Sarcocystis muris - TU Dresden

2 downloads 10 Views 374KB Size Report
cDNA clones of Sarcocystis muris (Apicomplexa} encoding a repetitive, arginine-rich ..... Mehlhorn H, Heydorn AO (1978) The sarcosporidia: life cycle and.

Parasitol Res (1994) 80:352-354

9 Springer-Verlag 1994

Sabine Lechner 9 Karl-Heinz Eschenbacher Rolf Entzeroth 9 Heinz Mehlhorn 9 Wolfgang Riiger

cDNA clones of Sarcocystis muris (Apicomplexa} encoding a repetitive, arginine-rich region of a putative microneme antigen

Received: 27 October 1993 / Accepted: 18 November 1993 Sarcocystis muris is an obligatory intracellular parasite that propagates in mice (intermediate host) and in cats (final host). In apicomplexan parasites, host cell invasion leads to the formation of a parasitophorous vacuole in which the parasite is enclosed. Three types of secretory organelles appear to be involved in host-parasite interactions during and shortly after penetration: rhoptries, dense granules, and micronemes (Mehlhorn and Heydorn 1978; Entzeroth et al. 1986; Mehlhorn 1988; Torii et al. 1989; Adams et al. 1990; Perkins 1992). Several proteins of these organelles have been characterized, providing some information about their possible functions. After immunization of mice with a microneme-enriched fraction of S. muris cyst merozoites, two microneme-specific monoclonal antibodies (mAbs) were obtained (Entzeroth et al. 1991). Immunofluorescence microscopy with mAb 2A3 showed that this antibody reacted not only with micronemes but also with patches of antigen on the surface of infected host cells. This indicates that the microneme antigen is secreted by the cyst merozoite during host cell penetration (Entzeroth et al. 1991). On immunoblots of S. muris proteins separated by sodium dodenyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions, proteins with a molecular weight of > 70 kDa were detected by mAb 2A3 (data not shown). We used mAb 2A3 to screen a ZAP cDNA expression library of S. muris cyst merozoites (Eschenbacher et al. 1992). Two positively reacting clones with cDNA

S. Lechner 9K.-H. Eschenbacher . W. Rfiger ([~) Biologie der Mikroorganismen,Arbeitsgruppe Molekulare Genetik, Ruhr-UniversitfitBochum, D-44780 Bochum, Germany H. Mehlhorn Lehrstuhl flit SpezielleZoologie und Parasitologie, Ruhr-Universit/it Bochum, D-44780 Bochum, Germany R. Entzeroth Lehrstuhl ffir SpezielleZoologie, TU Dresden, D-01069 Dresden, Germany

inserts of 1.4 kb (clone pSll.1) and 1.9 kb (clone pSll.2) were isolated and sequenced. The nucleotide sequence of pSll.2 comprises 1869 bp (Fig. 1). It contains an open reading frame of 690 bp with a coding capacity of approximately 25.8 kDa [229 amino acids (aa)]. Noteworthy is the presence of a very long 3'-noncoding region of 1161 bp, a feature also found in cDNA clones encoding the major microneme antigen (16/17 kDa) of S. muris (Eschenbacher etal. 1993). The typical eukaryotic polyadenylation signal is missing. The reading frame of pSll.2 shows a remarkable repeat structure consisting of a 30-bp (10 aa) unit that is tandemly repeated 23 times. Figure 2 shows the nucleotide and amino acid consensus sequence of the repeats. In all, 16 of the 30 bases are identical in every repeat unit (Fig. 2a). Of the 20 proteinogenic amino acids, only 10 are present in this polypeptide, which is very rich in arginine (31% of all residues) and therefore carries a highly positive charge. Furthermore, threonine and serine are very abundant residues (26% and 15%, respectively). In all, 79% of the amino acids are hydrophilic. The aa sequence contains 12 putative N-glycosylation sites (Fig. 1). In a search of the EMBL data base, high homology scores (up to 43 % identity) were obtained to several arginine- and threonine-rich proteins of various organisms. The positive charge of this putative microneme polypeptide might contribute to the adhesion of the parasite to the negatively charged surface of the host cells. The 16/17-kDa microneme antigen of S. muris (Entzeroth et al. 1992; Eschenbacher et al. 1993) and a microneme protein of Eimeria tenella (Tomley et al. 1991) have also been suggested to have adhesive functions. After expression of the cDNA insert pSll.2 in Escherichia coli cells, a fusion protein was obtained that reacted with mAb 2A3 on immunoblots. Interestingly, this fusion protein exhibited a retarded electrophoretic mobility in SDS-PAGE (data not shown). This behavior might be attributable to the high frequency of the positively charged amino acid arginine, leading to reduced binding of SDS (Takano et al. 1988).

Fig. 1 Nucleotide and deduced amino acid sequence of cDNA clone pSll.2. Unidirectional deletion clones were generated according to the method of Henikoff (1987). Sequencing of dsDNA was performed by the chain termination method (Sanger et al. 1977) on an automated laser fluorescence sequencer (LKB/ Pharmacia). Potential target sites of N-linked glycosylation are underlined. The nucleotide sequence has been submitted to the EMBL data library with the accession number Z26947

Fig. 2A, B Repeat structure and consensus motifs of cDNA clone pSll.2. A Nucleotide and B amino acid consensus sequences are highlighted by boldface letters. A Bases that are identical in every repeat unit are underlined. Nonconserved residues are indicated below. B Dashes indicate identical amino acids

1 1 52 18 103 35 154 52 205 69 256 86 307 103 358 120 409 137 460 154 511 171 562 188 613 205 664 222 722 789 856 923 990 1057 1124 1191 1250 1325 1392 1459 1526 1593 1660 1727 1794 1861

AGA ATA TCC ACC AGG AGG GAT TCC ACC CGA AGA ATA CCC ACC AGG AGA GGT Arg-lle-Ser-Thr-Arg-Arg-Asn-Ser-Thr-Arg-Arg-lle-Pro-Thr-Arg-Arg-Gly TCC ACC GGA AGA ATA CCC ACC AGG AGG GAT TCC ACC CGA AGA ATA TCC ACC Ser-Thr-Gly-Arg-lle-Pro-Thr-Arg-Arg-Asp-Ser-Thr-Arg-Arg-lle-Ser-Thr AGG AGA GGT TCC ACC GGA AGA ACG TCC ACC AGG AGA GGT TCC ACC GGG AGA Arg-Arg-Gly-Ser-Thr-Gly-Arg-Thr-Ser-Thr-Arg-Arg-Gly-Ser-Thr-Gly-Arg ATA TCC ACC AGG AGG AGT ACC ACC AGA AGA ATA TCC ACC AGG AGG AGT ACC lle-Ser-Thr-Arg-Arg-Ser-Thr-Thr-Arg-Arg-lle-Ser-Thr-Arg-Arg-Ser-Thr ACC CGA GGA AAT TCC ACC AGG AGG GGT ACC ACC GGA AGA AAT TCC ACC AGG Thr-Arg-Gly-Asn-Ser-Thr-Arg-Arg-Gly-Thr-Thr-Gly-Arg-Asn-Ser-Thr-Arg AGG GGT ACC ACC GGA AGA AAT TCC ACC AGG AGG GGT ACC ACC GGA AGA AAT Arg-Gly-Thr-Thr-Gly-Arg-Asn-Ser-Thr-Arg-Arg-Gly-Thr-Thr-Gly-Arg-Asn TCC ACC AGA AGG GGT ACC GCC GGA GGA AAT TCC ACC AGG AGG AGT ACC ACC Ser-Thr-Arg-Arg-Gly-Thr-Ala-Gly-Gly-Asn-Ser-Thr-Arg-Arg-Ser-Thr-Thr CGA GGA AAT TCC ACC AGG AGG GGT ACC ACC GGA AGA AAT TCC ACC AGG AGG Arg-Gly-Asn-Ser-Thr-Arg-Arg-Gly-Thr-Thr-Gly-Arg-Asn-Ser-Thr-Arg-Arg GGT ACC ACC GGA AGA AAT TCC ACC AGG AGG GGT ACC ACC GGA AGA AAT TCC Gly-Thr-Thr-Gly-Arg-Asn-Ser-Thr-Arg-Arg-Gly-Thr-Thr-Gly-Arg-Asn-Ser ACC AGG AGG GGT ACC ACC GGA AGA AAT TCC ACC AGA AGG GGT ACC GCC GGA Thr-Arg-Arg-Gly-Thr-Thr-Gly-Arg-Asn-Ser-Thr-Arg-Arg-Gly-Thr-Ala-Gly GGA AAT TCC ACC AGG AGG GGT ACC ACC TGG AGA AGT TCC ACC AGA AGG GGT Arg-Asn-Ser-Thr-Arg-Arg-Gly-Thr-Thr-Trp-Arg-Ser-Ser-Thr-Arg-Arg-Gly ACC ACC TGG AGA AGT TCC ACC AGA AGG GGT ACC ACC TGG AGA AGT TCC ACC Thr-Thr-Trp-Arg-Ser-Ser-Thr-Arg-Arg-Gly-Thr-Thr-Trp-Arg-Ser-Ser-Thr AGA AGG GGT ACC ACC TGG AGA AGT TCC ACC AGA AGG GGT ACC ACC CGG AGA Arg-Arg-Gly-Thr-Thr-Trp-Arg-Ser-Ser-Thr-Arg-Arg-Gly-Thr-Thr-Arg-Arg AGT TCC CCC AGG AGG CGT GCC ACC TGA AGGAGTTCCCCCGGAAGAAGCGCCACCCGGA Ser-Ser-Pro-Arg-Arg-Arg-Ala-Thr (Stop) GAAGTCCCACCAGAGGGAGTGCCACCGGCAGAGATGCTTCCGGAAGGAGAAAAGCCTGAAGAACTAC CTCCTGTCGAACCCGAGGCAGAAAAGGAAGAAGAAGGTGGCATGCCTACAGCGGCTATTGCAGGAGG CATTGTGGGCGGAGTGCTACTTTTAGGTGCTGCAGGAGGGGGAGCTGCGTACATGATGAAGGGGGGA GGTGGCCCAGGGGGAGAAGCAGAACAAGTCGTCTTTGAAGGAGAAGGCGCCGACACAGGCGCCGGAG AAGCACCACCTGAAAGCGAAACGGTTATTGAAATCGAGGACGACGCGTGGGCAGACACGTAAAGTGG TGGTGCATACAGAAGGGCTAACCGCCTCAAGAGAGTGACACTTACAGTGACAAGGAAGGGTTGGGGA AGAAGTTTTTGTGCTTGATTACTTCAGTGAAAATGATTACGGTGCATTTACAACATAAACACACTTC TTACGTCGCGTTCGATACATTTCATGAACAGTGGTGGTGGTAAAGCCGGCCCACGTGTCGGACAGCG TGCCAAGATAAAGGAGTCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAAC GAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAA ATTAAAAATGAAGTTTTAAATCAATCTCAAAAGAATTATTGGTTACCGGCCATCCCTGCTCTAAGTA GCACAGACCAGCATCATGATGCAGATGCGCGCAGTTCGCAAGTTTTTCCCGCTCACTCCCCTATTCA AATTTTCCGCGGACATGAACATGTTGTCCGGCAGCGAGTTAATCCCCGTTACTTGGTAGACAGCAGG ATCAATACAGACCAGATTCAGGGTGCGGCAGCACAGCCGTCCCAAGCCCGAACGAATGCCGTCATCG TGCGTGAAGAACAGAAACAGAAGAGGGCTTTCCCATGTTTTGTTCACTGTGTACTTGTTCAAGGTGT TGCATTGTCTAGTGTCCAAAGCTGCTGATGATAGTGACCGTGGACGACTTACACGTTGCCTCCAGCT GTGATGTTGTGACGGCACCCAATTGCGTTCAACCTGGTGGCACTCAAACGTTTGTACTGAAAAAAAA AAAAAAAAA

B) AGAAATTCCACCAGGAGGGGTACCACCCGA G. 9 .GG ............... G. .GGGG. .....

A

........

A..AAA

....

T ................

....

C.C

...........

.....

AAA..

T...TTT.. C ...........

G

1 Ii 21 31 41 51 61 71 81 91 101 111 121 131 141 151 161 171 181 191 201 211 221

-I .... NS-R -IP .... S--IP---DS-R -I ..... S--T .... GS--I .... S--R -I .... S--R G' RNSTRRGTTG

G ..... G

AS--R

......... -S ....... -S ....... -S ....... -S ....... -S-P--RA-

AW W W W R

i0 20 30 40 50 60 70 80 90 i00 ii0 120 130 140 150 160 170 180 190 200 210 220 229

354

1 23

4

5

6

7

References

w

21.2 -

u

_

4.23.5-

2 1.91.6

Acknowledgements We gratefully acknowledge H. Mentzel (Bochum) for infecting host animals. This work was supported by a grant of the Deutsche Forschungsgemeinschaft to H.M. and W.R.

m

kb Fig. 3 Southern-blot analysis of genomic DNA digests of Sarcocystis muris with a DNA probe derived from clone pSll.2. The restriction enzymes used and the sizes of the corresponding hybridization bands were as follows: PstI, 3.4 and 2.4 kb (lane 2); XhoI, 24 kb (lane 3); HindlII, 11 kb (lane 4); EcoRI, > 30 kb (lane 5); SstI, 13.5 kb (lane 6); and PvuII, two fragments of 2.3 kb (lane 7). EcoRI-digested mouse DNA (lane 1) shows no hybridization band. Size standards are indicated in kb on the left

In a Southern-blot analysis, a probe derived from cDNA clone pSll.2 hybridized to S. muris DNA fragments but not to mouse DNA (Fig. 3). Following cleavage of genomic S. muris DNA with enzymes lacking recognition sites within the cDNA insert, single bands were detected (XhoI, EcoRI, SstI, HindIII). Due to the presence of one internal PstI and PvuII restriction site within the cDNA region, these enzymes produced two hybridization bands each. Whereas the two PstI bands were distinguishable (Fig. 3, lane 2), PvuII generated two fragments of about the same length, appearing as one broad hybridization band with higher staining intensity (lane 7). These results indicate that the gene corresponding to the putative microneme antigen is present as a single copy in the haploid genome of S. muris. To our knowledge, this is the first report on a repetitive antigen of S. muris. Repetitive proteins have also been reported from other Coccidia. The cDNA sequence of a surface antigen of E. acervulina is characterized by the presence of two different tandemly repeated heptapeptides (Jenkins 1988). Merozoites of E. teneIIa have been found to contain a repetitive antigen that is very rich in glutamine (1