Sensitive and quantitative detection of KRAS2 gene ...

[Cancer Biology & Therapy 7:3, 260-8; March 2008]; ©2008 Landes Bioscience

Research Paper

This manuscript has been published online, prior to printing.Once the issue is complete and page numbers have been assigned, the citation will change accordingly.

Sensitive and quantitative detection of KRAS2 gene mutations in pancreatic duct juice differentiates patients with pancreatic cancer from chronic pancreatitis, potential for early detection Chanjuan Shi1, Noriyoshi Fukushima1, Tadayoshi Abe1, Yansong Bian1, Li Hua1, Brian J. Wendelburg5, Charles J. Yeo2, Ralph H. Hruban1,3, Michael G. Goggins1,3,4 and James R. Eshleman1,3,* Departments of 1Pathology, 2Surgery, 3Oncology and 4Medicine; The Sol Goldman Pancreatic Cancer Research Center; Johns Hopkins University School of Medicine; Baltimore, Maryland USA; 5Cepheid, Sunnyvale, California, USA

Abbreviations: Q-PCR, real-time quantitative PCR; RFLP, restriction fragment length polymorphism; PanIN, Pancreatic Intraepithelial Neoplasm; AS-PCR, Allele-Specific PCR; ARMS, Amplification Refractory Mutation System Key words: pancreatic cancer, KRAS2, Q-PCR, early detection, LigAmp, pancreatitis, point mutation

KRAS2 gene mutations are found in 75–90% of infiltrating pancreatic ductal adenocarcinomas but can also be present with other nonneoplastic pancreatic diseases. We recently developed a novel sensitive assay for point mutation detection, called “LigAmp”, which can detect one mutant molecule in the presence of 10,000 wild‑type molecules and can quantify mutant DNA over a wide dynamic range. We analyzed KRAS2 mutations in surgically‑collected pancreatic duct juice samples from patients with pancreatic adenocarcinoma (n = 27) and chronic pancreatitis (n = 9). DNA sequencing demonstrated that 17 of the 27 pancre‑ atic cancers harbored KRAS2 mutations at codon 12, including G12D (GGT → GAT), G12V (GTT), and G12R (CGT). We determined the relative amounts of each KRAS2 mutant by simul‑ taneously quantifying wild‑type and mutant KRAS2 DNA. For all pancreatic adenocarcinoma patients, the dominant KRAS2 muta‑ tion detected in the pancreatic juice corresponded to that found in the primary cancer. Mutation levels were substantially higher in patients with pancreatic cancer (0.05 to 82% of total KRAS2 molecules) compared to those with chronic pancreatitis (0 to 0.7%). Among patients with mutant KRAS2 positive cancers, all but one (94%) had mutant KRAS2 DNA concentrations of more than 0.5% in their pancreatic juice samples, whereas only 1 of 9 (11%) pancreatic juice samples from patients with chronic pancre‑ atitis had more than 0.5% mutant KRAS2 DNA, corresponding to a sensitivity of 94% and a specificity of 89%. LigAmp quantifica‑ tion of mutant KRAS2 in pancreatic juice differentiates pancreatic adenocarcinoma from chronic pancreatitis, and may be a useful early detection tool for pancreatic cancer. *Correspondence to: James R. Eshleman; Johns Hopkins University School of Medicine; Department of Pathology; Suite 344, CRB-II; 1550 Orleans St.; Baltimore, Maryland 21231 USA; Tel.: 410.955.3511; Fax: 410.614.0671; Email: jeshlema@ jhmi.edu Submitted:08/20/07; Revised: 11/30/07; Accepted: 12/02/07 Previously published online as a Cancer Biology & Therapy E-publication: www.landesbioscience.com/journals/cbt/article/5362

260

Introduction Pancreatic adenocarcinoma has a poor prognosis with an overall 5 year‑survival of less than 5% and is the fourth leading cause of cancer death in the United States.1 This poor outcome reflects the fact that the majority of patients are diagnosed with advanced inoperable cancers. Only 10–20% of patients are candidates for surgery at the time of presentation. Patients who are surgical candidates (without clinically evident metastases and lack of invasion into major visceral vessels) and who undergo resection of nonmetastatic lesions have a better outcome with a 5‑year survival of 15–20%.1 At the same time, patient populations with a significantly increased risk of pancreatic cancer have been identified. For example, individuals in kindreds in which other family members have been diagnosed with pancreatic cancer have a significantly increased risk of developing pancreatic cancer themselves.2,3 The early detection of pancreatic neoplasia is likely to be an important part of strategies to improve the survival of this otherwise nearly uniformly fatal disease, particularly in these high‑risk groups. Unfortunately, the early diagnosis of pancreatic cancer is often difficult. The clinical presentation of pancreatic cancer can resemble that of chronic pancreatitis, acute pancreatitis or bile stone disease. In addition, current imaging studies including computed tomography, magnetic resonance imaging and positron emission tomography are not sensitive and/or specific enough to completely distinguish an inflammatory mass from cancer.4 Even endoscopic ultrasonog‑ raphy‑guided needle aspiration, or brushings during endoscopic retrograde cholangiopancreatography, sometimes have difficulty discriminating pancreatic cancer from chronic pancreatitis.5 Novel accurate and sensitive techniques are urgently needed to detect pancreatic cancer at an early stage. The development of pancreatic cancer involves multiple genetic and epigenetic alterations including mutational activation of onco‑ genes and the inactivation of tumor suppressor genes. Point mutations of the KRAS2 gene at codon 12 have been identified in most pancreatic cancers6‑8 and can be detected in pancreatic duct juice,9 as well as plasma10,11 and stool.12,13 The detection of KRAS2

Cancer Biology & Therapy

2008; Vol. 7 Issue 3

Pancreatic cancer detection in duct juice

wild‑type allele converted into a different probe sequence. In the Q‑PCR step, the foreign DNA representing the mutant allele is quantitatively detected relative to that representing the wild‑type allele. We previously demonstrated that LigAmp is able to detect one mutant molecule in the presence of 10,000 wild‑type molecules, and that it can also accurately quantify the level of mutant DNA over a wide dynamic range.25 In the present study, we used LigAmp to analyze KRAS2 mutations in pancreatic duct juice samples surgically collected from patients with pancreatic adenocarcinoma and chronic pancreatitis.

Results Figure 1. Strategy for multiplex LigAmp to simultaneously detect mutant and wild‑type KRAS2. (A) LigAmp detection of mutant KRAS2 (GAT, G12D). (B) LigAmp detection of wild‑type KRAS2 (GGT, G12). In the ligation step, both mutant and wild‑type upstream ligation oligonucleotides were included at a ratio of 1000:1. In Q‑PCR, lacZ and 16S rDNA probes with different fluorophores labeled were used to detect mutant and wild‑type ligation products, respectively. Green, mutant or wild‑type KRAS2 sequences. Blue, M13 sequences. Red or Orange, probe binding sequences.

point mutations in pancreatic juice or other body fluids could provide a diagnostic tool for early cancer detection. However, small quanti‑ ties of mutant KRAS2 can also be detected in pancreatic duct juice from patients with chronic pancreatitis or pancreatic intraepithelial neoplasias (PanINs), which are considered the commonest precursor lesions to invasive pancreatic ductal adenocarcinoma.8,11,14,15 These studies have not clearly indicated that KRAS2 mutations detected in pancreatic juice are from PanINs. Therefore, while qualitative detection of mutant KRAS2 alone is not an accurate predictor of pancreatic cancer, quantitative assays for KRAS2 mutations in biolog‑ ical fluids might be able to distinguish between pancreatic cancer and other conditions. Several assays can detect single base substitutions at low concen‑ tration, but their limit of detection is generally 0.1–10% (ratio of mutant/wild‑type, equivalent to 1/1000 to 1/10). DNA sequencing typically can detect mutant molecules only at a 10–25% level, depending on sequence context.16 Restriction fragment length polymorphism (RFLP)/Southern blot assays typically have a limit of detection of 0.5–5%.17,18 The oligonucleotide ligation assay (OLA), even with sensitive capillary electrophoresis detection, can only detect minor species at about 0.1–1%.19,20 Ligation chain reaction uses four oligonucleotides and ligase as an alternative to polymerase, but its limit of detection is approximately 0.1 to 1%.21 Allele‑specific PCR (AS‑PCR) or the amplification refractory mutation system (ARMS) can only detect approximately 1% of mutant DNA.22,23 In addition, most of these techniques do not provide accurate quantification. Real‑time quantitative PCR (Q‑PCR) is remarkably quantitative over a wide dynamic range, but has been difficult to apply to the detection of point mutations because mutant probes that differ by only a single base cross‑hybridize with the wild‑type template.24 Thus a more sensitive method of detecting rare and low frequency mutational events is needed. Recently, we developed a novel sensitive and quantitative assay for point mutation detection, called LigAmp.25 The LigAmp reaction includes two steps: ligation and subsequent Q‑PCR amplification of the ligation product. In the ligation step, the single base muta‑ tion is converted into a foreign DNA probe sequence, and the www.landesbioscience.com

KRAS2 mutational status in pancreatic cancers. We first determined the KRAS2 gene status of a series of 27 pancreatic adenocarcinoma specimens. Following manual microdissection of the primary cancer, we amplified the hotspot region of KRAS2 gene. Direct DNA sequencing detected codon 12 KRAS2 gene mutations in 17 of these 27 cancers (63%). These mutations included GAT (G12D, 12/17, 71%), GTT (G12V, 1/17, 6%), CGT (G12R, 4/17, 23%). That the GAT mutation was the most frequently detected mutation is consistent with results from other series.7,27‑29 LigAmp strategy for sensitive point mutation detection. To quantify mutant KRAS2 DNA in pancreatic juice, we simultaneously determined mutant and wild‑type KRAS2 DNA levels in a multiplex LigAmp reaction including both mutant and wild‑type oligonucle‑ otides.25 Figure 1 demonstrates the LigAmp multiplex strategy to detect mutant and wild‑type KRAS2, where each species of genomic DNA molecule is converted into its own unique foreign probe site. The upstream oligonucleotide for mutant KRAS2 contains a region of LacZ DNA and that for wild‑type contains a 16S rDNA sequence. Following ligation, both wild‑type and mutant ligated products were amplified using the same M13 forward and reverse primers. The mutant and wild type DNA are detected with LacZ and 16S rDNA Taqman probes respectively, each containing a unique fluorophore. Maintenance of a wide linear range of mutant DNA detection required significant reduction (1:1000) of the upstream wild‑type oligonucleotide, permitting us to detect down to 0.01% mutant KRAS2 in serially diluted cell mixtures (data not shown). Inclusion of the wild‑type oligonucleotide also enhanced specificity of detec‑ tion as no amplification signal was observed using pure wild‑type Hela DNA. LigAmp analysis of pancreatic duct juice from KRAS2 mutant cancers. To quantify the relative levels of mutant and wild‑type KRAS2 DNA in juice samples, standard curves were generated for both wild‑type and each mutant KRAS2 gene using Ct values from serially diluted samples. The amounts of both wild‑type and mutant KRAS2 in pancreatic juice were then obtained from their corresponding standard curves, and the percent mutant calculated. Figure 2 is an example of quantification of mutant KRAS2 (GAT) in juice sample PJ70. Amplification curves from serially diluted mutant DNA mixtures and the juice DNA are shown in (Fig. 2A). Based on the standard curve (Fig. 2B) from Ct values of amplification curves shown in Figure 2A, we estimated that PJ70 contained about 9 pg/ml of mutant (GAT) KRAS2. Wild‑type DNA concentration for PJ70 was 900 pg/ml (data not shown), thus the relative amount of GAT mutant to wild‑type KRAS2 DNA was approximately 1%.


261


Figure 2. Representative LigAmp quantification of mutant KRAS2. (A) Representative Q‑PCR amplification curves for serially diluted mutant KRAS2 DNA (GAT, G12D, blue) and a juice sample, PJ70 (red). (B) The Ct values from the Q‑PCR amplification curves shown in (A) plotted against the concentration of serially diluted mutant KRAS2 (blue). The amount of mutant KRAS2 in PJ70 was obtained from the standard curve (shown as red) based on its Ct value.

We analyzed GAT, GTT and CGT KRAS2 mutations in pancre‑ atic juice samples from the 17 pancreatic cancer patients with documented KRAS2 gene mutations in their primary cancers. With ligation oligonucleotides specific for these mutations, we detected multiple KRAS2 mutations in the juice collected from most of these patients (Fig. 3). In each case, the dominant KRAS2 mutation detected in the juice sample was the same mutation found in the patient’s primary cancer (asterisks). In these duct juice samples, the amount of mutant KRAS2 DNA relative to the wild‑type KRAS2 varied considerably, ranging from less than 1% to more than 80% (median 3.4%). More than 0.5% KRAS2 mutant DNA was detected in all but one juice sample (94.1%). In that case (Fig. 3, PJ84), DNA sequencing identified a GAT mutation in the patient’s primary cancer tissue. However, LigAmp detected only 0.05% GAT KRAS2 in the juice, and the CGT mutation was also present, but at an even lower level. Some pancreatic juice samples also contained lower concentra‑ tions of mutations other than the KRAS2 gene mutation found in the patient’s primary cancer (e.g., PJ48), while others were relatively “pure”, harboring only the KRAS2 gene mutation found in the primary cancer (e.g., PJ85 or PJ89). The presence of multiple KRAS2 gene mutations in these samples likely reflects either intra‑tumor clonal heterogeneity of KRAS2 mutations,29 or the presence of multiple PanINs that contributed mutant DNA into the pancreatic duct juice. Low levels of other mutations were confirmed in three of these samples (PJ7, PJ70, PJ89) by BstN1 restriction enzyme digestion of wild‑type KRAS2 sequences, T‑A cloning, and DNA sequencing (data not shown). Pancreatic duct juice analysis from wild‑type KRAS2 cancers and chronic pancreatitis. In addition, we determined KRAS2 muta‑ tion levels in pancreatic juice from 10 patients with pancreatic cancer whose primary cancers showed only wild‑type KRAS2 sequences. LigAmp analysis demon‑ strated that 5 of these samples contained more than 0.5% mutant KRAS2 (Fig. 4). The discrepancy in KRAS2 status between the microdissected primary cancers and their Figure 3. Percentage of mutant KRAS2 relative to wild‑type KRAS2 detected in pancreatic juice from pancreatic cancer patients with known KRAS2 mutations in cancers. % mutant KRAS2 = mutant KRAS2/(mutant KRAS2+wild‑type KRAS2). LigAmp analysis of GAT (G12D), GTT (G12V) and CGT (G12R) KRAS2 mutations shown as red, green and blue bars, respectively. Asterisk indicates the KRAS2 mutation detected in corresponding cancer. The percentages of KRAS2 mutations in three samples having the highest levels are shown above their corresponding bars. Note the interrupted Y‑axis scale. N = 3‑5 independent LigAmp experiments. Error bars, 1 SEM. 262




corresponding pancreatic juice was investi‑ gated further. Since the limit of detection for standard DNA sequencing is less than ideal, we BstN1 digested cancer DNA PCR products to remove wild‑type KRAS2 and increase the relative concentration of mutant sequences if present. This strategy failed to demonstrate these mutations, so we believe that the wild‑type sequencing result is not due to the relative insensitivity of the original tumor DNA sequencing. These results are most easily explained by either intra‑tumor clonal heterogeneity or mutant KRAS2 from elsewhere in the pancreas such as from PanINs. When this data is combined with the mutation positive cancers, 21 of the 27 patients with pancreatic cancer (78%) contained more than 0.5% mutant Figure 4. Percentage of mutant KRAS2 relative to wild‑type KRAS2 detected in pancreatic juice from KRAS2 in their juice samples. pancreatic cancer patients with wild‑type KRAS2 detect in primary cancers. See legend, (Fig. 3). The pancreatic juice of 9 patients with chronic pancreatitis was also analyzed for KRAS2 gene mutations using LigAmp. Histological examination of surgical speci‑ mens demonstrated chronic inflammation and parenchymal atrophy with PanIN‑1 and PanIN‑2 in most patients. As expected, LigAmp analysis detected KRAS2 mutations in the juice from some of these patients, but at levels much lower than those from the patients with invasive pancreatic cancer (Fig. 5). In these patients, the highest ratio of mutant to wild‑type KRAS2 was 0.7%, and the median level of mutant KRAS2 was 0.03%. The majority of juice samples contained less than 0.1% mutant KRAS2. Only 1 of the 9 cases (11%) had more than 0.5% mutant KRAS2. In addition, multiple KRAS2 mutations were also observed in some samples. Receiver operator characteristic (ROC) curve analysis. ROC curves were used to evaluate the potential use of LigAmp detec‑ Figure 5. Percentage of mutant KRAS2 relative to wild‑type KRAS2 detected in pancreatic juice from tion of KRAS2 mutations as a tool for the chronic pancreatitis patients. See legend, (Fig. 3). early detection of pancreatic cancer. Using different cutoff threshold values, sensitivity and specificity of the assay were calculated based on the data from mutant KRAS2 pancreatic cancers shown in Figure 3. The area under pancreatic cancer and chronic pancreatitis patients, respectively. For the ROC curve is 0.96 (Fig. 6A). A perfect test has an area under the example, when 0.5% mutant KRAS2 is used as a cutoff value for curve of 1.0, and an ROC of 0.96 is considered excellent.32,33 When diagnosis of pancreatic cancer, LigAmp analysis for KRAS2 muta‑ an ROC curve was constructed for all the cancers, irrespective of tions in pancreatic juice has a sensitivity of 94% (16 of 17 cases their KRAS2 mutation status, an area of 0.87 was obtained (Fig. 6B). positive), a specificity of 89% (8 out of 9 pancreatitis cases negative). With this albeit limited sample size, the data suggests that LigAmp The values from this limited study compare favorably with serum CA may be an excellent test for detection of pancreatic cancer, irrespec‑ 19‑9 measurements (sensitivity 70%, specificity 87%).30,31 Using tive of the mutation status in the primary cancers. this threshold, the KRAS2 mutation frequency in pancreatic cancer Discussion was significantly higher than that in chronic pancreatitis (p < 0.001, chi‑squared). Based on sensitivities and specificities at different cutoff In the present study we quantified KRAS2 gene mutations in the thresholds, we constructed an ROC curve for the subset of cases with pancreatic duct juice from patients with pancreatic adenocarcinoma www.landesbioscience.com


263


Figure 6. ROC curve analyses of LigAmp assay for early detection of pancreatic cancer by quantification of KRAS2 mutations in pancreatic juice. The sensitivities were obtained from LigAmp analysis of KRAS2 mutation in pancreatic duct juice of pancreatic cancer patients (shown in Figs. 3 and 4) using different cutoff values. The specificities were obtained from LigAmp analysis of KRAS2 mutations in pancreatic duct juice of chronic pancreatitis patients (shown in Fig. 5) using the same set of cutoff values. False positive = 1‑specificity. (A) An ROC curve for the subset of pancreatic cancers with KRAS2 mutations (B) An ROC curve for all cancers with/without KRAS2 mutations.

and from patients with chronic pancreatitis using LigAmp. We conclude that quantitative analysis can generally distinguish these two patient populations. Further, the dominant KRAS2 gene muta‑ tion detected in the pancreatic juice was the same as the mutation found in the patient’s primary cancer. The range of the percent mutant DNA in duct juice varies considerably from less than 1% to about 80%. Some pancreatic juice samples contain essentially only the tumor specific KRAS2 gene mutation (e.g., PJ33, PJ85, etc), while others contain an almost even mixture of 2 or 3 mutations (e.g., JP48, JP70). In two of the cases, the malignancy was associ‑ ated with either a PanIN2 lesion or an in situ cancer, consistent with previous reports in the literature.29,34 Finally, pancreatic duct juice can be positive for KRAS2 gene mutations even in cancers that have tested negative for KRAS2 mutations by DNA sequencing. These studies highlight the diagnostic utility of precisely quanti‑ fying mutant DNA in clinical samples. Mutations in the KRAS2 gene are an early event in pancreatic cancer development.8,35 Mutations have been detected in very small incidental carcinomas that were only found at autopsy. KRAS2 could be a molecular marker for detecting pancreatic cancer at an early stage, however KRAS2 mutations are also qualitatively present in noninvasive proliferative epithelial lesions in pancreata with chronic pancreatitis.8 In addition, mutant KRAS2 has been detected in pancreatic and duodenal juice from patients with chronic pancreatitis.11,14,15 This makes it difficult to believe that simple qualitative detection of mutant KRAS2 could be a reliable tool for early diagnosis of pancreatic cancer. However, during cancer progression, cancer cell proliferation and invasion as well as luminal necrosis could result in accumulation of cancer DNA in the pancreatic juice, which may significantly increase the amount of mutant KRAS2 present in the juice of patients with cancer relative to that in patients with pancreatitis. Extremely high levels of mutant DNA in pancreatic juice could alternatively be due to extensive cancer invasion of adjacent pancreatic ducts. Both of these ideas are consistent with our results demonstrating quantitatively higher levels of KRAS2 gene mutations in the pancreatic juice of patients with pancreatic cancer. PanINs may explain the presence of mutant KRAS2 in pancreatic juice samples from patients without an invasive cancer. The precursor lesion, PanIN, is often present in pancreata with an invasive cancer and can be identified in pancreata with chronic pancreatitis.28,29 Up to 75% of PanIN lesions also carry KRAS2 gene mutations, 264

and because they involve the duct system PanIN lesions can shed DNA and/or cells into the pancreatic duct juice. Multiple discrete PanINs can be present in a pancreas, and the specific KRAS2 gene mutations in these lesions may be different from those in primary invasive cancers, which may explain why multiple KRAS2 muta‑ tions are detected in pancreatic duct juice. In addition, distinct KRAS2 gene mutations were found to coexist in different areas of a single tumor, suggesting genetic heterogeneity within the tumor sub‑populations.29 Three patient populations with high predisposition for pancreatic cancer that might benefit from periodic monitoring of pancreatic duct juice are: patients with chronic pancreatitis, pancreatic cancer families without a known gene defect, or patients from families with documented increased genetic risk (BRCA2, Peutz‑Jeghers syndrome, hereditary pancreatitis, and FAMMM).36 Pancreatic juice can be collected during routine upper GI endoscopy or ERCP using secretin infusion,37 and in these high risk settings the risk and the expense of the procedure may be justified given the lethality of late detected disease. The volume of pancreatic duct fluid, collected from the operating room in this study, is well within the volume that can be collected during ERCP following secretin stimulation.38,39 The National Familial Pancreas Tumor Registry (NFPTR) tracks such families and analysis clearly demonstrates a prospective increased risk in first‑degree relatives.2,40 In Peutz‑Jeghers syndrome, Giardiello’s group has reported a 130 fold increased (95% CI, 44‑261) relative risk of pancreatic cancer. Periodic endoscopy with pancreatic duct juice collection may be justified in high‑risk settings, such as those with a strong family history or chronic pancreatitis. General popula‑ tion screening will require assay cost reduction and detection in a less invasive sample such as stool or peripheral blood. Chronic pancreatitis is another independent risk factor for the development of pancreatic cancer. The incidence of pancreatic cancer 10 and 20 years after diagnosis of chronic pancreatitis is 1.8% and 4.0%, respectively,41 although the rate is higher in specific subsets. Chronic pancreatitis caused by alcohol consumption is only weakly related to pancreatic cancer, whereas patients with chronic pancre‑ atitis and documented KRAS2 mutations carry an increased risk for pancreatic cancer.14,42,43 Approximately 25–40% of patients with hereditary pancreatitis, an autosomal dominant disease, develop pancreatic cancer, especially those who smoke.44,45 LigAmp quan‑ titative analysis of KRAS2 gene mutations might predict and/or




pancreatic cancer from chronic pancreatitis patients with a high degree of accuracy. LigAmp may be a useful tool for early detection of pancreatic cancer, particularly in groups with an increased risk of developing the disease.

Materials and Methods DNA extraction. Genomic DNA was prepared from Hela (KRAS2 wild‑type codon 12, GGT, G12), SW480 (KRAS2 mutant, GTT, G12V) and LS513 (KRAS2 mutant, GAT, G12D) cell lines and the formalin‑fixed, paraffin embedded pancreatic cancer blocks using QiAamp DNeasy Tissue Kit (Qiagen, Valencia, CA). All of the patients in this study underwent pancre‑ aticoduodenectomy (Whipple procedure) and the pancreatic duct juice samples were collected intra‑operatively by aspirating the pancreatic duct contents once the main pancreatic duct was transected at the level of the pancreatic neck. Genomic DNA was isolated using the QIAamp DNA Blood Mini Kit (Qiagen). KRAS2 sequencing. KRAS2 gene sequencing was performed on pancreatic cancer DNA by PCR amplifying the KRAS2 locus (154 bases including codon 12) using the upstream 5'-GT AAAACGGACGGCCAGG‑GA GAGAGGCCTGCTGAAAA‑3' and downstream 5'CAGGAAA Underlined: M13 primer binding regions. Italics: probe binding regions (lacZ or 16S rDNA). Bold: target‑specific CAGCTATGACT‑TGGATCAT regions. *Terminal bases with perfect homology to either the wild‑type or mutant sequences. FAM: 6‑carboxyfluATTCGTCCACA‑3' M13 tailed rorescein. ROX: 6‑carboxy‑X‑rhodamine. BHQ: black hole quencher. Boxed base: An additional mis‑pair in the (underlined regions) primers. Dye upstream mutant oligonucleotides was introduced at the third base from the 3’ end to improve the specificity of the terminator sequencing was then assay. WT: wild type. performed using M13 forward detect development of malignant lesions in these high‑risk settings or reverse primers, BigDye 3.1 and a 3100 capillary sequencer (ABI, by dynamically monitoring KRAS2 gene mutation levels in the Applied Biosystems (Foster City, CA). LigAmp oligonucleotides and probes. Ligation oligonucleotides pancreatic juice. In addition to KRAS2, other protein and nucleic acid markers may for wild‑type and mutant KRAS2 and modified M13 forward and prove useful as early detection biomarkers. The aberrant methylation reverse primers (Table 1) were purchased from Invitrogen, Corp. of specific genes has been reported in pancreatic cancer46,47 and this (Carlsbad, CA). The downstream common oligonucleotides were methylation can be detected in endoscopically collected pancreatic phosphorylated at the 5' end. The LacZ and 16S rDNA Taqman juice samples.37 Other DNA point mutations, such as KRAS2 codon probes containing different fluorophores and quenchers (Table 1) 13, KRAS2 codon 61, p53, BRAF, and others48 may also be useful for were purchased from Integrated DNA Technology (Coralville, IA). early detection, and if warranted by their frequency, will be incorpo‑ LigAmp assay. A region of the KRAS2 gene (100 bases) including rated into multiplex LigAmp reactions in the future. KRAS2 codon 12 (hot spot) was first PCR amplified using 5'‑GGA In conclusion, quantification of KRAS2 gene mutations in GAGAGGCCTGCTGAAAA‑3' and 5'‑AATGATTCTGAATTAG pancreatic juice using LigAmp can be used to help differentiate CTGTATCGTCA‑3' primers. For the CGT KRAS2 mutation, the www.landesbioscience.com


265


mutant KRAS2 DNA was amplified from a plasmid containing that sequence. GTT, GAT, and wild‑type KRAS2 DNA were amplified from SW480, LS513, and HeLa cell genomic DNA, respectively. To construct standard quantitative curves for mutant DNA, amplified mutant KRAS2 from the cell lines was serially diluted into 875 pg wild‑type DNA. Wild‑type KRAS2 DNA was also serially diluted in H2O to quantify amounts of wild‑type DNA. Concentrations of stock mutant and wild‑type KRAS2 DNA were determined using NanoDrop (NanoDrop Technologies, Wilmington, DE). Juice amplified KRAS2 DNA samples were diluted at 1/100 prior to LigAmp analysis. Mutant DNA mixtures and diluted DNA were incubated with ligation oligonucleotides and 4 U Pfu DNA ligase in 1x Pfu Ligase Buffer (Stratagene, La Jolla, CA) in 25 ml reactions. Ligation reactions were first denatured at 95°C for 3 min, and then incubated for 99 two‑step cycles of 95°C for 30 seconds alternating with 65°C for 4 min. To simultaneously determine mutant and wild‑type KRAS2, we included both wild‑type and mutant upstream oligonucleotides in the reaction. The concentrations for mutant upstream and common downstream oligonucleotides were 1 pmol and 0.5 pmol, respectively. The concentration for the wild‑type upstream oligonucleotide was reduced to 1 fmol to maintain the full range of mutant DNA detection. We performed Q‑PCR using a SmartCycler and version 2.0c software (Cepheid, Sunnyvale, CA). Each 25 ml reaction contained 5 pmol forward and 5 pmol reverse M13 primers, 2 ml of the unpurified ligation reaction, 12.5 ml platinum Quantitative PCR SuperMix‑UDG (Invitrogen), and 2.5 pmol of LacZ and 16S rDNA probes. We preincubated PCR reactions at 50°C for 2 min and 95°C for 2 min, followed by 40 two‑step cycles of 95°C for 10 seconds alternating with 64°C for 20 seconds. We manually set the cycle threshold to 10, in the middle of the linear range of the amplification curves (log scale). BstN1 restriction digestion of wild‑type KRAS2 PCR products. To eliminate wild‑type and enrich for mutant KRAS2, KRAS2 DNA was first amplified using a forward mutant primer that produces a BstN1 restriction enzyme recognition site when the wild‑type allele is amplified26 (F: 5'‑aatataaacttgtggtagttggacct‑3', R: 5'‑tcaaagacaaggcgatatgc t‑3'; underlined cytosine intro‑ duced to create the BstN1 site). A 30‑cycle PCR using AmpliTaq Gold® DNA polymerase (ABI) was performed, yielding a 1031 bp PCR product. A second BstN1 site that cuts both the wild‑type and mutant KRAS2 is 136 bases upstream of the reverse primer (mutant: 136 and 906 bases; wild‑type: 18, 136 and 888 bases). Following purification using Qiagen PCR purification Kit, the PCR product (5 ml) was digested with BstN1 (20 units, NEBL, New England Biolabs, Beverly, USA) at 65°C for 2 hours, analyzed by 2% agarose gel, and sequenced as described above. References 1. Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A, Feuer EJ, Thun MJ. Cancer statistics, 2005. CA Cancer J Clin 2005; 55:10‑30. 2. Klein AP, Brune KA, Petersen GM, Goggins M, Tersmette AC, Offerhaus GJ, Griffin C, Cameron JL, Yeo CJ, Kern S, Hruban RH. Prospective risk of pancreatic cancer in familial pancreatic cancer kindreds. Cancer Res 2004; 64:2634‑8. 3. Amundadottir LT, Thorvaldsson S, Gudbjartsson DF, Sulem P, Kristjansson K, Arnason S, Gulcher JR, Bjornsson J, Kong A, Thorsteinsdottir U, Stefansson K. Cancer as a complex phenotype: Pattern of cancer distribution within and beyond the nuclear family. PLoS Med 2004; 1:e65. 4. Saisho H, Yamaguchi T. Diagnostic imaging for pancreatic cancer: Computed tomog‑ raphy, magnetic resonance imaging, and positron emission tomography. Pancreas 2004; 28:273‑8.

266

5. Mitchell ML, Carney CN. Cytologic criteria for the diagnosis of pancreatic carcinoma. Am J Clin Pathol 1985; 83:171‑6. 6. Almoguera C, Shibata D, Forrester K, Martin J, Arnheim N, Perucho M. Most human carcinomas of the exocrine pancreas contain mutant c‑K‑ras genes. Cell 1988; 53:549‑54. 7. Hruban RH, van Mansfeld AD, Offerhaus GJ, van Weering DH, Allison DC, Goodman SN, Kensler TW, Bose KK, Cameron JL, Bos JL. K‑ras oncogene activation in adenocarci‑ noma of the human pancreas: A study of 82 carcinomas using a combination of mutant‑en‑ riched polymerase chain reaction analysis and allele‑specific oligonucleotide hybridization. Am J Pathol 1993; 143:545‑54. 8. Hruban RH, Wilentz RE, Kern SE. Genetic progression in the pancreatic ducts. Am J Pathol 2000; 156:1821‑5. 9. Yamada T, Nakamori S, Ohzato H, Oshima S, Aoki T, Higaki N, Sugimoto K, Akagi K, Fujiwara Y, Nishisho I, Sakon M, Gotoh M, Monden M. Detection of K‑ras gene mutations in plasma DNA of patients with pancreatic adenocarcinoma: Correlation with clinicopatho‑ logical features. Clin Cancer Res 1998; 4:1527‑32. 10. Castells A, Puig P, Mora J, Boadas J, Boix L, Urgell E, Sole M, Capella G, Lluis F, Fernandez‑Cruz L, Navarro S, Farre A. K‑ras mutations in DNA extracted from the plasma of patients with pancreatic carcinoma: Diagnostic utility and prognostic significance. J Clin Oncol 1999; 17:578‑84. 11. Maire F, Micard S, Hammel P, Voitot H, Levy P, Cugnenc PH, Ruszniewski P, Puig PL. Differential diagnosis between chronic pancreatitis and pancreatic cancer: Value of the detection of KRAS2 mutations in circulating DNA. Br J Cancer 2002; 87:551‑4. 12. Mulcahy H, Farthing MJ. Diagnosis of pancreatico-biliary malignancy: Detection of gene mutations in plasma and stool. Ann Oncol 1999; 10:114‑7. 13. Caldas C, Hahn SA, Hruban RH, Redston MS, Yeo CJ, Kern SE. Detection of K‑ras mutations in the stool of patients with pancreatic adenocarcinoma and pancreatic ductal hyperplasia. Cancer Res 1994; 54:3568‑73. 14. van Laethem JL. Ki‑ras oncogene mutations in chronic pancreatitis: Which discriminating ability for malignant potential? Ann NY Acad Sci 1999; 880:210‑8. 15. Queneau PE, Adessi GL, Thibault P, Cleau D, Heyd B, Mantion G, Carayon P. Early detec‑ tion of pancreatic cancer in patients with chronic pancreatitis: Diagnostic utility of a K‑ras point mutation in the pancreatic juice. Am J Gastroenterol 2001; 96:700‑4. 16. Larder BA, Kohli A, Kellam P, Kemp SD, Kronick M, Henfrey RD. Quantitative detec‑ tion of HIV‑1 drug resistance mutations by automated DNA sequencing. Nature 1993; 365:671‑3. 17. Vary CP, Carmody M, LeBlanc R, Hayes T, Rundell C, Keilson L. Allele‑specific hybridiza‑ tion of lipoprotein lipase and factor‑V Leiden missense mutations with direct label alkaline phosphatase‑conjugated oligonucleotide probes. Genet Anal 1996; 13:59‑65. 18. Chen J, Viola MV. A method to detect ras point mutations in small subpopulations of cells. Anal Biochem 1991; 195:51‑6. 19. Redston MS, Papadopoulos N, Caldas C, Kinzler KW, Kern SE. Common occur‑ rence of APC and K‑ras gene mutations in the spectrum of colitis‑associated neoplasias. Gastroenterology 1995; 108:383‑92. 20. Rothschild CB, Brewer CS, Loggie B, Beard GA, Triscott MX. Detection of colorectal can‑ cer K‑ras mutations using a simplified oligonucleotide ligation assay. J Immunol Methods 1997; 206:11‑9. 21. Barany F. Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc Natl Acad Sci USA 1991; 88:189‑93. 22. Germer S, Holland MJ, Higuchi R. High‑throughput SNP allele‑frequency determination in pooled DNA samples by kinetic PCR. Genome Res 2000; 10:258‑66. 23. Kwok S, Kellogg DE, McKinney N, Spasic D, Goda L, Levenson C, Sninsky JJ. Effects of primer‑template mismatches on the polymerase chain reaction: Human immunodeficiency virus type 1 model studies. Nucleic Acids Res 1990; 18:999‑1005. 24. Oliver DH, Thompson RE, Griffin CA, Eshleman JR. Use of single nucleotide polymor‑ phisms (SNP) and real‑time polymerase chain reaction for bone marrow engraftment analysis. J Mol Diagn 2000; 2:202‑8. 25. Shi C, Eshleman SH, Jones D, Fukushima N, Hua L, Parker AR, Yeo CJ, Hruban RH, Goggins MG, Eshleman JR. LigAmp for sensitive detection of single‑nucleotide differences. Nature Methods 2004; 1:141‑7. 26. Mitchell CE, Belinsky SA, Lechner JF. Detection and quantitation of mutant K‑ras codon 12 restriction fragments by capillary electrophoresis. Anal Biochem 1995; 224:148‑53. 27. Pellegata NS, Sessa F, Renault B, Bonato M, Leone BE, Solcia E, Ranzani GN. K‑ras and p53 gene mutations in pancreatic cancer: Ductal and nonductal tumors progress through different genetic lesions. Cancer Res 1994; 54:1556‑60. 28. Luttges J, Schlehe B, Menke MA, Vogel I, Henne‑Bruns D, Kloppel G. The K‑ras muta‑ tion pattern in pancreatic ductal adenocarcinoma usually is identical to that in associated normal, hyperplastic, and metaplastic ductal epithelium. Cancer 1999; 85:1703‑10. 29. Laghi L, Orbetegli O, Bianchi P, Zerbi A, Di Carlo V, Boland CR, Malesci A. Common occurrence of multiple K‑RAS mutations in pancreatic cancers with associated precursor lesions and in biliary cancers. Oncogene 2002; 21:4301‑6. 30. Pleskow DK, Berger HJ, Gyves J, Allen E, McLean A, Podolsky DK. Evaluation of a serologic marker, CA19‑9, in the diagnosis of pancreatic cancer. Ann Intern Med 1989; 110:704‑9. 31. Vestergaard EM, Hein HO, Meyer H, Grunnet N, Jorgensen J, Wolf H, Orntoft TF. Reference values and biological variation for tumor marker CA 19‑9 in serum for differ‑ ent Lewis and secretor genotypes and evaluation of secretor and Lewis genotyping in a Caucasian population. Clin Chem 1999; 45:54‑61. 32. Swets JA. Measuring the accuracy of diagnostic systems. Science 1988; 240:1285‑93.




33. Zweig MH, Campbell G. Receiver‑operating characteristic (ROC) plots: A fundamental evaluation tool in clinical medicine. Clin Chem 1993; 39:561‑77. 34. Brune K, Abe T, Canto M, O’Malley L, Klein AP, Maitra A, Volkan Adsay N, Fishman EK, Cameron JL, Yeo CJ, Kern SE, Goggins M, Hruban RH. Multifocal neoplastic precursor lesions associated with lobular atrophy of the pancreas in patients having a strong family history of pancreatic cancer. Am J Surg Pathol 2006; 30:1067‑76. 35. Takaori K, Hruban RH, Maitra A, Tanigawa N. Pancreatic intraepithelial neoplasia. Pancreas 2004; 28:257‑62. 36. Canto MI, Goggins M, Yeo CJ, Griffin C, Axilbund JE, Brune K, Ali SZ, Jagannath S, Petersen GM, Fishman EK, Piantadosi S, Giardiello FM, Hruban RH. Screening for pancreatic neoplasia in high‑risk individuals: An EUS‑based approach. Clin Gastroenterol Hepatol 2004; 2:606‑21. 37. Fukushima N, Walter KM, Uek T, Sato N, Matsubayashi H, Cameron JL, Hruban RH, Canto M, Yeo CJ, Goggins M. Diagnosing pancreatic cancer using methylation specific PCR analysis of pancreatic juice. Cancer Biol Ther 2003; 2:78‑83. 38. Wong LT, Turtle S, Davidson AG. Secretin pancreozymin stimulation test and confirmation of the diagnosis of cystic fibrosis. Gut 1982; 23:744‑50. 39. Bali MA, Sztantics A, Metens T, Arvanitakis M, Delhaye M, Deviere J, Matos C. Quantification of pancreatic exocrine function with secretin‑enhanced magnetic resonance cholangiopancreatography: Normal values and short‑term effects of pancreatic duct drain‑ age procedures in chronic pancreatitis. Initial results. Eur Radiol 2005; 15:2110‑21. 40. Tersmette AC, Petersen GM, Offerhaus GJ, Falatko FC, Brune KA, Goggins M, Rozenblum E, Wilentz RE, Yeo CJ, Cameron JL, Kern SE, Hruban RH. Increased risk of incident pancreatic cancer among first‑degree relatives of patients with familial pancreatic cancer. Clin Cancer Res 2001; 7:738‑44. 41. Lowenfels AB, Maisonneuve P, Cavallini G, Ammann RW, Lankisch PG, Andersen JR, Dimagno EP, Andren‑Sandberg A, Domellof L. Pancreatitis and the risk of pancreatic cancer: International pancreatitis study group. N Engl J Med 1993; 328:1433‑7. 42. Berthelemy P, Bouisson M, Escourrou J, Vaysse N, Rumeau JL, Pradayrol L. Identification of K‑ras mutations in pancreatic juice in the early diagnosis of pancreatic cancer. Ann Intern Med 1995; 123:188‑91. 43. Arvanitakis M, Van Laethem JL, Parma J, De Maertelaer V, Delhaye M, Deviere J. Predictive factors for pancreatic cancer in patients with chronic pancreatitis in association with K‑ras gene mutation. Endoscopy 2004; 36:535‑42. 44. Lowenfels AB, Maisonneuve P, Whitcomb DC, Lerch MM, DiMagno EP. Cigarette smok‑ ing as a risk factor for pancreatic cancer in patients with hereditary pancreatitis. Jama 2001; 286:169‑70. 45. Meckler KA, Brentnall TA, Haggitt RC, Crispin D, Byrd DR, Kimmey MB, Bronner MP. Familial fibrocystic pancreatic atrophy with endocrine cell hyperplasia and pancreatic carci‑ noma. Am J Surg Pathol 2001; 25:1047‑53. 46. Sato N, Fukushima N, Maitra A, Matsubayashi H, Yeo CJ, Cameron JL, Hruban RH, Goggins M. Discovery of novel targets for aberrant methylation in pancreatic carcinoma using high‑throughput microarrays. Cancer Res 2003; 63:3735‑42. 47. Sato N, Parker AR, Fukushima N, Miyagi Y, Iacobuzio‑Donahue CA, Eshleman JR, Goggins M. Epigenetic inactivation of TFPI‑2 as a common mechanism associated with growth and invasion of pancreatic ductal adenocarcinoma. Oncogene 2005; 24:850‑8. 48. Li D, Xie K, Wolff R, Abbruzzese JL. Pancreatic cancer. Lancet 2004; 363:1049‑57.

www.landesbioscience.com


267