Screening, Isolation and Identification of Probiotic ...

Screening, Isolation and Identification of Probiotic Producing Lactobacillus acidophilus Strains EMBS081 & EMBS082 by 16S rRNA Gene Sequencing Harshpreet Chandok, Pratik Shah, Uday Raj Akare, Maliram Hindala, Sneha Singh Bhadoriya, G. V. Ravi, Varsha Sharma, Srinivas Bandaru, et al. Interdisciplinary Sciences: Computational Life Sciences Computational Life Sciences ISSN 1913-2751 Volume 7 Number 3 Interdiscip Sci Comput Life Sci (2015) 7:242-248 DOI 10.1007/s12539-015-0002-5

1 23

Your article is protected by copyright and all rights are held exclusively by International Association of Scientists in the Interdisciplinary Areas and SpringerVerlag Berlin Heidelberg. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.

1 23

Author's personal copy Interdiscip Sci Comput Life Sci (2015) 7:242–248 DOI 10.1007/s12539-015-0002-5

ORIGINAL RESEARCH ARTICLE

Screening, Isolation and Identification of Probiotic Producing Lactobacillus acidophilus Strains EMBS081 & EMBS082 by 16S rRNA Gene Sequencing Harshpreet Chandok1 • Pratik Shah1 • Uday Raj Akare1 • Maliram Hindala1 • Sneha Singh Bhadoriya1 • G. V. Ravi1 • Varsha Sharma1 • Srinivas Bandaru2 • Pragya Rathore3 • Anuraj Nayarisseri1

Received: 4 January 2013 / Revised: 11 February 2013 / Accepted: 12 March 2013 / Published online: 22 July 2015 Ó International Association of Scientists in the Interdisciplinary Areas and Springer-Verlag Berlin Heidelberg 2015

Abstract 16S rDNA sequencing which has gained wide popularity amongst microbiologists for the molecular characterization and identification of newly discovered isolates provides accurate identification of isolates down to the level of sub-species (strain). Its most important advantage over the traditional biochemical characterization methods is that it can provide an accurate identification of strains with atypical phenotypic characters as well. The following work is an application of 16S rRNA gene sequencing approach to identify a novel species of Probiotic Lactobacillus acidophilus. The sample was collected from pond water samples of rural and urban areas of Krishna district, Vijayawada, Andhra Pradesh, India. Subsequently, the sample was serially diluted and the aliquots were incubated for a suitable time period following which the suspected colony was subjected to 16S rDNA sequencing. The sequence aligned against other species was concluded to be a novel, Probiotic L. acidophilus bacteria, further which were named L. acidophilus strain EMBS081 & EMBS082. After the sequence characterization, the isolate was deposited in GenBank Database, maintained by the National Centre for Biotechnology Information NCBI. The sequence can also be retrieve from EMBL and DDBJ repositories with accession numbers JX255677 and KC150145. & Anuraj Nayarisseri [email protected] 1

Bioinformatics Research Laboratory, Eminent Biosciences, Indore 452 010, India

2

Institute of Genetics and Hospital for Genetic Diseases, Osmania University, Begumpet, Hyderabad 500 016, India

3

Department of Biotechnology, Sanghvi Institute of Management & Science, Indore 453 331, India

123

Keywords Lactobacillus acidophilus Probiotic Lactobacillus 16srRNA sequencing Lactobacillus acidophilus strain EMBS081 Lactobacillus acidophilus strain EMBS082

1 Background Probiotics are such micro-organisms when delivered live, through the diet, enhance the growth of the host. Fuller gave a well-constructed definition of probiotics, which defines them as live microbial feed supplements which beneficially affect the host animal by improving its intestinal balance [1]. The concept of probiotics first came to light in the beginning of the twentieth century, when researchers identified the potential of some microbial species to benefit the host by improving its intestinal microbial balance, thereby inhibiting the growth of pathogens and toxin producing bacteria. The term ‘‘probiotic’’ can refer to a pure or a mixed culture of micro-organisms, which when applied to animals or man, benefits the host by improving the properties of indigenous microbiota [2]. The use of probiotic micro-organisms is an alternative to the use of antibiotics in augmenting microbial infections, in both humans and man, thus emerging as a novel field which is currently under investigation for its applications in farming and aquaculture, as well in the development of prophylactic treatments for man. Probiotic products are being developed commercially for use, both as dietary supplements for humans and as feed supplements for animals being reared in the poultry and aquaculture industries [3, 4]. The potential benefits of probiotics include improved growth and prevention of several gastrointestinal tract infections and disorders [4]. In addition to being used as prophylactic agents, probiotics are also used as therapeutic

Author's personal copy Interdiscip Sci Comput Life Sci (2015) 7:242–248

agents [5]. Thus, probiotic micro-organisms can be thought of as non-pathogenic micro-organisms which on being ingested improve the hosts health, either directly by competing with pathogens for host attachment sites and/or nutrition or indirectly by exerting a positive influence on hosts immune system [6]. One manner in which modulation of the gut microbiota composition has been attempted is through the use of live microbial dietary additions, as probiotics. The word probiotics is translated from the Greek meaning ‘‘for life’’. An early definition was given [7] ‘‘Organisms and substances which contribute to intestinal microbial balance’’. However, this was subsequently refined as: ‘‘a live microbial feed supplement which beneficially affects the host animal by improving its intestinal microbial balance’’ [8]. This latter version is the most widely used definition and has gained widespread scientific acceptability. A probiotics would therefore incorporate living micro-organisms, seen as beneficial for gut health, into diet. Probiotics has a long history. In fact, the first records of intake of bacterial drinks by humans are over 2000 years old. However, at the beginning of this century, probiotics were first put onto a scientific basis by the work of Metchnikoff at the Pasteur Institute in observed longevity in Bulgarian peasants and associated this with their elevated intake of soured milks [9]. During these studies, he hypothesized that the normal gut microflora could exert adverse effects on the host and that consumption of certain bacteria could reverse this effect. Metchnikoff refined the treatment by using pure cultures of what is now called Lactobacillus delbrueckeii subsp. bulgaricus, which, with Streptococcus salivarius subsp. thermophilus, is used to ferment milk in the production of traditional yoghurt. Subsequent research has been directed towards the use of intestinal isolates of bacteria as probiotics [10]. Over the years, many species of micro-organisms have been used. They mainly consist of lactic acid producing bacteria (lactobacilli, streptococci, enterococci, lactococci, bifidobacteria) but also Bacillus spp. and fungi such as Saccharomyces spp. and Aspergillus spp. For the maintenance of its favourable properties, the strain must be genetically stable. For the production of probiotics, it is important that the micro-organisms multiply rapidly and densely on relatively cheap nutrients and that they remain viable during processing and storage [11]. The term, probiotics, simply means ‘‘for life’’, originating from the Greek words ‘‘pro’’ and ‘‘bios’’. He defined a probiotics as ‘‘a live microbial feed supplement which beneficially affects the host animal by improving its intestinal balance’’. The main purpose of using probiotics and prebiotic maybe are the use of this material to improve the health of their host and increasing growth rate [12]. The application of probiotics and prebiotic in aquaculture has

243

shown positive results, but insufficient evaluation of biological influence of bacteria in natural environment and cost of the material are the restriction of probiotics and prebiotics at this time. Aquaculture has grown tremendously during the last 50 years from a production of less than a million tone in the early 1950s to 59.4 million tones by 2004. This level of production had a value of US$70.3 billion. In this production, 41.3 million tones, or 69.6 %, was produced in China and 21.9 % in the rest of Asia and the Pacific region [13]. Increasing intensification and commercialization of aquaculture production, disease problems inevitably emerged. Disease is now a primary constraint to the culture of many aquatic species, impeding both economic and social development in many countries [14]. Probiotics are well established for use in humans, poultry and cattle. It was used for animal protein production. The probiotics in aquaculture was also concerned with ‘‘organic wastes’’ and ‘‘pollutants’’, as a result of incorporation of ‘‘bioremediation’’ and ‘‘biocontrol’’. Using probiotics products in aquaculture in China is the molecular microbial ecological tools for the enumeration of probiotics in a complex microbial community [15]. The probiotics used in Chinese aquaculture are mainly photosynthetic bacteria (PSB), antagonistic bacteria (Pseudoalteromonas sp., Flavobacterium sp., Alteromonas sp., Phaeobacter sp., Bacillus sp., etc.), micro-organisms for nutritional and enzymatic contribution to the digestion (lactic acid bacteria, yeast, etc.), bacteria for improving water quality (nitrifying bacteria, denitrifiers, etc.), Bdellovibrio, and other probiotics, an integrated approach by using combined probiotics (microecologics) is gaining popularity [16]. The increase in productivity in aquaculture has been accompanied by ecological impacts including emergence of a large variety of pathogens and bacterial resistance. These impacts are in part due to the indiscriminate use of chemotherapeutic agents as a result of management practices in production cycles. This review provides a summary of the use of probiotics for the prevention of bacterial diseases in aquaculture, with a critical evaluation of results obtained to date [17].

2 Materials and Methods 2.1 Collection of Samples In this study, we examined the response of probiotics organisms in aquaculture. The samples were collected from the bottom of prawn culturing pond located pond water samples of rural and urban areas of Krishna district, Vijayawada, Andhra Pradesh.

123

Author's personal copy 244

2.2 Serial Dilutions Ten millilitres of distilled water was added to the first test tube out of seven test tubes. To each of the remaining six test tubes, 9 mL of distilled water was added. One millilitre of the contents was transferred from test-1 to tube and mixed well. One millilitre of the contents of tube-2 was then transferred to tube-3, and the procedure is repeated for final tube. Finally, from the last tube, 60 lL of dilution is taken and pour on the Petri dish for further use. 2.3 Pure Culturing and Preparation of Nutrient Medium Twenty-five grams of nutrient agar was weighed and dissolved in 1000 mL of distilled water except agar in a conical flask. pH of the medium was adjusted to 7 by adding either 1N NaOH or 1N HCl. Twenty grams of agar was weighed and added to the medium and arranged the cotton plug and subjected to sterilization in an autoclave at 15 lbs pressure for 15 min. At the same time, the Petri plates were sterilized in an hot air oven at 160 C for 2 h. The laminar air flow chamber was smeared with rectified spirit. The medium was cooled to room temperature and transferred into the conical flask into laminar air flow chamber; 100 lL of the medium was taken from 105 and poured in sterile Petri plate. Similarly, 100 lL of the medium was taken from the 106 and poured in another sterile Petri plate. And allowed the plates for solidification. From the dilutions, the sample was taken and inoculated on the solidified plate and kept for incubation at 37 C for 24 h.

3 Isolation of Bacterial DNA by ST Buffer 1.5 mL of bacterial culture was taken into Ependorf tube under sterile conditions and centrifuged at 10,000 rpm, for about 2 min. Supernatant was discarded and 200 lL of TE buffer was added to the pellet and dissolved properly; 300 lL of ST buffer was added to the tubes and incubated at 65 C for 10 min. Tube was inversed for every 2 min while heating. Cooled to room temperature and centrifuged at 10,000 rpm for 2 min. Supernatant was taken and 150 lL of 0.3 M sodium acetate was added. These tubes are centrifuged at 10,000 rpm for 2 min. Supernatant was taken and 600 lL of isopropanol was added and incubated in 20 C for 20 min and centrifuged at 10,000 rpm for about 3 min. Now the supernatant was discarded and pellet was washed with 300 lL 70 % ethanol. These tubes are centrifuged at 10,000 rpm for 2 min. The supernatant was discarded and pellet was air-dried, placing the tube

123

Interdiscip Sci Comput Life Sci (2015) 7:242–248

reversely on the tissue paper, and 25 lL of TE buffer was added to pellet. Then the sample was subjected to gel electrophoresis. The formed bands were visualized UV transilluminator.

4 Isolation of Bacterial DNA by SN Buffer 1.5 mL of bacterial culture was taken into Ependorf tube under sterile conditions and centrifuged at 10,000 rpm, for about 2 min. Supernatant was discarded and 200 lL of TE buffer was added to the pellet and dissolved properly; 300 lL of SN buffer was added to the tubes and incubated at 65 C for 10 min. Tube was inversed for every 2 min while heating. Cooled to room temperature and centrifuged at 10,000 rpm for 2 min. Supernatant was taken and 150 lL of 0.3 M sodium acetate was added. These tubes are centrifuged at 10,000 rpm for 2 min. Supernatant was taken and 600 lL of isopropanol was added and incubated in 20 C for 20 min and centrifuged at 10,000 rpm for about 3 min. Now the supernatant was discarded and pellet was washed with 300 lL 70 % ethanol. These tubes are centrifuged at 10,000 rpm for 2 min. The supernatant was discarded and pellet was air-dried, placing the tube reversely on the tissue paper and 25 lL of TE buffer was added to pellet. Then the sample was subjected to gel electrophoresis. The formed bands were visualized UV transilluminator. 1.5 mL of bacterial culture was taken into Ependorf tube under sterile conditions and centrifuged at 10,000 rpm, for about 2 min. Supernatant was discarded and 200 lL of TE buffer was added to the pellet and dissolved properly; 160 lL of 10 % SDS, 80 lL of 2N NaCl was added and mixed well; tubes were incubated in hot water bath for 10 min at 65 C. Cooled to room temperature and centrifuged at 10,000 rpm for 2 min. Supernatant was taken and adds equal volume of phenol: chloroform: isoamyl alcohol as 25:24:1. These tubes are centrifuged at 10,000 rpm for 2 min. To the aqueous layer, add equal volume of chloroform: isoamyl alcohol as 24:1 and centrifuged at 10,000 rpm for about 2 min. To the aqueous layer, 180 lL of 3 molar sodium acetate was added. Tube was inversed for every 5 min. These tubes are centrifuged at 10,000 rpm for 2 min. Supernatant was taken and 400 lL of ice cold isopropanol was added. Tubes are inverted for ten times, and tubes are centrifuged at 10,000 rpm for 2 min. To the pellet, 300 lL of 70 % ethanol was added, and tubes are centrifuged at 10,000 rpm for 2 min. Pellet was air-dried and dissolved in TE buffer. Then the sample was subjected to gel electrophoresis. The formed bands were visualized UV transilluminator.


1.5 mL of bacterial culture was taken into Ependorf tube under sterile conditions and centrifuged at 10,000 rpm, for about 2 min. Supernatant was discarded and 600 lL of lysis buffer was added to the pellet and incubated at 65 C for 10 min. Cooled to room temperature and centrifuged at 10,000 rpm for 5 min. Supernatant was taken and 200 lL of 0.3 M sodium acetate was added. These tubes are centrifuged at 10,000 rpm for 2 min. Supernatant was taken and 600 lL of ice cold iso propanol was added and incubated at 20 C for 20 min and centrifuged at 10,000 rpm for about 2 min. Now the supernatant was discarded and pellet was washed with 300 lL 70 % ethanol. These tubes are centrifuged at 10,000 rpm for 2 min. The supernatant was discarded and pellet was air-dried, placing the tube reversely on the tissue paper, and 25 lL of TE buffer was added to pellet. Then the sample was subjected to gel electrophoresis. The formed bands were visualized UV transilluminator. 4.1 Characteristics of Agarose Gel Alexander Reuss made first observation in 1807 obtained it from agar—agar. Agar and agarose are two forms of solid growth media that are used for the culture of micro-organisms, particularly bacteria. Both agar and agarose act to solidify the nutrients that would otherwise remain in solution. Both agar and agarose are able to liquefy when heated sufficiently, and both return to a gel state upon cooling. 4.2 Amplification of 16srRNA There are three major steps in a PCR, which are repeated for 30 or 40 cycles. This is done on an automated cycler, which can heat and cool the tubes with the reaction mixture in a very short time. During the denaturation (at 94 C and 60 s), the double strand melts open to single-stranded DNA, and all enzymatic reactions stop (for example the extension from a previous cycle). Annealing has been carried out at 54 C and 30 s. The primers are jiggling around, caused by the Brownian motion. Ionic bonds are constantly formed and broken between the single-stranded primer and the single-stranded template. The more stable bonds last a little bit longer (primers that fit exactly) and on that little piece of double-stranded DNA (template and primer), the polymerase can attach and starts copying the template. Once there are a few bases built in, the ionic bond is so strong between the template and the primer and that it does not break anymore. Extension at 72 C and 60 s, this is the ideal working temperature for the polymerase. The primers, where there are a few bases built in, already have a stronger ionic attraction to the template than the forces breaking these attractions. Primers that are on

245

positions with no exact match get loose again (because of the higher temperature) and do not give an extension of the fragment. The bases (complementary to the template) are coupled to the primer on the 30 side (the polymerase adds dNTP’s from 50 to 30 , reading the template from 30 to 50 side; bases are added complementary to the template).

5 Results and Discussion 5.1 Sample Collection and Preservation For analysis, the pathogenic micro-organisms from pond water and aquatic organism like fish and shrimp samples were collected from coastal area of Krishna district. For collecting the samples, sterilized 15 ml tubes were used. The sample collected were transferred to laboratory conditions and stored aseptically until they used. The serial dilutions were performed from the collected samples, and the isolated colonies were observed when incubated on the nutrient agar medium. The isolated colonies were subjected to molecular-based characterization for knowing the information about the pathogenic organism at both genus and species level. After incubation, growth of pathogens is inhibited by probiotics organism. 5.2 Isolation of Bacterial DNA Bacterial DNA was successfully isolated using ST buffer and SN buffer method. Isolated DNA sample as successfully run on agarose gel and separated band was observed under UV transilluminator (Fig. 1). 5.3 PCR Primers Used One very big advantage in using the 16S rRNA gene for molecular characterization of bacteria and identification of new bacterial species/strains is that even though the sequence of the 16S rRNA coding gene of the isolate is yet

Fig. 1 16S rDNA amplification with 100 bp DNA Ladder

123

Author's personal copy 246

Interdiscip Sci Comput Life Sci (2015) 7:242–248

(a)

(b)

Fig. 2 a Phylogenetic affiliation of Lactobacillus acidophilus EMBS081 against all the other species of Lactobacillus; b Phylogenetic affiliation of Lactobacillus acidophilus EMBS082 against all the other species of Lactobacillus

to be sequenced, as a matter of fact is the very motive behind some research works like ours, it is possible to design primers for the PCR amplification of such yet to be sequenced genes too. Such primers are designated as ‘‘Universal Primers’’. The idea behind the usage of universal primers is that the 16S rRNA gene is unique for different species as well as for different strains of the same species, but the flanking regions of the 16S rRNA gene remain highly conserved across different species. Therefore, the primers can be designed for a novel species also since it would have the same flanking regions of its 16S rRNA gene, and so the primer will attach to these flanking

123

regions and facilitate the extension of the gene by the respective DNA polymerase enzyme. 5.4 PCR Primers Forward primer: AGAGTTTGATCCTGGCTCAG Reverse primer: GACGGGCRGTGWGTRCA The PCR mixture used had four components in it. It contained the PCR master mix (20 lL), which consisted of Taq polymerase enzyme, dNTP’s and 10 PCR buffer in it; the template (2 lL); the forward and reverse primers (1 lL each); and distilled water (6 lL). All these


components were added to a 200-lL capacity PCR vial in the sequence as described above and in the respective amounts. After adding all the above listed components in the above listed sequence to the 200-lL PCR vial, the vial was placed in a 1500-lL capacity bigger vial and subjected to a very brief spinning in centrifuge, only for the purpose of proper mixing of the contents. 5.5 Purification of the Amplified PCR Product After amplifying the 16S rRNA gene using the thermal cycle as described above. To the PCR, vial was added 5 lL of 3 M sodium acetate solution (pH = 4.6) and 100 lL of absolute ethanol. This was followed by vortexing the vial and incubating it at 20 C for 30–40 min, to precipitate the PCR product. Then the product was subjected to centrifugation at 10,000 rpm for 5 min. Next, we added 300 lL of 70 % ethanol to the resulting pellet and again carried out centrifugation at 10,000 rpm for 5 min. The resulting pellet was air-dried until there was no perceivable smell of ethanol. Finally, the pellet was suspended in 10 lL of sterile distilled water 5.6 Sequencing of the PCR Product The PCR product was sequenced using the ABI Prism. Sequencing reactions were carried out with ABI PRISM Dye Terminator Cycle Sequence Ready Reaction Kit (Applied Biosystems Inc., USA). The sequence obtained was as follows (Fig. 2).

247

Probiotics are live micro-organisms thought to be beneficial to the host organism. According to the currently adopted definition by WHO, probiotics are: ‘‘Live microorganisms which when administered in adequate amounts confer a health benefit on the host’’. In our case, L. acidophilus act as a probiotics to pond water prawns and other aquatic fishes to digest the food. The pond water sample was collected from urban and rural regions of Krishna district, Andhra Pradesh, India. Extraction, isolation, purification and amplification have been carried out in various wet laboratory techniques. Amplification of DNA has been performed by gradient PCR. After the amplification of DNA, sequencing has been carried out by Sanger dideoxy method. The given sequences were cloned with pGEM vector. Sequencing was carried out ABI Prism. Two .abi files have been obtained after sequencing. The one is reverse primer file, and other one is forward, respectively. Visualization of these .abi files we used in silico algorithm called DNA Baser. These trace files are opened by this tool and export the data into FASTA format. Both the sequences were assembled, and consensus sequences are generated. The generated consensus is subjected to sequence similarity by Blastn against nr database. First 20 HSPs has filtered from blast result, and MSA has been carried out, and then dendrogram has generated. From the dendrogram, we have concluded that the given 16s rRNA belongs to Lactobacillus acidophilus. The generated sequence has been submitted to Genbank, and sequences are available to download in NCBI, EMBL and DDBJ repositories by accession numbers JX255677 and KC150145.

5.7 GenBank Accession Number The sequence aligned against other species was concluded to be a novel, Probiotic Lactobacillus acidophilus bacteria, further which were named Lactobacillus acidophilus strain EMBS081 & EMBS082. After the sequence characterization, the isolate was deposited in GenBank Database, maintained by the National Centre for Biotechnology Information (NCBI), with accession numbers JX255677 and KC150145.

6 Conclusion Lactobacillus acidophilus is a member of one of the eight main genera of lactic acid bacteria. There are many species of Lactobacillus bacteria that are found in a variety of environments. But, current study focused on Lactobacillus acidophilus found in pond water act as probiotics to aquatic fishes. Lactobacillus acidophilus (L. acidophilus) is the most commonly used probiotic, or ‘‘friendly’’ bacteria.

References 1. Macfarlane GT, Cummings JH (1999) Probiotics and prebiotics: can regulating the activities of intestinal bacteria benefit health. West J Med 171(3):187–191 2. Verschuere L, Rombaut G, Sorgeloos P (2000) Probiotic bacteria as biological control agents in aquaculture. Microbiol Mol Biol Rev 64(4):655–671 3. Balca´zar JL, de Blas I, Ruiz-Zarzuela I, Cunningham D, Vendrell D, Mu´zquiz JL (2006) The role of probiotics in aquaculture. Vet Microbiol 114(3–4):173–186 4. Ninawe AS, Selvin J (2009) Probiotics in shrimp aquaculture: avenues and challenges. Crit Rev Microbiol 35(1):43–66 5. Gupta V, Garg R (2009) Probiotics. Indian J Med Microbiol 27(3):202–209 6. Corthe´sy B, Gaskins HR, Mercenier A (2007) Cross-talk between probiotic bacteria and the host immune system. J Nutr 137(3 Suppl 2):781S–790S 7. Van Gossum A, Dewit O, Louis E, de Hertogh G, Baert F, Fontaine F, DeVos M, Enslen M, Paintin M, Franchimont D (2007) Multicenter randomized-controlled clinical trial of probiotics (Lactobacillus johnsonii, LA1) on early endoscopic recurrence of Crohn’s disease after lleo-caecal resection. Inflamm Bowel Dis 13(2):135–142

123

Author's personal copy 248 8. Hickson M, D’Souza AL, Muthu N, Rogers TR, Want S, Rajkumar C, Bulpitt CJ (2007) Use of probiotic Lactobacillus preparation to prevent diarrhoea associated with antibiotics: randomised double blind placebo controlled trial. BMJ 335(7610):80 9. Lin YP, Thibodeaux CH, Pen˜a JA, Ferry GD, Versalovic J (2008) Probiotic Lactobacillus reuteri suppress proinflammatory cytokines via c-Jun. Inflamm Bowel Dis 14(8):1068–1083 10. Elguezabal N, Chamorro S, Molina E, Garrido JM, Izeta A, Rodrigo L (2012) Juste RA (2012) Lactase persistence, NOD2 status and Mycobacterium avium subsp. paratuberculosis infection associations to Inflammatory Bowel Disease. Gut Pathog 4:6 11. Hempel S, Newberry SJ, Maher AR, Wang Z, Miles JN, Shanman R, Johnsen B, Shekelle PG (2012) Probiotics for the prevention and treatment of antibiotic-associated diarrhea: a systematic review and meta-analysis. JAMA 307(18):1959–1969 12. Kesarcodi-Watson A, Heinrich KM, Lategan J, Gibson L (2008) Probiotics in aquaculture: the need, principles and mechanisms of action and screening processes. Aquaculture 274(2008):1–14

123

Interdiscip Sci Comput Life Sci (2015) 7:242–248 13. Sahu MK, Swarnakumar NS, Sivakumar K, Thangaradjou T, Kannan L (2008) Probiotics in aquaculture: importance and future perspectives. Indian J Microbiol 48(3):299–308 14. Liu KX, Zhu YG, Zhang J, Tao LL, Lee JW, Wang XD, Qu JM (2012) Probiotics’ effects on the incidence of nosocomial pneumonia in critically ill patients: a systematic review and metaanalysis. Critical Care 2012(16):R109 15. Desfosse´s-Foucault E´, Dussault-Lepage V, Le Boucher C, Savard P, LaPointe G, Roy D (2012) Assessment of probiotic viability during Cheddar cheese manufacture and ripening using propidium monoazide-PCR quantification. Front Microbiol 3:350 16. Verna EC (2010) Use of probiotics in gastrointestinal disorders: What to recommend? Therap Adv Gastroenterol 3(5):307–319 17. Neal-McKinney JM, Lu X, Duong T, Larson CL, Call DR, Shah DH, Konkel ME (2012) Production of organic acids by probiotic lactobacilli can be used to reduce pathogen load in poultry. PLoS One 7(9):e43928