Secretion of Functional Salivary Peptide by Streptococcus gordonii ...

INFECTION AND IMMUNITY, Aug. 1999, p. 3780–3785 0019-9567/99/$04.00⫹0 Copyright © 1999, American Society for Microbiology. All Rights Reserved.

Vol. 67, No. 8

Secretion of Functional Salivary Peptide by Streptococcus gordonii Which Inhibits Fimbria-Mediated Adhesion of Porphyromonas gingivalis KOSUKE KATAOKA,1 ATSUO AMANO,2* SHIGETADA KAWABATA,3 HIDEKI NAGATA,1 SHIGEYUKI HAMADA,3 AND SATOSHI SHIZUKUISHI1 Departments of Preventive Dentistry1 and Oral Microbiology3 and Division of Special Care Dentistry2, Osaka University Faculty of Dentistry, Suita-Osaka, Japan Received 9 March 1999/Returned for modification 20 April 1999/Accepted 5 May 1999

Porphyromonas gingivalis, a putative periodontopathogen, can bind to human salivary components with its fimbriae. We have previously shown that fimbriae specifically bind to a peptide domain shared by a major salivary component, i.e., proline-rich (glyco)proteins (PRPs). The synthetic domain peptide PRP-C (pPRP-C) significantly inhibits the fimbrial binding to PRPs. In this study, a recombinant strain of Streptococcus gordonii secreting pPRP-C was generated as a model of a possible approach to prevent the oral colonization by the pathogen. A duplicate DNA fragment (prpC) encoding pPRP-C was obtained by self-complementary annealing of synthetic oligonucleotides. prpC was connected downstream to a promoter and a gene encoding a signal peptide of Streptococcus downei glucosyltransferase I in frame. The linked fragments were inserted into the plasmid pMNK-4 derived from pVA838. The constructed plasmid was inserted to produce the transformant S. gordonii G9B, which then successfully secreted recombinant pPRP-C (r-pPRP-C) of the expected size. The concentrated bacterial culture supernatant containing r-pPRP-C inhibited the binding of P. gingivalis cells and fimbriae to PRP1 in a dose-dependent manner up to 72 and 77%, respectively. The r-pPRP-C concentrate also inhibited the coaggregation of P. gingivalis with various streptococcal strains as effectively as synthetic pPRP-C in a dose-dependent manner. Collectively, pPRP-C was found to be able to prevent P. gingivalis adherence to salivary receptor protein and plaque-forming bacteria. These results suggest that this recombination approach with a nonperiodontopathic bacterium may be suitable for the therapeutic prevention of P. gingivalis adherence to the oral cavity.

nificantly inhibits the binding of fimbriae to salivary receptor proteins, i.e., acidic and basic PRPs and their size variants (1). Recently, model systems using nonpathogenic oral streptococci were constructed for the secretion or surface expression of various biologically active proteins (16, 25–27). These trials were aimed toward therapy using recombinant organisms in place of commensal oral streptococci to induce protective host immune responses or to inhibit the adherence of pathogenic bacteria. Thus, replacement therapy could be a candidate for molecularly engineered vaccinations to prevent oral diseases. The colonization of P. gingivalis is thought to be initiated by the direct anchoring of the organism to saliva-coated host surfaces or commensal plaque-forming bacteria (13, 15, 18, 24). In this study, S. gordonii was engineered to secrete the functional peptide pPRP-C by using a shuttle vector plasmid. We evaluated the inhibitory effects of the secreted peptide in the interactions and coaggregation of P. gingivalis with both the salivary component PRP1 and various oral streptococcal cells.

Dental plaque accumulation around the gingival crevice and other oral surfaces is a predisposing factor for the initiation of periodontal diseases. Among bacterial species in plaque, Porphyromonas gingivalis, a putative major etiologic agent of periodontal diseases (28), has been shown to prevail in a variety of environments among surface components lining the oral cavity, such as mucosal membrane (7), healthy crevices (6), and supraand subgingival plaques (30). Saliva coats all of these surfaces and is thought to be critical for the organism to adhere to and colonize the oral cavity (11, 13, 24). Acidic proline-rich proteins (PRPs) have been reported to act as salivary receptors for several plaque-forming bacteria, such as Streptococcus gordonii, Streptococcus uberis, Streptococcus sanguis, Actinomyces viscosus, and Actinomyces naeslundii (11, 24). The mechanisms involved in these interactions are not fully understood. It was previously shown that fimbriae strongly bind to acidic PRPs and statherin by protein-protein interactions through definitive domains of the fimbriae (4) and salivary proteins (1–3, 14). The minimum active domain of PRP1 (a major variant of acidic PRPs) for binding to P. gingivalis fimbriae was found to be Pro-Gln-Gly-Pro-Pro-Gln (PQGPPQ). This peptide sequence is shared by a family of acidic and basic PRPs as a typical repeating sequence (1). The synthetic peptide PRP-C (pPRP-C), containing PQGPPQ, sig-

MATERIALS AND METHODS Bacterial culture conditions. P. gingivalis ATCC 33277 was grown and radiolabeled with [3H]thymidine as described previously (4). Streptococcus mitis ATCC 15909 and ATCC 15912, S. gordonii G9B, Streptococcus oralis ATCC 9811 and ATCC 10557, Streptococcus downei MFe 28, and S. sanguis ATCC 10556 were selected from our culture collections and were cultured as described previously (20). Bacterial cells were washed three times and suspended in an appropriate buffer for assay. Escherichia coli JM109 was grown in Luria-Bertani broth or medium containing 1.5% agar. Preparation of P. gingivalis fimbriae and synthetic pPRP-C. Fimbriae were purified from P. gingivalis ATCC 33277 by the method of Yoshimura et al. (29) and iodinated as described previously (4). The synthetic pPRP-C, corresponding to the carboxy-terminal segment composed of 21 residues of PRP1, was synthe-

* Corresponding author. Mailing address: Division of Special Care Dentistry, Osaka University Faculty of Dentistry, 1-8 Yamadaoka, Suita-Osaka 565-0871, Japan. Phone: 81-6-6879-2280. Fax: 81-6-68792284. E-mail: [email protected]. 3780

VOL. 67, 1999

SECRETION OF FUNCTIONAL PEPTIDE BY S. GORDONII

FIG. 1. Construction of shuttle vector pMNK-5. pMNK-5 was constructed by the tandem linkage of DNA fragments encoding a promoter and a signal peptide of S. downei glucosyltransferase I followed by the E. coli rrnBt1t2 terminator.

sized and purified in a previous study (14). The amino acid sequence of pPRP-C is PQGPPPQGGRPQGPPQGQSPQ. Preparation of polyclonal antibodies to synthetic pPRP-C. pPRP-C was polymerized by the addition of a cysteine residue at the amino terminus according to the m-maleimidobenzoyloxy succinimide method (12). Two clean rabbits were injected under the skin of the back with pPRP-C (0.67 mg in 0.3 ml of phosphatebuffered saline [pH 7.5]) emulsified with an equal volume of complete Freund’s adjuvant for immunization. Beginning two weeks after the first immunization, these rabbits were given boosters four times with the same amount of the immunogen over 8 additional weeks. Two weeks after the last immunization, these rabbits were bled and their sera were separated by centrifugation. The reactivities of these sera to pPRP-C were confirmed and the immunoglobulin Gs (IgGs) were fractionated with a protein A affinity column (Amersham Pharmacia Biotech, Uppsala, Sweden). Construction of recombinant S. gordonii. Shuttle vector plasmid pMNK-4 derived from pVA838 (19) was donated by T. Morita (Research Institute for Microbial Diseases, Osaka University). pMNK-4 was previously constructed to express and secrete Arthrobacter sp. dextranase by the insertion of dex linked to a DNA sequence encoding a promoter and a signal peptide of S. downei glucosyltransferase I, followed by the E. coli rrnBt1t2 terminator (16). DNA fragments containing the above promoter and signal peptide sequences were obtained by PCR with pMNK-4, a forward primer (5⬘-GCGCATGCGGATCGTC TATGGTAAAACAGAGAAGAA-3⬘), and a reverse primer (5⬘-TGCGCTAG CAACTGAAGCACCGAGA-3⬘). The forward and reverse primers incorporated the restriction enzyme sites of SphI and NheI, respectively (underlined). The PCR product was ligated into plasmid pGEM-T (Promega, Madison, Wis.) for DNA sequencing with the 373 DNA sequencing system (Perkin-Elmer Corp., Foster City, Calif.), and the resulting plasmid was digested with SphI and NheI. A DNA fragment (prpC) encoding pPRP-C was manufactured by self-complementary annealing of the synthetic oligonucleotides 5⬘-CTAGCGCACCCC AGGGACCACC TCCCCAAGGGGGCCGC C CACAAGGACC TCCACAG G GGCAGTCTCCTCAGTGAAAG-3⬘ and 5⬘-TCGACTTTCACTGAGGAGAC TGCCCCTGTGGAGGTCCTTGTGGGCGGCCCCCTTGGGGAGGTGGTC CCTGGGGTGCG-3⬘ following incubation at 96°C. The annealed doublestranded DNA was purified by a hydroxyapatite (HA) column (CHT2-I; Bio-Rad Laboratories, Hercules, Calif.) by using a fast protein liquid chromatography biologic workstation (Bio-Rad Laboratories) and was phosphorylated by PCR with a set of primers (5⬘-GCTAGCGCACCCCAGGGACCACCTCCC-3⬘ and 5⬘-GTCGACTTTCACTGAGGAGACTGCCCC-3⬘). The PCR product was inserted into plasmid pGEM-T for DNA sequencing and then was digested with SalI and NheI at the restriction sites underlined. The DNA fragments (365 bp) of the promoter-signal peptide sequence and prpC were ligated to plasmid pUC19 (Takara, Kyoto, Japan) and subcloned to E. coli JM109. The present expression vector (pMNK-5) was obtained following the insertion of the fragment into pMNK-4 digested twice at the restriction sites of SphI and SalI (Fig. 1). Transformation of S. gordonii with the construct. S. gordonii G9B was cultured in Todd-Hewitt broth supplemented with 0.2% yeast extract (THY broth) to the early logarithmic phase at 37°C. The harvested cells were heat shocked at 43°C and washed with 15% glycerol. pMNK-5 (1 ␮g/200 ␮l of cell suspension) was electroporated (1.75 kV, 25 ␮F, 400 ⍀, and 7 ms) into the competent cells. The cells were plated onto brain heart infusion agar plates containing 20 mM glucose and erythromycin (25 ␮g/ml) and were cultured at 37°C for 48 h. The positive transformants were screened by a direct PCR.

3781

Preparation of r-pPRP-C secreted by the transformant. The recombinant S. gordonii was grown in THY broth containing erythromycin (25 ␮g/ml) at 37°C. The culture supernatant containing the secreted recombinant pPRP-C (rpPRP-C) was dialyzed against deionized water overnight at 4°C through a membrane with a molecular weight cutoff of 500 (Spectrum Medical Industry Inc., Gardena, Calif.). The dialysate was filtrated through a membrane with a molecular weight cutoff of 20,000 (Toyo Roshi Co., Tokyo, Japan). The resulting solution was collected and freeze-dried for concentration. Blot assay and determination of r-pPRP-C secreted by the transformant. The proteins and peptides were immobilized on a polyvinylidene difluoride membrane (Bio-Rad Laboratories) with a Bio-Dot apparatus (Bio-Rad Laboratories) for the dot blot assay with a horseradish peroxidase conjugate substrate kit (Bio-Rad Laboratories) as described previously (17). For the Western blotting, the samples were loaded for electrophoresis on a 15 to 25% polyacrylamide gel (Daiichi Pure Chemicals Co., Ltd., Tokyo, Japan), and the proteins and peptides were transferred onto a Hybond enhanced chemiluminescence (ECL) nitrocellulose membrane (Amersham Pharmacia Biotech) as described previously (1). pPRP-C and r-pPRP-C were probed with anti-pPRP-C rabbit IgG (1:1,000) with anti-rabbit goat IgG (1:2,000) and an ECL Western blotting detection kit (Amersham Pharmacia Biotech). Bovine serum albumin was used as a negative control. The amount of r-pPRP-C secreted in the culture supernatant was measured with 96-well enzyme-linked immunosorbent assay plates (flat-bottom amino plate type A; Sumitomo Bakelite Co., Ltd., Tokyo, Japan) as previously described (2). Various known amounts of synthetic pPRP-C were dissolved in the culture supernatant of wild S. gordonii and then used as controls. The peptides were measured with anti-pPRP-C peptide sera (1:2,000). The antibodies that reacted with pPRP-C were detected by using a 1:1,000 dilution of horseradish peroxidase-conjugated anti-rabbit IgG (heavy plus light chain; Zymed Laboratories, Inc., San Francisco, Calif.) at room temperature for 2 h. The enzyme reaction proceeded with 3,3⬘,5,5⬘-tetramethylbenzidine (Moss, Inc., Pasadena, Md.) as a substrate. The reaction was terminated with 0.5 M HCl, and the color intensity was measured at 450 nm. All assays were performed in triplicate on three separate occasions. Data were expressed as mean ⫾ standard deviation. The peptide and protein content was measured by dry weight. Binding assay using PRP1-coated HA beads. Assays of the binding of [3H]thymidine-labeled P. gingivalis cells and 125I-labeled fimbriae to PRP1-coated HA beads (2 mg) were carried out with a 50 mM KCl buffer containing 1 mM KH2PO4, 1 mM CaCl2, and 0.1 mM MgCl2 (pH 6.8) as described previously (4). Synthetic pPRP-C (500 nmol) was dissolved in 1 ml of a 47-fold-concentrated supernatant of wild S. gordonii (40 mg/ml). 125I-fimbriae (0.5 nmol) or [3H]thymidine-labeled cells (108 cells) were added simultaneously with various inhibitors (200 ␮l) to PRP1-coated HA beads in glass tubes to a final volume of 400 ␮l. The specific binding was calculated by subtracting the nonspecific binding which was obtained by the preincubation of PRP1-coated HA beads with nonlabeled fimbriae (500 ␮l at 50 nmol/ml) at room temperature for 1 h. All assays were performed in triplicate on three separate occasions. Coaggregation assay. The assays of coaggregation between P. gingivalis and some oral streptococci were performed according to the turbidimetric method of Nagata et al. (20). The progress of coaggregation was monitored at 37°C by measurement of the decrease in A550 in 10 mM phosphate-buffered saline containing 0.15 M NaCl (pH 6.0). To assess the inhibitory effects of the culture supernatant of recombinant S. gordonii on coaggregation, the turbidimetric changes were evaluated by the naked eye according to the method of Cisar et al. (5). The cell suspensions were adjusted to optical densities of 0.5 for oral streptococci and 1.0 for P. gingivalis at 660 nm in a mixture containing 1 mM Tris-HCl, 0.1 mM CaCl2, 0.15 M NaCl, and 0.02% NaN3 (pH 7.2). Equal amounts of solutions (200 ␮l) of P. gingivalis and streptococcal cells were mixed with an inhibitor solution (200 ␮l) in a test tube to yield a final volume of 600 ␮l. The mixture was incubated on a shaker (150 rpm) at room temperature for 10 min. Coaggregation was evaluated according to a visual rating scale from ⫺ (minus) (least aggregation) to 4⫹ (most aggregation) (5). Statistical analysis. The data were averaged (mean ⫾ standard deviation), comparisons were performed with Student’s t test, and P values of ⬍0.01 were considered significant. The regression line was obtained by the least-squares method.

RESULTS Secretion of r-pPRP-C by recombinant S. gordonii. It was confirmed by DNA sequencing that the combined structural gene containing the promoter-leader sequence, prpC, and the terminator was constructed in pMNK-5 in the correct frame and orientation. The transformant cells (recombinant S. gordonii) were grown in THY broth, and the culture supernatant was concentrated 47-fold (vol/vol) following dialysis. In the dot blot assay, the recombinant S. gordonii concentrate (20 ␮l at 40 mg/ml) clearly reacted with the anti-pPRP-C IgG while that of the wild cells showed no positive reaction (Fig. 2A). The mo-

3782

KATAOKA ET AL.

FIG. 2. Secretion of r-pPRP-C by recombinant S. gordonii. (A) Dot blot assay of r-pPRP-C secreted by recombinant S. gordonii. The culture supernatant of recombinant S. gordonii containing r-pPRP-C was concentrated 47-fold (vol/vol; 40 mg/ml) as stated in the text. Samples of 20 ␮l were adsorbed to a polyvinylidene difluoride membrane. The r-pPRP-C on the membrane was probed with anti-pPRP-C rabbit antibodies. Dots: 1, synthetic pPRP-C (1 mg/ml); 2, culture supernatant containing r-pPRP-C secreted by recombinant S. gordonii (40 mg/ ml); 3, culture supernatant of wild S. gordonii (40 mg/ml); 4, 1% bovine serum albumin. (B) Western blot assay of r-pPRP-C in the culture supernatant of recombinant S. gordonii. The r-pPRP-C on the membrane was probed with anti-pPRP-C rabbit antibodies. Lanes: 1, r-pPRP-C in the culture supernatant secreted by recombinant S. gordonii (20 ␮l [40 mg/ml]); 2, synthetic pPRP-C (20 ␮l [1 mg/ml]); 3, culture supernatant of wild S. gordonii (20 ␮l [40 mg/ml]). Molecular sizes are on the left of the lanes. (C) Determination of the amount of r-pPRP-C in the nonconcentrated culture supernatant of recombinant S. gordonii by enzyme-linked immunosorbent assay. The regression line [y ⫽ (8.8 ⫻ 10⫺2) x ⫹ (2.8 ⫻ 10⫺3)] was obtained with various known amounts of synthetic pPRP-C dissolved in the nonconcentrated culture supernatant of wild S. gordonii (E). The amount of the r-pPRP-C in the culture supernatant (100 ␮l) (F) was determined with the regression line.

lecular size of r-pPRP-C secreted by recombinant S. gordonii was examined by Western blotting. r-pPRP-C in the concentrate migrated as far as synthetic pPRP-C (Fig. 2B), indicating that the leader sequence was digested by the host cells. To determine the concentration of r-pPRP-C in the nonconcentrated recombinant S. gordonii supernatant, a regression line [y ⫽ (8.8 ⫻ 10⫺2) x ⫹ (2.8 ⫻ 10⫺3)] was obtained by dissolving various known amounts of the synthetic pPRP-C in the culture supernatant of wild S. gordonii (Fig. 2C). The supernatant gave an absorbance (A450) of 0.040. Thus, the secreted amount of r-pPRP-C was estimated to be 8.6 ␮g/ml (4.3 nmol/ml) of the medium. Effect of the secreted r-pPRP-C. The inhibitory effect of r-pPRP-C in the 47-fold concentrate (40 mg/ml) was examined on the binding of 125I-fimbriae and [3H]thymidine-labeled cells

INFECT. IMMUN.

of P. gingivalis to PRP1-coated HA beads (Fig. 3). The amount of r-pPRP-C was estimated to be 5.05 nmol/mg of the concentrate. Synthetic pPRP-C (500 nmol) was dissolved in 1 ml of culture supernatant of wild S. gordonii which was also concentrated 47-fold (40 mg/ml) by the method used for recombinant S. gordonii. PRP1 in solution, which showed no inhibitory effect, and the concentrated supernatant of wild S. gordonii were used as negative controls. Synthetic pPRP-C markedly inhibited the binding of fimbriae and whole cells to PRP1 in a dose-dependent manner. Synthetic pPRP-C (final concentration, 250 nmol/ml) significantly inhibited the binding of fimbriae and whole cells by 93 and 90%, respectively. The rpPRP-C concentrate also revealed significant inhibition of fimbrial and whole-cell binding (77 and 72%, respectively) when 8 mg was added. Since 8 mg of the concentrate was estimated to contain 40.4 nmol of r-pPRP-C, r-pPRP-C seems to be as effective as synthetic pPRP-C. Ability of synthetic pPRP-C to inhibit coaggregation. The coaggregation assay was performed with synthetic pPRP-C to examine the effect of pPRP-C on the coaggregation of P. gingivalis with oral streptococci. The synthetic pPRP-C clearly inhibited the coaggregation of P. gingivalis with various streptococcal strains in a dose-dependent manner as shown in Fig. 4. At a concentration of 133 nmol/ml, coaggregation with S. mitis ATCC 15909 was inhibited by 81%, and coaggregation with other strains was also significantly inhibited; S. mitis ATCC 15912, 73%; S. gordonii G9B, 70%; S. oralis ATCC 9811, 68%; S. oralis ATCC 10557, 60%; S. downei MFe 28, 54%; and S. sanguis ATCC 10556, 44%. These inhibitory effects were not further increased by the addition of pPRP-C above the final concentration. Ability of r-pPRP-C to inhibit coaggregation. The turbidimetric method is suitable for evaluating the inhibitory effect on coaggregation (20). However, the r-pPRP-C concentrate was colored deep yellow due to the broth constituents, which prevented measurement of the decrease in A550 by a spectrophotometer. Thus, the coaggregation was evaluated by the naked eye with a visual rating scale from ⫺ to 4⫹ (Table 1). All of the streptococcal cells examined aggregated with P. gingivalis cells with a score of 4⫹. Equal amounts of synthetic pPRP-C (67 nmol) and r-pPRP-C (67 nmol in 13.2 mg of the concentrate) were added as inhibitors. The coaggregation scores dropped to 2⫹ and 1⫹ with the addition of r-pPRP-C, which was as effective as synthetic pPRP-C. The effect of the concentrated culture supernatant of wild S. gordonii was negligible. DISCUSSION Salivary flow is able to prevent bacterial adherences to oral tissues (9, 10, 24); however, salivary components capable of interacting with P. gingivalis fimbriae appear to act as receptor components to promote the adherence of this organism to oral surfaces. The bindings of P. gingivalis fimbriae to salivary proteins (acidic and basic PRPs and statherin) are mediated by unique hidden receptors termed cryptitopes (4). These interactions occur by the exposure of the functional domain induced by conformational change only when the salivary proteins are fixed to surfaces, such as those of HA beads. Thus, these proteins in solution showed no ability to bind fimbriae. The synthetic pPRP-C, a carboxy-terminal fragment of PRP1, was not cryptic in nature (1, 14), and the peptide diminished P. gingivalis binding to salivary proteins on apatitic surfaces by a competitive inhibition of the binding domain of the fimbrillin molecule (1). The r-pPRP-C was successfully secreted at a concentration of 8.6 ␮g/ml (4.3 nmol/ml) of the culture medium by recom-

VOL. 67, 1999


3783

FIG. 3. Comparison of effects of r-pPRP-C and synthetic pPRP-C. The inhibitory effects of r-pPRP-C at various concentrations on the bindings of 125I-fimbriae and [3H]thymidine-labeled cells of P. gingivalis (3H-cells) to PRP1-coated HA beads were examined. Synthetic pPRP-C (500 nmol) was dissolved in 1 ml of 47-foldconcentrated supernatant (sup.) of wild S. gordonii (Sg) (40 mg/ml). 125I-fimbriae (0.5 nmol) or 3H-cells (108 cells) were simultaneously added with various inhibitors (200 ␮l) to PRP1-coated HA beads in glass tubes to a final volume of 400 ␮l. PRP1 (0.5 ␮mol/ml) and 47-fold-concentrated supernatant of wild S. gordonii (40 mg/ml) were negative controls. Inhibitory effects of synthetic pPRP-C and r-pPRP-C on the binding of 125I-fimbriae to PRP1-coated HA beads (A) and 3H-cells to PRP1-coated HA beads (B). The binding levels were calculated by subtracting the nonspecific binding level, which was obtained by the preincubation of HA beads with nonlabeled fimbriae (25 nmol).

binant S. gordonii. The nonconcentrated culture supernatant was used for the inhibition assays; however, the dose of rpPRP-C was not sufficient to obtain significant effects (data not shown). It was quite hard to purify the r-pPRP-C from the supernatant with a good yield, so we assayed the concentrate. The components of the culture broth also showed weak inhibitory effects even after dialysis to remove the contaminants, as shown in Fig. 3. However, the results obtained here show that r-pPRP-C was as effective as synthetic pPRP-C. In this study,

pPRP-C was found to have a prominent effect on the coaggregation of P. gingivalis with various streptococcal strains. For the adherence in the oral cavity, the major targets of P. gingivalis are saliva-coated surfaces and the various bacteria forming dental plaque. It is interesting that pPRP-C seems capable of inhibiting P. gingivalis interactions with both saliva and a major plaque-forming factor, streptococci. Meanwhile, recombinant S. gordonii can bind to other salivary components, such as amylase and mucin (24), even in the presence of pPRP-C. The

3784

KATAOKA ET AL.

INFECT. IMMUN.

FIG. 4. Effect of synthetic pPRP-C on the coaggregation of P. gingivalis with oral streptococci. Aliquots (0.5 ml) of suspensions of P. gingivalis (A550 ⫽ 1.0; 5 ⫻ 8 10 cells) and each strain of oral streptococci (A550 ⫽ 0.35; 5 ⫻ 108 cells) and various concentrations of pPRP-C were simultaneously mixed to a total volume of 2 ml in a cuvette. The progress of coaggregation was monitored by the measurement of the decrease in A550 at 37°C in a temperature-controlled cuvette compartment with a magnetic stirrer. After the decrease in A550 had been recorded for 7.5 min, the change in A550/min was continuously calculated. The maximum value of the decrease in A550/min is the coaggregation activity. Lines: a (‚), S. mitis ATCC 15909; b (Œ), S. mitis ATCC 15912; c (■), S. gordonii G9B; d (E), S. oralis ATCC 9811; e (F), S. oralis ATCC 10557; f ({), S. downei MFe 28; g (䊐), S. sanguis ATCC 10556. All assays were performed in triplicate on three separate occasions.

mechanism involved in the inhibition of pPRP-C in the coaggregation is unknown. It has been suggested that the surface antigen (PAc) of S. mutans binds to salivary components through a proline-rich repeating region of the molecule (21). Streptococcal cells might possess specific proline-rich adhesive epitopes and/or proteins similar in amino acid sequence to pPRP-C on their surfaces. Several secretion and expression systems have been con-

TABLE 1. Effect of r-pPRP-C on the coaggregation of P. gingivalis with various strains of Streptococcus Amt of coaggregation after addition ofa: Species

Strain

pPRP-C

b

r-pPRP-C from recombinant S. gordoniic

Wild S. gordoniid

S. gordonii

G9B

2⫹

1⫹

4⫹

S. mitis

ATCC 15912 ATCC 15909

1⫹ 1⫹

1⫹ 2⫹

4⫹ 3⫹

S. oralis

ATCC 9811 ATCC 10557

1⫹ 2⫹

1⫹ 2⫹

4⫹ 4⫹

S. sanguis

ATCC 10556

1⫹

1⫹

4⫹

S. downei

MFe 28

1⫹

1⫹

4⫹

a

Coaggregation values were estimated according to a visual rating scale of ⫺ to 4⫹. b Synthetic pPRP-C solution (67 nmol/ml) as a positive control. c r-pPRP-C (67 nmol/ml) in concentrated culture supernatant of recombinant S. gordonii (13.2 mg/ml). d Concentrated culture supernatant of wild S. gordonii (13.2 mg/ml) containing no r-PRP-C as a negative control.

structed to produce bioactive proteins in nonpathogenic bacteria with plasmids transformed with foreign DNA, and efforts in oral biology have especially been concentrated on the inhibition of the glucosyltransferases (GTFs) promoting tooth decay by cariogenic S. mutans. Dextranase is an enzyme which hydrolyzes the cariogenic glucan produced by GTFs on the tooth surface; thus, the Arthrobacter gene encoding dextranase was introduced into S. gordonii by using the same shuttle vector as in a previous study (16). The transformants sometimes could be made to cease translating the foreign gene in the absence of selective antibiotics. Shiroza and Kuramitsu developed the resident plasmid integration method (26) and generated recombinant S. gordonii secreting cycloisomaltooligosaccharide glucanotransferase, a potent inhibitor of streptococcal GTF, by transformation with a foreign gene from Bacillus circulans (27). As an attempt to prevent periodontal disease, P. gingivalis fimbrillin polypeptide was engineered to be secreted by S. gordonii (25). The culture medium of the transformant was shown by immunoblotting to contain the fimbrillin peptide, and it was expected that the recombinant peptide would help to trigger an antibody response and to block fimbria-mediated adherence of P. gingivalis in vivo. These reports suggest that genetically engineered oral bacteria could be used to prevent dental caries and periodontal disease. The efficiency of secretion and expression (e.g., the amount of secreted proteins) was not reported in the oral disease studies mentioned above; however, other reports have referred to secretion efficiencies. The ␣-amylase gene from Bacillus amyloliquefaciens in multicopy plasmid pUB110 was inserted to transform B. subtilis, and the amount of the secreted enzyme was estimated to be 1.5 mg/ml of the culture medium (23). The same group inserted a hybrid gene encoding ␣-amylase and human leukocyte alpha 2 interferon to transform B. subtilis and reported that the product was secreted at 0.5 to 1 ␮g/ml of the culture medium (22). The secretion efficiency of the present construct seems to be comparable to those in previous reports. P. gingivalis often induces severe types of marginal periodontitis (8). Plaque control or oral prophylaxis is a crucial factor in preventing periodontal diseases; however, it is at present impossible to selectively control colonization by specific pathogens. pPRP-C might be an effective chemical agent in supragingival plaque control as well as in prevention of P. gingivalisinduced periodontitis. The usefulness of this model should be examined with animal models in order to form a better proposal for future studies. ACKNOWLEDGMENTS This work was supported in part by grants-in-aid (09771829, 09044302, and 09557175) from the Ministry of Education, Science, Sports and Culture of Japan. REFERENCES 1. Amano, A., S. Shizukuishi, H. Horie, S. Kimura, I. Morisaki, and S. Hamada. 1998. Binding of Porphyromonas gingivalis fimbriae to proline-rich glycoproteins in parotid saliva via a domain shared by major salivary components. Infect. Immun. 66:2072–2077. 2. Amano, A., K. Kataoka, P. A. Raj, R. J. Genco, and S. Shizukuishi. 1996. Binding sites of salivary statherin to Porphyromonas gingivalis recombinant fimbrillin. Infect. Immun. 64:4249–4254. 3. Amano, A., A. Sharma, J.-Y. Lee, H. T. Sojar, P. A. Raj, and R. J. Genco. 1996. Structural domains of Porphyromonas gingivalis recombinant fimbrillin that mediate binding to salivary proline-rich protein and statherin. Infect. Immun. 64:1631–1637. 4. Amano, A., H. T. Sojar, J.-Y. Lee, A. Sharma, M. J. Levine, and R. J. Genco. 1994. Salivary receptors for recombinant fimbrillin of Porphyromonas gingivalis. Infect. Immun. 62:3372–3380. 5. Cisar, J. O., P. E. Kolenbrander, and F. C. McIntire. 1979. Specificity of coaggregation reactions between human oral streptococci and strains of Actinomyces viscosus or Actinomyces naeslundii. Infect. Immun. 24:742–752. 6. Conrads, G., R. Mutters, J. Fischer, A. Brauner, R. Lutticken, and F.

VOL. 67, 1999

7. 8. 9.

10. 11.

12. 13. 14. 15. 16. 17.

18.


Lampert. 1996. PCR reaction and dot-blot hybridization to monitor the distribution of oral pathogens within plaque samples of periodontally healthy individuals. J. Periodontol. 67:994–1003. Danser, M. M., M. F. Timmerman, A. J. van Winkelhoff, and U. van der Velden. 1996. The effect of periodontal treatment on periodontal bacteria on the oral mucous membranes. J. Periodontol. 67:478–485. Darveau, R. P., A. Tanner, and R. C. Page. 1997. The microbial challenge in periodontitis. Periodontol. 2000 14:12–32. Gibbons, R. J., D. I. Hay, and D. H. Schlesinger. 1991. Delineation of a segment of adsorbed salivary acidic proline-rich proteins which promotes adhesion of Streptococcus gordonii to apatitic surfaces. Infect. Immun. 59: 2948–2954. Gibbons, R. J., D. I. Hay, W. C. I. Ghilds, and G. Davis. 1990. Role of cryptic receptors (cryptitopes) in bacterial adhesion to oral surfaces. Arch. Oral Biol. 35:107S–114S. Gibbons, R. J., and D. I. Hay. 1988. Adsorbed salivary proline-rich proteins as bacterial receptors on apatitic surfaces, p. 143–169. In L. M. Switalski, M. Hook, and E. Beachey (ed.), Molecular mechanisms of microbial adhesion. Springer-Verlag, New York, N.Y. Green, N., H. Alexander, A. Olson, S. Alexander, T. M. Shinnick, J. G. Sutcliffe, and R. A. Lerner. 1982. Immunogenic structure of the influenza virus hemagglutinin. Cell 28:477–487. Hamada, S., A. Amano, S. Kimura, I. Nakagawa, S. Kawabata, and I. Morisaki. 1998. The importance of fimbriae in the virulence and ecology of some oral bacteria. Oral Microbiol. Immunol. 13:129–138. Kataoka, K., A. Amano, M. Kuboniwa, H. Horie, N. Nagata, and S. Shizukuishi. 1997. Active sites of salivary proline-rich protein for binding to Porphyromonas gingivalis fimbriae. Infect. Immun. 65:3159–3164. Kolenbrander, P. E., N. Ganeshkumar, F. J. Cassels, and C. V. Hughes. 1993. Coaggregation: specific adherence among human oral plaque bacteria. FASEB J. 7:406–413. Kubo, S., H. Kubota, Y. Ohnishi, T. Morita, T. Matsuya, and A. Matsushiro. 1993. Expression and secretion of an Arthrobacter dextranase in the oral bacterium Streptococcus gordonii. Infect. Immun. 61:4375–4381. Kuboniwa, M., A. Amano, and S. Shizukuishi. 1998. Hemoglobin-binding protein purified from Porphyromonas gingivalis is identical to lysine-specific cysteine proteinase (Lys-gingipain). Biochem. Biophys. Res. Commun. 249: 38–43. Lamont, R. J., and H. F. Jenkinson. 1998. Life below the gum line: pathogenic mechanisms of Porphyromonas gingivalis. Microbiol. Mol. Biol. Rev. 62:1244–1263.

Editor: J. R. McGhee

3785

19. Macrina, F. L., J. A. Tobian, K. R. Jones, R. P. Evans, and D. B. Clewell. 1982. A cloning vector able to replicate in Escherichia coli and Streptococcus sanguis. Gene 19:345–353. 20. Nagata, H., Y. Murakami, E. Inoshita, S. Shizukuishi, and A. Tsunemitu. 1990. Inhibitory effect of human plasma and saliva on co-aggregation between Bacteroides gingivalis and Streptococcus mitis. J. Dent. Res. 69:1476– 1479. 21. Nakai, M., N. Okahashi, H. Ohta, and T. Koga. 1993. Saliva-binding region of Streptococcus mutans surface protein antigen. Infect. Immun. 61:4344– 4349. 22. Palva, I., P. Lehtovaara, L. Kaariainen, M. Sibakov, K. Cantell, C. H. Schein, K. Kashiwagi, and C. Weissmann. 1983. Secretion of interferon by Bacillus subtilis. Gene 22:229–235. 23. Palva, I. 1982. Molecular cloning of ␣-amylase gene from Bacillus amyloliquefaciens and its expression in B. subtilis. Gene 19:81–87. 24. Scannapieco, F. A. 1994. Saliva-bacterium interactions in oral microbial ecology. Crit. Rev. Oral Biol. Med. 5:203–248. 25. Sharma, A., H. Nagata, N. Hamada, H. T. Sojar, D. E. Hruby, H. K. Kuramitsu, and R. J. Genco. 1996. Expression of functional Porphyromonas gingivalis fimbrillin polypeptide domains on the surface of Streptococcus gordonii. Appl. Environ. Microbiol. 62:3933–3938. 26. Shiroza, T., and H. K. Kuramitsu. 1995. Development of a heterodimer plasmid system for the introduction of heterologous genes into streptococci. Plasmid 34:85–95. 27. Shiroza, T., N. Shinozaki, M. Hayakawa, T. Fujii, T. Oguma, M. Kobayashi, K. Fukushima, and Y. Abiko. 1998. Application of the resident plasmid integration technique to construct a strain of Streptococcus gordonii able to express the Bacillus circulans cycloisomaltooligosaccharide glucanotransferase gene, and secrete its active gene product. Gene 207:119–126. 28. van Steenbergen, T. J. M., A. J. van Winkelhoff, and J. de Graaf. 1991. Black-pigmented oral anaerobic rods: classification and role in periodontal disease, p. 41–52. In S. Hamada, S. C. Holt, and J. R. McGhee (ed.), Periodontal disease: pathogens and host immune responses. Quintessence Publishing Co., Ltd., Tokyo, Japan. 29. Yoshimura, F., K. Takahashi, Y. Nodasaka, and T. Suzuki. 1984. Purification and characterization of a novel type of fimbriae from the oral anaerobe Bacteroides gingivalis. J. Bacteriol. 160:949–957. 30. Zambon, J. J., H. S. Reynolds, R. G. Dunford, W. DeVizio, A. R. Volpe, R. Berta, J. P. Tempro, and Y. Bonta. 1995. Microbial alterations in supragingival dental plaque in response to a tricrosan-containing dentrifice. Oral Microbiol. Immunol. 10:247–255.