malate from two molecules of acetyl-CoA via the glyoxylate cycle. In this alternative oxidative pathway for malate production, the
37
Chapter 2 Table 2.1 Overview of production titers, yields and rates presented in various studies on malic acid production by fermentation-based processes. Yields are given in mol malate per mol glucose, unless indicated otherwise. Organism
Malic acid
Yield
Productivity
g l-1
mol mol -1
g l-1 h-1
1962
60
0.84
0.1
Abe et al. (1)
1988
36
0.51
0.19
Peleg et al. (43)
1991
113
1.26
0.59
Battat et al. (4)
Rhizopus arrhizus & Paecilomyces varioti
1983
48
0.81
0.34
Takao et al. (53)
Monascus araneosus
1993
28
0.50
0.23
Lumyong and Tomita (32)
Schizophyllum commune
1997
18
0.48
0.16
Kawagoe et al. (28)
Zygosaccharomyces rouxii
2007
75
0.52
0.54
Taing and Taing (52)
Aspergillus flavus
38
Saccharomyces cerevisiae
aGalactose
Year
0.01
References
1984
1
1988
2
Fatichenti et al. (12)
1996
6
0.09a
0.18
Pines et al. (44)
1997
12
0.13a
0.38
Pines et al. (45)
2008
59
0.42
0.19
This study
Schwartz and Radler (49)
used as carbon source instead of glucose
maximum malate yield on glucose is limited to 1 mol mol-1 due to the oxidative decarboxylation reaction required for acetyl-CoA production from pyruvate; IV. a non-cyclic pathway that involves the glyoxylate cycle enzymes, but in which oxaloacetate is replenished by pyruvate carboxylation, resulting in a theoretical maximum yield of 1⅓ mol malate per mol glucose. Metabolic engineering of S. cerevisiae for high-yield production of organic acids requires the elimination of alcoholic fermentation which, in this yeast, occurs even under fully aerobic conditions when high concentrations of sugar are present (46, 56). While deletion of the three pyruvate decarboxylase genes (PDC1, PDC5 and PDC6) in S. cerevisiae completely prevents alcoholic fermentation (24), C2compound auxotrophy and intolerance to high glucose levels (13, 14) complicate the use of pyruvate decarboxylase-negative (Pdc-) strains as a metabolic engineering platform. In a previous study, we have applied evolutionary engineering in batch and chemostat cultures to select a glucose-tolerant, C2-independent Pdc- S. cerevisiae strain (34). In aerobic, glucose-grown batch cultures, this strain produced large amounts of pyruvate, which is an intermediate for malate production.
Malic acid producing S. cerevisiae
Precursor synthesis
CO2 Acetyl-CoA (C2) Pyruvate dehydrogenase
Glycolysis
Pyruvate (C3)
Glucose (C6)
Pyruvate carboxylase
Oxaloacetate (C4) CO2
Metabolic routes towards malate I
Oxaloacetate reduction Yspmax: 2 mol mol-1
II
TCA cycle Yspmax: 1 mol mol-1 C2
OAA
OAA CIT
MAL
MAL
ICI
FUM
AKG
SUC SUCC
III
Glyoxylate route (cyclic) Yspmax: 1 mol mol-1 C2
IV
Glyoxylate route (non-cyclic) Yspmax: 1⅓ mol mol-1 C2
OAA MAL C2 FUM
CIT
OAA
CIT
MAL C2 FUM
SUC
SUC
Figure 2.1 Four possible pathways for malate production in Saccharomyces cerevisiae, using oxaloacetate and/or acetyl-CoA as precursors. I. Direct reduction of oxaloacetate. II. Oxidation of citrate via the TCA cycle. III. Formation from acetylCoA via the cyclic glyoxylate route. IV. Formation from acetyl-CoA and oxaloacetate via the non-cyclic glyoxylate route. Abbreviations: OAA: oxaloacetate, MAL: malate, CIT: citrate, ICI: isocitrate, AKG: α-ketoglutarate, SUCC: succinyl-CoA, SUC: succinate, FUM: fumarate, C2: acetyl-CoA, Yspmax: maximum theoretical yield (in mol malate per mol glucose).
39
Chapter 2 The aim of the present study is to explore a strategy for metabolic engineering of Pdc- S. cerevisiae for malate production that encompasses carboxylation of pyruvate to oxaloacetate, followed by reduction to malate, a route with a maximal theoretical yield of 2 mol malate per mol of glucose. To this end, the impact on malate production of the separate and combined introduction of three genetic modifications will be analyzed in a glucose-tolerant, C2-independent Pdcstrain: (i) overexpression of pyruvate carboxylase, (ii) high-level expression of a cytosolic malate dehydrogenase activity, and (iii) functional expression of a heterologous malate transporter, because malate transport rates via diffusion across the S. cerevisiae plasma membrane (57) may be too low for efficient malate production. To verify whether the malate produced by an engineered strain was indeed produced via the envisaged non-oxidative pathway, metabolic flux analysis was performed, based on 13C-NMR-labeling data of extracellular metabolites after cultivation on [1-13C]-glucose. 40
Materials and Methods Strains and maintenance. All strains used in this study (Table 2.2) are derived from the S. cerevisiae CEN.PK strain family (10). Stock cultures were prepared from shake flask cultures by addition of glycerol to culture broth (20% v/v) and storage of 2-ml aliquots in sterile vials at -80°C. Stock cultures were grown on a synthetic medium consisting of demineralized water, 20 g l-1 glucose, 5 g l-1 (NH4)2SO4, 3 g l-1 KH2PO4, 0.5 g l-1 MgSO4 ⋅ 7 H2O, vitamins and trace elements (55), with a pH of 6 (set with KOH). During construction, strains were maintained on complex medium [YP: 10 g l-1 yeast extract and 20 g l-1 peptone (both BD Difco)] or synthetic medium (MY) (55) supplemented with glucose (2%) as carbon source (YPD or MYD) and, in case of plates, with 1.5% agar. Construction of a trp1 null mutant of S. cerevisiae TAM. All S. cerevisiae strains in this study are based on the ura3∆ Pdc- TAM strain (34). To allow for introduction of additional plasmids, a second marker was introduced by deletion of TRP1. A deletion cassette that confers geneticin resistance was made by performing a PCR on plasmid pUG6 (22) using the oligopeptides 5’trp1::kanlox and 3’trp1::kanlox (Table 2.3) and used for the transformation of TAM. Transformants were selected on YPD containing 200 µg ml-1 geneticin (G418, Invitrogen/GIBCO), restreaked on the same medium and verified by testing for tryptophan auxotrophy and by diagnostic PCR, using the 5’TRP1 + KanA and 3’TRP1 + KanB primers (Table 2.3). RWB961 was identified as a trp1 deletion mutant and was used to construct all further strains.
Malic acid producing S. cerevisiae
Table 2.2 S. cerevisiae strains used in this study. All strains except CEN.PK 113-7D are derived from the evolved Pdc- S. cerevisiae (TAM) strain. Strain CEN.PK 113-7D TAM ura3∆
RWB961 ura3∆ trp1∆ RWB961 empty vector RWB961 ↑PYC2 RWB961 ↑MDH3∆SKL RWB961 ↑SpMAE1 RWB961 ↑PYC2 + ↑MDH3∆SKL RWB961 ↑MDH3∆SKL + ↑SpMAE1 RWB961 ↑PYC2 + ↑SpMAE1 RWB525 ↑PYC2 + ↑MDH3∆SKL + ↑SpMAE1
Genotype MATa, wild-type reference strain MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 selected for C2-independence in glucose-limited chemostats and glucose-tolerant growth in batch culture MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 trp1::Kanlox MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 trp1::Kanlox {YEplac195, YEplac112} MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 trp1::Kanlox {pRS2, YEplac112} MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 trp1::Kanlox {p426GPDMDH3∆SKL, YEplac112} MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 trp1::Kanlox {p426GPD, YEplac112SpMAE1} MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 trp1::Kanlox {pRS2MDH3∆SKL, YEplac112} MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 trp1::Kanlox {p426GPDMDH3∆SKL, YEplac112SpMAE1} MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 trp1::Kanlox {pRS2, YEplac112SpMAE1} MATa pdc1(-6,-2)::loxP pdc5(-6,-2)::loxP pdc6(-6,-2)::loxP mutx ura3-52 trp1::Kanlox {pRS2MDH3∆SKL, YEplac112SpMAE1}
Table 2.3 Oligonucleotides used in this study. Oligonucleotide KanA KanB 5’trp1::kanlox 3’trp1::kanlox 5’TRP1 3’TRP1 XbaI-5’MDH3 3’MDH3-SalI XbaI-5’SpMAE1 3’SpMAE1-SalI
Sequence CGCACGTCAAGACTGTCAAG TCGTATGTGAATGCTGGTCG GCCAAGAGGGAGGGCATTGGTGACTATTGAGCACGTGAGTATAC GAACTATTTTTATATGCTTTTACAAGACTTGAAATTTTCCTTGC TGGCATGTCTGGCGATGATA CGCCTGTGAACATTCTCTTC GCTCTAGAAACATGGTCAAAGTCGCAA AGCTGTCGACTCAAGAGTCTAGGATGAAACTCT GCTCTAGACATGGGTGAACTCAAGGA ACGCGTCGACTTAAACGCTTTCATGTTCA
41
Chapter 2
42
Plasmid construction and transformation. The plasmids used in this work are listed in table 2.4. The S. cerevisiae MDH3 gene was amplified by PCR from chromosomal DNA of S. cerevisiae CEN.PK 113-7D using the primers XbaI5’MDH3 and 3’MDH3-SalI. The resulting fragment contains the whole MDH3 gene, except for the last 9 base pairs that encode the peroxisomal targeting sequence (the tripeptide SKL) (36). The PCR fragment was cut at the introduced XbaI and SalI sites and ligated to p426GPD that was digested with SpeI and XhoI, resulting in p426GPDMDH3∆SKL. The cassette containing MDH3∆SKL flanked by the TDH3 promoter and the CYC1 terminator was cut from p426GPDMDH3∆SKL using KpnI and SacI. The ends were made blunt using Mung Bean nuclease (New England Biolabs, Beverly, MA, USA) according to the manufacturer’s protocol, followed by ligation of the fragment into the multicopy pRS2 plasmid [which carries the S. cerevisiae PYC2 gene; (51)] cut with SmaI. This resulted in pRS2MDH3∆SKL. The gene coding for the Schizosaccharomyces pombe malate transporter, SpMAE1, was amplified by PCR from chromosomal DNA of S. pombe L972 using the primers XbaI-5’SpMAE1 and 3’SpMAE1-SalI. The resulting fragment was digested with XbaI and SalI and ligated into p425GPD cut with SpeI and XhoI. This resulted in p425GDPSpMAE1, which was then digested with KpnI and SacI to obtain the cassette with the TDH3 promoter, SpMAE1 and the CYC1 terminator. The cassette was ligated into the multi-copy plasmid YEplac112 that was also digested with KpnI and SacI, resulting in YEplac112SpMAE1. Restriction endonucleases (New England Biolabs and Roche, Basel, Switzerland) and DNA ligase (Roche) were used according to instructions supplied by the manufacturers. Plasmids were isolated from Escherichia coli with the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). DNA fragments were separated on 1% agarose (Sigma, St. Louis, MO, USA) gel in 1×TBE (44). Fragments were Table 2.4 Plasmids used in this study. Plasmid p425GPD p426GPD p426GPDMDH3∆SKL p425GPDSpMAE1 pRS2 pRS2MDH3∆SKL pUG6 YEplac195 YEplac112 YEplac112SpMAE1
Characteristics 2µ, LEU2, PTDH3 2µ, URA3, PTDH3 2µ, URA3, PTDH3-MDH3∆SKL 2µ, LEU2, PTDH3-S. pombe MAE1 2µ, URA3, PYC2 2µ, URA3, PYC2, PTDH3-MDH3∆SKL loxP-KanMX-loxP cassette 2µ, URA3 2µ, TRP1 2µ, TRP1, PTDH3-S. pombe MAE1
Reference Mumberg et al. (40) Mumberg et al. (40) This work This work Stucka et al. (51) This work Güldener et al. (22) Gietz and Sugino (18) Gietz and Sugino (18) This work
Malic acid producing S. cerevisiae isolated from gel using the QIAquick Gel Extraction Kit (Qiagen). MDH3∆SKL and SpMAE1 were amplified using VentR DNA polymerase (New England Biolabs) according to the manufacturer’s instructions. PCR was performed in a Biometra TGradient Thermocycler (Biometra, Göttingen, Germany) in 30 cycles of consecutive annealing (1 min at 60°C), extension (3 min at 75°C) and denaturation (1 min at 94°C). Plasmids were amplified in E. coli XL-1 blue (Stratagene, La Jolla, CA, USA). E. coli transformations were performed according to Inoue et al. (25). For plasmid isolations, E. coli was grown on Luria-Bertani plates or in liquid Terrific broth medium (48). Yeast transformations were performed according to Gietz and Woods (17). After transformation of RWB961 with the various plasmids, the yeast strains were plated on MYD solid medium. Shake flask cultivation. Shake flask cultures were grown on synthetic medium, consisting of demineralized water and 100 g l-1 glucose, 3 g l-1 KH2PO4, 6.6 g l-1 K2SO4, 0.5 g l-1 MgSO4 ⋅ 7 H2O and 1 ml trace element solution (55). For the 13C-NMR analyses 100 g l-1 D-[1-13C]-glucose (99% 13C-labeling purity, Campro Scientific GmbH, Germany) was used. After setting the pH to 4.8 with KOH and heat sterilization for 20 min at 110°C, a filter-sterilized vitamin solution (55) (1 ml l1) and urea (to a final concentration of 1 g l-1) were added. Urea was used as the only nitrogen source in all experiments to avoid additional acidification of the medium by ammonium uptake, which especially for precultures was undesired. Medium (100 ml) was added to sterile 500 ml round bottom flasks containing 5 g CaCO3, shortly before inoculation with 1 g l-1 of biomass dry weight, as dissolving of CaCO3 would otherwise lead to a too high initial pH. Shake flasks were incubated at 30°C and 200 rpm in a rotary shaker. For shake flask cultivations starting with 200 g l-1 glucose, 15 g CaCO3 was added per flask to prevent CaCO3 depletion. Precultures were grown under identical conditions except for glucose (20 g l-1), urea (2.3 g l-1), pH (set to 6.0 with KOH) and without CaCO3. Preculture shake flasks were inoculated with 2 ml of stock culture. After 48 h of cultivation, the broth was centrifuged. The pellet was resuspended in 10 ml demineralized water and the cell suspension was equally divided over two shake flasks with fresh preculture medium, in order to obtain more biomass. After an additional 24 h of cultivation, the biomass concentration was determined and the broth was centrifuged. Cells were resuspended in demineralized water and shake flasks with production medium were inoculated with 2 ml of cell suspension to obtain an initial biomass dry weight of 1 g l-1.
43
Chapter 2
44
Chemostat cultivation for in vitro enzyme activity assays. Aerobic nitrogen-limited chemostat cultivation was performed as described previously (35), at a dilution rate of 0.10 h-1 and with 32 g l-1 glucose in the chemostat medium. For each chemostat, a shake flask with 100 ml preculture medium (see above for medium composition) was inoculated with 2 ml of stock culture. After 48 h of cultivation, the broth was transferred wholly to a fermentor containing 1 liter of medium. The fermenter was switched to the chemostat regime after completion of the batch phase. When steady-state conditions were obtained cultures were sampled for in vitro enzyme activity measurements. Dry weight determination. Culture samples (5 ml) were filtrated over oven-dried and weighed nitrocellulose filters (0.45 µm pore size; Pall Corporation) and washed with demineralized water. Biomass dry weight concentrations were determined from the weight increase after drying filters in a microwave oven for 20 min at 360W. Before dry weight determination, excess CaCO3 was dissolved by acidification of the broth with 0.2 M HCl. Metabolite analysis. Extracellular concentrations of acetate, ethanol, fumarate, glucose, glycerol, lactate and succinate were determined by highperformance liquid chromatography (HPLC), using a Bio-Rad Aminex HPX-87H column eluted with 5 mM H2SO4, at a flow rate of 0.6 ml min-1 and at 60°C. Acetate, fumarate and lactate were detected by a Waters 2487 dual-wavelength absorbance detector at 214 nm. Ethanol, glucose, glycerol and succinate were detected with a Waters 2410 refractive index detector. Malate was determined by enzymatic analysis (Enzyplus L-Malic Acid kit no. EZA786, Raisio Diagnostics). Pyruvate was assayed enzymatically with a reaction mixture containing 100 mM potassium phosphate buffer (pH 7.5), 0.17 mM NADH and diluted culture supernatant. Pyruvate was determined by measuring NADH consumption after addition of lactate dehydrogenase (6 U ml-1). Preparation of cell-free extracts for in vitro enzyme activity assays. Steady-state chemostat samples were centrifuged, washed and resuspended in potassium phosphate buffer (10 mM, pH 7.5, 2 mM EDTA) and stored at -20°C. Before assaying, samples were thawed, washed and resuspended in potassium phosphate-buffer (100 mM, pH 7.5, 2 mM MgCl2, 1 mM dithiothreitol). Extracts were prepared with a FastPrep 120A (Thermo Scientific) using 0.75 g glass beads (Sigma, G8772) per ml of cell suspension in 4 bursts (20 s per burst at speed 6, with 60 s intervals to allow for cooling). Unbroken cells and debris were removed by centrifugation (4°C, 20 min, 47,000 × g). The supernatant was used for the enzyme activity assays.
Malic acid producing S. cerevisiae
In vitro enzyme activity assays. The assay mixture for malate dehydrogenase (Mdh) contained 0.1 M potassium phosphate buffer (pH 8.0) and 0.15 mM NADH in demineralized water. The reaction was started by the addition of 1 mM oxaloacetate. Mdh activity was measured spectrophotometrically by following NADH oxidation at 340 nm. Activities of pyruvate carboxylase, isocitrate lyase and phospho-enol-pyruvate carboxykinase were determined as described previously (27). All enzymes activities were measured at 30°C. Protein concentrations in cell extracts were determined by the Lowry method (31) using bovine serum albumin as standard. NMR measurements. 0.1 ml 99.9% D2O (Isotec, USA) was added to 0.4 ml sample in a 5 mm NMR tube. 1-D 1H- and 13C-NMR spectra were obtained at respectively 500 and 125 MHz with a probe temperature of 280 K on a Bruker AMX-500 spectrometer, located at the Wageningen NMR Centre. 13C-enrichments were calculated from the 1H spectrum by comparing the signal of the 13C-satellites to the total signal obtained for the proton attached to the carbon of interest. 13Cenrichments of carbon atoms part of carboxyl-groups, which lack an adjacent proton, were calculated from the 13C-NMR spectra by comparing the signal of these carbon atoms in a completely relaxed spectrum to the signal obtained for other carbon atoms within the same compound for which 13C-enrichments could be determined using 1H-spectra. The 13C-enrichment data for succinate was not included in the analysis, as these enrichments could not be determined accurately due to overlapping signals in the NMR-spectra of succinate and other compounds. 13C-labeling based metabolic flux analysis. By iteratively fitting fluxes in a metabolic model, a set of fluxes could be estimated that yielded 13C-enrichment data similar to the measured NMR-data, while satisfying the mass balances of the model. The mass balances followed from the model stoichiometry, and incorporated the measured consumption and production rates of carbon-containing compounds. These included the consumption rate of glucose and the production rates of malate, succinate, fumarate, pyruvate, glycerol and biomass. The metabolic model used (Supplemental Table 2.S1, Fig. 2.4) was based on the S. cerevisiae genome-scale metabolic model of Duarte et al. (11). Compartmentalization was limited to the cytosol and mitochondrion. Cytosolic reactions include glycolysis, the pentose-phosphate pathway [modeled according to Kleijn et al. (29)], as well as relevant cytosolic reactions involving C4-dicarboxylic acids. The mitochondrial compartment contains the reactions of the TCA cycle. Since the model contains only one (cytosolic) carbon dioxide consuming reaction, a single spatially homogeneous carbon dioxide pool was used in the model, which, in addition to influxes of the modeled carbon dioxide producing metabolic reactions,
45
Chapter 2
46
included an additional influx of non-enriched carbon dioxide to account for the dissolution of the calcium carbonate. The stoichiometry of carbon dioxide export, the result of respiratory glucose dissimilation, was calculated from the carbon balance. The gluconeogenic phospho-enol-pyruvate carboxykinase reaction was not included in the model as this enzyme is subject to glucose repression and inactivation (15), and its presence could lead to cycling between pyruvate and phospho-enol-pyruvate. Scrambling reactions were included to distribute labeling of the symmetric compounds succinate and fumarate evenly over their symmetric carbon atoms. Where possible, the model was simplified by combining reactions. Reversible reactions were modeled as separate forward and backward reactions. Exchange fluxes between the cytosol and mitochondria were unrestricted in all calculations. Consumption rates of macromolecule precursors were included in the model to account for the demand of these precursors in biomass formation. The consumption rates of these precursors were estimated using the macromolecular biomass composition (30) at the estimated specific growth rate, combined with the stoichiometric precursor requirements for macromolecule construction as listed in the metabolic model of Daran-Lapujade et al. (9). A previously described flux fitting procedure (62) was used. The sum of squared residuals (SSres) between the simulated and measured data was minimized using sequential quadratic programming, implemented in Matlab (R2006b, The MathWorks Inc., USA). End point labeling patterns of extracellular metabolites were used to gain insight into the overall, time-averaged contribution of specific pathways to malate production. This approach does not allow for the analysis of possible changes of flux distribution during the experiment.
Results Overproduction of pyruvate carboxylase, cytosolically relocated malate dehydrogenase and Schizosaccharomyces pombe malate permease. The metabolic engineering strategy that was explored in this study is based on the highlevel expression of three proteins. Pyruvate carboxylase was overexpressed using the multicopy plasmid pRS2, which carries the PYC2 gene under the control of its native promoter (51). In S. cerevisiae, pyruvate carboxylase is a cytosolic enzyme (23, 47, 54, 59). Therefore, to circumvent the need for transport of oxaloacetate and malate between subcellular compartments, malate dehydrogenase should preferably also be expressed in the cytosol. One of the three malate dehydrogenase isoenzymes in S. cerevisiae, Mdh2p, is located in the cytosol. However, Mdh2p is subject to glucose catabolite inactivation (37, 39), which is an undesirable property for batch
Malic acid producing S. cerevisiae cultivation on glucose. Therefore, the strategy for cytosolic malate dehydrogenase overexpression was based on retargeting the peroxisomal isoenzyme encoded by MDH3. Peroxisomal targeting of Mdh3p is caused by a C-terminal SKL tripeptide (36). An MDH3 allele, in which the 9 nucleotides that encode this C-terminal sequence were removed, was cloned in multicopy vectors under the control of the constitutive TDH3 promoter (Table 2.4). Subcellular fractionation experiments on aerobic, glucose-limited chemostat cultures, performed as described by Luttik et al. (33), confirmed overexpression of the truncated MDH3, showing an over 20-fold increase of the cytosolic malate dehydrogenase activity (data not shown). It has previously been reported that transport of malate across the plasma membrane of S. cerevisiae occurs at very low rates, probably via diffusion (57). As insufficient transport capacity might impede efficient production of malate, the Schizosaccharomyces pombe malate transporter SpMae1p (21), which has been demonstrated to mediate both import and export of malate when expressed in S. cerevisiae (6, 58), was expressed under the control of the TDH3 promoter from a separate multicopy plasmid. The expression cassettes were introduced in an evolved pyruvateoverproducing Pdc- S. cerevisiae strain (34), resulting in strain RWB525 (Table 2.2). To confirm overexpression of Pyc2 and Mdh3∆SKL in this strain that also carried the SpMAE1 expression vector, pyruvate carboxylase and malate dehydrogenase activities were analyzed in cell extracts of aerobic, nitrogen-limited chemostat cultures grown at a dilution rate of 0.10 h-1. Pyc and Mdh activities were 0.24 ± 0.02 and 30.5 ± 0.6 µmol min-1 (mg protein)-1, respectively. These activities were about 10-fold higher compared to an empty vector (YEplac195) reference strain, for which Pyc and Mdh activities were 0.02 ± 0.00 and 3.5 ± 0.1 µmol min-1 (mg protein)-1, respectively. Impact of pyruvate carboxylase, malate dehydrogenase and malate permease on malate production. To study the individual and combined effects of the different genetic modifications on malate production, a set of prototrophic strains (Table 2.2) with different combinations of PYC2-, MDH3∆SKL- and SpMAE1-carrying plasmids was tested in shake flasks on synthetic medium containing 100 g l-1 glucose (Fig. 2.2). To prevent acidification, calcium carbonate was added as a buffering agent. Addition of 50 g l-1 of CaCO3 ensured saturation throughout the fermentation. Shake flasks were sampled 4 days after inoculation when glucose depletion was confirmed by HPLC. Under these conditions, the pyruvate decarboxylase-negative host strain S. cerevisiae TAM produced ca. 10 mM malate. Control experiments showed that, after glucose depletion, malate consumption was negligible.
47
Chapter 2
Malate (mM)
300
200
100
48
+
PYC2
+
MDH3∆SKL
+
+ | +
| + +
+ + |
| | +
| + |
+ | |
|
|
|
0
SpMAE1
Figure 2.2 Malate concentrations obtained in shake flask cultivations of different strains of S. cerevisiae overexpressing combinations of pyruvate carboxylase, malate dehydrogenase or malate permease. Concentrations were determined after 96 h of cultivation when glucose was depleted (100 ml synthetic medium in 500 ml shake flasks, 100 g l-1 glucose, 5 g CaCO3). Each bar represents a strain. A plus sign (+) below the bar indicates that the gene shown at the end of the row (PYC2, MDH3∆SKL or SpMAE1) is overexpressed in that particular strain. If a minus sign (-) is listed, the gene was not overexpressed. Error bars indicate standard deviation (each strain was tested at least twice).
Overexpression of PYC2 alone had only a small impact on malate production (Fig. 2.2). Conversely, individual overexpression of either MDH3∆SKL or SpMAE1 led to a ca. 3-fold increase of the malate concentration reached in the shake flask fermentation experiments. This indicates that pyruvate carboxylase has a low degree of control over the rate of malate production in the reference strain. Even in combination with either MDH3∆SKL or SpMAE1, overexpression of PYC2 yielded only small increases of the malate titer relative to strains in which MDH3∆SKL or SpMAE1 were expressed individually (Fig. 2.2). In contrast, combined overexpression of MDH3∆SKL and SpMAE1 resulted in an over 10-fold increase of the malate titer relative to the Pdc- reference strain (130 ± 39 mM). The highest malate concentrations (235 ± 25 mM) were obtained with strain RWB525, in which PYC2, MDH3∆SKL and SpMAE1 were simultaneously overexpressed. These results suggest that when malate dehydrogenase and a malate exporter are (over)-expressed, control of malate production shifts to pyruvate carboxylase.
Malic acid producing S. cerevisiae HPLC analysis of culture supernatants showed that, in addition to malate, the engineered strains produced substantial amounts of glycerol, pyruvate and succinate. Product formation by strain RWB525 in shake flask cultures. In the experiments shown in figure 2.2, emphasis was on final malate titers. The kinetics of malate production and byproduct formation were investigated in more detail for strain RWB525, in which PYC2, MDH3∆SKL and SpMAE1 were simultaneously overexpressed. In CaCO3-buffered shake flask cultures grown on 189 ± 1 g l-1 glucose a final concentration of 59 ± 2 g l-1 malic acid was obtained, corresponding to an overall malate yield on glucose of 0.42 mol mol-1 (Fig. 2.3). For the fermentation shown in this figure, the average volumetric malate production rate was 0.29 g l-1 h-1 during the period of glucose consumption, the first 192 h of incubation. In addition to malate, the engineered strain produced succinic acid (8 ± 0 g -1 l ), glycerol (25 ± 0 g l-1), pyruvic acid (3 ± 0 g l-1) and fumaric acid (2 ± 0 g l-1). The concentrations of succinate, glycerol and fumarate increased at rather constant rates during glucose consumption and remained constant following glucose depletion. 8
1000 7 800
600
6
pH
Glucose, malate, glycerol, succinate pyruvate, fumarate (mM)
1200
400 5 200
0
4 0
50
100
150
200
250
300
Time after inoculation (h)
Figure 2.3 Extracellular metabolite concentrations during a representative shake flask fermentation of RWB525 (100 ml synthetic medium in a 500 ml shake flask, 188 g l-1 initial glucose, 15 g CaCO3, 1 g l-1 initial biomass). Glucose (■), malate (□), glycerol (●), succinate (○), pyruvate (▲), fumarate ( ) and pH (♦, dashed line). Endpoint determinations of two additional experiments yielded quantitatively similar results. Standard deviations for these experiments are indicated in the text.
49
Chapter 2
50
Pyruvate was produced mainly in the first 50 h of the fermentation. After reaching a concentration of 12 g l-1 (Fig. 2.3), pyruvate was partially consumed again after glucose was depleted. The culture pH, which remained between 5.5 and 6.5 during the glucose consumption phase, increased after glucose depletion (Fig. 2.3). The observed pH profile can be explained by taking into account the presence of CaCO3 and the production or consumption of acids. When a saturating amount of CaCO3 is added to the synthetic medium, which has a low buffering capacity, dissolving CaCO3 will increase the pH to a value of around 8 at equilibrium. The small initial pH increase during the lag phase of the fermentation (Fig. 2.3) can therefore be explained by dissolving CaCO3. During the glucose consumption phase, production of acids results in a net decrease in pH. Finally, after glucose depletion, the pH increased again due to consumption of pyruvate and dissolving CaCO3 (Fig. 2.3). Verification of the malate production pathway. The malate yield of 0.42 mol (mol glucose)-1 reached in the batch experiments with strain RWB525 did not surpass the maximum theoretical yields of the less efficient pathways. For the design of future optimization studies, it is important to know whether the less efficient, oxidative pathways contribute to malate production by the engineered strains. To test whether the glyoxylate routes contributed to malate formation by strain RWB525, the activity of the crucial enzyme isocitrate lyase was measured in cell extracts of malate-producing shake flask cultures. Isocitrate lyase activity was below the detection limit of the assay [0.005 µmol min-1 (mg protein)-1], whereas positive controls (RWB525 and the wild-type reference strain grown on ethanol) reproducibly showed isocitrate lyase activities of 0.1-0.2 µmol min-1 (mg protein)-1 which, for the reference strain, is in good agreement with literature values (26). The absence of detectable isocitrate lyase activity is consistent with the fact that this enzyme is subject to glucose catabolite inactivation (41) and was taken as evidence that the glyoxylate routes do not contribute to malate production by strain RWB525. Similarly, phospho-enol-pyruvate carboxykinase activities in these cell extracts were below the detection limit of the assay [0.005 µmol min-1 (mg protein)-1], whereas a positive control of the wild-type reference strain grown on ethanol showed an activity of 0.4 µmol min-1 (mg protein)-1. Enzyme activities cannot be used to assess the contribution of the nonoxidative pathway and oxidative formation of malate via the TCA cycle. Therefore, a 13C-NMR-based metabolic flux analysis was performed on strain RWB525 grown in shake flask cultures on 100 g l-1 [1-13C]-glucose. This approach, based on the dependency of 13C-labeling patterns of extracellular metabolites on the intracellular
Malic acid producing S. cerevisiae fluxes, has been applied previously to study pathways of malate formation in strains of A. flavus and S. cerevisiae (42, 44). After three days, when no residual [1-13C]-glucose could be detected, culture supernatants were analyzed by NMR. Enrichments were measured for malate, succinate, fumarate, glycerol and pyruvate. Two types of 13C-enrichment data were obtained: positional, indicating 13C-enrichment at specific carbon positions (e.g. the C2 of malate), and relative, indicating the fraction of molecules, 13C-labeled at carbon position A, that are also 13C-labeled at neighboring position B (Table 2.5). Flux analyses were performed using both physiological and enrichment data combined with a metabolic model, as described by Wiechert (61). The metabolic model consisted of glycolysis, the pentose phosphate pathway, the TCA cycle and Table 2.5 13C-enrichments of metabolites in the supernatant, sampled after 72 h of cultivation in shake flasks containing pure [1-13C]-glucose. The estimated error for the determination of the 13C-enrichments is 1% (absolute to the measurement). Positional 13Cenrichments indicate the enrichment at specific carbon positions. Relative enrichments indicate the fraction of molecules, 13C-labeled at carbon position A, that are also 13Clabeled at neighboring position B. This is presented as: “B given that A”. ND, not determined. Chemical shifts (δ, in ppm) are given in parentheses. 13C-Enrichment
Metabolite
Type
Location
Enrichment percentage Measured Expt I
Expt II
Fitted
Pyruvate
Positional
C2 C3 (δ 1.43) C3 (δ 1.34)
1 46 46
1 46 45
1 45 45
Malate
Positional
C1 C2 C3 C4
5 15 33 6
ND 15 32 ND
5 17 32 5
C1 given that C2 C2 given that C1 C2 given that C3 C3 given that C2 C3 given that C4 C4 given that C3
5 21 4 10 28 5
4.5 20 4 10 30 4.5
6 19 5 10 31 4
Relative
Glycerol
Positional
C1/3 (δ 3.48) C1/3 (δ 3.57) C2
26 25 1
25 23 1
25 25 1
Fumarate
Positional
C2/3
25
25
25
51
Chapter 2
52
the relevant reactions of cytosolic C4-dicarboxylic acid metabolism. Based on the absence of measurable isocitrate lyase and phospho-enol-pyruvate carboxykinase activities (see above), the glyoxylate cycle and the phospho-enol-pyruvate carboxykinase reaction were omitted from the model. The measured consumption and production rates for glucose, malate, succinate, fumarate, pyruvate and glycerol were used as constraints for the mass balances of the metabolic model. The increase in biomass concentration was 6 g dry weight l-1, as determined in two shake flasks with non-13C-enriched glucose. An estimated average specific growth rate in the cultures of 0.10 h-1 was used to estimate the consumption rates of precursors for biomass formation. The obtained optimal fit for flux distribution in strain RWB525 represents a situation in which all excreted malate is derived via the non-oxidative pathway, i.e. by carboxylation of pyruvate and subsequent reduction of oxaloacetate to malate by malate dehydrogenase (Fig. 2.4). In this situation, the TCA cycle only supplies the excreted succinate and mitochondrial pyruvate is supplied by mitochondrial import of cytosolic pyruvate and by malic enzyme. The mitochondrial malate required for the latter reaction is supplied by mitochondrial import of cytosolic fumarate followed by its conversion to mitochondrial malate. The minimized covarianceweighted sum of squared residuals (the fluxfit error) between the measured and fitted 13C-enrichments was 8. Deviations of 1% (absolute) between all measured and simulated enrichment percentages (which is the estimated measurement error) would have resulted in an error of 15. The estimated flux distribution shown in figure 2.4 was consistent with exclusive involvement of the envisaged non-oxidative pathway. However, it remained relevant to assess to what extent an involvement of the oxidative TCAcycle pathway would result in a worse fit of the 13C-enrichment data. To this end, a sensitivity analysis was performed by fixing the net cytosolic malate dehydrogenase and malic enzyme fluxes in the model to reduced values, while allowing the optimization algorithm to change the remaining fluxes to minimize the fitting error. The malic enzyme flux was included in this sensitivity analysis, since this flux has a large influence on the amount of freedom in the model, and in vitro enzyme activity measurements for malic enzyme were unsuccessful, probably due to interference by CaCO3 (data not shown). The fluxfit error increased at low malic enzyme and low net cytosolic malate dehydrogenase fluxes (Fig. 2.5). For the extreme case where both these fluxes were set to zero, all excreted C4-dicarboxylic acids were derived from the TCA cycle (Fig. 2.6, top values). The fluxfit error for this condition increased from 8 for the best fit to 160, over 10 times higher than what is expected based on measurement error alone. When the malic enzyme flux was set to zero, but
Malic acid producing S. cerevisiae
Glucose Cytosol 100 3 BIOMASS
CO2
Glucose-6-P
10
P5P
87 (3045)
124 (708)
3 (6)
CO2
21
Glycerol
S7P
F6P E4P
94 BIOMASS
6 (24)
C2
3 (239)
1
3 (240)
3 (0)
21
G3P
BIOMASS
C3
169 62
Pyruvatecyt
17 (2)
CO2 0 (0)
Oxaloacetatecyt
Malatecyt
3
AcCoAmit
53
1 BIOMASS
CO2
Oxaloacetatemit 54 (714)
89 (2107) 38
CO2
2 41
90 1
Pyruvatemit
56
0 (0)
Malatemit 95 (1887)
52 (143)
53
51 (57)
1
Fumaratecyt
Fumaratemit 44 (1012)
0 8
Succinatecyt
8 (59)
2 CO2
Succinatemit Mitochondrion
Figure 2.4 Flux estimates for the 13C-based metabolic flux analysis of RWB525 under malate producing conditions in shake flasks. Fluxes (in moles) are normalized for a glucose uptake of 100 moles. Arrows indicate the direction of the (net) flux. In case of reversible reactions, the exchange flux is included in parentheses. Some arrows are dashed to improve readability. Metabolites present in both compartments are differentiated by the indications ‘cyt’ (cytosol) and ‘mit’ (mitochondrion).
Chapter 2
54
Figure 2.5 Sensitivity analysis showing the covariance-weighted sum of squared residuals (the fluxfit error) between measured and fitted 13C-enrichment data over a range of malic enzyme and net cytosolic malate dehydrogenase fluxes. Optimizations were run at various fixed malic enzyme fluxes. For each malic enzyme flux the net cytosolic malate dehydrogenase was forced stepwise from the free fit value to lower values. Flux distributions of the square data points are shown in detail in figures 2.4 and 2.6: the top right point represents the best fit (Fig. 2.4), the lower left, top left and lower right are respectively the top, middle and lower values in figure 2.6. The black surface in the lower left of the figure contains errors higher than 150.
the malate dehydrogenase flux was left free, the best fit represented a situation where the TCA cycle supplied the excreted succinate and fumarate, but the nonoxidative pathway still provided 94% of all excreted malate (Fig. 2.6, middle values). The fluxfit error for this situation was 18, double the fluxfit error for the best fit. In the other extreme scenario, the net cytosolic malate dehydrogenase flux was forced to zero, while the malic enzyme flux was fixed at the value obtained for the fit shown in Fig. 2.4. In this scenario, 35% of the excreted malate was produced via the non-oxidative pathway, while the remainder was produced via oxidative TCA pathway (Fig. 2.6, lower values). In this case, all succinate and fumarate was derived from the TCA cycle. For this situation the fluxfit error was 12, 1.5-fold higher than the fluxfit error for the best fit.
Malic acid producing S. cerevisiae
Glucose 3 3 3 BIOMASS
Glucose-6-P 78 (200) 94 (3040) 86 (2907)
124 (744) 124 (934) 124 (690)
CO2
BIOMASS
21 21 21
Cytosol
100 100 100
Glycerol
20 4 11
6 (211) 1 (2) 3 (34)
CO2
13 (0) 2 (65) 7 (0)
C2
F6P 91 96 93
1 1 1
21 21 21
7 (0) 1 (88) 4 (58)
G3P
0 (563) 35 (664) 0 (1399)
Malatecyt
38 38 38
1 (65) -2 (87) -13 (101)
Fumaratecyt
1 1 1
0 0 0 8 8 8
7 (3) 1 (54) 4 (4) BIOMASS
C3
166 171 169
Oxaloacetatecyt
1 1 1
S7P
E4P
55 (99) 61 (1217) 16 (2) Pyruvatecyt 49 0 CO2 49 0 90 41
62 62 62
7 (173) 1 (54) 4 (214)
P5P
Succinatecyt
48 (0) 13 (1) 89 (0)
Pyruvatemit
53 59 56
2 2 2 BIOMASS
Oxaloacetatemit
39 (0) 0 (0) 24 (0)
0 (0) 3 (0) 14 (0)
8 (238) 8 (36) 8 (104)
3 3 3
CO2
AcCoAmit
1 1 1
55 CO2
3 (542) 43 (982) -36 (793)
Malatemit 41 (0) 43 (987) 30 (1382)
49 55 52
Fumaratemit 41 (271) 46 (1052) 44 (998)
2 CO2
Succinatemit Mitochondrion
Figure 2.6 Flux profiles for three highlighted situations from the sensitivity analysis of figure 2.5. Fluxes (in moles) are normalized for a glucose uptake of 100 moles. Arrows indicate the direction of the (net) flux. In case of reversible reactions, the exchange flux is included in parentheses. Some arrows are dashed to improve readability. Metabolites present in both compartments are differentiated by the indications ‘cyt’ (cytosol) and ‘mit’ (mitochondrion). Top numbers: malic enzyme and net cytosolic malate dehydrogenase fluxes forced to 0. Middle numbers: malic enzyme flux forced to 0. Lower numbers: malic enzyme flux forced to the value obtained for the best fit and net cytosolic malate dehydrogenase flux forced to 0.
Chapter 2
Discussion
56
Contribution of different pathways to malate production. High-yield production of malate by engineered S. cerevisiae strains requires the exclusive use of the non-oxidative pathway of malate production. While involvement of the glyoxylate pathways could be excluded based on enzyme activity assays, this method was not applicable for analyzing involvement of the oxidative TCA cycle pathway. Use of [1-13C]-glucose to distinguish between the production of malate via the nonoxidative route and oxidative TCA cycle pathways has been described previously (42). That approach was based on the assumption that conversion of [1-13C]-glucose through the non-oxidative pathway yields [3-13C]-malate, the oxidative glyoxylate pathway would yield [2,3-13C]-malate, and the oxidative TCA cycle pathway would result in the formation of [1,2,3,4-13C]-malate. Strong 13C-enrichment of malate at the C3 atom would then be indicative of an active non-oxidative pathway (42). Several effects may complicate the above interpretation of 13C-labeling patterns of malate. Firstly, 13CO2, a product of the oxidative pentose phosphate pathway (PPP), can participate in carboxylation reactions. Secondly, the nonoxidative part of the PPP yields [1,2,3-13C]-pyruvate (29). Moreover, reversible reactions often result in more complex labeling. For example, even in the absence of a net flux, malate dehydrogenase activity can equilibrate the labeling patterns of oxaloacetate and malate. Oxaloacetate can then be used in the oxidative TCA or glyoxylate cycle pathways. Alternatively, interconversion of malate and fumarate by fumarase may result in redistribution of malate labeling due to the symmetry of fumarate. These “scrambling” effects are especially relevant when, as is the case in the present study, malate yields are significantly lower than the maximum theoretical yield. These complications were taken into account in the metabolic flux analysis performed in this study. Their impact can for instance be seen in the optimal fit scenario (Fig. 2.4), in which all excreted malate is derived from the non-oxidative pathway, but the calculated 13C-labeling of the C3 of malate was only 32%. This enrichment is much lower than the 51% enrichment that would be predicted when [1-13C]-glucose is converted solely via the non-oxidative pathway without interference of scrambling reactions. By taking into account the involvement of the PPP, which in the model results in a 13C-enrichment at the C3 atom of pyruvate of only 45%, and a high fumarase exchange flux, resulting in redistribution of the 13Clabel over the C2 and C3 carbon atoms of malate, it was nevertheless fully compatible with exclusive involvement of the non-oxidative pathway. Although the best fit for the observed 13C-labeling patterns indicated an exclusive involvement of the non-oxidative pathway (Fig. 2.4), the fluxfit errors of
Malic acid producing S. cerevisiae alternative scenarios that involved a contribution of the oxidative TCA cycle pathway were not high enough to reject them. An argument in favor of a predominant role of the non-oxidative pathway in malate production is the strong positive effect of MDH3∆SKL overexpression on malate production (Fig. 2.2). As malate dehydrogenase overexpression specifically targets the non-oxidative pathway, its key role in malate production seems difficult to reconcile with flux fits in which the oxidative TCA cycle pathway made a significant contribution and cytosolic malate dehydrogenase activities were low or absent (Fig. 2.6). Metabolic engineering of S. cerevisiae for malate production. In a previous study, we developed a pyruvate decarboxylase-negative strain of S. cerevisiae that lacks two important phenotypic characteristics of such strains: the requirement for a C2-compound and an inability to grow at high glucose concentrations (34). The results presented in this study confirm that this strain is a suitable platform for metabolic engineering: high levels of malate were produced under conditions that would result in vigorous alcoholic fermentation in wild-type strains. The present study shows that the S. pombe malate transporter SpMae1p, which has previously been applied to metabolically engineer S. cerevisiae for improved malate uptake (6, 58), can also be used to facilitate malate export. Malate export was shown to be a crucial process in metabolic engineering of S. cerevisiae for malate production (Fig. 2.2). However, the requirement for a heterologous malate transporter was not absolute. Even in the absence of SpMAE1, strains that overexpressed PYC2 and especially MDH3∆SKL produced higher concentrations of malate than the pyruvate decarboxylase-negative host strain (Fig. 2.2). Under the experimental conditions, the intra- and extracellular pH values were above the pKa values of malate (3.40 and 5.11), with only a small fraction of malate present in its uncharged, fully undissociated form. As it is unlikely that malate anions can diffuse freely across the plasma membrane at a significant rate, these results suggest the presence of a low-capacity native malate exporter. Indeed, a dicarboxylate transporter was recently identified in S. cerevisiae (2), which was shown to transport succinate with competitive inhibition by malate. The impact of overexpressing PYC2 was generally small, except when MDH3∆SKL or SpMAE1 was also overexpressed. This can probably be explained by very low cytosolic malate dehydrogenase and malate transport activity in the host strain. In wild-type S. cerevisiae, Mdh2p, the cytosolic isoenzyme of malate dehydrogenase (38), is subject to glucose-induced proteolysis (50) and glucose repression at the mRNA level (5). In contrast, pyruvate carboxylase is an essential anaplerotic enzyme that is expressed at significant levels in glucose-grown cultures of wild-type S. cerevisiae (23, 47, 54, 59).
57
Chapter 2
58
The highest malate yield achieved in this study (0.42 mol per mol glucose) is still significantly lower than both the maximal theoretical yield that can be achieved via reduction of oxaloacetate (2 mol per mol) or the actual yields that have been achieved with A. flavus (up to 1.26 mol per mol glucose), which lacks “generally regarded as safe” (GRAS) status. Malate production in the best performing S. cerevisiae strain RWB525 was accompanied by respiratory dissimilation of glucose and the formation of pyruvate, glycerol, succinate and fumarate. The residual production of pyruvate, the precursor for malate production and the main metabolite produced by the Pdc- host strain (34), indicates that the kinetics of the malate production pathway can still be further improved. Glycerol production is probably a consequence of the combination of a high rate of pyruvate production and a limited capacity of reoxidation of cytosolic NADH by mitochondrial respiration (3). This limitation may have been augmented by oxygen limitation, which readily occurs in shake flask cultures. With regard to succinate and fumarate, we observed higher concentrations of these acids after the introduction of SpMAE1p, suggesting that, in addition to malate, SpMAE1p also mediates the export of succinate and fumarate. This observation is in agreement with earlier findings in S. pombe where SpMAE1 is required for malic and succinic acid import (21). In addition, overexpression of SpMAE1 in S. cerevisiae has been reported to enable import of malic acid, succinic and fumaric acid (6). The malate titers and yields achieved in this study are the highest that have hitherto been reported for S. cerevisiae (Table 2.1) and provide a good basis for further metabolic engineering of the production of C4-dicarboxylic acids by S. cerevisiae. Analysis and improvement of the in vivo kinetics of malate production, as well as analysis of the pathways involved in byproduct formation, will be important aspects in future research.
Acknowledgements The Ph.D. research of RMZ is financed by Tate & Lyle Ingredients Americas. The Kluyver Centre for Genomics of Industrial Fermentation is supported by the Netherlands Genomics Initiative. We thank Dr. Stanley Bower, Dr. Jefferson C. Lievense, Dr. Chi-Li Liu, Prof. Carlos Gancedo, Dr. Carmen-Lisette Flores and Dr. Albert de Graaf for stimulating discussions. We acknowledge the contributions of Ann-Kristin Stave and Rosario F. Berriel to construction of the strains and of Marijke Luttik, Eline Huisjes and Tiemen Zijlmans to subcellular localization experiments.
Malic acid producing S. cerevisiae Supplemental Table 2.S1 Carbon atom mappings of the reactions of the studied metabolic model. Reactions with a forward arrow were modeled as being unidirectional, whereas those with a two way arrow were modeled as reversible. Abbreviations: GLC: glucose, G6P: glucose-6-phosphate, F6P: fructose-6-phosphate, G3P: glyceraldehyde-3-phosphate, PYR: pyruvate, P5P: xylulose-5-phosphate/ribose-5-phosphate/ribulose-5-phosphate, E4P: erythrose-4-phosphate, S7P: sedoheptulose-7-phosphate, OAA: oxaloacetate, MAL: malate, FUM: fumarate, SUC: succinate, ACCOA: acetyl-CoA, GLY: glycerol, mit: mitochondrial, cyt: cytosolic. Reactions Glycolysis
Pentose Phosphate Pathway
→ G6P (abcdef) G6P (abcdef) F6P (abcdef) F6P (abcdef) → G3P (cba) + G3P (def) G3P (abc) → PYRcyt (abc) GLC (abcdef)
Uncategorized cytosolic reactions PYRcyt (abc) + CO2 (d)
→
OAAcyt (abcd)
MALcyt (abcd) MALcyt (abcd) FUMcyt (abcd) FUMcyt (abcd) → ½ FUMcyt (abcd) + ½ FUMcyt (dcba) FUMcyt (abcd) SUCcyt (abcd) SUCcyt (abcd) → ½ SUCcyt (abcd) + ½ SUCcyt (dcba) G3P (abc) → ½ GLY (abc) + ½ GLY (cba) OAAcyt (abcd)
Mitochondrial PYRmit (abc)
→
→ CO2 (a) + P5P (bcdef) P5P (abcde) C2 (ab) + G3P (cde) F6P (abcdef) C2 (ab) + E4P (cdef) S7P (abcdefg) C2 (ab) + P5P (cdefg) F6P (abcdef) C3 (abc) + G3P (def) S7P (abcdefg) C3 (abc) + E4P (defg) G6P (abcdef)
Intracellular transport reactions
PYRmit (abc) OAAcyt (abcd) OAAmit (abcd) MALcyt (abcd) MALmit (abcd) FUMcyt (abcd) FUMmit (abcd) SUCcyt (abcd) SUCmit (abcd) PYRcyt (abc)
Biomass formation related reactions CO2 (a) + ACCOAmit (bc)
ACCOAmit (ab) + OAAmit (cdef)
→
SUCmit (abde) + 2 CO2 (c, f)
→ ½ SUCmit (abcd) + ½ SUCmit (dcba) FUMmit (abcd) → ½ FUMmit (abcd) + ½ FUMmit (dcba) SUCmit (abcd) FUMmit (abcd) FUMmit (abcd) MALmit (abcd) MALmit (abcd) OAAmit (abcd) MALmit (abcd) → PYRmit (abc) + CO2 (d)
ACCOAmit PYRmit
→
→
biomass
biomass
ACCOAmit (ab) + OAAmit (cdef)
→
CO2 (c)
SUCmit (abcd)
Plasma membrane transport reactions
→ PYRextracellular OAAcyt → OAAextracellular SUCcyt → SUCextracellular FUMcyt → FUMextracellular MALcyt → MALextracellular GLYcyt → GLYextracellular CO2intracellular (a) CO2extracellular (a) PYRcyt
59
Chapter 2
References
60
1. Abe S., A. Furuya, T. Saito, and K. Takayama. November 1962. Method of producing L-malic acid by fermentation. U.S. Patent 3,063,910. 2. Aliverdieva D. A., D. V. Mamaev, D. I. Bondarenko, and K. F. Sholtz. 2006. Properties of yeast Saccharomyces cerevisiae plasma membrane dicarboxylate transporter. Biochemistry Mosc. 71:1161-1169. 3. Bakker B. M., K. M. Overkamp, A. J. van Maris, P. Kötter, M. A. Luttik, J. P. van Dijken, and J. T. Pronk. 2001. Stoichiometry and compartmentation of NADH metabolism in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 25:15-37. 4. Battat E., Y. Peleg, A. Bercovitz, J. S. Rokem, and I. Goldberg. 1991. Optimization of L-malic acid production by Aspergillus flavus in a stirred fermentor. Biotechnol. Bioeng. 37:1108-1116. 5. van den Berg M. A., P. de Jong-Gubbels, and H. Y. Steensma. 1998. Transient mRNA responses in chemostat cultures as a method of defining putative regulatory elements: Application to genes involved in Saccharomyces cerevisiae acetylcoenzyme A metabolism. Yeast 14:1089-1104. 6. Camarasa C., F. Bidard, M. Bony, P. Barre, and S. Dequin. 2001. Characterization of Schizosaccharomyces pombe malate permease by expression in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 67:4144-4151. 7. Chibata I., T. Tosa, and I. Takata. 1983. Continuous production of L-malic acid by immobilized cells. Trends Biotechnol. 1:9-11. 8. Dakin H. D. 1924. The formation of l-malic acid as a product of alcoholic fermentation by yeast. J. Biol. Chem. 61:139-145. 9. Daran-Lapujade P., M. L. A. Jansen, J. Daran, W. van Gulik, J. H. de Winde, and J. T. Pronk. 2004. Role of transcriptional regulation in controlling fluxes in central carbon metabolism of Saccharomyces cerevisiae: a chemostat culture study. J. Biol. Chem. 279:9125-9138. 10. van Dijken J. P., J. Bauer, L. Brambilla, P. Duboc, J. M. Francois, C. Gancedo, M. L. F. Giuseppin, J. J. Heijnen, M. Hoare, H. C. Lange, E. A. Madden, P. Niederberger, J. Nielsen, J. L. Parrou, T. Petit, D. Porro, M. Reuss, N. van Riel, M. Rizzi, H. Y. Steensma, C. T. Verrips, J. Vindeløv, and J. T. Pronk. 2000. An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains. Enzyme Microb. Technol. 26:706714. 11. Duarte N. C., M. J. Herrgård, and B. Ø. Palsson. 2004. Reconstruction and validation of Saccharomyces cerevisiae iND750, a fully compartmentalized genome-scale metabolic model. Genome Res. 14:1298-1309.
Malic acid producing S. cerevisiae 12. Fatichenti F., G. A. Farris, P. Deiana, and S. Ceccarelli. 1984. Malic acid production and consumption by selected of Saccharomyces cerevisiae under anaerobic and aerobic conditions. Appl. Microbiol. Biotechnol. 19:427-429. 13. Flikweert M. T., M. de Swaaf, J. P. van Dijken, and J. T. Pronk. 1999. Growth requirements of pyruvate-decarboxylase-negative Saccharomyces cerevisiae. FEMS Microbiol. Lett. 174:73-79. 14. Flikweert M. T., L. van der Zanden, W. M. T. M. Janssen, H. Y. Steensma, J. P. van Dijken, and J. T. Pronk. 1996. Pyruvate decarboxylase: an indispensable enzyme for growth of Saccharomyces cerevisiae on glucose. Yeast 12:247257. 15. Gancedo C., and K. Schwerzmann. 1976. Inactivation by glucose of phosphoenolpyruvate carboxykinase from Saccharomyces cerevisiae. Arch. Microbiol. 109:221-225. 16. Geiser D. M., J. I. Pitt, and J. W. Taylor. 1998. Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proc. Natl. Acad. Sci. U.S.A. 95:388-393. 17. Gietz R. D., and R. A. Woods. 2002. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Meth. Enzymol. 350:87-96. 18. Gietz R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534. 19. Giorno L., E. Drioli, G. Carvoli, A. Cassano, and L. Donato. 2001. Study of an enzyme membrane reactor with immobilized fumarase for production of L-malic acid. Biotechnol. Bioeng. 72:77-84. 20. Goldberg I., J. S. Rokem, and O. Pines. 2006. Organic acids: old metabolites, new themes. J. Chem. Technol. Biotechnol. 81:1601-1611. 21. Grobler J., F. Bauer, R. E. Subden, and H. J. J. van Vuuren. 1995. The mae1 gene of Schizosaccharomyces pombe encodes a permease for malate and other C4 dicarboxylic acids. Yeast 11:1485-1491. 22. Güldener U., S. Heck, T. Fielder, J. Beinhauer, and J. Hegemann. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucl. Acids Res. 24:2519-2524. 23. Haarasilta S., and L. Taskinen. 1977. Location of three key enzymes of gluconeogenesis in baker’s yeast. Arch. Microbiol. 113:159-161. 24. Hohmann S. 1991. Characterization of PDC6, a third structural gene for pyruvate decarboxylase in Saccharomyces cerevisiae. J. Bacteriol. 173:7963-7969.
61
Chapter 2
62
25. Inoue H., H. Nojima, and H. Okayama. 1990. High efficiency transformation of Escherichia coli with plasmids. Gene 96:23-28. 26. de Jong-Gubbels P., J. Bauer, P. Niederberger, I. Stückrath, P. Kötter, J. P. van Dijken, and J. T. Pronk. 1998. Physiological characterisation of a pyruvatecarboxylase-negative Saccharomyces cerevisiae mutant in batch and chemostat cultures. Antonie Van Leeuwenhoek 74:253-263. 27. de Jong-Gubbels P., P. Vanrolleghem, S. Heijnen, J. P. Van Dijken, and J. T. Pronk. 1995. Regulation of carbon metabolism in chemostat cultures of Saccharomyces cerevisiae grown on mixtures of glucose and ethanol. Yeast 11:407-418. 28. Kawagoe M., K. Hyakumura, S. Suye, K. Miki, and K. Naoe. 1997. Application of bubble column fermentors to submerged culture of Schizophyllum commune for production of L-malic acid. J. Ferment. Bioeng. 84:333-336. 29. Kleijn R. J., W. A. van Winden, W. M. van Gulik, and J. J. Heijnen. 2005. Revisiting the 13C-label distribution of the non-oxidative branch of the pentose phosphate pathway based upon kinetic and genetic evidence. FEBS J. 272:49704982. 30. Lange H. C., and J. J. Heijnen. 2001. Statistical reconciliation of the elemental and molecular biomass composition of Saccharomyces cerevisiae. Biotechnol. Bioeng. 75:334-344. 31. Lowry O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193:265-75. 32. Lumyong S., and F. Tomita. 1993. L-malic acid production by an albino strain of Monascus araneosus. World J. Microbiol. Biotechnol. 9:383-384. 33. Luttik M. A., K. M. Overkamp, P. Kotter, S. de Vries, J. P. van Dijken, and J. T. Pronk. 1998. The Saccharomyces cerevisiae NDE1 and NDE2 genes encode separate mitochondrial NADH dehydrogenases catalyzing the oxidation of cytosolic NADH. J. Biol. Chem. 273:24529-24534. 34. van Maris A. J. A., J. A. Geertman, A. Vermeulen, M. K. Groothuizen, A. A. Winkler, M. D. W. Piper, J. P. van Dijken, and J. T. Pronk. 2004. Directed evolution of pyruvate decarboxylase-negative Saccharomyces cerevisiae, yielding a C2independent, glucose-tolerant, and pyruvate-hyperproducing yeast. Appl. Environ. Microbiol. 70:159-166. 35. van Maris A. J. A., B. M. Bakker, M. Brandt, A. Boorsma, M. J. Teixeira de Mattos, L. A. Grivell, J. T. Pronk, and J. Blom. 2001. Modulating the distribution of fluxes among respiration and fermentation by overexpression of HAP4 in Saccharomyces cerevisiae. FEMS Yeast Res. 1:139-149.
Malic acid producing S. cerevisiae 36. McAlister-Henn L., J. S. Steffan, K. I. Minard, and S. L. Anderson. 1995. Expression and function of a mislocalized form of peroxisomal malate dehydrogenase (MDH3) in yeast. J. Biol. Chem. 270:21220-21225. 37. Minard K. I., and L. McAlister-Henn. 1992. Glucose-induced degradation of the MDH2 isozyme of malate dehydrogenase in yeast. J. Biol. Chem. 267:1745817464. 38. Minard K. I., and L. McAlister-Henn. 1991. Isolation, nucleotide sequence analysis, and disruption of the MDH2 gene from Saccharomyces cerevisiae: evidence for three isozymes of yeast malate dehydrogenase. Mol. Cell. Biol. 11:370-380. 39. Minard K. I., and L. McAlister-Henn. 1994. Glucose-induced phosphorylation of the MDH2 isozyme of malate dehydrogenase in Saccharomyces cerevisiae. Arch. Biochem. Biophys. 315:302-309. 40. Mumberg D., R. Müller, and M. Funk. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156:119-122. 41. Ordiz I., P. Herrero, R. Rodicio, and F. Moreno. 1996. Glucose-induced inactivation of isocitrate lyase in Saccharomyces cerevisiae is mediated by the cAMPdependent protein kinase catalytic subunits Tpk 1 and Tpk2. FEBS Lett. 385:43-46. 42. Peleg Y., A. Barak, M. C. Scrutton, and I. Goldberg. 1989. Malic acid accumulation by Aspergillus flavus. III. 13C NMR and isoenzyme analyses. Appl. Microbiol. Biotechnol. 30:176-183. 43. Peleg Y., B. Stieglitz, and I. Goldberg. 1988. Malic acid accumulation by Aspergillus flavus. I. Biochemical aspects of acid biosynthesis. Appl. Microbiol. Biotechnol. 28:69-75. 44. Pines O., S. Even-Ram, N. Elnathan, E. Battat, O. Aharonov, D. Gibson, and I. Goldberg. 1996. The cytosolic pathway of L-malic acid synthesis in Saccharomyces cerevisiae: the role of fumarase. Appl. Microbiol. Biotechnol. 46:393-399. 45. Pines O., S. Shemesh, E. Battat, and I. Goldberg. 1997. Overexpression of cytosolic malate dehydrogenase (MDH2) causes overproduction of specific organic acids in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 48:248-255. 46. Postma E., C. Verduyn, W. A. Scheffers, and J. P. Van Dijken. 1989. Enzymic analysis of the Crabtree effect in glucose-limited chemostat cultures of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 55:468-477. 47. Rohde M., F. Lim, and J. C. Wallace. 1991. Electron microscopic localization of pyruvate carboxylase in rat liver and Saccharomyces cerevisiae by immunogold procedures. Arch. Biochem. Biophys. 290:197-201.
63
Chapter 2
64
48. Sambrook J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 49. Schwartz H., and F. Radler. 1988. Formation of L(-)malate by Saccharomyces cerevisiae during fermentation. Appl. Microbiol. Biotechnol. 27:553-560. 50. Steffan J., and L. McAlister-Henn. 1992. Isolation and characterization of the yeast gene encoding the MDH3 isozyme of malate dehydrogenase. J. Biol. Chem. 267:24708-24715. 51. Stucka R., S. Dequin, J. Salmon, and C. Gancedo. 1991. DNA sequences in chromosomes II and VII code for pyruvate carboxylase isoenzymes in Saccharomyces cerevisiae: analysis of pyruvate carboxylase-deficient strains. Mol. Gen. Genet. 229:307-315. 52. Taing O., and K. Taing. 2006. Production of malic and succinic acids by sugar-tolerant yeast Zygosaccharomyces rouxii. Eur. Food Res. Technol. 224:343-347. 53. Takao S., A. Yokota, and M. Tanida. 1983. L-Malic acid fermentation by a mixed culture of Rhizopus arrhizus and Paecilomyces varioti. J. Ferment. Technol. 61:643-645. 54. van Urk H., D. Schipper, G. J. Breedveld, P. R. Mak, W. A. Scheffers, and J. P. Van Dijken. 1989. Localization and kinetics of pyruvate-metabolizing enzymes in relation to aerobic alcoholic fermentation in Saccharomyces cerevisiae CBS 8066 and Candida utilis CBS 621. Biochim. Biophys. Acta. 992:78-86. 55. Verduyn C., E. Postma, W. A. Scheffers, and J. P. van Dijken. 1992. Effect of benzoic acid on metabolic fluxes in yeasts: A continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast 8:501-517. 56. Verduyn C., T. P. L. Zomerdijk, J. P. van Dijken, and W. A. Scheffers. 1984. Continuous measurement of ethanol production by aerobic yeast suspensions with an enzyme electrode. Appl. Microbiol. Biotechnol. 19:181-185. 57. Volschenk H., H. J. J. van Vuuren, and M. Viljoen-Bloom. 2003. Maloethanolic fermentation in Saccharomyces and Schizosaccharomyces. Curr. Genet. 43:379391. 58. Volschenk H., M. Viljoen, J. Grobler, B. Petzold, F. Bauer, R. E. Subden, R. A. Young, A. Lonvaud, M. Denayrolles, and H. J. van Vuuren. 1997. Engineering pathways for malate degradation in Saccharomyces cerevisiae. Nat. Biotech. 15:253-257. 59. Walker M. E., D. L. Val, M. Rohde, R. J. Devenish, and J. C. Wallace. 1991. Yeast pyruvate carboxylase: Identification of two genes encoding isoenzymes. Biochem. Biophys. Res. Commun. 176:1210-1217.
Malic acid producing S. cerevisiae 60. Werpy T., and G. Petersen. 2004. Top value added chemicals from biomass: I. Results of screening for potential candidates from sugars and synthesis gas. U.S. Department of Energy, Washington, DC. 61. Wiechert W. 2001. 13C Metabolic flux analysis. Metab. Eng. 3:195-206. 62. van Winden W. A., J. C. van Dam, C. Ras, R. J. Kleijn, J. L. Vinke, W. M. van Gulik, and J. J. Heijnen. 2005. Metabolic-flux analysis of Saccharomyces cerevisiae CEN.PK113-7D based on mass isotopomer measurements of 13C-labeled primary metabolites. FEMS Yeast Res. 5:559-568.
65
Chapter 3 Key process conditions for production of C4dicarboxylic acids in bioreactor batch cultures of an engineered Saccharomyces cerevisiae strain Rintze M. Zelle, Erik de Hulster, Wendy Kloezen, Jack T. Pronk, and Antonius J. A. van Maris Published in Applied and Environmental Microbiology, February 2010, Vol. 76, No. 3, p. 744-750 (doi:10.1128/AEM.02396-09)
Chapter 3
Abstract
68
A recent effort to improve malic acid production by Saccharomyces cerevisiae by means of metabolic engineering resulted in a strain that produced up to 59 g l-1 of malate at a yield of 0.42 mol (mol glucose)-1 in calcium carbonate-buffered shake flask cultures. With shake flasks, process parameters that are important for scaling up this process cannot be controlled independently. In this study, growth and product formation by the engineered strain were studied in bioreactors in order to separately analyze the effects of pH, calcium, carbon dioxide and oxygen availability. A nearneutral pH, which in shake flasks was achieved by adding CaCO3, was required for efficient C4-dicarboxylic acid production. Increased calcium concentrations, a side effect of CaCO3 dissolution, had a small positive effect on malate formation. Carbon dioxide enrichment of the sparging gas [up to 15% (v/v)] improved production of both malate and succinate. At higher concentrations, succinate titers further increased, reaching 0.29 mol (mol glucose)-1, whereas malate formation strongly decreased. Although fully aerobic conditions could be achieved, it was found that moderate oxygen limitation benefitted malate production. In conclusion, malic acid production with the engineered S. cerevisiae strain could be successfully transferred from shake flasks to 1-liter batch bioreactors by simultaneous optimization of four process parameters (pH and concentrations of CO2, calcium and O2). Under optimized conditions, a malate yield of 0.48 ± 0.01 mol (mol glucose)-1 was obtained in bioreactors, a 19% increase over shake flask experiments.
C4-acid production by engineered S. cerevisiae
Introduction In recent years, biologically-produced 1,4-dicarboxylic acids (succinate, malate and fumarate) have attracted great interest as more sustainable replacements for oilderived commodity chemicals, such as maleic anhydride (50). Malate is currently mainly produced via petrochemical routes for use in food and beverages (18). Development of a biotechnological production process started in the early 1960s with the investigation of the natural malate producer Aspergillus flavus (2). Although process improvements eventually resulted in high product yields and productivities (6), the potential production of aflatoxins (20) prevented the use of this filamentous fungus in industry. Other investigated natural malate-producing fungi [listed in (51)] produced insufficient malate for industrial use. With the rational design options of metabolic engineering, microorganisms that do not naturally produce large amounts of malic acid may also be considered as production platforms. Wild-type Saccharomyces cerevisiae strains produce little, if any, malate, but would be an interesting starting point for the construction of an efficient malate producer. This yeast has a relatively high tolerance to organic acids and low pH and, due to its role as a model organism in research, a well-developed metabolic engineering toolbox is available. In addition, wild-type S. cerevisiae strains have the GRAS (Generally Regarded As Safe) status, so that modified strains are more likely to be allowed in the production of food-grade malic acid. One of the main challenges in the development of an organic acid producing strain of S. cerevisiae has been the elimination of ethanol formation, which in wild-type strains occurs even under aerobic conditions when glucose concentrations are high (45). Deletion of the pyruvate decarboxylase encoding genes was found to prevent ethanolic fermentation (17). After evolutionary engineering to remove the growth defects usually associated with pyruvate decarboxylase-negative S. cerevisiae strains, a strain was obtained that produced large amounts of pyruvate, a direct precursor to malate, when grown on glucose (42). Subsequent overexpression of the anaplerotic enzyme pyruvate carboxylase, a cytosolically relocalized malate dehydrogenase and a heterologous malate transporter from Schizosaccharomyces pombe led to a strain that produced significant amounts of malate (51). Cultivation in calcium carbonate (CaCO3) buffered shake flasks resulted in malate titers of up to 59 g l-1 at a yield of 0.42 mol (mol glucose)-1. There are many differences between cultivation in shake flasks and in laboratory or industrial bioreactors. As shake flask cultures lack online pH monitoring and control, there is often significant pH variation over time. The pH is of particular importance. If the yeast can be persuaded to produce organic acids at
69
Chapter 3
70
lower pH values, this reduces the need for active neutralization and thereby reduces byproduct formation such as gypsum. However, thermodynamic constraints on acid export, as well as increased stress levels from (undissociated) acid and the low pH, often limit the ability of the microorganisms to produce acids at low pH (32, 43). For this reason, the poorly soluble CaCO3 has traditionally been used to maintain a near-neutral pH in malic acid-producing microbial cultures (6, 29, 51). Adding CaCO3 also gives increased concentrations of bicarbonate (and thereby CO2), a substrate for pyruvate carboxylase in the carboxylation of pyruvate (a C3-carbon molecule) to oxaloacetate (C4-carbon), as well as calcium. Calcium is known to be involved in cellular signaling pathways (22, 26, 33, 46) and to influence pyruvate carboxylase activity (21, 24). Finally, oxygen transfer rates in shake flasks are often poor when compared to stirred (laboratory) bioreactors. The formation of significant concentrations (25 g l-1) of glycerol, a well-known redox sink in S. cerevisiae (41), in shake flask cultures of the engineered malate-producing strain (51) was a strong indication for oxygen limitation. Initial experiments in aerobic, pH-controlled bioreactor cultures of the malate- and succinate-producing Saccharomyces cerevisiae strain RWB525 only yielded low concentrations of these C4-dicarboxylic acids. The goal of the present study was to identify process parameters that explain the different production levels in shake flask and bioreactor cultures. To this end, we analyzed, both separately and in combination, the impact of culture pH and concentrations of calcium, carbon dioxide and oxygen on the production of malate and succinate.
Materials and Methods Strain and maintenance. The malate producing strain RWB525 (51) is derived from the S. cerevisiae CEN.PK strain family (40). Stock cultures were prepared from shake flask cultures grown on 100 ml synthetic medium consisting of demineralized water, 20 g l-1 glucose, 5 g l-1 (NH4)2SO4, 3 g l-1 KH2PO4, 0.5 g l-1 MgSO4 7 H2O, vitamins and trace elements (44), pH 6 (set with KOH). 500 ml round-bottom shake flasks were incubated at 30°C and 200 rpm in a rotary shaker. After addition of glycerol (20% v/v), 2-ml aliquots were stored at -80°C. Shake flask cultivations. Inocula for batch fermentations were obtained by inoculating preculture shake flasks with 2 ml frozen stock culture. The preculture medium was identical to the stock culture medium, except that urea (2.3 g l-1) was used instead of (NH4)2SO4 and 6.6 g l-1 K2SO4 was added. After 48 h incubation, the biomass was centrifuged and resuspended in 10 ml demineralized water. The cell suspension was then evenly distributed over two shake flasks with fresh medium, in order to obtain more biomass. After an additional 24 hours, biomass was again
C4-acid production by engineered S. cerevisiae collected by centrifuging, resuspended in demineralized water, and used to inoculate the bioreactors at an initial dry weight of ca. 0.25 g l-1. Calcium carbonate-buffered shake flask cultures for malic acid production were performed as described earlier (51). Bioreactor batch fermentations. Aerobic batch cultivation was done at 30°C in 2-liter bioreactors (Applikon, Schiedam, the Netherlands) with a working volume of 1 liter. The pH was controlled by the automatic titration of base (10 M KOH was used to minimize dilution of the fermentation broth). For fermentations run at a pH below that of the medium (pH 4.8, low buffering capacity), no correction was made by acid addition (here the desired pH was attained within the first few hours after inoculation). The bioreactors were sparged with 0.5 liter gas per minute and stirred at 800 rpm, which ensured dissolved oxygen concentrations above 30% of air saturation as measured by an oxygen electrode for non-oxygen limited fermentations. For CO2-enriched fermentations, pure CO2 was mixed with air, except when gaseous CO2 concentrations above 15% were needed. In those cases, a blend of 21% O2 and 79% CO2 was mixed with air to maintain a sufficiently high concentration of dissolved oxygen. The medium was identical to the stock culture medium, except for the nitrogen source (1 g l-1 urea), the glucose concentration (100 g l-1), the addition of K2SO4 (6.6 g l-1) and, where indicated, CaCl2. Silicon antifoam (BDH, Poole, England) was added to control foaming. Glucose was autoclaved separately (110°C for 20 min), while urea and vitamins were filter sterilized. Dry weight determination. Culture samples (5 ml) were filtrated over oven-dried and weighed nitrocellulose filters (0.45 µm pore size; Gelman Sciences) and washed with demineralized water. After drying the filters in a microwave oven for 20 min at 360W, the filters were weighed again. The weight increase was used to calculate biomass dry weight concentration. Samples from cultures with added CaCl2 were diluted 1:1 with 1 M HCl shortly before filtration, to dissolve precipitates. Metabolite analysis. Extracellular concentrations of acetate, ethanol, fumarate, glucose, glycerol, lactate and succinate were determined by HPLC, using a Bio-Rad Aminex HPX-87H column eluted with 5 mM H2SO4 at a flow rate of 0.6 ml min-1 and at 60°C. Acetate, fumarate and lactate were detected by a Waters 2487 dual-wavelength absorbance detector at 214 nm. Ethanol, glucose, glycerol and succinate were detected with a Waters 2410 refractive index detector. Malate concentrations were determined by enzymic analysis (Enzyplus L-Malic Acid kit no. EZA786, BioControl Systems, Inc.). Pyruvate concentrations were assayed enzymically with a reaction mixture containing 100 mM potassium phosphate buffer (pH 7.5), 0.17 mM NADH and diluted culture supernatant. Pyruvate concentrations
71
Chapter 3 were determined by measuring NADH consumption after addition of lactate dehydrogenase (6 U ml-1). To support HPLC analysis, glucose concentrations were determined enzymatically (EnzyPlus D-Glucose kit no. EZS781). All metabolite and biomass concentrations were corrected for dilution by titration of the cultures with KOH. Precipitates were only found for fermentations supplemented with CaCl2, and dissolving the precipitates by acidification did not result in increased carboxylic acid titers. Data from independent duplicate cultures are presented as average ± deviation from the mean.
Results
72
Aerobic bioreactor batch cultures of the malate-producing, engineered S. cerevisiae strain RWB525 (51) were grown on a synthetic medium with 98 ± 1 g l-1 (542 ± 4 mM) glucose as the sole carbon and energy source (Fig. 3.1A). Temperature and pH were maintained at 30°C and 5.0, respectively, which are routinely used conditions for batch cultivation of S. cerevisiae. In these cultures, growth ceased about 25 h after inoculation. The final biomass concentration of 10 ± 0 g l-1 reached in the bioreactors was higher than the biomass concentration of 6.0 g l-1 obtained with calcium carbonate-buffered shake flasks cultures with 100 ± 1 g l-1 (555 ± 6 mM) glucose, even though bioreactors were inoculated with only 0.25 g l-1 biomass dry weight, versus 1 g l-1 for shake flasks. Fermentation times were similar, with glucose depletion occurring after 83 ± 2 h in bioreactors and after ca. 72 h in shake flasks. When the glucose became depleted, the malate and succinate concentrations in the bioreactor cultures had reached 77 ± 4 and 27 ± 1 mM, respectively (Fig. 3.1A). The malate yield on glucose observed in the bioreactor cultures was a third of that previously found in calcium carbonate-buffered shake flask cultures (0.14 ± 0.01 and 0.41 ± 0.04 mol mol-1, respectively). The succinate yield in the bioreactor cultures was half that in the shake flasks (0.05 ± 0.00 and 0.11 ± 0.03 mol mol-1, respectively). Concentrations of fumarate, already low in shake flask cultures (5 ± 1 mM), were only 1 ± 0 mM in duplicate bioreactor batch cultures. In the bioreactor cultures, half of the substrate carbon was diverted to pyruvate production (565 ± 2 mM, see Fig. 3.1A) rather than to dicarboxylate production. The resulting high pyruvate yield of 1.0 ± 0.0 mol mol-1 was about twice as high as in CaCO3-buffered shake flasks (0.56 ± 0.04 mol mol-1). Conversely, the glycerol yield on glucose was much lower in the bioreactor cultures than in the shake flask cultures (0.08 ± 0.00 and 0.18 ± 0.02 mol mol-1, respectively). This suggested that the efficient aeration in the bioreactors increased the reoxidation of
C4-acid production by engineered S. cerevisiae
15
500 400
10
300 200
5
100 0
Dry weight (g l-1)
Concentration (mM)
A 600
0 0
25
50
75
100
Time (h) 15
500 400
10
300 200
5
100 0
Dry weight (g l-1)
Concentration (mM)
B 600
0 0
25
50
75
100
Time (h)
30°C. A) Culture grown at pH 5, sparged with air, B) Culture grown at pH 6.8, sparging with air/CO2 mixture containing 15 % CO2, C) Culture grown at pH 6.8 supplemented with 10 mM CaCl2, sparged with air/CO2/N2 mixture containing 15% CO2 and a limiting O2 concentration of 3%. Symbols: glucose (), pyruvate (), malate (), succinate (), biomass (▲, right axis).
15
500 400
10
300 200
5
100 0
Dry weight (g l-1)
Concentration (mM)
C 600
Figure 3.1 Extracellular concentrations of glucose and metabolites during aerated bioreactor batch cultivation of the engineered malateproduction strain S. cerevisiae RWB525 on 100 g l-1 glucose at
0 0
25
50
75
100
Time (h)
NADH formed in glycolysis via mitochondrial respiration, while decreasing the reoxidation via reduction of dihydroxyacetone phosphate to glycerol. After glucose had been depleted, the succinate and fumarate concentrations continued to increase slowly, while glycerol, pyruvate and malate concentrations slowly decreased (Fig. 3.1A). The strong pH-dependency of malate productivity. The average pH of approximately 6 in calcium carbonate-buffered shake flasks (51) differed significantly from the KOH-titrated pH of 5.0 used in the reference bioreactor
73
Chapter 3 cultures. As culture pH has a major impact on weak organic acid transport (43), tolerance to organic acids (30), and the process economy of downstream processing, the impact of pH on malate production by S. cerevisiae RWB525 in aerobic bioreactor cultures was studied over a pH range from 2.9 to 6.7. At higher culture pH values, concentrations of dicarboxylic acids increased (Fig. 3.2A and 3.2B) while pyruvate production fell (Fig. 3.2C). The pH dependency of malate production was much more pronounced than that for succinate. Final
A Malate yield
0.4 0.3 0.2 0.1
74
0.0 2
3
4
5
6
7
5
6
7
5
6
7
pH
Succinate yield
B
0.3
0.2
0.1
0.0 2
3
4
pH
C
1.2
Pyruvate yield
1.0 0.8 0.6 0.4 0.2 0.0 2
3
4
pH
Figure 3.2 Molar yields on glucose of malate (A), succinate (B) and pyruvate (C) for aerobic bioreactor batch cultivations of S. cerevisiae RWB525 on 100 g l-1 glucose as a function of pH (each data point represents an independent fermentation). Yields were determined for the time-point at which the highest malate concentration was observed. Closed () and open () symbols indicate sparging with air or air enriched to 10.8 ± 0.4% CO2, respectively.
C4-acid production by engineered S. cerevisiae malate and succinate titers in cultures grown at pH 6.7 were 191 mM and 57 mM, respectively [corresponding to malate and succinate yields of 0.34 and 0.10 mol (mol glucose)-1, respectively]. In cultures grown at a pH of 3.9, only 28 mM malate and 27 mM succinate was produced. Glycerol and fumarate titers showed positive correlations with pH (21 and 1 mM at pH 3.9, 52 and 13 mM at pH 6.7, respectively). In contrast, the final pyruvate concentration reached at pH 6.7 (438 mM) was lower than at pH 3.9 (556 mM). Complete consumption of glucose took considerably longer at low pH, with fermentation times increasing to 101 h at pH 4.2 and 160 h at pH 3.9. At pH 2.9, the lowest pH tested, fermentation became stuck after 96 h, with half the glucose left unconsumed. Carbon balances of the bioreactor batch experiments showed carbon recoveries of 95 ± 4%. Impact of carbon dioxide on C4-dicarboxylic acid production. The previously discussed fermentations were sparged with air, with CO2 concentrations in the off gas averaging 0.4 ± 0.1% over the fermentation experiments and peaking at 1.1 ± 0.3% at the end of the exponential growth phase. We subsequently investigated whether the concentration of CO2 affects dicarboxylic acid yields, for example by influencing the carboxylation of pyruvate. To this end, fermentations were run at different pH values, while sparging the bioreactors with air enriched with 10.8 ± 0.4% CO2. The CO2 enrichment increased malate and succinate yields on glucose over the entire range of pH values tested (Fig. 3.2A and 3.2B), while pyruvate (Fig. 3.2C) and glycerol titers slightly decreased. At pH 3.9, sparging with CO2-enriched air extended the fermentation time to 191 h, an effect not observed at higher pH values. After the positive effect of CO2 on dicarboxylic acid production had been established using a fixed CO2 concentration in the inlet gas, additional cultures were run at pH values of 5 and 6.8 to identify the optimal CO2 concentration for malate and succinate production. At both pH values, a gaseous CO2 concentration of about 15% gave the highest malate yields (Fig. 3.3A). Higher levels of CO2 resulted in lower malate yields, extended fermentation duration (104-115 h at CO2 concentrations of 50% and above) and reduced biomass yields. The latter effect was more pronounced at pH 6.8, where, when 57% CO2 was used, the final biomass concentration was only 6 g l-1. In contrast to the negative impact on malate production of CO2 levels above 15%, succinate titers continued to increase with the CO2 concentration in the sparging gas (Fig. 3.3B). At CO2 concentrations above 50%, succinate even became the dominant dicarboxylic acid at both culture pH values investigated (Fig. 3.4). In the culture grown at 57% CO2 and pH 6.8, succinate and malate yields of 0.29 and 0.19 mol (mol glucose)-1 were obtained. Glycerol and fumarate yields did not
75
Chapter 3 substantially change over the tested range of CO2 concentrations (data not shown), while pyruvate showed a slight negative trend with increasing CO2 levels (Fig. 3.3C). On the basis of the observed effects of pH and CO2 enrichment, duplicate aerobic bioreactor batch cultures on 100 ± 1 g l-1 (553 ± 5 mM) glucose, grown at pH 6.8 and with a CO2 concentration in the inlet gas of 15%, were analyzed in detail (Fig. 3.1B). Compared to the reference cultures (pH 5, sparging with air), a substantially higher malate titer was observed [219 ± 2 mM, corresponding to a
A Malate yield
0.4 0.3 0.2 0.1
76
0.0 0
Succinate yield
B
10
20
30
40
50
60
40
50
60
40
50
60
CO2 (%)
0.3
0.2
0.1
0.0 0
C
10
20
30
CO2 (%)
1.2
Pyruvate yield
1.0 0.8 0.6 0.4 0.2 0.0 0
10
20
30
CO2 (%)
Figure 3.3 Molar yields on glucose of malate (A), succinate (B) and pyruvate (C) for aerobic bioreactor batch cultivations of S. cerevisiae RWB525 on 100 g l-1 glucose as a function of the CO2 concentration in the inlet gas (each data point represents an independent fermentation). Yields were determined for the time-point at which the highest malate concentration was observed. Closed () and open () symbols indicate cultivation at a pH of 5 or 6.8, respectively.
C4-acid production by engineered S. cerevisiae
Molar ratio succinate over malate
2.0 1.5 1.0 0.5 0.0 0
10
20
30
40
50
60
CO2 (%) Figure 3.4 Molar ratio of succinate over malate as a function of the CO2 concentration in the inlet gas for aerobic bioreactor batch cultivations of S. cerevisiae RWB525 on 100 g l-1 glucose (each data point represents an independent fermentation). Ratios were determined for the time-point at which the highest malate concentration was observed. Closed () and open () symbols indicate cultivation at a pH of 5 or 6.8, respectively.
malate yield of 0.40 ± 0.00 mol (mol glucose-1)], while the pyruvate titer decreased to 422 ± 9 mM (0.8 ± 0.0 mol mol-1). Glycerol levels remained around 45 ± 2 mM (0.08 ± 0.00 mol mol-1), while succinate and fumarate increased significantly to 92 ± 7 (0.17 ± 0.01 mol mol-1) and 13 ± 3 mM (0.02 ± 0.01 mol mol-1), respectively. Fermentation time (75 ± 3 h) was slightly shorter than in the reference cultures and the final biomass concentration (8 ± 0 g l-1) was about 20% lower. Effects of calcium on malate production. Although malate production was greatly improved by optimizing the pH and CO2 concentration in the sparging gas, the malate yield of 0.40 mol mol-1 did not surpass the yields obtained in CaCO3buffered shake flasks. As well as increasing pH and CO2 availability, the use of CaCO3 gives a higher Ca2+ concentration. In S. cerevisiae, Ca2+ is involved in signaling pathways, stress responses and maintenance of cellular integrity (22, 26, 46). Ca2+ might also affect production of organic acids by chelation (37). Finally, Ca2+ has been found to influence pyruvate carboxylase activity in rat liver mitochondria (21, 48) and in the yeast Torulopsis glabrata (24). To investigate the possible impact of Ca2+ on dicarboxylic acid production by S. cerevisiae RWB525, concentrations of up to 100 mM CaCl2 were tested in bioreactor batch cultures grown at pH 6.8 and sparged with 15% CO2. Over the range of tested calcium concentrations, a modest increase (ca. 5%) in malate yield
77
Chapter 3
78
was only observed when 5 or 10 mM CaCl2 was added (data not shown). Subsequent fermentation experiments were therefore carried out with 10 mM CaCl2. Positive effect of oxygen limitation on malate production. As mentioned above, oxygen transfer capacities of (unbaffled) shake flasks are much lower than those of laboratory bioreactors. The batch cultivation experiments discussed above all had dissolved oxygen concentrations above 30% of air saturation. To investigate the possible effect of oxygen limitation on malate production, the oxygen concentration in the sparging gas was reduced by using mixtures of air, CO2 and N2, while keeping the culture pH at 6.8 and the CO2 concentration in the inlet gas at 15%. Although complete depletion of oxygen in the off gas did not occur, the reduced oxygen supply did result in oxygen limitation as evident from near-zero dissolved oxygen concentrations. Oxygen limitation did not occur at the start of the fermentation, where biomass concentration was still low, or after glucose had been depleted. With this setup it was observed that with ingoing oxygen concentrations of 2-4%, the total fermentation time was about 100 h, with oxygen limitation occurring during a period of ca. 50 h in the middle of the fermentation. Although the severity of oxygen limitation varied, oxygen limitation in three separate cultures clearly resulted in lower pyruvate [0.57 ± 0.08 mol (mol glucose)-1] and higher malate yields [0.48 ± 0.01 mol (mol glucose)-1]. More severe oxygen limitation, such as achieved by a very low oxygen concentration of 0.4% in the ingoing gas, led to an earlier onset of oxygen limitation but severely lengthened the fermentation: after 144 h, during which biomass dry weight had increased linearly to only 2 g l-1, just one-fifth of the glucose initially present had been consumed. For further analysis, an oxygen percentage of 3% in the ingoing gas was used. To analyze the combined impact of all 4 parameters (pH, CO2, Ca2+ and O2 limitation), duplicate batch experiments were carried out with 100 ± 1 g l-1 (556 ± 3 mM) glucose, pH 6.8, CO2 enriched (15%) air, 10 mM CaCl2 and a reduced oxygen concentration (3%) in the inlet gas (Fig. 3.1C). Compared to cultures without CaCl2 addition and oxygen limitation, the greatest changes were observed for malate titers, which increased from 219 ± 2 mM to 268 ± 5 mM (corresponding to a yield on glucose of 0.48 ± 0.01 mol mol-1), and for pyruvate titers, which decreased from 422 ± 9 mM to 347 ± 18 mM (0.6 ± 0.0 mol mol-1). Final titers of the other metabolites remained at similar levels: 92 ± 2 mM glycerol (0.17 ± 0.00 mol mol-1), 86 ± 1 mM succinate (0.15 ± 0.00 mol mol-1) and 18 ± 0 mM fumarate (0.03 ± 0.00 mol mol-1). The total fermentation time was slightly longer (82 ± 1 h), and biomass dry weight fell to 6 ± 0 g l-1.
C4-acid production by engineered S. cerevisiae
Discussion Impact of culture pH on organic acid production. A strong positive correlation between increasing culture pH and malate yields was found in bioreactor batch cultures of the engineered S. cerevisiae strain RWB525 (Fig. 3.2A). This observation might be explained by the equilibrium thermodynamics of product export (8, 43). Export of malate and succinate in S. cerevisiae RWB525 has been shown to be strongly dependent on expression of the heterologous malate transporter SpMae1 (51), which seems to catalyze electroneutral proton-coupled symport of the monoanion species of these dicarboxylates (9, 36). Export via this transport mechanism would become progressively more difficult as the extracellular pH decreases (Fig. 3.5). Due to the different acid dissociation constants of the two dicarboxylates, this pH dependency is predicted to be more pronounced for malate production than for succinate (Fig. 3.5). This is consistent with the experimental observation that succinate production was much less affected by culture pH than malate production (Fig. 3.2). 79 10 1
Ratio external over internal total acid
10 0 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 2
3
4
5
6
7
pH
Figure 3.5 Theoretical ratios of extracellular over intracellular concentrations of malate (solid line), succinate (dotted line) and pyruvate (dashed line). Equilibrium ratios were calculated on the assumption that all three compounds are exported via monoanion-proton symport, on a proton motive force across the yeast plasma membrane of -150 mV, an intracellular pH of 7 and on the following acid dissociation (pKa) constants: malate (3.46 and 5.10), pyruvate (2.39), succinate (4.16 and 5.61). Calculations were performed as described earlier (1, 43).
Chapter 3
80
Production of pyruvate, the major by-product of all bioreactor fermentations in this study and the key precursor of malate production via the engineered pyruvate carboxylase-dependent pathway in S. cerevisiae RWB525, occurred even at low pH. In cultures grown at pH 3.9, the final extracellular pyruvate concentration exceeded 0.5 M. Jen1p, the only pyruvate transporter that has hitherto been characterized in S. cerevisiae, is essential for pyruvate uptake (4, 25) and catalyses electroneutral anion-proton symport (12, 13). However, this mode of transport appears to be incompatible with efficient pyruvate export at low pH (Fig. 3.5). Even if the cytosolic pH is strongly reduced, pyruvate concentrations would have to be several orders of magnitude higher intracellularly than extracellularly. It is therefore likely that, at least at low pH values, pyruvate is exported via different mechanisms, presumably by as yet unidentified ABC-transporters. The culture pH not only impacts the thermodynamics of product export. It has also been reported that a low extracellular pH, combined with the presence of organic acids, can decrease the cytosolic pH (11, 28). With a pKa of 6.35, the equilibrium between carbon dioxide and bicarbonate would be strongly influenced by changes in the intracellular pH. This in turn might influence pyruvate carboxylase (14), a key carboxylating enzyme in S. cerevisiae RWB525 for the production of malate (51). Effects of carbon dioxide on dicarboxylate production. It has been shown that C4-dicarboxylic acid production by bacteria can benefit from supplementation with either CO2 (16, 31, 34) or bicarbonate salts (6, 27, 38, 39). This effect can be explained by more favourable kinetics or thermodynamics of the carboxylation reactions in C4-acid production, or by improved pH buffering. Furthermore, it is probably not a coincidence that natural succinate producers are often isolated from high-CO2 environments such as the rumen (35). The most efficient C4-dicarboxylic acid-producing pathways require a net input of CO2. However, all cultures of the engineered S. cerevisiae strain RWB525 showed a net production of CO2 due to respiratory glucose dissimilation. The positive effect of CO2 enrichment on C4-acid production can therefore be entirely attributed to kinetic effects. The conversion between CO2 and bicarbonate occurs spontaneously, but is also catalyzed by carbonic anhydrase (3). To assess the impact of the extracellular CO2 concentration on C4-acid production, we assumed that CO2 diffuses freely over the plasma membrane (19) and that intracellular bicarbonate and CO2 are in equilibrium. The increase of the extracellular CO2 concentration from approximately 0.4% to 11% (Fig. 3.2) would then decrease the free energy change of bicarbonate-dependent pyruvate carboxylation by 8 kJ mol-1, thus stimulating formation of oxaloacetate.
C4-acid production by engineered S. cerevisiae S. cerevisiae RWB525 was engineered with the aim of increasing yields and titers of malate. Interestingly, cultivation at CO2 concentrations above 15% gave lower malate production but strongly stimulated succinate production, with yields and titers of succinate that are the highest known for S. cerevisiae. This differential effect of CO2 on malate and succinate production must be due to different transport mechanisms or metabolic pathways involved in the production of these dicarboxylic acids. Wild-type S. cerevisiae is unable to efficiently transport malate across the plasma membrane (47). In previous experiments with CaCO3-buffered shake flask cultures, production of both malate and succinate transport by S. cerevisiae RWB525 was shown to strongly depend on functional expression of the heterologous SpMae1 transporter. Unless a succinate-specific native exporter is induced at high CO2 concentrations, it seems unlikely that the differential effect of CO2 on the production of the two dicarboxylates originates at the level of transport. In the engineered S. cerevisiae strain RWB525, 13C-labeling experiments in shake flasks suggested that malate production predominantly occurred via the overexpressed fermentative pathway in which oxaloacetate, formed by carboxylation of pyruvate, is reduced to malate (51). Intriguingly, succinate dehydrogenase (SDH), which catalyzes the oxidation of succinate to fumarate in the tricarboxylic acid (TCA) cycle, has been shown to be inhibited by bicarbonate in several organisms (7, 15, 49). This inhibition could limit the (re)oxidation of succinate to malate, thereby explaining the observed effect of CO2 on the production of succinate and malate. However, the exact route of succinate production remains to be investigated. In vitro assays to verify inhibition of SDH in S. cerevisiae, and 13C-labeling studies to ascertain the origin of the produced succinate, would likely prove valuable. In this light it is interesting that deletion of SDH genes has previously been shown to increase succinate titers in aerobic S. cerevisiae cultures (5, 10, 23), presumably via interruption of the TCA cycle. From shake flask to bioreactor. The metabolically engineered, malateproducing S. cerevisiae strain RWB525 was initially characterized in calcium carbonate-buffered shake flask cultures for which malate yields corresponding to 21% of the theoretical maximum were obtained (51). Reproducing these results in bioreactor batch cultures proved to be a non-trivial exercise. On the basis of over 50 controlled 1-liter bioreactor experiments, culture pH, CO2 and O2 levels were identified as key process parameters for C4-dicarboxylic acid production by the engineered yeast strain, while an increased calcium ion concentration had an additional, minor impact on malate production. However, optimizing these parameters only gave a modest improvement (19%) of the malate yield on glucose,
81
Chapter 3 compared to the shake flask cultures; further strain engineering is clearly required to reach malate yields that are compatible with industrial application. The high-level production of pyruvate by the engineered strain indicates that sufficient precursor is available for further improvement of C4-dicarboxylate production. The results in this paper will contribute to further strain optimization in two ways. Firstly, rational strain improvement will benefit from the availability of a bioreactor-based fermentation system, especially where C4-acid production at low pH, quantitative analysis and interpretation of genome- and metabolome-wide analyses are concerned. Secondly, the results from the bioreactor experiments indicate that CaCO3-buffered batch cultures provide favorable conditions for malate production at the current yields and titers, and therefore provide a useful platform for high-throughput screening in classical strain improvement and/or metabolic engineering.
Acknowledgements 82
The Ph.D. research of RMZ is financed by Tate & Lyle Ingredients Americas. This project was carried out within the research programme of the Kluyver Centre for Genomics of Industrial Fermentation which is part of the Netherlands Genomics Initiative / Netherlands Organization for Scientific Research. We acknowledge Stefan de Kok for valuable discussions on export thermodynamics and Nienke Hylkema for her contributions to the experimental work. Dr. Lesley Robertson is gratefully acknowledged for critical reading of the manuscript.
C4-acid production by engineered S. cerevisiae
References 1. Abbott D. A., R. M. Zelle, J. T. Pronk, and A. J. A. van Maris. 2009. Metabolic engineering of Saccharomyces cerevisiae for production of carboxylic acids: current status and challenges. FEMS Yeast Res. 9:1123-1136. 2. Abe S., A. Furuya, T. Saito, and K. Takayama. November 1962. Method of producing L-malic acid by fermentation. U.S. Patent 3,063,910. 3. Aguilera J., J. P. van Dijken, J. H. de Winde, and J. T. Pronk. 2005. Carbonic anhydrase (Nce103p): an essential biosynthetic enzyme for growth of Saccharomyces cerevisiae at atmospheric carbon dioxide pressure. Biochem. J. 391:311-316. 4. Akita O., C. Nishimori, T. Shimamoto, T. Fujii, and H. Iefuji. 2000. Transport of pyruvate in Saccharomyces cerevisiae and cloning of the gene encoded pyruvate permease. Biosci. Biotechnol. Biochem. 64:980-984. 5. Arikawa Y., T. Kuroyanagi, M. Shimosaka, H. Muratsubaki, K. Enomoto, R. Kodaira, and M. Okazaki. 1999. Effect of gene disruptions of the TCA cycle on production of succinic acid in Saccharomyces cerevisiae. J. Biosci. Bioeng. 87:28-36. 6. Battat E., Y. Peleg, A. Bercovitz, J. S. Rokem, and I. Goldberg. 1991. Optimization of L-malic acid production by Aspergillus flavus in a stirred fermentor. Biotechnol. Bioeng. 37:1108-1116. 7. Bendall D. S., S. L. Ranson, and D. A. Walker. 1960. Effects of carbon dioxide on the oxidation of succinate and reduced diphosphopyridine nucleotide by Ricinus mitochondria. Biochem. J. 76:221-225. 8. Burgstaller W. 2006. Thermodynamic boundary conditions suggest that a passive transport step suffices for citrate excretion in Aspergillus and Penicillium. Microbiology 152:887-893. 9. Camarasa C., F. Bidard, M. Bony, P. Barre, and S. Dequin. 2001. Characterization of Schizosaccharomyces pombe malate permease by expression in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 67:4144-4151. 10. Camarasa C., J. Grivet, and S. Dequin. 2003. Investigation by 13C-NMR and tricarboxylic acid (TCA) deletion mutant analysis of pathways for succinate formation in Saccharomyces cerevisiae during anaerobic fermentation. Microbiology 149:2669-2678. 11. Carmelo V., H. Santos, and I. Sá-Correia. 1997. Effect of extracellular acidification on the activity of plasma membrane ATPase and on the cytosolic and vacuolar pH of Saccharomyces cerevisiae. Biochim. Biophys. Acta. 1325:63-70. 12. Casal M., S. Paiva, R. P. Andrade, C. Gancedo, and C. Leão. 1999. The lactate-proton symport of Saccharomyces cerevisiae is encoded by JEN1. J. Bacteriol. 181:2620-2623.
83
Chapter 3
84
13. Cássio F., C. Leão, and N. van Uden. 1987. Transport of lactate and other short-chain monocarboxylates in the yeast Saccharomyces cerevisiae. Appl. Environ. Microbiol. 53:509-513. 14. Cooper T. G., T. T. Tchen, H. G. Wood, and C. R. Benedict. 1968. The carboxylation of phosphoenolpyruvate and pyruvate. I. The active species of “CO2” utilized by phosphoenolpyruvate carboxykinase, carboxytransphosphorylase, and pyruvate carboxylase. J. Biol. Chem. 243:3857-3863. 15. Drake B. G., J. Azcon-Bieto, J. Berry, J. Bunce, P. Dijkstra, J. Farrar, R. M. Gifford, M. A. Gonzalez-Meler, G. Koch, H. Lambers, J. Siedow, and S. Wullschleger. 1999. Does elevated atmospheric CO2 concentration inhibit mitochondrial respiration in green plants? Plant Cell Environ. 22:649-657. 16. Elsden S. R. 1938. The effect of CO2 on the production of succinic acid by Bact. coli commune. Biochem. J. 32:187-193. 17. Flikweert M. T., L. van der Zanden, W. M. T. M. Janssen, H. Y. Steensma, J. P. van Dijken, and J. T. Pronk. 1996. Pyruvate decarboxylase: an indispensable enzyme for growth of Saccharomyces cerevisiae on glucose. Yeast 12:247257. 18. Goldberg I., J. S. Rokem, and O. Pines. 2006. Organic acids: old metabolites, new themes. J. Chem. Technol. Biotechnol. 81:1601-1611. 19. Gutknecht J., M. A. Bisson, and F. C. Tosteson. 1977. Diffusion of carbon dioxide through lipid bilayer membranes: Effects of carbonic anhydrase, bicarbonate, and unstirred layers. J. Gen. Physiol. 69:779-794. 20. Hesseltine C. W., O. L. Shotwell, J. J. Ellis, and R. D. Stubblefield. 1966. Aflatoxin formation by Aspergillus flavus. Bacteriol. Rev. 30:795-805. 21. Kimmich G. A., and H. Rasmussen. 1969. Regulation of pyruvate carboxylase activity by calcium in intact rat liver mitochondria. J. Biol. Chem. 244:190-199. 22. Kraus P. R., and J. Heitman. 2003. Coping with stress: calmodulin and calcineurin in model and pathogenic fungi. Biochem. Biophys. Res. Commun. 311:1151-1157. 23. Kubo Y., H. Takagi, and S. Nakamori. 2000. Effect of gene disruption of succinate dehydrogenase on succinate production in a sake yeast strain. J. Biosci. Bioeng. 90:619-624. 24. Liu L., Y. Li, Y. Zhu, G. Du, and J. Chen. 2007. Redistribution of carbon flux in Torulopsis glabrata by altering vitamin and calcium level. Metab. Eng. 9:21-29. 25. Makuc J., S. Paiva, M. Schauen, R. Krämer, B. André, M. Casal, C. Leão, and E. Boles. 2001. The putative monocarboxylate permeases of the yeast Saccharomyces cerevisiae do not transport monocarboxylic acids across the plasma membrane. Yeast 18:1131-1143.
C4-acid production by engineered S. cerevisiae 26. Matsumoto T. K., A. J. Ellsmore, S. G. Cessna, P. S. Low, J. M. Pardo, R. A. Bressan, and P. M. Hasegawa. 2002. An osmotically induced cytosolic Ca2+ transient activates calcineurin signaling to mediate ion homeostasis and salt tolerance of Saccharomyces cerevisiae. J. Biol. Chem. 277:33075-33080. 27. McKinlay J. B., and C. Vieille. 2008. 13C-metabolic flux analysis of Actinobacillus succinogenes fermentative metabolism at different NaHCO3 and H2 concentrations. Metab. Eng. 10:55-68. 28. Orij R., J. Postmus, A. Ter Beek, S. Brul, and G. J. Smits. 2009. In vivo measurement of cytosolic and mitochondrial pH using a pH-sensitive GFP derivative in Saccharomyces cerevisiae reveals a relation between intracellular pH and growth. Microbiology 155:268-278. 29. Pines O., S. Even-Ram, N. Elnathan, E. Battat, O. Aharonov, D. Gibson, and I. Goldberg. 1996. The cytosolic pathway of L-malic acid synthesis in Saccharomyces cerevisiae: the role of fumarase. Appl. Microbiol. Biotechnol. 46:393-399. 30. Russell A. 1991. Mechanisms of bacterial resistance to non-antibiotics: food additives and food and pharmaceutical preservatives. J. Appl. Microbiol. 71:191-201. 31. Samuelov N. S., R. Lamed, S. Lowe, and J. G. Zeikus. 1991. Influence of CO2-HCO3− levels and pH on growth, succinate production, and enzyme activities of Anaerobiospirillum succiniciproducens. Appl. Environ. Microbiol. 57:3013-3019. 32. Sauer M., D. Porro, D. Mattanovich, and P. Branduardi. 2008. Microbial production of organic acids: expanding the markets. Trends Biotechnol. 26:100-108. 33. Serrano R., A. Ruiz, D. Bernal, J. R. Chambers, and J. Ariño. 2002. The transcriptional response to alkaline pH in Saccharomyces cerevisiae: evidence for calcium-mediated signalling. Mol. Microbiol. 46:1319-1333. 34. Song H., J. W. Lee, S. Choi, J. K. You, W. H. Hong, and S. Y. Lee. 2007. Effects of dissolved CO2 levels on the growth of Mannheimia succiniciproducens and succinic acid production. Biotechnol. Bioeng. 98:1296-1304. 35. Song H., and S. Y. Lee. 2006. Production of succinic acid by bacterial fermentation. Enzyme Microb. Technol. 39:352-361. 36. Sousa M. J., M. Mota, and C. Leão. 1992. Transport of malic acid in the yeast Schizosaccharomyces pombe: Evidence for a proton-dicarboxylate symport. Yeast 8:1025-1031. 37. Stratford M., and T. Eklund. 2003. Organic acids and esters, pp. 56-58. In N.J. Russell, and G.W. Gould (eds.), Food Preservatives, 2nd ed. Springer. 38. Tachibana S., and T. Murakami. 1973. L-Malate production from ethanol and calcium carbonate by Schizophyllum commune. J. Ferment. Technol. 51:858-864. 39. Takao S. 1965. Organic acid production by Basidiomycetes: I. Screening of acid-producing strains. Appl. Environ. Microbiol. 13:732-737.
85
Chapter 3
86
40. van Dijken J. P., J. Bauer, L. Brambilla, P. Duboc, J. M. Francois, C. Gancedo, M. L. F. Giuseppin, J. J. Heijnen, M. Hoare, H. C. Lange, E. A. Madden, P. Niederberger, J. Nielsen, J. L. Parrou, T. Petit, D. Porro, M. Reuss, N. van Riel, M. Rizzi, H. Y. Steensma, C. T. Verrips, J. Vindeløv, and J. T. Pronk. 2000. An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains. Enzyme Microb. Technol. 26:706714. 41. van Dijken J. P., and W. A. Scheffers. 1986. Redox balances in the metabolism of sugars by yeasts. FEMS Microbiol. Lett. 32:199-224. 42. van Maris A. J. A., J. A. Geertman, A. Vermeulen, M. K. Groothuizen, A. A. Winkler, M. D. W. Piper, J. P. van Dijken, and J. T. Pronk. 2004. Directed evolution of pyruvate decarboxylase-negative Saccharomyces cerevisiae, yielding a C2independent, glucose-tolerant, and pyruvate-hyperproducing yeast. Appl. Environ. Microbiol. 70:159-166. 43. van Maris A. J. A., W. N. Konings, J. P. van Dijken, and J. T. Pronk. 2004. Microbial export of lactic and 3-hydroxypropanoic acid: implications for industrial fermentation processes. Metab. Eng. 6:245-255. 44. Verduyn C., E. Postma, W. A. Scheffers, and J. P. van Dijken. 1992. Effect of benzoic acid on metabolic fluxes in yeasts: A continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast 8:501-517. 45. Verduyn C., T. P. L. Zomerdijk, J. P. van Dijken, and W. A. Scheffers. 1984. Continuous measurement of ethanol production by aerobic yeast suspensions with an enzyme electrode. Appl. Microbiol. Biotechnol. 19:181-185. 46. Viladevall L., R. Serrano, A. Ruiz, G. Domenech, J. Giraldo, A. Barceló, and J. Ariño. 2004. Characterization of the calcium-mediated response to alkaline stress in Saccharomyces cerevisiae. J. Biol. Chem. 279:43614-43624. 47. Volschenk H., H. J. J. van Vuuren, and M. Viljoen-Bloom. 2003. Maloethanolic fermentation in Saccharomyces and Schizosaccharomyces. Curr. Genet. 43:379391. 48. Walajtys-Rhode E., J. Zapatero, G. Moehren, and J. Hoek. 1992. The role of the matrix calcium level in the enhancement of mitochondrial pyruvate carboxylation by glucagon pretreatment. J. Biol. Chem. 267:370-379. 49. Wanders R. J. A., A. J. Meijer, A. K. Groen, and J. M. Tager. 1983. Bicarbonate and the pathway of glutamate oxidation in isolated rat-liver mitochondria. Eur. J. Biochem. 133:245-254. 50. Werpy T., and G. Petersen. 2004. Top value added chemicals from biomass: I. Results of screening for potential candidates from sugars and synthesis gas. U.S. Department of Energy, Washington, DC.
C4-acid production by engineered S. cerevisiae 51. Zelle R. M., E. de Hulster, W. A. van Winden, P. de Waard, C. Dijkema, A. A. Winkler, J. A. Geertman, J. P. van Dijken, J. T. Pronk, and A. J. A. van Maris. 2008. Malic acid production by Saccharomyces cerevisiae: engineering of pyruvate carboxylation, oxaloacetate reduction, and malate export. Appl. Environ. Microbiol. 74:2766-2777.
87
Chapter 4 Phospho-enol-pyruvate carboxykinase as the sole anaplerotic enzyme in Saccharomyces cerevisiae Rintze M. Zelle, Josh Trueheart, Jacob C. Harrison, Jack T. Pronk, and Antonius J. A. van Maris Published in Applied and Environmental Microbiology, August 2010, Vol. 76, No. 16, p. 5383-5389 (doi:10.1128/AEM.01077-10)
Chapter 4
Abstract
90
Pyruvate carboxylase is the sole anaplerotic enzyme in glucose-grown cultures of wild-type Saccharomyces cerevisiae. Pyruvate carboxylase-negative (Pyc-) S. cerevisiae strains cannot grow on glucose, unless media are supplemented with C4compounds, such as aspartic acid. In several succinate-producing prokaryotes, phospho-enol-pyruvate carboxykinase (PEPCK) fulfills this anaplerotic role. However, the S. cerevisiae PEPCK encoded by PCK1 is repressed by glucose and is considered to have a purely decarboxylating and gluconeogenic function. This study investigates whether and under which conditions PEPCK can replace the anaplerotic function of pyruvate carboxylase in S. cerevisiae. Pyc- S. cerevisiae strains constitutively overexpressing either the PEPCK from S. cerevisiae or from Actinobacillus succinogenes did not grown on glucose as the sole carbon source. However, evolutionary engineering yielded mutants able to grow on glucose as the sole carbon source at a maximum specific growth rate of ca. 0.14 h-1, half that of the (pyruvate carboxylase-positive) reference strain grown under the same conditions. Growth was dependent on high carbon dioxide concentrations, indicating that the reaction catalyzed by PEPCK operates near thermodynamic equilibrium. Analysis and reverse engineering of two independently evolved strains showed that single point mutations in pyruvate kinase, which competes with PEPCK for phospho-enol-pyruvate, were sufficient to enable the use of PEPCK as sole anaplerotic enzyme. The PEPCK reaction produces one ATP per carboxylation event, whereas the original route through pyruvate kinase and pyruvate carboxylase is ATP neutral. This increased ATP yield may prove crucial for engineering of efficient and low-cost anaerobic production of C4-dicarboxylic acids in S. cerevisiae.
Anaplerotic PEPCK in S. cerevisiae
Introduction Interest in biotechnological production of the four-carbon dicarboxylic acids fumarate, succinate and malate from sugars has strongly increased in recent years (19), as these sugar-derived acids are seen as potential replacements for oil-derived chemical intermediates such as maleic anhydride (41). Metabolic engineering of Escherichia coli has resulted in strains capable of producing 73 g l-1 succinate at pH 7.0 with a yield that, at 1.61 mol per mol glucose (21), is at 94% of the theoretical maximum. The crucial role of carboxylation reactions in this biotechnological process is illustrated by a carbon yield of 1.07 C-mol succinate per C-mol of glucose. Despite the high product yields obtained with these prokaryotes, other microorganisms are also under investigation in view of possible gains in process economy and robustness. The yeast Saccharomyces cerevisiae might offer such gains due to its high tolerance to organic acids and to low pH and its insensitivity to bacteriophages. Metabolic engineering of S. cerevisiae has recently resulted in a strain able to produce malate and succinate at yields of 0.48 mol and 0.29 mol per mol glucose (43). Whereas phospho-enol-pyruvate carboxykinase (PEPCK) is the main carboxylating reaction in the metabolically engineered E. coli strain referred to above (45) and in natural succinate producers such as Actinobacillus succinogenes (25, 35), dicarboxylic acid production in this S. cerevisiae strain depended on (over)expression of native pyruvate carboxylase. Although PEPCK and pyruvate carboxylase can both produce oxaloacetate, the choice of enzyme strongly effects the overall ATP balance of dicarboxylic acid formation. PEPCK directly converts phospho-enolpyruvate (PEP) into oxaloacetate while generating one ATP per carboxylation event (Fig. 4.1). In contrast, no net ATP is recovered in the route through pyruvate kinase and pyruvate carboxylase, where the ATP produced by the first enzyme is consumed by the second (Fig. 4.1). Introducing carboxylating PEPCK activity in S. cerevisiae would thus have significant benefits for dicarboxylic acid production by improving the ATP-stoichiometry of the anaplerotic reaction. In S. cerevisiae, PEPCK is generally considered to be a decarboxylating enzyme with a function in gluconeogenesis (14). Expression of PCK1, which encodes PEPCK, is repressed by glucose (26, 42) and induced by gluconeogenic substrates (11), while the Pck1 protein is inactivated in the presence of glucose (31). This multi-layered regulation has presumably evolved to avoid futile cycling due to simultaneous decarboxylating PEPCK and carboxylating pyruvate carboxylase activity. In line with this, the central enzymes in the glyoxylate cycle, another anaplerotic alternative to pyruvate carboxylase, are also repressed by glucose (16, 17,
91
Chapter 4
½ glucose Glycolysis + NADH
PEP Pyk
Pdh
+ ATP
PEPCK - ATP + CO2
+ NADH + CO2
PYR
C2
Pyc - ATP - HCO3-
C2 CIT
ME + CO2 + NAD(P)H
Mdh
OAA
- NADH
ICI
MAL GLX
+ NADH + CO2
C2 FUM
92
AKG + NADH + CO2
+ FADH2
SUC
+ ATP
Figure 4.1 Metabolic routes between PEP and malate in S. cerevisiae. Signs indicate consumption (-) or production (+) in the direction of the arrow. Abbreviations of metabolites: PEP, phospho-enol-pyruvate; PYR, pyruvate, OAA, oxaloacetate; MAL, malate; CIT, citrate; ICI, isocitrate; AKG, alpha-ketoglutarate; SUCC, succinyl-CoA; SUC, succinate; FUM, fumarate; C2, acetyl-CoA; GLX, glyoxylate. Abbreviations of enzymes: Pyk, pyruvate kinase; Pyc, pyruvate carboxylase; Mdh, malate dehydrogenase; PEPCK, phospho-enol-pyruvate carboxykinase; ME, malic enzyme; Pdh, pyruvate dehydrogenase.
SUCC
20, 32). As a consequence, S. cerevisiae strains lacking the PYC1 and PYC2 genes, encoding the pyruvate carboxylase isoenzymes, are unable to fulfill their anaplerotic requirements during growth on glucose and are auxotrophic for 4-carbon molecules, such as aspartate (34). In a mutagenized pyc1∆ pyc2∆ S. cerevisiae strain able to grow on glucose, derepression of the glyoxylate cycle enzymes was shown to have suppressed the 4-carbon auxotrophy (5). However, using the glyoxylate cycle for dicarboxylic acid production results in suboptimal product yields (44) and is therefore not interesting from an industrial viewpoint. The aim of the present study is to investigate whether and under which conditions PEPCK can replace pyruvate carboxylase as the sole anaplerotic enzyme in S. cerevisiae. To this end, PEPCK from S. cerevisiae and A. succinogenes were constitutively (over)expressed in pyc1∆ pyc2∆ S. cerevisiae strains, thereby avoiding the carbon source-dependent transcription of the native gene, and, in the case of A. succinogenes PEPCK, also glucose catabolite inactivation of the protein. Subsequently, growth conditions and second-site mutations required for an in vivo contribution to oxaloacetate formation by PEPCK were investigated.
Anaplerotic PEPCK in S. cerevisiae
Materials and Methods Strains and maintenance. All strains constructed in this study (Table 4.1) were derived from CEN.JB27, a S. cerevisiae strain from the CEN.PK family (36), containing targeted deletions of URA3 and of the two pyruvate carboxylase genes, PYC1 and PYC2, and carrying a plasmid expressing Escherichia coli PEP carboxylase and the URA3 marker (3). Strains were maintained on YPD (demineralized water, 10 g l-1 yeast extract [BD Difco], 20 g l-1 peptone [BD Difco] and 20 g l-1 glucose), or, for strains carrying plasmids, on synthetic medium consisting of demineralized water, 3 g l-1 KH2PO4, 0.5 g l-1 MgSO4, 6.6 g l-1 L-aspartic acid (from a filter-sterilized 7.4 g l-1 solution set to pH 6 with KOH), 6.6 g l-1 K2SO4, 20 g l-1 glucose, trace elements and filtersterilized vitamins (39). Culture stocks, prepared from shake flask cultures by the addition of glycerol (20% vol/vol), were stored at -80°C in 1-ml aliquots. Incubations were performed at 30°C, and shake flasks were kept in orbital shakers at 200 rpm. Plasmid construction and transformation. Plasmid MB4917 (Table 4.2) was constructed by cloning PEPCK from Actinobacillus succinogenes (codon optimized for expression in S. cerevisiae by Blue Heron Biotechnology, Bothell, WA, US), preceded by an AACAAA Kozak sequence, into pRS416-GPD (27) via the XbaI and XhoI sites. MB4917 was subsequently used as the template for a PCR with primers 5’-pUDC1 and 3’-pUDC1-XbaI (Table 4.3). The resulting PCR product was inserted into MB4917 via the EcoRI and XhoI sites, which introduced a second XbaI site directly upstream of the XhoI site. Then the AsPEPCK gene was excised Table 4.1 S. cerevisiae strains used in this study. Strain CEN.PK 113-7D CEN.JB27 IMK157 ura3∆ IMY002 IMY007 empty vector IMY050 & IMY051 IMW001 & IMW002 IMY011 IMY012 & IMY013 IMY014 & IMY015
Genotype MATa, reference strain MATa pyc1::kanMx pyc2::ILV2smr ura3-52 {pAN-10ppc} MATa pyc1::kanMx pyc2::ILV2smr ura3-52 MATa pyc1::kanMx pyc2::ILV2smr ura3-52 {MB4917} MATa pyc1::kanMx pyc2::ILV2smr ura3-52 {pUDC1} MATa pyc1::kanMx pyc2::ILV2smr ura3-52 {MB4917}, evolved MATa pyc1::kanMx pyc2::ILV2smr ura3-52 (cured), derived from IMY050 and IMY051, respectively MATa pyc1::kanMx pyc2::ILV2smr ura3-52 {pUDC5} MATa pyc1::kanMx pyc2::ILV2smr ura3-52 {pUDC5}, derived from IMW001 and IMW002, respectively MATa pyc1::kanMx pyc2::ILV2smr ura3-52, with G436A or G1006T point mutations in PYK1, respectively
93
Chapter 4
Table 4.2 Plasmids used in this study. Plasmid pRS406 pRS416-GPD MB4917 pUDC1 pUDC5 MB5633 MB5635
Characteristics Integrating yeast vector, URA3 Centromeric yeast vector, URA3, PTDH3-TCYC1 Centromeric yeast vector, URA3, PTDH3-A. succinogenes PEPCK-TCYC1 Centromeric yeast vector, URA3, PTDH3-TCYC1 Centromeric yeast vector, URA3, PTDH3- S. cerevisiae PCK1-TCYC1 Integrating yeast vector, PYK1 allele replacement (G436A), URA3 Integrating yeast vector, PYK1 allele replacement (G1006T), URA3
Reference (33) (27) This work This work This work This work This work
Table 4.3 Oligonucleotides used in this study. Oligonucleotide 5’-pUDC1 3’-pUDC1-XbaI 5’-pUDC5-XbaI 3’-pUDC5-XhoI 5’-PYK1-HindIII 3’-PYK1-NotI
94
Sequence GCCGACTTTACAGTCCTAAACG ATTCATCTCGAGTCTAGATTAGGCCTTGGGTCCAGCTCCAAC ATCATCTAGACATGTCCCCTTCTAAAATGAATGC GTTACTCGAGTTACTCGAATTGAGGACCAGCGGCTAATAC CACACAAGCTTGACATCGGGCTTCCACAATT CACACGCGGCCGCTGCAACACCTCATCGTTATG
via digestion with XbaI and self-ligation resulting in the empty vector plasmid pUDC1. Construction of plasmid pUDC5 was started by isolating PCK1 from genomic DNA of CEN.PK 113-7D using primers 5’-pUDC5-XbaI and 3’-pUDC5XhoI (Table 4.3). After ligation of the blunt PCR fragment into the pCR-Blunt IITOPO vector (Invitrogen), the PCK1 ORF was inserted in MB4917 via the XbaI and XhoI sites, replacing the AsPEPCK gene and thereby creating pUDC5. The mutated PYK1 alleles were isolated from strains IMW001 and IMW002 using primers 5’-PYK1-HindIII and 3’-PYK1-NotI. Each PCR fragment was ligated into the pRS406 vector via the HindIII and NotI restriction sites, resulting in plasmids MB5633 and MB5635. Yeast transformations were performed as described previously (8). Transformants were selected on synthetic medium plates without uracil, and with aspartate as the nitrogen source. Transformations were verified by PCR. Plasmid curing. Strain IMK157 (Table 4.1) was obtained by curing CEN.JB27 of its PEP carboxylase expression vector. Loss of the URA3-based plasmid was induced by growth on agar plates containing 5-fluoroorotic acid (5FOA). These plates were prepared combining an 8% agar solution (autoclaved for 20 minutes at 121°C) with a filter-sterilized solution containing the other medium components (synthetic medium with aspartate as the nitrogen source, 1 g l-1 5-FOA and 0.03 g l-1 uracil). No pH correction was made to the medium components, as it
Anaplerotic PEPCK in S. cerevisiae was found that 5-FOA only exerts its toxic effect at low pH (consistent with diffusional entry of the undissociated acid into the cell). Plasmid loss was confirmed by testing for uracil and aspartate auxotrophies. Strains IMW001 and IMW002 were obtained by curing strains IMY050 and IMY051, respectively. Here, the plasmid-carrying strains were grown under nonselective conditions on liquid YPD. After several serial transfers, the culture was plated on YPD agar. Single colony isolates were tested for uracil auxotrophy and plasmid loss was subsequently confirmed by PCR. Isolation and characterization of evolved strains. Samples of the continuous culture selection experiments were incubated under a CO2 atmosphere on synthetic medium agar with 2 g l-1 (NH4)2SO4 as the nitrogen source. Single colony isolates, one per selection cultivation, were designated IMY050 and IMY051. Plasmids from IMY050 and IMY051 were isolated using the Zymoprep II Yeast Plasmid Miniprep kit. The PYK1 ORF (extending 700 bp upstream and 300 bp downstream) of the cured IMW001 and IMW002 strains was sequenced by Beckman Coulter Genomics. Introduction of mutated pyruvate kinase alleles. Mutated PYK1 alleles were introduced in IMK157 by transformation with XbaI digests of the integration plasmids MB5633 and MB5635 (Table 4.2). Transformants were selected on synthetic medium plates without uracil, and with aspartate as the nitrogen source. Single colony “pop-in” isolates were incubated on 5-FOA agar plates (see above for medium composition) to select for the “pop-out” of the URA3 marker gene and one of the two PYK1 alleles. Several single colony “pop-out” isolates were transformed with MB4917, and screened for growth on synthetic medium plates with (NH4)2SO4 as the nitrogen source under a CO2 atmosphere. For a number of transformants, sequencing of PYK1 was performed by BaseClear, the Netherlands. Plate cultivation. Solid media were prepared by addition of 20 g l-1 Bacto agar. Apart from the nitrogen source [either 4 g l-1 aspartate or 2 g l-1 (NH4)2SO4], and the addition of Tween-80 (0.42 g l-1) and ethanol-dissolved ergosterol (10 mg l1), added to allow for growth under anaerobic conditions, solid synthetic media were identical to the synthetic stock culture medium. Gas-tight jars with 0.2 bar of overpressure were used for incubation of agar plates under CO2 atmosphere. Continuous cultivation. Nitrogen-limited chemostat cultivation was carried out as described previously (38) at a dilution rate of 0.1 h-1 and a culture pH of 5 (set with 2 M KOH). Cultures were continuously sparged with 200 ml min-1 CO2. The medium was identical to the synthetic stock culture medium, with the following modifications: medium contained either 2 g l-1 L-aspartic acid -1 and 6.6 g l-1 K2SO4 or 1 g l-1 (NH4)2SO4 and 5.3 g l-1 K2SO4, as well as 30 g l-1 glucose, 0.15 ml
95
Chapter 4
96
l-1 silicon antifoam (BDH, Poole, England) to control foaming, Tween-80 (0.42 g l-1) and ethanol-dissolved ergosterol (10 mg l-1) to allow for growth under anaerobic conditions. Chemostat cultures were inoculated with 100 ml preculture, obtained from shake flasks inoculated with 1-ml aliquots of frozen stock culture. Batch cultivation. Batch cultivation was performed at 30°C in 2-liter bioreactors (Applikon, Schiedam, the Netherlands) at a working volume of 1 liter. The pH was controlled by automatic addition of 2 M KOH. Bioreactors were sparged with 250 ml CO2 per minute and stirred at 800 rpm. The medium was identical to the synthetic stock culture medium, except for the replacement of the aspartic acid and K2SO4 by 5 g l-1 (NH4)2SO4, and the addition of 0.15 ml l-1 silicon antifoam (BDH, Poole, England) to control foaming. Tween-80 (0.42 g l-1) and ethanol-dissolved ergosterol (10 mg l-1) were added to the medium to allow for growth under anaerobic conditions. Maximum growth rates were determined from optical density (660 nm) measurements. Preculture shake flasks were inoculated with 1-ml aliquots of frozen stock culture. Cells from exponentially growing shake flask precultures were washed twice with demineralized water and used to inoculate batch cultures at an initial OD660 of 0.1 or less. Metabolite analysis. Extracellular concentrations of glucose were determined by high-performance liquid chromatography (HPLC), using a Bio-Rad Aminex HPX-87H column eluted with 5 mM H2SO4 at a flow rate of 0.6 ml min-1 and kept at 60°C, coupled to a Waters 2410 refractive index detector. In vitro enzyme activity assays. Cell extracts for the in vitro measurement of enzyme activities were prepared from culture samples (each containing approximately 60 mg biomass dry weight) as described earlier (44). Activities of pyruvate carboxylase, phospho-enol-pyruvate carboxykinase and pyruvate kinase were determined as previously described (13), except that 2 mM instead of 10 mM PEP was used to start the pyruvate kinase assay. Protein concentrations in cell extracts were determined with the Lowry method (24), using bovine serum albumin as the standard.
Results AsPEPCK-expression alone is insufficient to rescue C4-auxotrophy of Pyc- S. cerevisiae. Pyruvate carboxylase-negative (Pyc-) strains of S. cerevisiae are unable to grow on glucose as the sole carbon source. Consistent with an essential anaplerotic role of pyruvate carboxylase, growth on glucose can be restored by the addition of the four-carbon compound aspartate (34). To test whether overexpression of PEPCK can restore C4-prototrophy in Pyc- S. cerevisiae, a codon-optimized PEPCK gene from the natural succinate producer Actinobacillus succinogenes was introduced on
Anaplerotic PEPCK in S. cerevisiae a centromeric plasmid in the Pyc- S. cerevisiae strain IMK157, resulting in strain IMY002 (Table 4.1). This heterologous gene was chosen as it has been shown to function as an anaplerotic enzyme in A. succinogenes (25, 35), and because it was expected to circumvent glucose-induced repression and glucose catabolite inactivation, which affect expression of the native S. cerevisiae PEPCK (26, 31, 42). Enzyme activity measurements on glucose/aspartate-grown shake flask cultures of strain IMY002 showed a 20-fold increased PEPCK activity (0.38 ± 0.11 mmol·min-1·g protein-1) as compared to the laboratory reference strain CEN.PK 113-7D and the empty vector strain IMY007 (both 0.02 ± 0.00 mmol·min-1·g protein-1) (Table 4.4). However, despite successful overexpression of PEPCK, strain IMY002 was not able to grow in the absence of aspartate. This growth defect was shown on synthetic medium agar plates with glucose as the sole carbon source, even when incubated under an atmosphere of 1.2 bar CO2 (Fig. 4.2, panels A & C), which increases the thermodynamic potential of carboxylation reactions. Evolutionary engineering for increased anaplerotic flux. The experiments described above demonstrated that PEPCK overexpression alone did not provide a sufficiently high anaplerotic flux to allow for observable growth after 7 days. Since an increase in the anaplerotic flux would allow for an increased growth rate, evolutionary engineering provides an opportunity to increase the flux through PEPCK. A nitrogen-limited chemostat culture of strain IMY002, with aspartate as the sole nitrogen source, maintained at pH 5 and flushed with CO2, provided a reproducible starting point for the evolutionary engineering and allowed for a quick Table 4.4 In vitro enzyme activities: PEPCK: phospho-enol-pyruvate carboxykinase, PK: pyruvate kinase, PYC: pyruvate carboxylase. Yeast strains were grown in shake flasks on glucose and aspartate synthetic medium unless indicated otherwise. Errors are deviations from mean (for each condition two shake flask cultures were run). Strain CEN.PK 113-7D (reference) CEN.PK 113-7D on ethanol IMY007 (empty vector) IMY002 (AsPEPCK) IMY011 (ScPEPCK) IMY050 (AsPEPCK, evolved) IMY051 (AsPEPCK, evolved) IMY012 (ScPEPCK, evolved) IMY013 (ScPEPCK, evolved)
Enzyme activities (mmol·min-1·g protein-1) PEPCK
PK
PYC
0.02 ± 0.00 0.53 ± 0.04 0.02 ± 0.00 0.38 ± 0.11 0.55 ± 0.04 0.87 ± 0.23 0.72 ± 0.28 0.40 ± 0.01 0.29 ± 0.00
9.8 ± 0.3 0.9 ± 0.3 9.2 ± 0.3 8.4 ± 0.6 9.4 ± 0.8 4.1 ± 0.4 5.1 ± 0.4 3.5 ± 0.3 4.2 ± 0.3
0.02 ± 0.00 0.14 ± 0.00 0.01 ± 0.00 0.01 ± 0.00 0.01 ± 0.00 0.01 ± 0.01 0.01 ± 0.01 0.01 ± 0.00 0.01 ± 0.00
97
Chapter 4
98
Figure 4.2 Synthetic medium agar plates, incubated for 7 days under an atmosphere of either 1.2 bar CO2 (plates A & B), or air (C & D). Plates contained glucose, Tween-80 and ergosterol, and, as the nitrogen source, either ammonium sulfate (plates A & C) or aspartate (B & D). Strains: 1) CEN.PK 113-7D, 2) IMY002 (Pyc-, AsPEPCK), 3) IMY050 (Pyc- evolved, AsPEPCK,), 4) IMY051 (Pyc- evolved, AsPEPCK), 5) IMY012 (Pyc- evolved, ScPEPCK), 6) IMY013 (Pyc- evolved, ScPEPCK), 7) IMY014 (Pyc-, AsPEPCK, G436A) and 8) IMY015 (Pyc-, AsPEPCK, G1006T).
switch of the nitrogen source without nitrogen starvation. After a steady state was achieved, the selection procedure was started by switching the nitrogen source in the medium from aspartate to ammonium sulfate. Directly after the switch, growth of the culture ceased. To prevent complete washout of the culture, the medium inflow was stopped after 24 h and the experiment was continued as a batch culture. Three days into this batch cultivation, the rate of base addition started to increase exponentially, indicating ammonium consumption and thereby growth. When base addition stopped, glucose had been depleted and dry weight measurements confirmed that growth had occurred. The base addition profile suggested a maximum specific growth rate of circa 0.11 h-1, and continuous cultivation was resumed at a dilution rate of 0.1 h-1. The evolved culture could indeed be maintained at this dilution rate and a steady state was obtained. When, subsequently, the gas used to sparge the bioreactor was switched from CO2 to N2, complete washout of the culture occurred, indicating that a high
Anaplerotic PEPCK in S. cerevisiae CO2 concentration was required for growth. A second selection experiment yielded essentially the same results. A sample from both cultivations (taken during the steady states on ammonium sulfate with CO2 as the sparging gas) was plated on synthetic medium agar plates with glucose as the sole carbon source and incubated under a CO2 atmosphere. In contrast to the unevolved IMY002 strain, growth was now observed, and single colony isolates (one per experiment) were designated IMY050 and IMY051 (Fig. 4.2, strains 3 & 4 in panels A & C). With each of these isolates, duplicate bioreactor batch cultures were performed on synthetic medium at pH 5 with glucose as the sole carbon source. Cultures were continuously sparged with pure CO2. Optical density (660 nm) measurements showed a specific growth rate of 0.15 ± 0.01 h-1 for the evolved AsPEPCK-expressing strains IMY050 and IMY051. This corresponded to 50% of the specific growth rate observed for the pyruvate carboxylase-positive reference strain CEN.PK 113-7D (0.30 ± 0.01 h-1) under identical conditions. Reverse engineering: the role of pyruvate kinase. Even though growth was already observed after only 4 days into the selection experiment of the PycIMY002 S. cerevisiae strain, this period is long enough for a single mutated yeast cell, present at the start of the experiment, to go through 20 generations and produce close to a million daughter cells. Since, in addition, IMY050 and IMY051 retained their phenotype after sequential transfers on non-selective synthetic medium agar plates (containing glucose and aspartate), it is likely that mutations were responsible for the observed physiological changes. As these mutations could be either located in the genome, the AsPEPCK-expressing plasmid, or both, the plasmid was isolated from both strains. In addition, IMY050 and IMY051 were cured of their plasmids, resulting in strains IMW001 and IMW002, respectively. To test whether the mutations responsible for the observed phenotype were located on the plasmid, the non-evolved Pyc- IMK157 S. cerevisiae strain was transformed with the plasmids isolated from the evolved strains. However, no growth of these strains was observed on synthetic medium agar plates with glucose as the sole carbon source in the presence of a CO2 atmosphere (data not shown). To check whether changes in the genome of the evolved strains are responsible for the observed phenotype, the cured strains (IMW001 and IMW002) were retransformed with either the original plasmid (MB4917), the empty vector plasmid (pUDC1), or the plasmids isolated from the evolved strains. After incubation on synthetic medium agar plates with glucose as the sole carbon source in the presence of a CO2 atmosphere, only the cured strains retransformed with either the original or the isolated AsPEPCK plasmids showed growth. The cured strains transformed with
99
Chapter 4
100
the empty vector did not grow, indicating that the phenotype of the evolved strains not only requires the genomic mutation(s), but also depended on AsPEPCK overexpression. In the selection experiments it was found that growth depended on the presence of high CO2 concentrations, suggesting that substrate and product concentrations strongly affect the anaplerotic flux through PEPCK. In Pyc- S. cerevisiae the PEP concentration not only depends on the activity of PEPCK, but also on the flux through pyruvate kinase (Fig. 4.1). A lower activity or lower affinity of pyruvate kinase would result in increased PEP levels, which would benefit carboxylation of PEP by PEPCK. Indeed, in vitro enzyme activity measurements of samples taken during the selection of IMY051 showed that the specific activity of pyruvate kinase had dropped significantly (from 10 to 2 mmol·min-1·g protein-1) after a new steady state had been achieved on ammonium sulfate, and that the Km had increased from 0.12 to 0.52 mM. Pyruvate kinase activity was also measured for the strains IMY002, IMY050 and IMY051 grown in shake flasks on glucose and aspartate medium (Table 4.4). Here however, the specific activity in the evolved strains was reduced less markedly (by 45%), while the Km actually decreased from 0.13 to 0.08 mM. In contrast, PEPCK activity increased to 0.79 mmol·min-1·g protein-1 under these conditions. If it is assumed that IMY051 is representative of the steady state culture from which it was derived, it might be concluded that culture conditions strongly affect the properties of pyruvate kinase, possible by changing the isozyme distribution (6), or by means of post-translational modifications. Subsequent sequencing of PYK1, which encodes the main pyruvate kinase isozyme, revealed single point mutations in the coding region of the gene in both evolved strains (IMY050 and IMY051). Both single base substitutions resulted in an amino acid change: G436A (in IMY050) giving Asp146Asn, and G1006T (in IMY051) giving Ala336Ser. To test whether these mutations accounted for the observed change in phenotype, single point mutation allele replacements (G436A or G1006T) were carried out in the original Pyc- IMK157 strain via pop-in, pop-out recombination (29). With this technique, part of the recombined “pop-out” transformants will carry the mutated allele. The AsPEPCK-expressing plasmid was introduced in a number of the transformants (successful transformation of the plasmid was verified by PCR), and a phenotypic screening was performed on synthetic medium agar plates for growth on glucose under a CO2 atmosphere. Sequencing of the PYK1 gene showed that 7 “pop-out” transformants that grew all had incorporated a mutated allele [these included IMY014 (G436A) and IMY015 (G1006T), see Fig. 4.2], whereas 2 “pop-out” transformants that showed no growth both contained the original allele. Together these findings indicated that the
Anaplerotic PEPCK in S. cerevisiae combination of a mutated PYK1 allele and the expression of AsPEPCK enabled growth on glucose as the sole carbon source in IMY050 and IMY051. ScPEPCK can support anaplerosis in evolved Pyc- S. cerevisiae. For the previous experiments, (codon-optimized) PEPCK from A. succinogenes was used to circumvent the glucose-induced repression and inactivation that has been described for ScPEPCK (26, 42). Based on the results discussed in the preceding paragraph, we tested whether also the endogenous ScPEPCK (encoded by PCK1) could function in an anaplerotic role in Pyc- S. cerevisiae strains. To this end, plasmid pUDC5 (overexpressing PCK1 isolated from the reference strain CEN.PK 113-7D) was introduced in the cured Pyc- strains IMK157 (not evolved) and IMW001 and IMW002 (both evolved), resulting in strains IMY011, IMY012 and IMY013, respectively. No growth was observed when ScPEPCK was overexpressed in the non-evolved IMY011 strain. In contrast, expression of ScPEPCK in the evolved IMY012 and IMY013 strains did result in growth on synthetic medium agar plates with glucose under a CO2 atmosphere (Fig. 4.2). In duplicate glucose-grown and CO2-sparged batch bioreactor cultivations, IMY012 and IMY013 grew at a specific rate of 0.13 ± 0.01 h-1, which is comparable to the rates obtained with the AsPEPCK-expressing S. cerevisiae strains IMY050 and IMY051.
Discussion PEPCK as an anaplerotic enzyme in S. cerevisiae. Pyruvate carboxylasenegative strains of S. cerevisiae cannot grow on glucose as the sole carbon source (7, 34). When a Pyc- S. cerevisiae strain was grown in chemostat culture on a mixture of glucose and ethanol, washout occurred when ethanol made up less than 30% of the substrate carbon (12), indicating that the glyoxylate cycle, which synthesizes C4building blocks from acetyl-coenzyme A, cannot easily replace the anaplerotic role of pyruvate carboxylase. However, suppressor mutants of Pyc- strains could be obtained by UV mutagenesis, and a derepressed glyoxylate cycle was shown to functionally replace the anaplerotic function of pyruvate carboxylase (5). In addition, overexpression of the Escherichia coli ppc gene, encoding PEP carboxylase, in a Pycmutant restored growth on glucose (18). However, neither alternative for anaplerosis is of particular interest for metabolic engineering of C4-dicarboxylic acid production. The glyoxylate cycle does not involve a net carboxylation (44), which reduces maximum theoretical product yields, while conversion of PEP to oxaloacetate via PEP carboxylase is ATP neutral. In contrast, PEPCK, which in this study was shown to be a third alternative for anaplerosis in Pyc- S. cerevisiae, both fully benefits from carboxylation and generates one ATP per carboxylation event.
101
Chapter 4
102
The additional ATP that is produced compared to the original anaplerotic route via pyruvate carboxylase is both PEPCK’s main advantage and disadvantage. While the additional ATP increases metabolic flexibility, and might allow for anaerobic dicarboxylic acid production, it also increases the free energy change (∆G’) of the reaction by at least 32 kJ mol-1. In addition, PEPCK uses CO2 as the source of inorganic carbon, whereas pyruvate carboxylase uses bicarbonate (10). In S. cerevisiae, inorganic carbon is transported over the cell membrane as dissolved CO2 by (facilitated) diffusion (2). Intracellularly, Nce103p carbonic anhydrase catalyzes the conversion between CO2 and bicarbonate (1). Assuming a cytosolic pH higher than the pKa1 of carbonic acid (pH 6.4) (9), dissolved CO2 will be less abundant than bicarbonate when this reaction is in equilibrium. The less favorable thermodynamics of carboxylation by PEPCK most likely explain why wild-type S. cerevisiae strains use pyruvate carboxylase instead and are also consistent with the decreased pyruvate kinase activity in the evolved Pyc- PEPCK overexpressing strains. Although this might come at the cost of a reduced maximum specific growth rate, a lower pyruvate kinase activity will increase the concentration of the shared substrate PEP, which benefits PEPCK. The thermodynamics of the PEPCK reaction also explain why the evolved strains require high CO2 concentrations for growth on glucose, and why several natural succinate producers, which are known to use PEPCK for anaplerosis (23, 25, 30, 35), are found in the cow rumen, an anaerobic and CO2-rich environment. For example, at atmospheric pressure and equilibrium between gas and liquid phase, an increase in the concentration of CO2 in the gas phase from 1% to 100% would decrease the ∆G by 12 kJ mol-1. Whereas in previous selection experiments with (mutagenized) Pyc- S. cerevisiae the glyoxylate cycle became derepressed (5), this cycle did not seem to play a role in our evolution experiments. The multiple dependencies for growth on glucose exhibited by the evolved Pyc- PEPCK expressing S. cerevisiae strains (a requirement for CO2-enrichment, for PEPCK overexpression and for a lowered pyruvate kinase activity) can only be explained if anaplerosis occurred via PEPCK. The absence of glyoxylate cycle-derepression mutants during selection might be explained by inhibition of succinate dehydrogenase by CO2 (4, 15, 40). As this enzyme is required for a functional glyoxylate cycle, its inhibition by CO2 would represent a second hurdle in addition to the glucose repression of the glyoxylate cycle enzymes isocitrate lyase and malate synthase (16, 17, 20, 32). PEPCK for C4-dicarboxylic acid production by S. cerevisiae. The main attraction of replacing the carboxylating role of pyruvate carboxylase in S. cerevisiae by PEPCK is the improved ATP yield of C4-dicarboxylic acid production. If acid production has a positive ATP yield, it may be possible to completely eliminate
Anaplerotic PEPCK in S. cerevisiae additional pathways for sugar dissimilation, such as ethanolic fermentation or respiration. This should strongly improve product yields and is a prerequisite for “carbon-negative” processes, in which a net fixation of CO2 takes place. However, although this study shows that PEPCK can indeed sustain anaplerosis in S. cerevisiae, a higher carboxylating flux is required for successful application in metabolic engineering strategies for production of C4-dicarboxylic acids. The Pyc- AsPEPCK-expressing strains constructed in this study grew slower on glucose under a CO2 atmosphere than an isogenic reference strain (0.15 ± 0.01 h-1 versus 0.30 ± 0.01 h-1). If this is taken as evidence that the anaplerotic PEPCK activity in these strains is growth-limiting, the maximum anaplerotic capacity can then be estimated to be circa 0.3 mmol h-1 (g dry biomass)-1 [assuming a protein mass fraction in dry biomass of 0.4 (22), an average amino acid molecular weight of 109 g mol-1 (22) and a C4-requirement of 0.5 mol (mol amino acid)-1 (11, 22, 28)]. In comparison, in a previous study, an engineered strain of S. cerevisiae overexpressing pyruvate carboxylase was found to be able to produce malate at a 7fold higher rate of ca. 2 mmol h-1 (g dry biomass)-1 (43). The anaplerotic flux might be increased by selecting for mutants with a higher growth rate (e.g. via sequential batch reactor cultivation). However, even if a growth rate of 0.30 h-1 would be reached with these Pyc- AsPEPCK strains, the increase in anaplerotic capacity will only be 2-fold. An interesting approach to further increase the carboxylating PEPCK flux would be natural selection. If PEPCK catalyzed carboxylation can be made solely responsible for fulfilling the ATP requirements of the cell, there would be a strong selective pressure to increase the rate of C4-dicarboxylic acid production. The first demand, that no other pathway should supply the cell with ATP, can be met by applying anaerobic conditions and by deleting the pyruvate decarboxylase genes, which respectively eliminate respiration and ethanolic fermentation. However, the second demand is more challenging. For the production of intracellular malate from glucose, the use of PEPCK increases the ATP yield from 0 to 1 mol (mol malate)-1. Although such a yield might be sufficient for growth, it is unclear whether malate can be exported efficiently from the cell without a free energy investment. Any export mechanism that depends on ATP hydrolysis or proton translocation (37) will consume all the ATP generated by PEPCK. Therefore, the success of this approach depends on the availability of energetically neutral acid export, or alternatively on an increase in the free energy conservation in the production of intracellular acid.
103
Chapter 4
Acknowledgements The Ph.D. research of RMZ is financed by Tate & Lyle Ingredients Americas. This project was carried out within the research program of the Kluyver Centre for Genomics of Industrial Fermentation which is part of the Netherlands Genomics Initiative / Netherlands Organization for Scientific Research. We acknowledge Eveline Vreeburg for her contributions to the experimental work, and Peter Niederberger for granting permission to use strain CEN.JB27.
104
Anaplerotic PEPCK in S. cerevisiae
References 1. Aguilera J., J. P. van Dijken, J. H. de Winde, and J. T. Pronk. 2005. Carbonic anhydrase (Nce103p): an essential biosynthetic enzyme for growth of Saccharomyces cerevisiae at atmospheric carbon dioxide pressure. Biochem. J. 391:311-316. 2. Bahn Y., and F. A. Mühlschlegel. 2006. CO2 sensing in fungi and beyond. Curr. Opin. Microbiol. 9:572-578. 3. Bauer J., M. A. H. Luttik, C. Flores, J. P. van Dijken, J. T. Pronk, and P. Niederberger. 1999. By-product formation during exposure of respiring Saccharomyces cerevisiae cultures to excess glucose is not caused by a limited capacity of pyruvate carboxylase. FEMS Microbiol. Lett. 179:107-113. 4. Bendall D. S., S. L. Ranson, and D. A. Walker. 1960. Effects of carbon dioxide on the oxidation of succinate and reduced diphosphopyridine nucleotide by Ricinus mitochondria. Biochem. J. 76:221-225. 5. Blázquez M. A., F. Gamo, and C. Gancedo. 1995. A mutation affecting carbon catabolite repression suppresses growth defects in pyruvate carboxylase mutants from Saccharomyces cerevisiae. FEBS Lett. 377:197-200. 6. Boles E., F. Schulte, T. Miosga, K. Freidel, E. Schluter, F. Zimmermann, C. Hollenberg, and J. Heinisch. 1997. Characterization of a glucose-repressed pyruvate kinase (Pyk2p) in Saccharomyces cerevisiae that is catalytically insensitive to fructose- 1,6-bisphosphate. J. Bacteriol. 179:2987-2993. 7. Brewster N. K., D. L. Val, M. E. Walker, and J. C. Wallace. 1994. Regulation of pyruvate carboxylase isozyme (PYC1, PYC2) gene expression in Saccharomyces cerevisiae during fermentative and nonfermentative growth. Arch. Biochem. Biophys. 311:62-71. 8. Burke D., D. Dawson, and T. Stearns. 2000. High-efficiency Transformation of Yeast, pp. 103-105. In Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Plainview, NY. 9. Canelas A. B., W. M. van Gulik, and J. J. Heijnen. 2008. Determination of the cytosolic free NAD/NADH ratio in Saccharomyces cerevisiae under steady-state and highly dynamic conditions. Biotechnol. Bioeng. 100:734-743. 10. Cooper T. G., T. T. Tchen, H. G. Wood, and C. R. Benedict. 1968. The carboxylation of phosphoenolpyruvate and pyruvate. I. The active species of "CO2" utilized by phosphoenolpyruvate carboxykinase, carboxytransphosphorylase, and pyruvate carboxylase. J. Biol. Chem. 243:3857-3863. 11. Daran-Lapujade P., M. L. A. Jansen, J. Daran, W. van Gulik, J. H. de Winde, and J. T. Pronk. 2004. Role of transcriptional regulation in controlling
105
Chapter 4
106
fluxes in central carbon metabolism of Saccharomyces cerevisiae: a chemostat culture study. J. Biol. Chem. 279:9125-9138. 12. de Jong-Gubbels P., J. Bauer, P. Niederberger, I. Stückrath, P. Kötter, J. P. van Dijken, and J. T. Pronk. 1998. Physiological characterisation of a pyruvatecarboxylase-negative Saccharomyces cerevisiae mutant in batch and chemostat cultures. Antonie Van Leeuwenhoek 74:253-263. 13. de Jong-Gubbels P., P. Vanrolleghem, S. Heijnen, J. P. Van Dijken, and J. T. Pronk. 1995. Regulation of carbon metabolism in chemostat cultures of Saccharomyces cerevisiae grown on mixtures of glucose and ethanol. Yeast 11:407-418. 14. de Torrontegui G., E. Palacián, and M. Losada. 1966. Phosphoenolpyruvate carboxykinase in gluconeogenesis and its repression by hexoses in yeasts. Biochem. Biophys. Res. Commun. 22:227-231. 15. Drake B. G., J. Azcon-Bieto, J. Berry, J. Bunce, P. Dijkstra, J. Farrar, R. M. Gifford, M. A. Gonzalez-Meler, G. Koch, H. Lambers, J. Siedow, and S. Wullschleger. 1999. Does elevated atmospheric CO2 concentration inhibit mitochondrial respiration in green plants? Plant Cell Environ. 22:649-657. 16. Duntze W., D. Neumann, J. M. Gancedo, W. Atzpodien, and H. Holzer. 1969. Studies on the regulation and localization of the glyoxylate cycle enzymes in Saccharomyces cerevisiae. Eur. J. Biochem. 10:83-89. 17. Fernández E., F. Moreno, and R. Rodicio. 1992. The ICL1 gene from Saccharomyces cerevisiae. Eur. J. Biochem. 204:983-990. 18. Flores C., and C. Gancedo. 1997. Expression of PEP carboxylase from Escherichia coli complements the phenotypic effects of pyruvate carboxylase mutations in Saccharomyces cerevisiae. FEBS Lett. 412:531-534. 19. Goldberg I., J. S. Rokem, and O. Pines. 2006. Organic acids: old metabolites, new themes. J. Chem. Technol. Biotechnol. 81:1601-1611. 20. Hartig A., M. M. Simon, T. Schuster, J. R. Daugherty, H. S. Yo, and T. G. Cooper. 1992. Differentially regulated malate synthase genes participate in carbon and nitrogen metabolism of S. cerevisiae. Nucl. Acids Res. 20:5677-5686. 21. Jantama K., M. J. Haupt, S. A. Svoronos, X. Zhang, J. C. Moore, K. T. Shanmugam, and L. O. Ingram. 2008. Combining metabolic engineering and metabolic evolution to develop nonrecombinant strains of Escherichia coli C that produce succinate and malate. Biotechnol. Bioeng. 99:1140-1153. 22. Lange H. C., and J. J. Heijnen. 2001. Statistical reconciliation of the elemental and molecular biomass composition of Saccharomyces cerevisiae. Biotechnol. Bioeng. 75:334-344.
Anaplerotic PEPCK in S. cerevisiae 23. Lee S. J., H. Song, and S. Y. Lee. 2006. Genome-based metabolic engineering of Mannheimia succiniciproducens for succinic acid production. Appl. Environ. Microbiol. 72:1939-1948. 24. Lowry O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193:265-75. 25. McKinlay J. B., Y. Shachar-Hill, J. G. Zeikus, and C. Vieille. 2007. Determining Actinobacillus succinogenes metabolic pathways and fluxes by NMR and GC-MS analyses of 13C-labeled metabolic product isotopomers. Metab. Eng. 9:177192. 26. Mercado J. J., R. Smith, F. A. Sagliocco, A. J. P. Brown, and J. M. Gancedo. 1994. The levels of yeast gluconeogenic mRNAs respond to environmental factors. Eur. J. Biochem. 224:473-481. 27. Mumberg D., R. Müller, and M. Funk. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156:119-122. 28. Oura E. 1972. Reactions leading to the formation of yeast cell material from glucose and ethanol. Alkon Keskuslaboratorio, Helsinki, Finland. 29. Rothstein R. 1991. Targeting, disruption, replacement, and allele rescue: Integrative DNA transformation in yeast. Meth. Enzymol. 194:281-301. 30. Samuelov N. S., R. Lamed, S. Lowe, and J. G. Zeikus. 1991. Influence of CO2-HCO3− levels and pH on growth, succinate production, and enzyme activities of Anaerobiospirillum succiniciproducens. Appl. Environ. Microbiol. 57:3013-3019. 31. Santt O., T. Pfirrmann, B. Braun, J. Juretschke, P. Kimmig, H. Scheel, K. Hofmann, M. Thumm, and D. H. Wolf. 2008. The yeast Gid complex, a novel ubiquitin ligase (E3) involved in the regulation of carbohydrate metabolism. Mol. Biol. Cell. 19:3323-3333. 32. Schöler A., and H. Schüller. 1993. Structure and regulation of the isocitrate lyase gene ICL1 from the yeast Saccharomyces cerevisiae. Curr. Genet. 23:375-381. 33. Sikorski R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27. 34. Stucka R., S. Dequin, J. Salmon, and C. Gancedo. 1991. DNA sequences in chromosomes II and VII code for pyruvate carboxylase isoenzymes in Saccharomyces cerevisiae: analysis of pyruvate carboxylase-deficient strains. Mol. Gen. Genet. 229:307-315. 35. van der Werf M. J., M. V. Guettler, M. K. Jain, and J. G. Zeikus. 1997. Environmental and physiological factors affecting the succinate product ratio during carbohydrate fermentation by Actinobacillus sp. 130Z. Arch. Microbiol. 167:332-342.
107
Chapter 4
108
36. van Dijken J. P., J. Bauer, L. Brambilla, P. Duboc, J. M. Francois, C. Gancedo, M. L. F. Giuseppin, J. J. Heijnen, M. Hoare, H. C. Lange, E. A. Madden, P. Niederberger, J. Nielsen, J. L. Parrou, T. Petit, D. Porro, M. Reuss, N. van Riel, M. Rizzi, H. Y. Steensma, C. T. Verrips, J. Vindeløv, and J. T. Pronk. 2000. An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains. Enzyme Microb. Technol. 26:706714. 37. van Maris A. J. A., W. N. Konings, J. P. van Dijken, and J. T. Pronk. 2004. Microbial export of lactic and 3-hydroxypropanoic acid: implications for industrial fermentation processes. Metab. Eng. 6:245-255. 38. van Maris A. J. A, B. M. Bakker, M. Brandt, A. Boorsma, M. J. Teixeira de Mattos, L. A. Grivell, J. T. Pronk, and J. Blom. 2001. Modulating the distribution of fluxes among respiration and fermentation by overexpression of HAP4 in Saccharomyces cerevisiae. FEMS Yeast Res. 1:139-149. 39. Verduyn C., E. Postma, W. A. Scheffers, and J. P. van Dijken. 1992. Effect of benzoic acid on metabolic fluxes in yeasts: A continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast 8:501-517. 40. Wanders R. J. A., A. J. Meijer, A. K. Groen, and J. M. Tager. 1983. Bicarbonate and the pathway of glutamate oxidation in isolated rat-liver mitochondria. Eur. J. Biochem. 133:245-254. 41. Werpy T., and G. Petersen. 2004. Top value added chemicals from biomass: I. Results of screening for potential candidates from sugars and synthesis gas. U.S. Department of Energy, Washington, DC. 42. Yin Z., R. J. Smith, and A. J. P. Brown. 1996. Multiple signalling pathways trigger the exquisite sensitivity of yeast gluconeogenic mRNAs to glucose. Mol. Microbiol. 20:751-764. 43. Zelle R. M., E. de Hulster, W. Kloezen, J. T. Pronk, and A. J. A. van Maris. 2010. Key process conditions for production of C4 dicarboxylic acids in bioreactor batch cultures of an engineered Saccharomyces cerevisiae strain. Appl. Environ. Microbiol. 76:744-750. 44. Zelle R. M., E. de Hulster, W. A. van Winden, P. de Waard, C. Dijkema, A. A. Winkler, J. A. Geertman, J. P. van Dijken, J. T. Pronk, and A. J. A. van Maris. 2008. Malic acid production by Saccharomyces cerevisiae: engineering of pyruvate carboxylation, oxaloacetate reduction, and malate export. Appl. Environ. Microbiol. 74:2766-2777. 45. Zhang X., K. Jantama, J. C. Moore, L. R. Jarboe, K. T. Shanmugam, and L. O. Ingram. 2009. Metabolic evolution of energy-conserving pathways for
Anaplerotic PEPCK in S. cerevisiae succinate production in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 106:2018020185.
109
Chapter 5 Anaplerotic role for cytosolic malic enzyme in engineered Saccharomyces cerevisiae strains Rintze M. Zelle, Jacob C. Harrison, Jack T. Pronk, and Antonius J. A. van Maris Published in Applied and Environmental Microbiology, February 2011, Vol. 77, No. 3, p. 732-738 (doi:10.1128/AEM.02132-10)
Chapter 5
Abstract
112
Malic enzyme catalyzes the reversible oxidative decarboxylation of malate to pyruvate and CO2. The Saccharomyces cerevisiae MAE1 gene encodes a mitochondrial malic enzyme whose proposed physiological roles are related to the oxidative, malate-decarboxylating reaction. Hitherto, the inability of pyruvate carboxylasenegative (Pyc-) S. cerevisiae strains to grow on glucose suggested that Mae1p cannot act as a pyruvate-carboxylating, anaplerotic enzyme. In this study, relocation of malic enzyme to the cytosol and creation of thermodynamically favorable conditions for pyruvate carboxylation by metabolic engineering, process design and adaptive evolution, enabled malic enzyme to act as sole anaplerotic enzyme in S. cerevisiae. The Escherichia coli NADH-dependent sfcA malic enzyme was expressed in a Pyc- S. cerevisiae background. When PDC2, a transcriptional regulator of pyruvate decarboxylase genes, was deleted to increase intracellular pyruvate levels and cells were grown under a CO2 atmosphere to favor carboxylation, adaptive evolution yielded a strain that grew on glucose (specific growth rate 0.06 ± 0.01 h-1). Growth of the evolved strain was enabled by a single point mutation (Asp336Gly) that switched the cofactor preference of E. coli malic enzyme from NADH to NADPH. Consistently, cytosolic relocalization of the native Mae1p, which can use both NADH and NADPH, in a pyc1,2∆ pdc2∆ strain grown under a CO2 atmosphere, also enabled slow growth on glucose. Although growth rates of these strains are still low, the higher ATP efficiency of carboxylation via malic enzyme, as compared to the pyruvate carboxylase pathway, may contribute to metabolic engineering of S. cerevisiae for anaerobic, high-yield C4-dicarboxylic acid production.
Anaplerotic malic enzyme in engineered S. cerevisiae
Introduction Malic enzyme is a ubiquitous enzyme that catalyzes the reversible oxidative decarboxylation of malate to pyruvate and CO2, using either NAD+ (EC 1.1.1.3839) or NADP+ (EC 1.1.1.40) as the redox cofactor. In eukaryotes, malic enzyme has been found in the cytosol and/or in mitochondria and, in plants, in the chloroplasts (20, 35). The reaction has a ∆G0’ of circa -8 kJ mol-1 in the decarboxylating direction (19) and, although both carboxylation and decarboxylation have been observed in vitro, substrate affinities and maximum reaction rates generally appear to favor the latter (5, 14, 34). Despite decades of study, the physiological function of malic enzyme often remains enigmatic. Proposed physiological roles for the decarboxylating reaction include provision of pyruvate, inorganic carbon, reducing power and pH regulation (20, 26). Carboxylating roles for malic enzyme have also been suggested (25, 30), although in vivo evidence is sparse. The strongest indications for in vivo malic enzyme activity in the carboxylating direction come from experiments with engineered Escherichia coli, in which overexpression of malic enzyme improved succinate titers (17, 27, 28). However, interpretation of these results was complicated by the fact that these strains still expressed phospho-enolpyruvate carboxylase, the main carboxylating enzyme in glucose-grown wild-type E. coli (2). In the yeast Saccharomyces cerevisiae, malic enzyme is encoded by the MAE1 gene (4). The mitochondrial Mae1 protein can use both NAD+ and NADP+ as electron acceptor and exhibits a relatively high Km towards malate (50 mM, or 17 mM in the presence of 0.5 mM phospho-enol-pyruvate) (13). Also in S. cerevisiae, the physiological role of malic enzyme is still uncertain, even though the enzyme has been shown to provide the pyruvate required for biosynthesis in pyruvate kinasenegative strains grown on ethanol (4). No kinetic data have been published for the carboxylating reaction, but the inability of pyruvate carboxylase-negative strains of S. cerevisiae to grow on glucose indicates that Mae1p can not readily take over the anaplerotic role of pyruvate carboxylase (29). Consequently, the in vivo reaction catalyzed by Mae1p is often assumed to be irreversible in the decarboxylating direction (23). In recent years, interest in the biotechnological production of C4dicarboxylic acids has intensified, as these acids are envisaged to become key building blocks in an increasingly “bio-based” chemical industry (24, 36). S. cerevisiae is an interesting production host for organic acids (1). Hitherto, attempts to engineer S. cerevisiae for malate (and succinate) production were based on replacement of the native alcoholic fermentation pathway by a malate fermentation pathway. To this
113
Chapter 5
114
end, pyruvate carboxylase, a cytosolically retargeted malate dehydrogenase and a heterologous malate transporter were (over)expressed in a pyruvate decarboxylasenegative strain (38, 39). Although this approach yielded malate titers of up to 59 g l1, ATP hydrolysis by pyruvate carboxylase precludes a net synthesis of ATP via this fermentative pathway. In practice, ATP yields are even expected to be negative due to energy requirements for dicarboxylic acid export (32). As a result, part of the glucose fed to the cultures has to be respired to provide ATP, which goes at the expense of the product yield on glucose. Improved understanding of the energetics and thermodynamics of C3-C4 carboxylation reactions is therefore not only of fundamental physiological interest but may also have industrial applications. In the last step of glycolysis, pyruvate kinase transfers the phosphate group of phospho-enol-pyruvate (PEP) to ADP, producing pyruvate and ATP. In wild-type S. cerevisiae strains grown on glucose, anaplerosis occurs via pyruvate carboxylase, which converts pyruvate to oxaloacetate and consumes 1 ATP per carboxylation. As a result, the overall conversion of PEP to oxaloacetate is ATP neutral. However, if pyruvate kinase can be combined with malic enzyme, which converts pyruvate to malate without consuming ATP, PEP is converted to malate while producing net ATP. The same gain in ATP yield can be achieved by using phospho-enol-pyruvate carboxykinase (PEPCK), which converts PEP directly to oxaloacetate while producing ATP. Any reaction with an improved ATP yield has a lower thermodynamic driving force, since phosphorylation of ADP requires an input of free energy. That this can impose limits on metabolism is illustrated by a previous study, where PEPCK was shown to be able to function as an anaplerotic enzyme in S. cerevisiae, but only when concentrations of the substrates PEP and CO2 were increased (40). The goal of this study was to investigate the requirements for an in vivo carboxylating role of malic enzyme in a pyruvate carboxylase-negative S. cerevisiae strain grown on glucose as the sole carbon source. Since in S. cerevisiae endogenous malic enzyme (Mae1p) is mitochondrial, while the pyruvate carboxylases (Pyc1p and Pyc2p) are cytosolic, various malic enzyme expression constructs were tested: (i) overexpression of the endogenous Mae1p, (ii) expression of a truncated form of Mae1p without the mitochondrial targeting sequence, and (iii) expression of the NADH-dependent malic enzyme from E. coli. In addition, the impact of the substrate concentrations of the malic enzyme reaction was tested by varying CO2 concentrations and decreasing the activity of a pyruvate consuming reaction.
Anaplerotic malic enzyme in engineered S. cerevisiae
Materials and Methods Strains and maintenance. Strains constructed in this study (Table 5.1) were derived from IMK157, a S. cerevisiae strain derived from the CEN.PK family (31), containing targeted deletions of URA3 and the two pyruvate carboxylase genes PYC1 and PYC2 (40). Exceptions were strains IMY030 to IMY032, which originate from S. cerevisiae BY4741 mae1∆ (37). Strains were maintained on YPD [demineralized water, 10 g l-1 yeast extract (BD Difco), 20 g l-1 peptone (BD Difco) and 20 g l-1 glucose], or, for strains carrying plasmids, on synthetic stock medium consisting of demineralized water, 3 g l-1 KH2PO4, 0.5 g l-1 MgSO4, 6.6 g l-1 Laspartic acid (from a filter-sterilized 7.4 g l-1 solution set to pH 6 with KOH), 6.6 g l1 K2SO4, 20 g l-1 glucose, trace elements and filter-sterilized vitamins (33). Culture stocks, prepared from shake flask cultures by the addition of glycerol (20% vol/vol), were stored at -80°C in 1-ml aliquots. Incubations were performed at 30°C, and shake flasks were kept in orbital shakers at 200 rpm. Plasmid construction and transformation. Plasmid pUG-hphNT1 (Table 5.2) was constructed by replacing the kanMX marker in pUG6 (15) with the Table 5.1 S. cerevisiae strains used in this study. Strain CEN.PK 113-7D IMK157 ura3∆ IMK299 IMW012 IMY007 empty vector IMY016 IMY017 IMY019 IMY024 IMY025 IMY026 IMY027 IMY028 IMY029 BY4741 mae1∆ IMY030 IMY031 IMY032
Genotype MATa, reference strain MATa pyc1::kanMx pyc2::ILV2smr ura3-52 MATa pyc1::kanMx pyc2::ILV2smr pdc2::loxP::hph::loxP ura3-52 MATa pyc1::kanMx pyc2::ILV2smr pdc2::loxP::hph::loxP ura3-52 (cured); derived from IMY017 MATa pyc1::kanMx pyc2::ILV2smr ura3-52 (pUDC1) MATa pyc1::kanMx pyc2::ILV2smr pdc2::loxP::hph::loxP ura3-52 (MB5573) MATa pyc1::kanMx pyc2::ILV2smr pdc2::loxP::hph::loxP ura3-52 (MB5573*); evolved MATa pyc1::kanMx pyc2::ILV2smr ura3-52 (MB5573) MATa pyc1::kanMx pyc2::ILV2smr pdc2::loxP::hph::loxP ura3-52 (MB5573*) MATa pyc1::kanMx pyc2::ILV2smr ura3-52 (pUDC10) MATa pyc1::kanMx pyc2::ILV2smr ura3-52 (pUDC9) MATa pyc1::kanMx pyc2::ILV2smr pdc2::loxP::hph::loxP ura3-52 (pUDC10) MATa pyc1::kanMx pyc2::ILV2smr pdc2::loxP::hph::loxP ura3-52 (pUDC9) MATa pyc1::kanMx pyc2::ILV2smr pdc2::loxP::hph::loxP ura3-52 (pUDC9); derived from IMY017 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 mae1::kanMx MATa his3∆1 leu2∆0 met15∆0 ura3∆0 mae1::kanMx (pUDC1) MATa his3∆1 leu2∆0 met15∆0 ura3∆0 mae1::kanMx (MB5573) MATa his3∆1 leu2∆0 met15∆0 ura3∆0 mae1::kanMx (MB5573*)
115
Chapter 5
Table 5.2 Plasmids used in this study. Plasmid pFA6a-hphNT1 pUG6 pUG-hphNT1 p416-GPD MB5573 MB5573* pUDC1 pUDC9 pUDC10
Characteristics Template for hphNT1 Template for loxP-kanMX-loxP deletion cassette Template for loxP-hphNT1-loxP deletion cassette Centromeric yeast vector, URA3, PTDH3-TCYC1 Centromeric yeast vector, URA3, PTDH3-E. coli sfcA-TCYC1 Centromeric yeast vector, URA3, PTDH3-E. coli sfcA-TCYC1, isolated from strain IMY017 Centromeric yeast vector, URA3, PTDH3-TCYC1 Centromeric yeast vector, URA3, PTDH3-sMAE1-TCYC1 Centromeric yeast vector, URA3, PTDH3-MAE1-TCYC1
Reference (18) (15) This work (22) This work This work (40) This work This work
Table 5.3 Oligonucleotides used in this study. Oligonucleotide 5’-PDC2-S1 3’-PDC2-S2 5’-MAE1-XbaI 5’-sMAE1-XbaI 3’-MAE1-SalI
116
Sequence ACGCAACTTGAATTGGCAAAATGGGCTTATGAGACGTTCCCAGCTGAAGCT TCGTACGC AGCCTGTGTTACCAGGTAAGTGTAAGTTATTAGAGTCTGGGCATAGGCCAC TAGTGGATCTG CGACGGATTCTAGAGGTTATGCTTAGAACCAGACTATCCG ACCATCTAGAATGTGGCCTATTCAGCAATCGCG GTTAGTCGACCTACAATTGGTTGGTGTGCACC
hphNT1 marker (conferring hygromycin B resistance) from pFA6a-hphNT1 (18) using the SacI and BglII restriction sites. The PDC2 deletion cassette was prepared by PCR using pUG-hphNT1 with primers 5’-PDC2-S1 and 3’-PDC2-S2 [Table 5.3 and (10)]. Transformants of strain IMK157 were selected on YP agar containing ethanol (3% v/v), glycerol (2% v/v) and hygromycin B (200 mg L-1). A single colony isolate, for which deletion of PDC2 was confirmed by PCR, was named IMK299. A synthetic gene, consisting of Escherichia coli sfcA malic enzyme (also known as maeA) with flanking SpeI and XhoI restriction sites, was inserted into p416-GPD (22) digested with XbaI and XhoI (synthesis and codon optimization for expression in S. cerevisiae were performed by Blue Heron Biotechnology, Bothell, WA, US). The resulting plasmid was named MB5573 (Table 5.2). S. cerevisiae MAE1 and the truncated version sMAE1 (21) were amplified from CEN.PK 113-7D genomic DNA with primers 5’-MAE1-XbaI or 5’-sMAE1-XbaI and 3’-MAE1-SalI (Table 5.3). After digestion with XbaI and SalI, the PCR products were inserted into p416-GPD via the XbaI and XhoI sites, resulting in plasmids pUDC9 (expressing
Anaplerotic malic enzyme in engineered S. cerevisiae sMAE1) and pUDC10 (expressing MAE1) (Table 5.2). Correct PCR amplification was verified by sequencing, performed by BaseClear, the Netherlands. Yeast transformations were performed as described previously (7). Transformants were selected on synthetic glucose medium agar plates without uracil, and with aspartate as the nitrogen source. Histidine (25 mg l-1), leucine (30 mg l-1) and methionine (25 mg l-1) were added as required. Transformations were verified by PCR. Plate cultivation. Solid media were prepared by addition of 20 g l-1 Bacto agar. Apart from the nitrogen source [either 4 g l-1 aspartate or 2 g l-1 (NH4)2SO4], and the addition of Tween-80 (0.42 g l-1) and ethanol-dissolved ergosterol (10 mg l1), added to allow for growth under anaerobic conditions, solid synthetic media were identical to the synthetic stock culture medium. Gas-tight jars with 0.2 bar of overpressure were used for incubation of agar plates under CO2 atmosphere. Batch cultivation. Batch cultivation was performed at 30°C in 2-liter bioreactors (Applikon, Schiedam, the Netherlands) at a working volume of 1 liter. The pH was controlled by automatic addition of 2 M KOH. Bioreactors were sparged with 250 ml CO2 per minute and stirred at 800 rpm. The medium was identical to the synthetic stock culture medium, except for the replacement of the aspartic acid and K2SO4 by 5 g l-1 (NH4)2SO4, and the addition of 0.15 ml l-1 silicon antifoam (BDH, Poole, England) to control foaming. Tween-80 (0.42 g l-1) and ethanol-dissolved ergosterol (10 mg l-1) were added to the medium to allow for growth under anaerobic conditions. For growth rate measurements, the initial OD660 after inoculation was 0.1 or less. Maximum specific growth rates were determined for duplicate cultures (errors are given as deviations from mean), and based on optical density measurements at 660 nm. Preculture shake flasks with synthetic stock medium were inoculated with 1-ml aliquots of frozen stock culture. Cells from exponentially growing shake flask precultures were washed twice with demineralized water and used to inoculate batch cultures. Selection of strain IMY017. Nitrogen-limited medium for the selection of strain IMY017 was based on the synthetic stock culture medium, with the following modifications: medium contained 1 g l-1 (NH4)2SO4 and 5.3 g l-1 K2SO4, as well as 30 g l-1 glucose, 0.15 ml l-1 silicon antifoam (BDH, Poole, England) to control foaming, Tween-80 (0.42 g l-1) and ethanol-dissolved ergosterol (10 mg l-1) to allow for growth under anaerobic conditions. Medium was added via a peristaltic pump, and the working volume was kept constant by means of a conductive level sensor. Plasmid isolation and curing. The plasmid from IMY017 was isolated with a Zymoprep II Yeast Plasmid Miniprep kit and amplified in E. coli. Sequencing of the recovered plasmid, which was designated MB5573* (Table 5.2), was
117
Chapter 5
118
performed by BaseClear, the Netherlands. Plasmid loss in strain IMY017 was achieved by growth under non-selective conditions on liquid YPD. After several serial transfers, the culture was plated on YPD agar. A single colony isolate, which displayed uracil auxotrophy and for which plasmid loss was supported by PCR, was named IMW012 (Table 5.1). Metabolite analysis. Extracellular concentrations of glucose and ethanol were determined by high-performance liquid chromatography (HPLC), using a BioRad Aminex HPX-87H column eluted with 5 mM H2SO4 at a flow rate of 0.6 ml min-1 and kept at 60°C, coupled to a Waters 2410 refractive index detector. Preparation of cell extracts. Samples for enzyme activity measurements were obtained from shake flask cultures on synthetic stock medium, with glucose and aspartate, or 3% (v/v) ethanol as the carbon source(s). Cells, harvested in the exponential phase before depletion of either glucose or ethanol, were centrifuged, washed, and resuspended in potassium phosphate buffer (10 mM, pH 7.5, with 2 mM EDTA) and stored at -20°C (each sample contained approximately 60 mg biomass dry weight). Cell extracts for isocitrate lyase, pyruvate decarboxylase and phospho-enol-pyruvate carboxykinase were prepared as described earlier (41). For malic enzyme, cell extracts were prepared in 50 mM Tris-HCl buffer (pH 7.5) containing 1 mM dithiothreitol and 2 mM MgCl2, and dialyzed against this buffer for 4 hours at 4°C using 3 ml 10K MWCO Slide-A-Lyzer Dialysis Cassettes (Thermo Scientific). Enzyme activity assays. Activities of isocitrate lyase, pyruvate decarboxylase and phospho-enol-pyruvate carboxykinase were determined as previously described (9, 11). As similar assay mixtures have been used to determine in vitro malic enzyme activities for S. cerevisiae and E. coli (4, 5), malic enzyme activities were determined as described for S. cerevisiae (4) with either 0.4 mM NAD+ or NADP+ as the redox cofactor. Malic enzyme activity was measured in the decarboxylating direction to avoid interference with pyruvate decarboxylase and alcohol dehydrogenase. Values for Vmax and Km were determined with non-linear fits, assuming Michaelis-Menten kinetics (using Graphpad Prism 4).
Results Expression of E. coli NAD+-dependent malic enzyme is insufficient to rescue C4-auxotrophy of Pyc- S. cerevisiae. In wild-type S. cerevisiae grown on glucose, pyruvate carboxylase functions as the sole anaplerotic enzyme (6, 29), replenishing the intracellular pools of C4-acids. To test whether malic enzyme can assume this anaplerotic role in pyruvate carboxylase-negative (Pyc-) S. cerevisiae, a codonoptimized version of the E. coli NAD+-dependent malic enzyme, sfcA (also known
Anaplerotic malic enzyme in engineered S. cerevisiae as maeA), was overexpressed in the pyc1∆ pyc2∆ strain IMK157, resulting in strain IMY019. Compared to the Pyc- empty vector control strain IMY007, overexpression of the E. coli malic enzyme increased in vitro NAD+-dependent malic enzyme activity by circa 8-fold to 0.49 ± 0.03 mmol min-1 (g protein)-1 (Table 5.4). However, strain IMY019 showed no growth on synthetic medium agar plates with glucose as the sole carbon source, even when cultures were incubated under a CO2 atmosphere to thermodynamically favor pyruvate carboxylation (Fig. 5.1). To test whether increased intracellular substrate concentrations would allow for an anaplerotic flux through malic enzyme, an attempt was made to increase intracellular pyruvate levels by deleting PDC2, which encodes a positive regulator of the pyruvate decarboxylase (Pdc) isozymes Pdc1 and Pdc5 (16). Pyruvate Table 5.4 In vitro whole-cell enzyme activities: ME-NAD: malic enzyme (with NAD+), ME-NADP: malic enzyme (with NADP+), Pdc: pyruvate decarboxylase, PEPCK: phospho-enol-pyruvate carboxykinase, Icl: isocitrate lyase. Yeast strains were grown on synthetic medium with glucose and aspartate unless indicated otherwise. Errors are deviations from mean (for each condition two shake flask cultures were run). Also indicated are the maximum specific growth rates (µmax) on glucose under a CO2 atmosphere in batch cultures. n.a. not applicable. n.d.: not detectable (< 0.005 mmol·min-1·g protein-1). n.g.: no growth (tested on plates). Strain CEN.PK 113-7D CEN.PK 113-7D on ethanol IMY007 (pyc1,2∆, empty vector) IMY019 (pyc1,2∆, E. coli sfcA) IMY016 (pyc1,2∆ pdc2∆, E. coli sfcA) IMY017 (pyc1,2∆ pdc2∆ evolved, mutated E. coli sfcA) IMY027 (pyc1,2∆ pdc2∆,
µmax
Enzyme activities (mmol·min-1·g protein-1)
(h-1) ME-NAD
ME-NADP
Pdc
PEPCK
Icl
0.30 ± 0.01 n.a.
0.04 ± 0.00 0.09 ± 0.02
0.03 ± 0.00 0.02 ± 0.00
1.5 ± 0.2 0.2 ± 0.0
0.04 ± 0.01 0.44 ± 0.05
nd 0.22 ± 0.03
n.g.
0.06 ± 0.00
0.03 ± 0.01
1.9 ± 0.3
0.04 ± 0.00
nd
n.g.
0.49 ± 0.03
0.03 ± 0.00
1.6 ± 0.1
0.04 ± 0.00
nd
n.g.
1.03 ± 0.07
0.03 ± 0.00
0.7 ± 0.0
0.04 ± 0.01
nd
0.06 ± 0.01
0.12 ± 0.01
0.39 ± 0.02
0.7 ± 0.0
0.04 ± 0.02
nd
n.g.
0.30 ± 0.03
0.34 ± 0.04
0.5 ± 0.0
0.04 ± 0.00
nd
0.012 ± 0.000
0.17 ± 0.01
0.18 ± 0.01
0.7 ± 0.0
0.04 ± 0.00
nd
0.019 ± 0.003
0.18 ± 0.02
0.19 ± 0.02
1.3 ± 0.0
0.04 ± 0.00
nd
↑MAE1) IMY028 (pyc1,2∆ pdc2∆,
↑sMAE1) IMY029 (pyc1,2∆ pdc2∆, ↑sMAE1), IMY017 background
119
Chapter 5 decarboxylases convert pyruvate to acetaldehyde, a crucial step in the formation of ethanol. Deletion of PDC2 has previously been shown to result in a 3-4 fold reduction of Pdc activity in aerobic glucose-limited chemostat cultures, and in substantial production of pyruvate during batch cultivation on glucose (10). In this study, PDC2 was deleted in strain IMK157, yielding strain IMK299. Subsequent overexpression of the E. coli sfcA malic enzyme in the pyc1,2∆ pdc2∆ strain IMK299 resulted in strain IMY016 (Table 5.1). Although an over 2-fold reduction in pyruvate decarboxylase activity was observed in cell extracts relative to the parental strain IMY019 (Table 5.4), strain IMY016 showed no growth on glucose, regardless of whether an air or CO2 atmosphere was applied (Fig. 5.1).
120
Figure 5.1 Synthetic medium agar plates, incubated for 14 days under an atmosphere of either 1.2 bar CO2 (plates A & B), or air (C & D). Plates contained glucose, Tween-80 and ergosterol, and, as the nitrogen source, either ammonium sulfate (plates A & C) or aspartate (B & D). Strains: 1) CEN.PK 113-7D (wild-type reference), 2) IMY016 (pyc1,2∆ pdc2∆, E. coli sfcA), 3) IMY017 (pyc1,2∆ pdc2∆ evolved, mutated E. coli sfcA), 4) IMY019 (pyc1,2∆, E. coli sfcA), 5) IMY024 (pyc1,2∆ pdc2∆, mutated E. coli sfcA), 6) IMY025 (pyc1,2∆, ↑MAE1), 7) IMY026 (pyc1,2∆, ↑sMAE1), 8) IMY027 (pyc1,2∆ pdc2∆, ↑MAE1), 9) IMY028 (pyc1,2∆ pdc2∆, ↑sMAE1) and 10) IMY029 (pyc1,2∆ pdc2∆ evolved, ↑sMAE1). sMAE1 is a truncated, cytosolically retargeted version of S. cerevisiae MAE1.
Anaplerotic malic enzyme in engineered S. cerevisiae Evolutionary engineering for increased anaplerotic flux. To select for mutants with an increased anaplerotic flux through malic enzyme, evolutionary engineering was used, a strategy that previously proved successful for enabling anaplerosis in S. cerevisiae via PEPCK. After precultivation on glucose and aspartate, strain IMY016 was inoculated at an initial OD660 of circa 0.5 in a CO2-sparged batch bioreactor, containing synthetic medium with glucose as the sole carbon source. After a week of incubation without growth, aspartate was pulsed to allow the (viable) biomass concentration to increase. Subsequent nitrogen-limited chemostat cultivation on glucose medium at a dilution rate of 0.05 h-1 resulted in partial wash out and feeding was stopped. During the following batch phase, growth was observed. After two additional washout-batch cycles on medium with glucose as the sole carbon source, a specific growth rate of 0.06 h-1 was reached. At the end of the bioreactor cultivation a culture sample was taken and incubated on synthetic medium agar with glucose as the sole carbon source. Growth on plates was now observed, but only when plates were incubated under a CO2 atmosphere. This was consistent with an anaplerotic role of malic enzyme and indicated that growth did not result from cells with a derepressed glyoxylate cycle (3), for which CO2 is not a substrate. A single colony isolate from the evolved culture, designated IMY017 (Fig. 5.1), showed a representative maximum specific growth rate of 0.06 ± 0.01 h-1 in CO2-sparged batch cultures on glucose. At a specific growth rate of 0.06 h-1, a single gain-of-function mutant cell would be able to grow to a stationary phase culture in the 1-liter bioreactor (corresponding to approximately 35 generations) within 2 weeks. This time span is well within the 1-month duration of the selective cultivation. Reverse engineering: a switch in cofactor specificity of E. coli malic enzyme. To identify the basis of the changed phenotype, in vitro enzyme activities of malic enzyme, pyruvate decarboxylase, PEPCK and isocitrate lyase were determined in cell extracts of strain IMY017. Consistent with the strong CO2 dependence observed for growth on glucose (Fig. 5.1), no activity was found for isocitrate lyase, confirming that the glyoxylate cycle, which is normally repressed during batch cultivation on glucose, did not act as an anaplerotic pathway in the evolved strain. The PEPCK activity remained low at 0.04 ± 0.02 mmol min-1 (g protein)-1, while no further decrease in Pdc activity was observed compared to IMY016 (Table 5.4). However, large changes were observed for malic enzyme. Whereas NAD+-dependent malic enzyme activity had dropped over 8-fold to 0.12 ± 0.01 mmol min-1 (g protein)-1, NADP+ dependent activity had increased over 10fold to 0.39 ± 0.02 mmol min-1 (g protein)-1 (Table 5.4).
121
Chapter 5
122
The enzyme activity measurements provided strong indications that the new phenotype was primarily due to changes to E. coli malic enzyme. Indeed, when the plasmid from IMY017, named MB5573*, was retransformed to IMK299, the resulting strain immediately showed growth on glucose under a CO2 atmosphere (strain IMY024, Fig. 5.1). Growth was slower than for IMY017, suggesting that additional beneficial mutations had occurred in IMY017 on a genomic level. No growth was observed when the original MB5573 plasmid or an empty plasmid were retransformed to a cured IMY017, or when the MB5573* plasmid isolated from IMY017 was transformed to strain IMK157, which still carried an intact copy of PDC2 (data not shown). Subsequent sequencing of the sfcA open reading frame, as well as its TDH3 promoter and CYC1 terminator, in the MB5573* strain uncovered a single A1007G point mutation resulting in an Asp336Gly amino acid change. This mutation lies in the NAD-domain of sfcA, and is close to the 311-319 amino acid sequence that is predicted to be the NAD(P)-binding site (5). Interestingly, sequencing of the plasmid from an independently evolved single colony isolate, which like strain IMY017 showed growth on glucose but was not further investigated due to a low specific growth rate on glucose of 0.02 ± 0.00 h-1, uncovered a G1006A point mutation, resulting in a change of the same amino acid residue (in this case an Asp336Asn substitution). To test whether the A1007G mutation had indeed changed the cofactor specificity and to avoid interference of the endogenous Mae1p in enzyme assays, the original and mutated E. coli malic enzyme were introduced in a mae1 knockout strain from the Saccharomyces Genome Deletion Project (37) (Table 5.1). Although PCR confirmed deletion of mae1, low background activities were still found in the malic enzyme assay for a mae1 deletion strain carrying an empty vector (strain IMY030). However, at circa 5% of the activities measured for the strains carrying MB5573 (IMY031) or MB5573* (IMY032), this did not significantly influence the characterization of the E. coli malic enzyme. Interestingly, the A1007G point mutation in sfcA resulted in a 2-fold lower Vmax on NAD+, and a slightly increased Vmax on NADP+ (Table 5.5). However, a far more striking effect was observed for the cofactor substrate-saturation constants. In the mutated E. coli malic enzyme, the Km for NAD+ had decreased approximately 30-fold, while the Km for NADP+ was improved by approximately the same factor (Table 5.5). Combined, these changes effected a drastic switch in cofactor specificity.
Anaplerotic malic enzyme in engineered S. cerevisiae
Table 5.5 Kinetic parameters of the original allele of E. coli sfcA NADH-dependent malic enzyme and of a mutated allele obtained by adaptive evolution in yeast, with either NAD+ or NADP+ as the redox cofactor. Measurements were performed in whole-cell extracts of S. cerevisiae strains grown on synthetic medium with glucose and aspartate. Ranges indicate 95% confidence intervals (for each strain, enzyme assays were performed on cell extracts from two independent shake flasks). Strain
IMY031 (mae1∆, E. coli sfcA) IMY032 (mae1∆, mutated E. coli sfcA)
Kinetic enzyme parameters (Vmax in mmol·min-1·g protein-1; Km in mM) NAD+
NADP+
Vmax
Km,cofactor
Vmax
Km,cofactor
1.8 ± 0.2 1.0 ± 0.2
0.14 ± 0.05 3.9 ± 1.9
0.6 ± 0.3 0.7 ± 0.1
8.7 ± 7.3 0.23 ± 0.08
An anaplerotic role for cytosolically targeted S. cerevisiae Mae1p. After having established the importance of cofactor specificity in the anaplerotic role of the E. coli enzyme, replacement of the anaplerotic role of pyruvate carboxylase by alleles of the native yeast malic enzyme, encoded by MAE1, was investigated. Interestingly, the endogenous malic enzyme already has the potential to use NADPH as the cofactor, but is, in contrast to the heterologously expressed E. coli enzyme, targeted to the mitochondrion. Therefore, both a full copy of MAE1 and a truncated version lacking the mitochondrial targeting sequence, named sMAE1 (21), were overexpressed in Pyc- S. cerevisiae. No growth was discernable on synthetic glucose medium for the Pyc- strain IMK157 (over)expressing MAE1 (strain IMY025) or sMAE1 (IMY026), and for the pyc1,2∆ pdc2∆ strain IMK299 overexpressing MAE1 (IMY027). However, colonies were obtained for the pyc1,2∆ pdc2∆ strain IMK299 expressing the cytosolic sMAE1 (IMY028, see Fig. 5.1). This strain showed a maximum specific growth rate of 0.012 ± 0.000 h-1 on glucose in CO2-sparged batch cultures. The characterization of the evolved strain IMY017, which expresses a mutated copy of the E. coli sfcA gene, suggested that changes in the yeast genetic background, although not essential for growth, contributed to its improved growth. To test whether these unidentified genomic changes would also benefit a strain expressing the truncated S. cerevisiae malic enzyme, sMAE1 was expressed in IMY017 after its original plasmid had been cured. Indeed, growth of the resulting strain IMY029 was faster on glucose plates (Fig. 5.1) and in CO2-sparged batch cultures, where a specific growth rate of 0.019 ± 0.003 h-1 was observed. The relatively low growth rate of this sMAE1-based strain (the E. coli sfcA-based strain IMY017 showed a maximum specific growth rate of 0.06 ± 0.01 h-1) might in part be explained by a lower NADP+-dependent malic enzyme activity for strain
123
Chapter 5 IMY029 as compared to strain IMY017 [0.19 ± 0.02 versus 0.39 ± 0.02 mmol min-1 (g protein)-1, see table 5.4].
Discussion
124
This study shows that, in addition to a derepressed glyoxylate cycle (3), heterologous PEP carboxylase (12), and PEPCK (40), malic enzyme can assume the anaplerotic role in S. cerevisiae during growth on glucose that is normally fulfilled by pyruvate carboxylase (6, 29). This is substantiated by the fact that isocitrate lyase activity in the Pyc- strains remained below the detection level, growth depended on high CO2 levels, which would only benefit anaplerotic routes involving carbon fixation, and, also in the evolved strains, growth required the overexpression of (cytosolic) malic enzyme. A significant carboxylating flux through PEPCK is not expected, since PEPCK activities were not increased after evolution, and in vitro enzyme activities were only a fraction of those found in PEPCK-anaplerotic strains [0.04 versus 0.290.87 mmol min-1 (g protein)-1, see (40)]. Similarly, the low expression levels of endogenous MAE1 and mitochondrial localization of Mae1p make it unlikely that malic enzyme made a significant contribution to the anaplerotic flux in the earlier characterized PEPCK-expressing S. cerevisiae strains (40). This study has shown that a cytosolic localization is crucial for enabling an anaplerotic role of malic enzyme, which might be explained by less favorable conditions for carboxylation in the mitochondrial matrix, an inability to generate mitochondrial NAD(P)H, and/or limitations in the transport of C4-acids from the mitochondria to the cytosol. NADPH as a preferred cofactor. The NAD+-specific E. coli sfcA malic enzyme was chosen based on several grounds: a) as a prokaryotic protein, sfcA lacks an intracellular targeting sequence, and thus can be expected to be cytosolically expressed in S. cerevisiae, b) previous studies on malic enzyme as a carboxylating enzyme in E. coli also targeted sfcA (17, 27), and c) if malic enzyme would be used for the high-yield production of C4-dicarboxylic acids, the use of NADH instead of NADPH would simplify the balancing of cofactors (e.g. avoiding the need for transhydrogenase activity for the production of malate and fumarate, which can be produced redox-neutrally from glucose). However, the Pyc- S. cerevisiae only grew when expressing either the cytosolically relocalized sMAE1p, which can use both NADH and NADPH, or a mutated sfcA allele with a strongly improved affinity for NADPH. This indicates that, in the tested strains, anaplerosis via malic enzyme depended on the use of NADPH for reductive pyruvate carboxylation. The Asp336Gly mutation clearly resulted in a near complete switch of the cofactor specificity from NAD+ to NADP+ in E. coli malic enzyme. This preferential use of NADPH by malic enzyme in this carboxylating role might be explained by
Anaplerotic malic enzyme in engineered S. cerevisiae the thermodynamics of the catalyzed reaction. The dependency of growth on deletion of PDC2, which probably increased the cytosolic pyruvate concentration, and on incubation under a CO2 atmosphere, both indicate that this reaction is likely to be close to thermodynamic equilibrium when operating in the carboxylating direction. Although few measurements are available on cytosolic redox factor concentrations in S. cerevisiae (8), whole cell measurements showed intracellular ratios of NADPH/NADP+ that are higher than those of NADH/NAD+ (21). If this is representative for the cofactor distribution in the cytosol, the use of NADPH would increase the driving force of carboxylation by cytosolic malic enzyme. Malic enzyme for C4-acid production by S. cerevisiae. Like PEPCK, malic enzyme offers the prospect of metabolic engineering of S. cerevisiae for C4dicarboxylic acid production from glucose under anaerobic conditions (40). The higher ATP yield of carboxylation might eliminate the need to respire part of the glucose for ATP generation, thereby increasing product yields. In view of the relatively low growth rates of the current strains [0.06 h-1 with the mutated E. coli malic enzyme, versus 0.14 h-1 for PEPCK-anaplerotic strains and 0.30 h-1 for the pyruvate carboxylase-positive reference strain (40)], the first priority will be to increase the in vivo rates of pyruvate carboxylation by malic enzyme. Initially, sequential batch cultivation can be used to select for faster growth and a higher anaplerotic flux. Further increases in the carboxylating fluxes through malic enzyme or PEPCK might be achieved by improving substrate availability and reducing the flux to ethanol. Such an approach previously proved successful in engineering a pyruvate carboxylase-overexpressing S. cerevisiae strain, which was unable to produce ethanol due to deletion of the pyruvate decarboxylase genes, for malate and succinate production (38, 39). The increased availability of pyruvate in pyruvate decarboxylase-negative strains can also improve the carboxylation through malic enzyme. As an additional benefit, when ATP generation becomes dependent on the production (and export) of C4-dicarboxylic acids, this might allow for evolutionary engineering for an improved flux through malic enzyme (40).
Acknowledgements The Ph.D. research of RMZ is financed by Tate & Lyle Ingredients Americas. This project was carried out within the research program of the Kluyver Centre for Genomics of Industrial Fermentation which is part of the Netherlands Genomics Initiative / Netherlands Organization for Scientific Research. We thank our colleagues at the Delft University of Technology, Tate & Lyle and Microbia for stimulating discussions. We acknowledge Giang Huong Duong for her contribution to the literature review, Erwin Suir for construction of pUG-hphNT1 and Peter
125
Chapter 5 Niederberger for granting permission to use strain CEN.JB27, the ancestor of strain IMK157.
126
Anaplerotic malic enzyme in engineered S. cerevisiae
References 1. Abbott D. A., R. M. Zelle, J. T. Pronk, and A. J. A. van Maris. 2009. Metabolic engineering of Saccharomyces cerevisiae for production of carboxylic acids: current status and challenges. FEMS Yeast Res. 9:1123-1136. 2. Ashworth J. M., and H. L. Kornberg. 1966. The anaplerotic fixation of carbon dioxide by Escherichia coli. Proc. Biol. Sci. 165:179-188. 3. Blazquez M. A., F. Gamo, and C. Gancedo. 1995. A mutation affecting carbon catabolite repression suppresses growth defects in pyruvate carboxylase mutants from Saccharomyces cerevisiae. FEBS Lett. 377:197-200. 4. Boles E., P. de Jong-Gubbels, and J. T. Pronk. 1998. Identification and characterization of MAE1, the Saccharomyces cerevisiae structural gene encoding mitochondrial malic enzyme. J. Bacteriol. 180:2875-2882. 5. Bologna F. P., C. S. Andreo, and M. F. Drincovich. 2007. Escherichia coli malic enzymes: two isoforms with substantial differences in kinetic properties, metabolic regulation, and structure. J. Bacteriol. 189:5937-5946. 6. Brewster N. K., D. L. Val, M. E. Walker, and J. C. Wallace. 1994. Regulation of pyruvate carboxylase isozyme (PYC1, PYC2) gene expression in Saccharomyces cerevisiae during fermentative and nonfermentative growth. Arch. Biochem. Biophys. 311:62-71. 7. Burke D., D. Dawson, and T. Stearns. 2000. High-efficiency Transformation of Yeast, pp. 103-105. In Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Plainview, NY. 8. Canelas A. B., W. M. van Gulik, and J. J. Heijnen. 2008. Determination of the cytosolic free NAD/NADH ratio in Saccharomyces cerevisiae under steady-state and highly dynamic conditions. Biotechnol. Bioeng. 100:734-743. 9. de Jong-Gubbels P., P. Vanrolleghem, S. Heijnen, J. P. van Dijken, and J. T. Pronk. 1995. Regulation of carbon metabolism in chemostat cultures of Saccharomyces cerevisiae grown on mixtures of glucose and ethanol. Yeast 11:407-418. 10. Flikweert M. T., M. Kuyper, A. J. A. van Maris, P. Kötter, J. P. van Dijken, and J. T. Pronk. 1999. Steady-state and transient-state analysis of growth and metabolite production in a Saccharomyces cerevisiae strain with reduced pyruvatedecarboxylase activity. Biotechnol. Bioeng. 66:42-50. 11. Flikweert M. T., L. van der Zanden, W. M. T. M. Janssen, H. Y. Steensma, J. P. van Dijken, and J. T. Pronk. 1996. Pyruvate decarboxylase: an indispensable enzyme for growth of Saccharomyces cerevisiae on glucose. Yeast 12:247257.
127
Chapter 5
128
12. Flores C., and C. Gancedo. 1997. Expression of PEP carboxylase from Escherichia coli complements the phenotypic effects of pyruvate carboxylase mutations in Saccharomyces cerevisiae. FEBS Lett. 412:531-534. 13. Fuck E., G. Stärk, and F. Radler. 1973. Äpfelsäurestoffwechsel bei Saccharomyces. II. Anreicherung und Eigenschaften eines Malatenzyms. Arch. Microbiol. 89:223-231. 14. Gerrard Wheeler M., C. Arias, M. Tronconi, V. Maurino, C. Andreo, and M. Drincovich. 2008. Arabidopsis thaliana NADP-malic enzyme isoforms: high degree of identity but clearly distinct properties. Plant Mol. Biol. 67:231-242. 15. Güldener U., S. Heck, T. Fielder, J. Beinhauer, and J. Hegemann. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucl. Acids Res. 24:2519-2524. 16. Hohmann S. 1993. Characterisation of PDC2, a gene necessary for high level expression of pyruvate decarboxylase structural genes in Saccharomyces cerevisiae. Mol. Gen. Genet. 241:657-666. 17. Hong S. H., and S. Y. Lee. 2001. Metabolic flux analysis for succinic acid production by recombinant Escherichia coli with amplified malic enzyme activity. Biotechnol. Bioeng. 74:89-95. 18. Janke C., M. M. Magiera, N. Rathfelder, C. Taxis, S. Reber, H. Maekawa, A. Moreno-Borchart, G. Doenges, E. Schwob, E. Schiebel, and M. Knop. 2004. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast 21:947-962. 19. Kunkee R. E. 1968. Malo-lactic fermentation. Adv. Appl. Microbiol. 9:235-279. 20. Maurino V. G., M. C. Gerrard Wheeler, C. S. Andreo, and M. F. Drincovich. 2009. Redundancy is sometimes seen only by the uncritical: Does Arabidopsis need six malic enzyme isoforms? Plant Sci. 176:715-721. 21. Moreira dos Santos M., V. Raghevendran, P. Kötter, L. Olsson, and J. Nielsen. 2004. Manipulation of malic enzyme in Saccharomyces cerevisiae for increasing NADPH production capacity aerobically in different cellular compartments. Metab. Eng. 6:352-363. 22. Mumberg D., R. Muller, and M. Funk. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156:119-122. 23. Nookaew I., M. Jewett, A. Meechai, C. Thammarongtham, K. Laoteng, S. Cheevadhanarak, J. Nielsen, and S. Bhumiratana. 2008. The genome-scale metabolic model iIN800 of Saccharomyces cerevisiae and its validation: a scaffold to query lipid metabolism. BMC Syst. Biol. 2:71.
Anaplerotic malic enzyme in engineered S. cerevisiae 24. Patel M. K., M. Crank, V. Dornburg, B. G. Hermann, A. L. Roes, B. Hüsing, L. Overbeek, F. Terragni, and E. Recchia. 2006. Medium and longterm opportunities and risks of the biotechnological production of bulk chemicals from renewable resources. Utrecht University, Utrecht. 25. Pound K. M., N. Sorokina, K. Ballal, D. A. Berkich, M. Fasano, K. F. Lanoue, H. Taegtmeyer, J. M. O’Donnell, and E. D. Lewandowski. 2009. Substrate-enzyme competition attenuates upregulated anaplerotic flux through malic enzyme in hypertrophied rat heart and restores triacylglyceride content: attenuating upregulated anaplerosis in hypertrophy. Circ. Res. 104:805-812. 26. Sauer U., and B. J. Eikmanns. 2005. The PEP-pyruvate-oxaloacetate node as the switch point for carbon flux distribution in bacteria. FEMS Microbiol. Rev. 29:765-794. 27. Stols L., and M. I. Donnelly. 1997. Production of succinic acid through overexpression of NAD+-dependent malic enzyme in an Escherichia coli mutant. Appl. Environ. Microbiol. 63:2695-2701. 28. Stols L., G. Kulkarni, B. G. Harris, and M. I. Donnelly. 1997. Expression of Ascaris suum malic enzyme in a mutant Escherichia coli allows production of succinic acid from glucose. Appl. Biochem. Biotechnol. 63-65:153-158. 29. Stucka R., S. Dequin, J. Salmon, and C. Gancedo. 1991. DNA sequences in chromosomes II and VII code for pyruvate carboxylase isoenzymes in Saccharomyces cerevisiae: analysis of pyruvate carboxylase-deficient strains. Mol. Gen. Genet. 229:307-315. 30. Sundqvist K. E., J. Heikkilä, I. E. Hassinen, and J. K. Hiltunen. 1987. Role of NADP+-linked malic enzymes as regulators of the pool size of tricarboxylic acidcycle intermediates in the perfused rat heart. Biochem. J. 243:853-857. 31. van Dijken J. P., J. Bauer, L. Brambilla, P. Duboc, J. M. Francois, C. Gancedo, M. L. F. Giuseppin, J. J. Heijnen, M. Hoare, H. C. Lange, E. A. Madden, P. Niederberger, J. Nielsen, J. L. Parrou, T. Petit, D. Porro, M. Reuss, N. van Riel, M. Rizzi, H. Y. Steensma, C. T. Verrips, J. Vindeløv, and J. T. Pronk. 2000. An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains. Enzyme Microb. Technol. 26:706714. 32. van Maris A. J. A., W. N. Konings, J. P. van Dijken, and J. T. Pronk. 2004. Microbial export of lactic and 3-hydroxypropanoic acid: implications for industrial fermentation processes. Metab. Eng. 6:245-255. 33. Verduyn C., E. Postma, W. A. Scheffers, and J. P. van Dijken. 1992. Effect of benzoic acid on metabolic fluxes in yeasts: A continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast 8:501-517.
129
Chapter 5
130
34. Voegele R. T., M. J. Mitsch, and T. M. Finan. 1999. Characterization of two members of a novel malic enzyme class. Biochim. Biophys. Acta 1432:275-285. 35. Volschenk H., H. J. J. van Vuuren, and M. Viljoen-Bloom. 2003. Maloethanolic fermentation in Saccharomyces and Schizosaccharomyces. Curr. Genet. 43:379391. 36. Werpy T., and G. Petersen. 2004. Top value added chemicals from biomass: I. Results of screening for potential candidates from sugars and synthesis gas. U.S. Department of Energy, Washington, DC. 37. Winzeler E. A., D. D. Shoemaker, A. Astromoff, H. Liang, K. Anderson, B. Andre, R. Bangham, R. Benito, J. D. Boeke, H. Bussey, A. M. Chu, C. Connelly, K. Davis, F. Dietrich, S. W. Dow, M. El Bakkoury, F. Foury, S. H. Friend, E. Gentalen, G. Giaever, J. H. Hegemann, T. Jones, M. Laub, H. Liao, N. Liebundguth, D. J. Lockhart, A. Lucau-Danila, M. Lussier, N. M’Rabet, P. Menard, M. Mittmann, C. Pai, C. Rebischung, J. L. Revuelta, L. Riles, C. J. Roberts, P. Ross-MacDonald, B. Scherens, M. Snyder, S. SookhaiMahadeo, R. K. Storms, S. Véronneau, M. Voet, G. Volckaert, T. R. Ward, R. Wysocki, G. S. Yen, K. Yu, K. Zimmermann, P. Philippsen, M. Johnston, and R. W. Davis. 1999. Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285:901-906. 38. Zelle R. M., E. de Hulster, W. Kloezen, J. T. Pronk, and A. J. A. van Maris. 2010. Key process conditions for production of C4 dicarboxylic acids in bioreactor batch cultures of an engineered Saccharomyces cerevisiae strain. Appl. Environ. Microbiol. 76:744-750. 39. Zelle R. M., E. de Hulster, W. A. van Winden, P. de Waard, C. Dijkema, A. A. Winkler, J. A. Geertman, J. P. van Dijken, J. T. Pronk, and A. J. A. van Maris. 2008. Malic acid production by Saccharomyces cerevisiae: engineering of pyruvate carboxylation, oxaloacetate reduction, and malate export. Appl. Environ. Microbiol. 74:2766-2777. 40. Zelle R. M., J. Trueheart, J. C. Harrison, J. T. Pronk, and A. J. A. van Maris. 2010. Phosphoenolpyruvate carboxykinase as the sole anaplerotic enzyme in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 76:5383-5389.
Summary of the PhD thesis “Metabolic engineering of Saccharomyces cerevisiae for C4-dicarboxylic acid production” Over the past several decades, the global economy has become greatly dependent on oil as a cheap source of fuel, and as raw material for the production of chemicals. However, in the years to come, depletion of oil reserves, increasing costs of oil extraction, and concerns on climate change will drive the use of more sustainable alternatives. In this respect, the biotechnological production of chemicals based on microbial conversion of renewable feedstocks, such as plant biomass, is expected to make a significant contribution. However, the transition to a more biobased economy is not without its challenges: bioconversion must meet strict demands with regard to product yields, titers, and productivities to be cost competitive with oil. This thesis focuses on the ability of Saccharomyces cerevisiae (baker’s yeast) to produce four-carbon dicarboxylic acids. In recent years, the C4-acids fumarate, malate and succinate have come into focus as chemicals with great potential in taking up roles as commodity chemicals to replace oil-derived compounds like maleic anhydride. At first glance, S. cerevisiae might seem an odd choice as a production organism. This yeast, which is extensively used for the production of bread, beer and wine, produces only small amounts of organic acids. Instead, wildtype strains produce ethanol and carbon dioxide as the main end products of metabolism when grown on sugars. However, this well-studied microorganism has many advantages for use in organic acid production. In addition to its simple medium requirements, S. cerevisiae is tolerant to low pH and high organic acid concentrations, resistant to bacteriophages and easy to cultivate at large scale. It is also very accessible to genetic modification, which allows for making directed changes to its metabolism. At the onset of this PhD project, a first step had already been made to engineer S. cerevisiae for C4-acid production. It had been shown that ethanol formation by S. cerevisiae could be completely eliminated by deletion of the pyruvate decarboxylases, resulting in strains that produced large amounts of pyruvic acid. This was considered to be an excellent starting point, especially since pyruvate represents one of the main crossroads in central carbon metabolism and is only a few metabolic steps removed from C4-acids. Indeed, overexpression of pyruvate
131
132
carboxylase and expression of a cytosolically retargeted malate dehydrogenase and a heterologous malate transporter in a pyruvate decarboxylase-negative background resulted in malate titers of up to 59 g l-1 at a molar yield of 0.42 mol (mol glucose)-1 (chapter 2). Strain characterization, based on in vitro enzyme activity measurements and 13C metabolic flux analysis, confirmed that malate was (predominantly) produced via the overexpressed pathway. Initially, this malate producing strain was grown in calcium carbonatebuffered shake flasks. Although this setup offered a quick and simple screening platform for increased malate production, these shake flask cultures offered limited control and, as a consequence, experienced dynamic regimes for oxygen limitation and pH. To establish whether similar yields could be obtained on a larger cultivation scale, the same strain was tested in closely controlled 1-liter batch bioreactors (chapter 3). An extensive analysis showed that production of malate and succinate depended on a high pH, that oxygen limitation improved malate production, and that CO2 greatly influenced C4-acid titers. Whereas both malate and succinate titers increased with moderate CO2 enrichment in the sparging gas, increasing the CO2 concentrations above 15% was detrimental to malate production, while continuing to stimulate the formation of succinate. By optimizing the cultivation conditions, malate and succinate could be produced at yields of 0.48 and 0.29 mol (mol glucose)-1, respectively. To make life possible, cellular metabolism needs to provide both the building blocks (such as nucleotides, amino acids and lipids) and the free energy that are required for cellular growth and maintenance. Wild-type S. cerevisiae strains that are grown on glucose have two options for generating ATP, the main free-energy carrier in the cell. Glucose can either be respired to CO2 and water, or it can be converted to a mix of ethanol and CO2 via (anaerobic) fermentation, a process that does not consume oxygen. While C4-acid formation via the overexpressed pathway through pyruvate carboxylase is efficient due to net carboxylation of CO2, no net ATP is produced. As a result, the malate producing strain, which is unable to form ethanol, is dependent on respiration for its ATP generation and therefore requires oxygen for growth. However, respiration results in a loss of carbon substrate and reducing power, which together with the need for air sparging can significantly increase the cost of large-scale fermentation. As the process economy of C4-acid production would be greatly improved by an anaerobic production process, the use of phospho-enol-pyruvate carboxykinase (PEPCK) was investigated as an alternative to pyruvate carboxylase (chapter 4). Whereas no net ATP is produced in the twostep conversion of phospho-enol-pyruvate (PEP) to oxaloacetate by pyruvate kinase and pyruvate carboxylase, the single-step conversion catalyzed by PEPCK would
generate one ATP per carboxylation event. However, while PEPCK has been shown to catalyze this carboxylating reaction in a number of natural succinate producing bacteria, it had only been characterized as a decarboxylating and gluconeogenic enzyme in S. cerevisiae. To test whether PEPCK could fulfill an anaplerotic function in S. cerevisiae, a pyruvate carboxylase-negative (Pyc-) strain was used, which cannot grow on glucose unless media are supplemented with C4-compounds, such as aspartate. When expression of a heterologous PEPCK from the succinate producer Actinobacillus succinogenes was found to be insufficient to allow for growth on glucose, the PEPCK-expressing Pyc- strain was subjected to laboratory evolution on glucose. These experiments were done under a CO2 atmosphere, which improves the thermodynamics of carboxylation. Mutants were quickly obtained, exhibiting CO2 dependent growth on glucose at specific growth rates of up to 0.15 h-1, which is half that of a pyruvate carboxylase-positive reference strain. The altered phenotype of two separately evolved strains could in both cases be attributed to a single amino acid change in PYK1, the major isozyme of pyruvate kinase. These mutations lowered pyruvate kinase activities, presumably improving carboxylation through PEPCK by increasing the concentration of PEP and were used for successful “reverse engineering” in non-evolved Pyc- S. cerevisiae. Interestingly, similar growth rates were obtained by overexpressing the endogenous PEPCK, encoded by PCK1, in the evolved strain background. Malic enzyme represented a second alternative to pyruvate carboxylase (chapter 5). Like PEPCK, malic enzyme is known to function as a decarboxylating enzyme in S. cerevisiae, and, also like PEPCK, its use as a carboxylating enzyme should improve the ATP yield of C4-acid production by directly converting pyruvate to malate without consuming ATP. As with PEPCK, expression of the heterologous NADH-dependent malic enzyme from Escherichia coli in the Pyc- S. cerevisiae strain did not result in growth on glucose. Having previously recognized the importance of substrate concentrations, PDC2, which encodes a positive regulator of the pyruvate decarboxylases Pdc1 and Pdc5, was deleted with the aim to increase intracellular pyruvate concentrations. When this also failed to enable growth, even at elevated CO2 concentrations, the E. coli malic enzyme-expressing pyc1,2∆ pdc2∆ strain was subjected to evolutionary engineering. A mutant was isolated that showed CO2 dependent growth on glucose at a specific growth rate of 0.06 h-1. Analysis of the evolved strain uncovered a single point mutation in the E. coli malic enzyme, causing a drastic shift in cofactor specificity from NADH to NADPH. Introduction of the mutant allele of the E. coli malic enzyme gene enabled CO2 dependent growth on glucose of a non-evolved pyc1,2∆ pdc2∆ strain. Under the assumption that the
133
134
cytosolic NADPH/NADP+ pool is more reduced than that of NADH/NAD+, the use of NADPH gives a thermodynamic benefit to the carboxylation reaction. Finally, also the endogenous malic enzyme, Mae1p, was brought to overexpression in the pyc1,2∆ pdc2∆ strain, in either the original mitochondrial or a truncated cytosolic form. Surprisingly, growth (at a low rate of 0.01 h-1) was achieved for the cytosolic variant without selection, which can possibly be explained by the ability of S. cerevisiae Mae1p to use either NADH or NADPH. A slightly increased maximum specific growth rate of 0.02 h-1 was observed when the cytosolic S. cerevisiae Mae1p was overexpressed in the strain background that was previously evolved and from which the E. coli malic enzyme plasmid had been removed. The results in this thesis demonstrate that S. cerevisiae can be engineered to produce substantial amounts of the C4-dicarboxylic acids malate and succinate. However, industrial application demands higher yields and titers, and less byproduct formation. Therefore, reducing pyruvate production will be of particular importance when using pyruvate decarboxylase-negative strains. A more difficult and even more interesting challenge is enabling anaerobic production of C4-acids with S. cerevisiae. Eliminating the need for respiration would not only improve product yields, but, once free-energy conservation is linked to product formation, would also create a selective pressure for improved acid production rates, which could greatly assist further strain optimization. Here a first step has been made with the demonstration that PEPCK and malic enzyme can function as alternative anaplerotic enzymes in S. cerevisiae. For both enzymes, it was crucial to improve the thermodynamics of carboxylation by increasing substrate (PEP, pyruvate and CO2/HCO3-) and cofactor [NAD(P)H] concentrations. However, reduced growth rates indicate that the capacity of the alternative carboxylating reactions in these academic “proof-ofprinciple” strains is still too low for (commercial) C4-acid production. To a limited extent, higher carboxylating fluxes may be achieved by selecting for faster growth. Finally, energetics of acid export will play a central role. Even with an increased ATP yield through the use of PEPCK or malic enzyme, anaerobic production of C4acids is only possible when the ATP costs for acid export do not match or exceed the ATP yield from the fermentation pathway, which would limit the fermentation process to a high extracellular pH or low product concentrations. Alternatively, additional metabolic engineering strategies may be devised to further increase the ATP yield of intracellular acid formation.
Samenvatting van het proefschrift “Metabolic engineering van Saccharomyces cerevisiae voor de productie van C4-dicarbonzuren” In de afgelopen decennia is de wereldeconomie zeer afhankelijk geworden van olie als een goedkope bron van brandstof en als grondstof voor de productie van chemicaliën. Echter, in de komende jaren zullen uitputting van olievoorraden, de stijgende kosten van oliewinning en bezorgdheid om klimaatverandering het gebruik van duurzamere alternatieven stimuleren. Naar verwachting zal de biotechnologische productie van chemicaliën op basis van microbiële omzetting van hernieuwbare grondstoffen, zoals plantenbiomassa, hierbij een significante rol spelen. De overgang naar een meer biobased economie is evenwel niet zonder uitdagingen: om te kunnen concurreren met de prijs van olie zal bioconversie aan strikte eisen moeten voldoen voor wat betreft productopbrengsten, productconcentraties en productiesnelheden. Dit proefschrift richt zich op het vermogen van Saccharomyces cerevisiae (bakkersgist) om dicarbonzuren met vier koolstofatomen te produceren. In de afgelopen jaren zijn de C4-zuren appelzuur (malaat), barnsteenzuur (succinaat) en fumaarzuur (fumaraat) in beeld gekomen als een categorie verbindingen met een grote potentie voor het vervangen van bulkchemicaliën die nu uit olie worden geproduceerd, zoals maleïnezuuranhydride. Op het eerste gezicht lijkt S. cerevisiae misschien een vreemde keuze als productie-organisme. Deze gist, die op grote schaal gebruikt wordt voor de productie van brood, bier en wijn, produceert slechts kleine hoeveelheden organische zuren. In plaats hiervan zijn ethanol en koolstofdioxide de belangrijkste eindproducten van het metabolisme van natuurlijke bakkersgiststammen die op suikers worden gekweekt. Toch heeft dit uitgebreid bestudeerde micro-organisme vele voordelen voor gebruik in de productie van organische zuren. S. cerevisiae stelt bescheiden eisen aan het medium, heeft een hoge tolerantie voor lage pH en hoge concentraties organische zuren, is ongevoelig voor bacteriofagen en makkelijk op grote schaal te kweken. Het is ook zeer toegankelijk voor genetische modificatie, wat het mogelijk maakt om gericht veranderingen aan te brengen in de stofwisseling. Bij aanvang van dit promotieproject was al een eerste stap gezet om S. cerevisiae aan te passen voor C4-zuur-productie. Het was aangetoond dat
135
136
ethanolproductie door S. cerevisiae volledig kon worden geëlimineerd door het verwijderen van de pyruvaatdecarboxylases. Dit leverde stammen op die grote hoeveelheden pyrodruivenzuur (pyruvaat) produceerden. Dit werd als een uitstekend uitgangspunt gezien, in het bijzonder omdat pyrodruivenzuur zich op een belangrijk kruispunt bevindt in het centrale koolstofmetabolisme en slechts enkele stofwisselingsstappen is verwijderd van C4-zuren. Overexpressie van pyruvaatcarboxylase en expressie van een cytosolisch gerelocaliseerd malaatdehydrogenase en een heterologe appelzuur-transporter in een pyruvaatdecarboxylase-negatieve achtergrond bleek inderdaad effectief, met appelzuurconcentraties tot 59 g l-1 bij een molaire opbrengst van 0,42 mol (mol glucose)-1 (hoofdstuk 2). Een stamkarakterisering, gebaseerd op in vitro enzym-activiteiten en 13C metabole flux analyses, bevestigde dat appelzuur (voornamelijk) via de tot overexpressie gebrachte route werd geproduceerd. Deze appelzuur-producerende stam werd aanvankelijk gekweekt in calciumcarbonaat-gebufferde schudkolven. Hoewel geschikt voor het snel en eenvoudig testen van stammen voor verhoogde appelzuurproductie, boden deze schudkolfcultures weinig mogelijkheden voor controle, waardoor variaties optraden in de pH en mate van zuurstoflimitatie. Om te bepalen of vergelijkbare opbrengsten konden worden behaald op een grotere schaal werd dezelfde stam getest in strikt gecontroleerde 1-liter batch bioreactoren (hoofdstuk 3). Een uitgebreide analyse toonde aan dat de productie van appelzuur en barnsteenzuur afhankelijk was van een hoge pH, dat zuurstoflimitatie de appelzuurproductie verbeterde, en dat CO2 een grote invloed had op de behaalde concentraties van C4-zuren. Beperkte CO2verrijking van de gasfase verhoogde de opbrengst van zowel appelzuur als barnsteenzuur. CO2 concentraties boven de 15% hadden een negatief effect op de appelzuurproductie, maar bleven de productie van barnsteenzuur stimuleren. Door het optimaliseren van de kweekcondities konden appelzuur en barnsteenzuur geproduceerd worden met opbrengsten van respectievelijk 0,48 en 0,29 mol (mol glucose)-1. Om leven mogelijk te maken moet de cellulaire stofwisseling zorgen voor zowel bouwstenen (zoals nucleotiden, aminozuren en lipiden) als vrije energie. Beide zijn nodig voor groei en onderhoud van de cel. Natuurlijke S. cerevisiae-stammen die op glucose worden gekweekt hebben twee mogelijkheden voor het genereren van ATP, de belangrijkste vrije-energiedrager in de cel. Glucose kan ofwel worden verademd tot CO2 en water, ofwel worden omgezet in een mix van ethanol en CO2 via (anaërobe) fermentatie, een proces dat geen zuurstof verbruikt. Hoewel de productie van C4-zuren via de tot overexpressie gebrachte pyruvaatcarboxylaseroute efficiënt is door netto carboxylering van CO2, wordt hierbij netto geen ATP
geproduceerd. Dit heeft als gevolg dat de malaat-producerende stam, die geen ethanol kan produceren, afhankelijk is van ademhaling om ATP te genereren en hierdoor zuurstof nodig heeft voor groei. Echter, ademhaling zorgt voor een verlies van koolstofsubstraat en reductiekracht, wat samen met de noodzaak van beluchting de kosten van grote-schaalfermentaties significant kan verhogen. Omdat de proceseconomie van C4-zuurproductie sterk zou worden verbeterd met een anaëroob productieproces, is het gebruik van fosfo-enol-pyruvaat-carboxykinase (PEPCK) onderzocht als een alternatief voor pyruvaatcarboxylase (hoofdstuk 4). Terwijl geen ATP wordt geproduceerd in de door pyruvaatkinase en pyruvaatcarboxylase gekatalyseerde tweestaps-conversie van fosfo-enol-pyruvaat (PEP) tot oxaalazijnzuur, wordt er één ATP gegenereerd per carboxylering in de door PEPCK gekatalyseerde eenstaps-omzetting. Maar hoewel is aangetoond dat PEPCK deze carboxylerende reactie katalyseert in een aantal in de natuur voorkomende barnsteenzuur-producerende bacteriën, was PEPCK in S. cerevisiae alleen gekarakteriseerd als een decarboxylerend en gluconeogenetisch enzym. Om te testen of PEPCK ook een anaplerotische rol zou kunnen vervullen in S. cerevisiae werd een pyruvaatcarboxylase-negatieve (Pyc-) stam gebruikt, die niet op glucose kan groeien, tenzij C4-verbindingen (zoals aspartaat) aan het medium worden toegevoegd. Nadat bleek dat expressie van een heteroloog PEPCK uit de barnsteenzuur-producent Actinobacillus succinogenes onvoldoende was om groei op glucose mogelijk te maken, werd de Pyc- stam met PEPCK gebruikt voor laboratorium-evolutie in glucosegekweekte cultures. Deze experimenten werden uitgevoerd onder een CO2 atmosfeer, wat de carboxylerings-thermodynamica verbetert. Er werden snel mutanten verkregen die CO2-afhankelijke groei op glucose vertoonden bij specifieke groeisnelheden tot 0,15 h-1, wat overeen kwam met de helft van de groeisnelheid van een pyruvaatcarboxylase-positieve referentiestam. Het veranderde fenotype van twee apart geëvolueerde stammen kon in beide gevallen worden toegeschreven aan een gewijzigd aminozuur in PYK1, het belangrijkste isozym van pyruvaatkinase. Deze mutaties verlaagden de pyruvaatkinase-activiteiten, wat vermoedelijk de carboxylering door PEPCK verbeterde door het verhogen van de PEP-concentratie. De gemuteerde gensequenties werden succesvol toegepast voor reverse engineering in niet-geëvolueerde Pyc- S. cerevisiae. Een interessante vinding was dat vergelijkbare groeisnelheden werden behaald wanneer het endogene gistPEPCK, dat door PCK1 wordt gecodeerd, in de geëvolueerde stamachtergrond tot overexpressie werd gebracht. Malic enzyme vertegenwoordigt een tweede mogelijk alternatief voor pyruvaatcarboxylase (hoofdstuk 5). Net zoals van PEPCK is van malic enzyme bekend dat het in S. cerevisiae een functie vervult als decarboxylerend enzym, en net zoals
137
138
PEPCK zou gebruik van malic enzyme als carboxylerend enzym de ATP-opbrengst van C4-zuurproductie kunnen verbeteren door pyruvaat direct om te zetten naar appelzuur zonder ATP te consumeren. Net als in de eerste experimenten met PEPCK, resulteerde expressie van het heterologe NADH-afhankelijke malic enzyme uit Escherichia coli in de Pyc- S. cerevisiae stam niet in groei op glucose. Na eerder het belang van substraatconcentraties gezien te hebben werd PDC2, dat codeert voor een positieve regulator van de pyruvaatdecarboxylases Pdc1 en Pdc5, verwijderd om intracellulaire pyruvaatconcentraties te verhogen. Toen ook hiermee geen groei op glucose werd bereikt, zelfs niet bij verhoogde CO2 concentraties, werd de pyc1,2∆ pdc2∆ stam waarin malic enzyme uit E. coli tot expressie was gebracht gebruikt voor laboratoriumevolutie-experimenten. Een mutant werd geïsoleerd die CO2afhankelijke groei vertoonde op glucose met een specifieke groeisnelheid van 0,06 h1. Analyse van de geëvolueerde stam onthulde een enkele puntmutatie in het E. coli malic enzyme, die een drastische verschuiving veroorzaakte in de cofactor-specificiteit, van NADH naar NADPH. Introductie van het gemuteerde allel van het E. coli malic enzyme maakte CO2-afhankelijke groei mogelijk in een niet-geëvolueerde pyc1,2∆ pdc2∆ stam. Als wordt aangenomen dat de cytosolische voorraad NADPH/NADP+ sterker gereduceerd is dan die van NADH/NAD+, geeft het gebruik van NADPH een thermodynamisch voordeel voor de carboxyleringsreactie. Tot slot werd ook het endogene malic enzyme, Mae1p, tot overexpressie gebracht in de pyc1,2∆ pdc2∆ stam, zowel in de originele mitochondriële, als in een ingekorte cytosolische vorm. Verrassend genoeg werd al zonder selectie groei waargenomen (bij een lage snelheid van 0,01 h-1) voor de cytosolische variant, wat mogelijk verklaard kan worden door het vermogen van S. cerevisiae Mae1p om zowel NADH als NADPH te gebruiken. Een enigszins hogere maximale specifieke groeisnelheid van 0,02 h-1 werd waargenomen toen het cytosolische S. cerevisiae Mae1p tot overexpressie werd gebracht in de eerder geëvolueerde stamachtergrond waaruit het plasmide met het E. coli malic enzyme was verwijderd. De resultaten in dit proefschrift laten zien dat S. cerevisiae aangepast kan worden voor de productie van substantiële hoeveelheden van de C4-dicarbonzuren appelzuur en barnsteenzuur. Echter, industriële toepassing vereist hogere opbrengsten en concentraties, en minder bijproductvorming. Daarom zal het terugbrengen van pyruvaatproductie van bijzonder belang zijn bij gebruik van pyruvaatdecarboxylase-negatieve stammen. Een moeilijkere en nog interessantere uitdaging is het mogelijk maken van anaërobe C4-zuurproductie met S. cerevisiae. Het elimineren van de noodzaak voor ademhaling zou niet alleen productopbrengsten verhogen, maar zou ook, wanneer de conservering van vrije energie is gekoppeld aan productvorming, een selectiedruk creëren voor verhoogde zuur-
productiesnelheden, wat een grote bijdrage kan leveren aan verdere stamoptimalisatie. Hiervoor is een eerste stap gezet met de demonstratie dat PEPCK en malic enzyme kunnen functioneren als alternatieve anaplerotische enzymen in S. cerevisiae. Voor beide enzymen was het cruciaal om de thermodynamica van carboxylering te verbeteren door de concentraties te verhogen van de substraten (PEP, pyrodruivenzuur en CO2/HCO3-) en de cofactor [NAD(P)H]. Echter, verminderde groeisnelheden wijzen erop dat de capaciteit van de alternatieve carboxyleringsreacties in deze academische proof-of-principle stammen nog te laag is voor (commerciële) C4-zuurproductie. In beperkte mate kunnen hogere carboxyleringsfluxen behaald worden door te selecteren voor snellere groei. Tot slot zal de energetica van zurenexport een centrale rol spelen. Zelfs met de toegenomen ATP-opbrengst door het gebruik van PEPCK of malic enzyme is anaërobe C4-zurenproductie alleen mogelijk wanneer de energiekosten van zuurexport lager zijn dan de energieopbrengst van de fermentatieroute. Dit zou het fermentatieproces beperken tot een hoge extracellulaire pH of lage productconcentraties. Als alternatief zouden aanvullende strategieën kunnen worden ontwikkeld om de ATP-opbrengst van intracellulaire zuurproductie verder te verhogen.
139
Curriculum Vitae – English Rintze Meindert Zelle was born on February 18, 1983 in Delft. He obtained his secondary school degree at the Christelijk Lyceum Delft, and subsequently, in September 2001, began his studies in Life Science and Technology, a joint program by Delft University of Technology and Leiden University. After obtaining his bachelor’s degree (cum laude), he chose the master track Cell Factory, where he graduated on the dynamics of galactose metabolism in baker’s yeast (Saccharomyces cerevisiae) under supervision of Joost van den Brink and Han de Winde. He completed his industrial internship at Royal Nedalco in Bergen op Zoom, where he studied the conversion of xylose by S. cerevisiae for the production of second generation bioethanol. In June 2006 he received his master’s degree (cum laude), and in the same month started his PhD research in the Industrial Microbiology section of the department of Biotechnology at Delft University of Technology. Under supervision of Ton van Maris and Jack Pronk, he focused on metabolic engineering strategies for improving the production of malic and succinic acid by S. cerevisiae. The results of this research, which was sponsored by Tate and Lyle Ingredients Americas, are presented in this thesis. After his PhD studies, Rintze has taken up a new challenge as Scientist Metabolic Engineering at Allylix in Lexington, Kentucky, USA.
140
Curriculum Vitae – Nederlands Rintze Meindert Zelle werd geboren op 18 februari 1983 te Delft. Hij behaalde zijn VWO/Gymnasium diploma “oude stijl” aan het Christelijk Lyceum Delft en begon vervolgens in september 2001 met de studie Life Science & Technology, een gezamenlijke opleiding van de Technische Universiteit Delft en Universiteit Leiden. Na het voltooien van de bachelorfase (cum laude) koos hij voor de master-variant Cell Factory, waar hij onder begeleiding van Joost van den Brink en Han de Winde afstudeerde op de dynamica van het galactosemetabolisme in bakkersgist (Saccharomyces cerevisiae). De bedrijfsstage bracht Rintze door bij Koninklijke Nedalco in Bergen op Zoom, waar hij onderzoek deed aan omzetting van xylose door S. cerevisiae voor de productie van tweede-generatie bioethanol. In juni 2006 ontving hij zijn masterdiploma (cum laude) en nog dezelfde maand begon hij met zijn promotieonderzoek in de sectie Industriële Microbiologie van de afdeling Biotechnologie aan de Technische Universiteit Delft. Onder begeleiding van Ton van Maris en Jack Pronk richtte hij zich op metabolic engineering-strategieën voor het verbeteren van de productie van appelzuur en barnsteenzuur door bakkersgist. De resultaten van dit onderzoek, dat werd gesponsord door Tate and Lyle Ingredients Americas, zijn in dit proefschrift besproken. Na zijn promotieonderzoek is Rintze een nieuwe uitdaging aangegaan als Scientist Metabolic Engineering bij Allylix in Lexington, Kentucky, VS. 141
List of Publications Zelle R. M., E. de Hulster, W. A. van Winden, P. de Waard, C. Dijkema, A. A. Winkler, J. A. Geertman, J. P. van Dijken, J. T. Pronk, and A. J. A. van Maris. 2008. Malic acid production by Saccharomyces cerevisiae: engineering of pyruvate carboxylation, oxaloacetate reduction, and malate export. Appl. Environ. Microbiol. 74:2766-2777. Abbott D. A., R. M. Zelle, J. T. Pronk, and A. J. A. van Maris. 2009. Metabolic engineering of Saccharomyces cerevisiae for production of carboxylic acids: current status and challenges. FEMS Yeast Res. 9:1123-1136. Zelle R. M., E. de Hulster, W. Kloezen, J. T. Pronk, and A. J. A. van Maris. 2010. Key process conditions for production of C4 dicarboxylic acids in bioreactor batch cultures of an engineered Saccharomyces cerevisiae strain. Appl. Environ. Microbiol. 76:744-750. Zelle R. M., J. Trueheart, J. C. Harrison, J. T. Pronk, and A. J. A. van Maris. 2010. Phosphoenolpyruvate carboxykinase as the sole anaplerotic enzyme in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 76:5383-5389. 142
Lawrence A., J. T. Pronk, A. J. A. van Maris, R. M. Zelle, K. T. Madden, J. C. Harrison, J. Trueheart, C. Gancedo, C. Flores, and S. Bower. September 2010. Methods and microorganisms for production of C4-dicarboxylic acids. Patent WO/2010/111344. Zelle R. M., J. C. Harrison, J. T. Pronk, and A. J. A. van Maris. 2011. Anaplerotic role for cytosolic malic enzyme in engineered Saccharomyces cerevisiae strains. Appl. Environ. Microbiol. 77:732-738.
Acknowledgements The completion of this thesis marks the end of a 5 year period during which I was part of the yeast group Industrial Microbiology section as a master and PhD student. I have greatly enjoyed this time for its scientific and social experiences, and for this I would like to express my gratitude to all my former section colleagues. Sincerely hoping I did not forget someone, I would like to thank the staff members Frieda, Hans, Jean-Marc, Marcel, Marijke, Marinka, Pascale and Tracey, the technicians Barbara, Erwin, Koen, Maurice, Susan and Zita, the postdocs Andreas, Dani, Eleonora, Filipa, Frank, Guoliang, Ishtar, Linda, Mareike, Raffaele, Wouter and Yulia, the PhD researchers Bart, Chiara, Derek, Diana, Gabriele, Giang-Huong, Irina, Jan-Maarten, Jeremiah, Léonie, Lucie, Marit, Mark, Niels, Siew, Stefan, Tânia and Thiago, the students Ashwin, Ashwini, Bart (2x), Bianca, Carsten, Daniel, Diederik, Dieu, Dino, Duygu, Edwin (2x), Eelco, Feibai, Filipa, Frank, Freek, Geert, Guido, Inês, Ines, Inge, Iris, Jermaine, Jop, Joris, Justin, Kirill, Maaike, Madelon, Margriet, Marijke, Marta, Max, Mirjam, Nils, Nuno, Pervin, Priscilla, Qixiang (Lilian), Raoul, Rita, Robert, Roberta, Rogier, Rosanne, Ruben, Vincent, Ward, Yigen and Zha Ying, the Birdies Erik, Kai, Marko, Ron, Rosario, Tom and Vicky, the colleagues from EWI/ICT Dick, Jurgen, Rogier and Theo, and of course the ever helpful staff from the medium and sterilization service group, Apilena, Astrid, Jannie and Miranda, for contributing to this dynamic and international environment. Of course, my gratitude extends beyond the boundaries of “my” group. The Biotechnology department always has a great atmosphere, which undoubtedly is largely due to its great support staff that keeps things running smoothly. In this respect I’m particularly indebted to Arno, Dirk, Ginie, Hans, Herman, Jos, Kees, Lesley, Mario, Max, Rob, Sjaak and Stef. Wouter (BPT), thanks for your tireless efforts in helping me with the analyses of the 13C-measurements. Beyond the borders of Delft, I’d like to thank the industrial sponsor of my PhD research, Tate & Lyle Ingredients Americas, Inc. Abi, Chi-Li, Jeff and Stan, I greatly enjoyed our scientific discussions. I also would like to thank my colleagues at Microbia in Lexington, Massachusetts (Adam, Jake, Josh, Kevin), at the Department of Metabolism and Cell Signaling, Instituto de Investigaciones Biomédicas “Alberto Sols” in Madrid (Carlos, Carmen), and at Wageningen University and Research Centre in Wageningen (Cor, Pieter). If you made it this far, and have been paying attention, you might have noticed that some people have not (yet) been mentioned. I would like to express special thanks to “my” students: Nienke, Wendy, Briek and Eveline. Supervising you
143
has been a joyful and educational experience. Paranymphs Eline and Victor, thank you for offering your time to assist me before and during my defense. Joost and Han, I would like to thank you for introducing me to the always interesting world of (oscillating) microbial fermentations. Erik, thanks for your contributions in the early days of the project, and for getting me started right away. Finally, I would like to thank my promotor and copromotor. Jack and Ton, I always looked forward to our energizing discussions. Your broad knowledge of biology, your enthusiasm and your humor (“what is the air-speed velocity of an unladen Great Cormorant?”) have brought much joy to my work. Of course, this section would not be complete without thanking my parents, Bauke and Ria, and my brother, Wouter, for their support during the last 28 years. It cannot be denied that, as a family, we have been good customers for Delft University of Technology (although when my father graduated, the name was still “Technische Hogeschool van Delft”): 3 bachelor’s degrees, 3 master’s degrees, and, if all goes well, also one doctorate. And now, after having spent most of my life in and around Delft, it is time for something completely different. I’m both curious and excited about the next step in my life, which starts with my new job at Allylix in the United States!
144
