APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2007, p. 5464–5470 0099-2240/07/$08.00⫹0 doi:10.1128/AEM.00572-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 73, No. 17
Sensitive Multiplex Real-Time Reverse Transcription-PCR Assay for the Detection of Human and Animal Noroviruses in Clinical and Environmental Samples䌤 Sandro Wolf,1 Wendy M. Williamson,2 Joanne Hewitt,1 Malet Rivera-Aban,1 Susan Lin,2 Andrew Ball,2 Paula Scholes,2 and Gail E. Greening1* Communicable Disease Group, Institute of Environmental Science & Research Ltd., Kenepuru Science Centre, P.O. Box 50-348, Porirua, New Zealand,1 and Water Resource Group, Institute of Environmental Science & Research Ltd., Christchurch Science Centre, P.O. Box 29-181, Christchurch, New Zealand2 Received 13 March 2007/Accepted 28 June 2007
In this study, we developed a triplex real-time reverse transcription-PCR (RT-PCR)-based method that detects and distinguishs between noroviruses belonging to genogroups I, II, and III and that targets the junction between the regions of open reading frame 1 (ORF1) and ORF2. This is the first assay to include all three genogroups and the first real-time RT-PCR-based method developed for the detection of bovine noroviruses. The assay was shown to be broadly reactive against a wide spectrum of norovirus genotypes, including GI/1 through GI/7, GII/1 through GII/8, GII/10, GII/12, and GII/17, in different matrices (including fecal specimens, treated and raw sewage, source water, and treated drinking water). The assay is highly sensitive, detecting low copy numbers of plasmids that carry the target sequence. A new bovine norovirus, Bo/NLV/ Norsewood/2006/NZL, was identified by this assay and was further genetically characterized. The results implicate a broad range of possible applications, including clinical diagnostics, tracing of fecal contaminants, and due to its sensitivity and broad reactivity, environmental studies. The genus Norovirus (NoV) is in the family Caliciviridae and has been found in humans, pigs, cattle, and mice (12, 16, 25). Currently, NoVs have been classified into five genogroups (GI through GV) (33) of which the human noroviruses (HuNoVs) belong to genogroups I, II, and IV. HuNoV is reported to be the major cause of nonbacterial gastroenteritis in humans worldwide and is commonly associated with water- and foodborne outbreaks via the fecal-oral route (1, 5, 7, 18). Porcine NoVs (PoNoVs) have been identified in the United States, Europe, and Japan and are classified genetically into three genotypes within genogroup II (GII/11, GII/18, and GII/19) (3, 27, 33). Bovine NoVs (BoNoVs) belong to genogroup III and have been found in the United States, Europe, Japan, and South Korea (S. I. Park, K. O. Chi, C. Jeong, S. H. Park, Y. J. Kim, H. H. Kim, and S. J. Park, submitted for publication; 3, 22, 23, 28). Within genogroup III, two distinct genotypes, GIII/1 (or Jena like) and GIII/2 (or Newbury2 like [NA2 like]), have been characterized (2). Recently, Smiley et al. (22) reported a new bovine calicivirus, designated Nebraska, which is morphologically similar to NoVs but genetically more closely related to sapoviruses and lagoviruses. The close relatedness of human and animal NoVs has raised concerns about potential zoonotic transmission (27, 35). Although a recent breakthrough has been achieved in the culture of HuNoV (24), no cell culture-based method is readily available to detect viable NoV to date, except that to detect murine NoV. Therefore, aside from immunological assays, mo-
lecular-based reverse transcription-PCR (RT-PCR) and realtime RT-PCR are the methods of choice for NoV detection and characterization. Compared to conventional RT-PCR, real-time RT-PCR is generally faster, less prone to contamination than nested or seminested RT-PCR, and often more sensitive and gives at least semiquantitative information about the concentration of the respective target nucleic acid (21). NoVs are highly variable, single-stranded RNA viruses. This variability makes it difficult to find regions that are highly conserved across the broad spectrum of NoV sequences deposited in GenBank. Nevertheless, over the last 15 years, many different RT-PCR-based NoV assays have been designed. Aside from generic or genogroup-specific RT-PCR assays (1, 9, 14, 29, 30), different real-time RT-PCR assays for NoV genogroups I and II (7, 8, 10, 11, 19) and RT-PCR assays for PoNoV (33) and for BoNoV genogroup III (23) have been developed. However, no single assay is able to semiquantitatively detect human, porcine, and bovine NoVs of genogroups I, II, and III. The aim of this study was to develop a single-tube, broadly reactive and sensitive, multiplex real-time RT-PCR assay that can detect and differentiate between NoV genogroups I, II, and III. MATERIALS AND METHODS Design of NoV multiplex real-time RT-PCR. Fifty-two NoV sequences from GenBank, including human, porcine, and bovine strains, were aligned using ClustalW, version 1.83, implemented in Geneious, version 2.0.4 (Biomatters Ltd.) (Table 1). The alignment was then imported into GeneDoc, version 2.6.002, and the primers and probes were designed manually. The primers and probes were tested for their melting temperatures, potential hairpins, self-annealing sites, and primer-primer/primer-probe interactions by using the oligonucleotide properties calculator OligoCalc, version 1.0 (www.basic.northwestern .edu/biotools/oligocalc.html), and OligoAnalyzer, version 3.0 (Integrated DNA Technologies; http://www.idtdna.com/analyzer/applications/oligoanalyzer/). For
* Corresponding author. Mailing address: Institute of Environmental Science and Research Ltd., Kenepuru Science Centre, P.O. Box 50-348, Porirua, New Zealand. Phone: 64-4-9140765. Fax: 64-49140770. E-mail:
[email protected]. 䌤 Published ahead of print on 6 July 2007. 5464
VOL. 73, 2007
RT-PCR FOR DETECTION OF HUMAN AND ANIMAL NOROVIRUSES
TABLE 1. Norovirus strains used for the design of the NoV multiplex real-time RT-PCRa Strain (genogroup)
GenBank accession no.
Hu/NLV/Norwalk/8FIIa/76/USb (GI)......................................M87661 Hu/NLV/Southampton/91/UK (GI) ........................................L07418 Hu/NLV/Hesse3/97/DE (GI) ...................................................AF093797 Hu/NLV/Chiba/87/JP (GI) .......................................................AB042808 Hu/NLV/Desert Shield395/90/SA (GI) ...................................U04469 Hu/NLV/West_Chester/2001/US (GI) ....................................AY502016 Hu/NLV/Wisconsin/2001/USb (GI) .........................................AY502008 Hu/NLV/Berlin/2004/DE (GI) .................................................DQ340089 Hu/NLV/Saitama/2002/JP (GI)................................................AB112144 Hu/NLV/Osaka/337/2004/JP (GI)............................................AB248831 Hu/NLV/Camberwell/101922/94/AUS (GII) ..........................AF145896 Hu/NLV/Chiba/05/JP (GII)......................................................AB220921 Hu/NLV/Ehime/05/JP (GII).....................................................AB220923 Hu/NLV/Hawaii/71/US (GII)...................................................U07611 Hu/NLV/HoChiMinh/VN (GII) ..............................................AF504671 Hu/NLV/Lordsdale/93/UK (GII).............................................X86557 Hu/NLV/Melksham/94/UK (GII) ............................................X81879 Hu/NLV/Mexico/89/MX (GII).................................................U22498 Hu/NLV/Sakai/05/JP (GII).......................................................AB220922 Hu/NLV/SnowMountain/76/US (GII).....................................U75682 Hu/NLV/Toronto/91/CA (GII) ................................................U02030 Hu/NLV/GII.4/Sydney348/97O/AU (GII) ..............................DQ078829 Hu/NLV/Kunming/146/2004/CHN (GII) ................................DQ304651 Hu/NLV/Picton/2003/AU (GII) ...............................................AY919139 Po/NLV/GII-11/MI-QW48/02/USb (GII)................................AY823303 Po/NLV/GII-18/OH-QW101/03/US (GII) ..............................AY823304 Po/NLV/GII-18/OH-QW125/03/US (GII) ..............................AY823305 Po/NLV/GII-19/OH-QW218/03/US (GII) ..............................AY823307 Po/NLV/GII-19/OHQW170/03/US (GII) ...............................AY823306 Po/NLV/Sw43/1997/JPc (GII)...................................................AB074892 Po/NLV/Sw918/1997/JP (GII) ..................................................AB074893 Bo/NLV/Thirsk10/00/UK (GIII) ..............................................AY126468 Bo/NLV/Penrith55/00/UK (GIII) ............................................AY126476 Bo/NLV/Newbury2/1976/UK (GIII)........................................AF097917 Bo/NLV/Jena/80/DE (GIII) .....................................................AJ011099 Bo/NLV/Dumfries/94/UK (GIII).............................................AY126474 Bo/NLV/CV95-OH/02/USd (GIII) ..........................................AF542083 Bo/NLV/Aberystwyth24/00/UK (GIII)....................................AY126475 BoNLV/Sa16/04/JP (GIII) ........................................................DQ288307 BoNLV/Sa35/04/JP (GIII) ........................................................DQ288308 BoNLV/Sa56/05/JP (GIII) ........................................................DQ288309 BoNLV/Sa57/05/JP (GIII) ........................................................DQ288310 BoNLV/Sa58/05/JP (GIII) ........................................................DQ288311 Bo/NLV/Sh1/04/JP (GIII).........................................................DQ288312 Bo/NLV/Sh28/04/JP (GIII).......................................................DQ288313 Bo/NLV/Sh31/04/JP (GIII).......................................................DQ288314 Bo/NLV/Sh58/04/JP (GIII).......................................................DQ288315 Bo/NLV/Sh84/05/JP (GIII).......................................................DQ288316 Bo/NLV/Sh96/05/JP (GIII).......................................................DQ288317 Bo/NLV/Sh111/05/JP (GIII).....................................................DQ288318 Bo/NLV/Mohiville/B123/2002/BE (GIII)................................AY686490 Bo/NLV/11MSU-MW/US (GIII).............................................AY274820 a
Sequence identity of primers and probes is 100% unless indicated otherwise. Sequence identity of primers and probes is 96%. Sequence identity of primers and probes is 95%. d Sequence identity of primers and probes is 94%. b c
comparison, samples were analyzed using the accredited, standard, two-step, real-time RT-PCR assay of the Institute of Environmental Science and Research (ESR) for the detection of NoVs. The assay is based on the method of Kageyama et al. (Kageyama assay) (11). The PCR primers and probes used are listed in Table 2. Specimens and samples. Real-time RT-PCR assays were evaluated against extracted RNA samples known to contain NoV. These included 34 NoV-positive human fecal specimens from New Zealand hospitals, rest homes, and other
5465
outbreak settings; six raw and three treated sewage samples; and single samples of NoV-contaminated drinking water and source water. Samples were collected between 2001 and 2006. Concentration and RNA extraction were carried out as follows. For fecal specimens, a pea-sized portion was resuspended in 2 ml phosphate-buffered saline and 200 l chloroform and clarified by centrifugation at 12,000 ⫻ g for 10 min at 4°C. Raw and treated sewage samples were concentrated using polyethylene glycol 6000 (10% wt/vol) and 0.3 M sodium chloride (1.75% wt/vol) as described previously by Lewis and Metcalf (15). Drinking and source water were concentrated as described previously by Hill et al. (6), with further polyethylene glycol 6000 concentration. Viral RNA was extracted from the concentrates (200 l) by using the High Pure viral nucleic acid kit (Roche Molecular Biochemicals Ltd., Mannheim, Germany) as per the manufacturer’s instructions. Genotyping of the above human fecal specimens showed the presence of NoV genotypes GI/1, GI/2, GI/3, GI/4, GI/5, GI/6, GI/7, GII/1, GII/2, GII/3, GII/4, GII/5, GII/6, GII/7, GII/8, GII/10, GII/12, and GII/17, which represents the range of genotypes detected in New Zealand in the above-mentioned period. For NoV genotyping, NoV-positive specimens were amplified using primers at the 3⬘ end of open reading frame 1 (ORF1) (“region B”) (31) and/or the capsid VP1 region (“region D”) (32). Products were purified using the QIAquick PCR purification kit (QIAGEN Ltd., Germany), followed by DNA sequencing in both directions with Big Dye Terminator cycling methodology (Applied Biosystems, Foster City, CA) using automated sequencer ABI 3130XL (Applied Biosystems). Phylogenetic analysis was then performed and compared against NIH GenBank and/or CDC CaliciNet sequence databases using BioNumerics analysis software (Applied Maths BVBA, Kortrijk, Belgium). Twenty-eight bovine fecal specimens were collected from asymptomatic cattle in May 2006 from two farms in the North Island of New Zealand. Preparation and RNA extraction of bovine fecal material were as described previously for the human fecal specimens. Plasmids. Fragments of NoV cloned into DNA plasmids were used to evaluate the sensitivity of the assay. NoV inserts were generated either from New Zealand human fecal specimens (NoV GI/1 and GII/3) or from bovine fecal specimens that were positive for BoNoV (NV GIII/1) by RT-PCR. NoV inserts were cloned into TOPO vectors and transformed into one-shot TOP10 cells (Invitrogen, Carlsbad, CA). Plasmids were purified with the PureLink quick plasmid miniprep kit (Invitrogen), and the concentrations were determined with the Quant-iT dsDNA HS assay kit using a Qubit fluorometer (Invitrogen). Real-time RT-PCR. Reverse transcription was carried out using the SuperScript III first-strand synthesis system for RT-PCR (Invitrogen). The newly designed reverse primers, SW GI/II/III, and the reverse primers of the Kageyama assays were used to generate specific cDNA in three different reactions (in the new multiplex assay, the Kageyama NoV GI assay, and the Kageyama NoV GII assay). The 10-l RT reaction mixture comprised 100 U SuperScript III reverse transcriptase, 10 U RNase inhibitor (RNaseOUT; Invitrogen), 100 nM of each reverse primer, 1 mM of each deoxynucleoside triphosphate (dATP, dCTP, dGTP, and dTTP), 1⫻ first-strand RT buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2), and 5 l viral RNA. RT was carried out at 50°C for 30 min, followed by an enzyme inactivation step of 95°C for 4 min, and then held at 4°C until real-time PCR amplification was performed. For real-time PCR, each 25-l reaction mixture contained 5 l of cDNA, 12.5 l of 2⫻ quantitative PCR Supermix-UDG (Invitrogen), 0.4 M each of forward and reverse primers, and 0.2 M of each probe of the new multiplex real-time RT-PCR (Table 2) or 0.3 M of the RING1(a)-TP/0.2 M RING1(b) probes (Kagayama NoV GI assay) and 0.2 M of the RING2-TP probe (Kageyama NoV GII assay). The initial activation of the HotStar polymerase at 95°C for 5 min was followed by a two-step cycling protocol, comprising denaturation at 95°C for 15 s and annealing/extension at 57°C (new multiplex real-time RT-PCR) and 56°C (Kageyama NoV GI and NoV GII assays) for 60 s over 45 cycles. All real-time assays were carried out with a Rotor-Gene 6000 real-time rotary analyzer (Corbett Life Science, Sydney, Australia). Anticontamination procedures were followed for all RNA and DNA procedures. RNase-free reagents and procedures were used to minimize contamination. Negative and positive controls were included in each run. Confirmation of bovine norovirus-positive specimens. To confirm NoV GIIIpositive specimens, RNA was tested using the SW GIII forward primer and the NVSWGIIIrseq reverse primer (Table 2) by using the SuperScript III one-step RT-PCR system with Platinum Taq (Invitrogen). Cycling conditions were 50°C for 30 min; 95°C for 2 min; 40 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s; and a final extension step for 10 min at 72°C. The PCR products were run on a 2% (wt/vol) agarose gel, and the band that corresponded to the expected product size of about 515 bp was excised. Amplicons obtained following real-time RT-PCR or excised bands obtained following RT-PCR were purified using a QIAquick PCR purification kit (QIAGEN,
5466
WOLF ET AL.
APPL. ENVIRON. MICROBIOL. TABLE 2. Primers and probes used in this study
Name
SW GI/IIa forw SW GI/IIb forw SW GIII forw SW GI rev SW GII rev SW GIII rev SW GI probe SW GII probe SW GIII probe NVGIIIrseq
Sequence
5⬘ 5⬘ 5⬘ 5⬘ 5⬘ 5⬘ 5⬘ 5⬘ 5⬘ 5⬘
ATGTTYAGRTGGATGAGRTTYT ATGTTCCGYTGGATGCGVTT CGCTCCATGTTYGCBTGG CTTAGACGCCATCATCATTYAC TMGAYGCCATCWTCATTCAC TCAGTCATCTTCATTTACAAAATC AGGAGATYGCGATCYCCTGTCCAYAd CACRTGGGAGGGCGATCGCAATCd TGTGGGAAGGTAGTCGCGACRYCd ATCAGCACATGRGGRAACTG
Sense
Tm (°C)
Location
⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫹ ⫹ ⫺
56–61 56–61 56–61 57–60 57–60 57–60 67–70 67–70 67–70 56–60
5285–5306a 5285–5304a 4973–4990c 5354–5375a 5081–5100b 5041–5064c 5322–5344a 5044–5066b 5015–5034c 5468–5488c
a
Genome location of primers and probes is based on Hu/NLV/Norwalk/8FIIa/76/US (M87661). Genome location of primers and probes is based on Hu/NLV/Lordsdale/93/UK (X86557). Genome location of primers and probes is based on Bo/NLV/Jena/80/DE (AJ011099). d SW GI/GII/GIII probes were FAM-BHQ1, Cal Fluor Red 610-BHQ2, and Quasar 705-BHQ2 labeled, respectively. b c
Inc., Germany) according to the manufacturer’s instructions. Sequencing reactions were performed as described above. Sequences were aligned using ClustalW, version 1.83, implemented in Geneious, version, 2.5.2. Phylogenetic analysis was performed using the neighbor-joining method of the tree-builder tool of the same software. Nucleotide sequence accession number. The sequence of the Bo/NLV/ Norsewood/2006/NZL virus reported in this paper has been deposited in the GenBank database under accession number EF143411.
RESULTS A multiplex assay consisting of three forward and three reverse primers with three specific probes for the detection of NoV genogroups I, II, and III was developed. The sequence homology of the primers and probes was ⬎94% to the NoV strains listed in Table 1. There was a maximum of one mismatching base in the forward and reverse primers and the probe for 6 out of 52 sequences and 100% homology for the remaining 46 out of 52 sequences. All except the SW GI probe (Table 2) showed only weak interactions, with a Gibbs free energy value of more than ⫺20 kcal/mole. The SW GI probe has a tendency to form self-dimers involving 18 bp and a Gibbs free energy value of ⫺36 kcal/mole. The new multiplex realtime RT-PCR assay and the Kageyama real-time RT-PCR assay (11) were used to examine RNA from 45 NoV-positive specimens that had been analyzed previously in our laboratory for the presence of NoV GI and GII. Consistent with analyses using the ESR two-step, real-time RT-PCR method, samples with threshold cycle (CT) values of ⬍40 were regarded as positive. All specimens that were positive by the Kageyama assay were also positive by the multiplex assay described here. Interestingly, 2 out of 25 (8%) and 3 out of 17 (18%) specimens that were negative by the Kageyama assay for NoV GI and NoV GII, respectively, were positive by the multiplex assay, having CT values between 33.0 and 37.1. No cross-reactivity of the assay with nontarget genogroups was observed (Table 3). For 16 out of 20 (NoV GI) and 26 out of 28 (NoV GII) of the specimens that were positive by both assays, the CT values for the multiplex assay were lower (on average ⫺2.4 CT U) than those for the Kageyama assay. The remaining six specimens produced higher CT values with the new multiplex assay. These particular NoV strains belonged to genotype GI/3 (three out of three GI/3 specimens, on average ⫹3.9 CT U), GI/7 (one out of one GI/7 specimens, ⫹3.5 CT U), GII/1 (one out of one
GII/1 specimen, ⫹3.3 CT U), or GII/12 (one out of one GII/12 specimen, ⫹1.4 CT U). We also tested RNA from 28 bovine fecal specimens using the new multiplex assay and found that 15 out of 28 (54%) of the specimens were positive for NoV GIII, with CT values ranging between 21.5 and 33.3. Sequencing of the 92-bp amplicon obtained from the real-time RT-PCR with the primers SW GIII forw and SW GIII rev confirmed that the amplified fragment was NoV GIII (data not shown). To characterize this bovine NoV strain, a conventional RT-PCR with the SW GIII forw primer and the newly designed NVGIIIrseq reverse primer was performed and the amplicon was subsequently purified and sequenced. An analysis of the 517-bp amplicon revealed that this strain was genetically closest to Bo/NLV/ Jena/80/DE virus (accession no. AJ011099), showing 85% nucleotide identity and confirmed alignment to genotype GIII/1 (Fig. 1). Serial dilutions of prequantified plasmids (109 to 5 copies per reaction) revealed that the multiplex real-time PCR assay reliably detects less than 10 copies per reaction of NoV GI/I, NoV GII/3, and NoV GIII/I DNA. Using the formula E ⫽ (10⫺1/slope) ⫺ 1 (13), the calculated efficiency values of the assay were 0.93, 0.90, and 1.04 based on the slopes of the standard curves of 3.59, 3.60, and 3.23, respectively, for the above strains. DISCUSSION An improved real-time RT-PCR assay for NoV has been developed. The newly designed assay uses the junction between the ORF1 and ORF2 regions, which is highly conserved among different NoV strains (7, 11, 19). The multiplex assay consists of three sets of forward and reverse primers and three specific probes for the detection of genogroups I, II, and III. The probes were designed so that the predicted melting temperature was at least 6°C higher than that of the primers, ensuring that the probes would anneal before the primers and before any elongation occurs. Due to degeneracies, the primer and probe pool consisted of 28 forward, 11 reverse, and 14 different probe sequences, amounts which were reasonably small compared to those of Kageyama et al., with 208 forward, 3 reverse, and 6 different probe sequences, respectively (11), and those of Mohamed et al., with 84 forward, 16 reverse, and
VOL. 73, 2007
RT-PCR FOR DETECTION OF HUMAN AND ANIMAL NOROVIRUSES
5467
TABLE 3. Norovirus results for 73 fecal and environmental samples that were analyzed with the Kageyama real-time RT-PCR assay (11) and the new multiplex real-time RT-PCR No. of samples positive by indicated assayc Sample type
Human feces
Raw sewage Treated sewage Source water Tap water Total Positive Negative Bovine feces
Genotype
a
n
b
GI/1 GI/2 GI/3 GI/4 GI/5 GI/6 GI/7 GII/1 GII/2 GII/3 GII/4 GII/5 GII/6 GII/7 GII/8 GII/10 GII/12 GII/17 NT NT NT NT
3 1 3 1 4 1 1 1 3 3 2 1 2 1 3 1 1 2 6 3 1 1 45
GIII/1
28
Real-time RT-PCR
New multiplex real-time RT-PCR
GI
GII
GI
GII
GIII
3 (19.2) 1 (19.7) 3 (19.0) 1 (23.7) 4 (22.4) 1 (19.5) 1 (15.8) 0 0 0 0 0 0 0 0 0 0 0 3 (37.6) 1 (39.1) 1 (35.7) 1 (34.3) 45 20 (26.5) 25 0
0 0 0 0 0 0 0 1 (14.0) 3 (20.6) 3 (15.1) 2 (12.7) 1 (12.5) 2 (19.8) 1 (14.1) 3 (20.4) 1 (19.4) 1 (15.4) 2 (20.3) 5 (34.1) 3 (33.8) 0 0 45 28 (23.5) 17 0
3 (16.8) 1 (19.2) 3 (22.9) 1 (22.6) 4 (19.9) 1 (14.7) 1 (18.3) 0 0 0 0 0 0 0 0 0 0 0 3 (36.3) 3 (35.5) 1 (32.1) 1 (30.8) 45 22 (27.8) 23 0
0 0 0 0 0 0 0 1 (17.2) 3 (17.1) 3 (12.1) 2 (10.5) 1 (10.5) 2 (17.1) 1 (11.8) 3 (18.4) 1 (17.0) 1 (16.8) 2 (20.2) 6 (29.1) 3 (28.4) 1 (33.7) 1 (37.1) 45 31 (22.4) 14 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 45 0 45 15 (28.6)
a
NT, not typed. b n, number of samples. c Mean CT values of samples are shown in parentheses.
17 different probe sequences, respectively (19). The SW GI probe was predicted to have a Gibbs free energy value of ⫺36 kcal/mole of self-dimer interaction. However, the GI probe designed by Mohamed et al. (19), which is reported to work effectively, has an even stronger self-dimer-forming tendency, with a Gibbs free energy value of ⫺40 kcal/mole and involving 20 bp (data not shown). The melting temperature of the selfdimer stretch of the SW GI probe is approximately 6°C below the chosen annealing/extension temperature of the assay of 57°C, which reduces possible self-dimers. In practical application, no formation of the self-dimers was observed. All human NoV genotypes that were identified in our laboratory from 2001 to 2006 were included in the test panel and were detected with the new assay. These included NoV genotypes GI/1 to GI/7, GII/1 to GII/8, GII/10, GII/12, and GII/17. In terms of analytical sensitivity, the new assay was generally superior to the Kageyama assays for the detection of both genogroup I and II noroviruses used in this study. The CT values were on average 2.4 CT U lower, which corresponds to about a fivefold-higher sensitivity. However, 6 out of 45 specimens gave higher CT values with the new assay and these specimens were formerly typed as genotypes GI/3, GI/7, GII/1, and GII/12. For genotypes GI/7, GII/1, and GII/12, only one strain of each genotype was included in the test panel. Therefore, the assay should be tested against a broader range of NoV strains of these genotypes to verify this finding. The three GI/3 specimens all belong to a particular cluster within the GI/3
sequences (not shown). An in silico comparison of the primers and probes revealed 100% sequence identity to the Desert Shield virus (U04469) and only one mismatching base in the SW GI probe for both Hu/NLV/Little Rock/316/1994/US (AF414405) and Hu/NLV/Honolulu/219/1992/US (AF414403) (all genotype GI/3), and therefore, it may be a peculiarity of this cluster, rather than a noncompliance of the assay with genotype GI/3 sequences. In a recent Norwegian paper (26), three optimized TaqMan-based assays and one optimized SYBR green-based assay were directly compared. None of these assays were able to detect NoV GI/2, although only one strain of GI/2 was included in this study. Also, this study did not include strains of genotypes GI/6, GI/7, GII/5, GII/8, GII/ 12, and GII/17, which we included and successfully identified with the new multiplex NoV assay. The multiplex real-time PCR showed a high analytical sensitivity, as determined by the reliable detection of less than 10 copies of plasmid per reaction for NoV genogroups I, II, and III. However, it is important to note that this does not reflect the sensitivity of the assay for viral RNA, since possible losses of viral RNA during the nucleic acid extraction and incomplete transcription to cDNA during the RT reaction will occur. Nonetheless, we believe that the use of plasmids for the evaluation of the assay sensitivity is valid and allows a comparison with other published assays independent of the efficiency of the steps prior to the actual real-time PCR. Clinical sensitivity was improved, with 8 to 18% of formerly
5468
WOLF ET AL.
APPL. ENVIRON. MICROBIOL.
FIG. 1. Neighbor-joining phylogenetic tree based on the partial ORF1 and ORF2 regions of bovine noroviruses. The newly identified strain (Bo/NLV/Norsewood/2006/NZL) is in boldface at the top of the tree.
NoV-negative specimens testing positive by the new assay. All of these specimens generated high CT values, which suggests a low copy number of NoV RNA, and it is possible that a less sensitive assay may fail to detect them. Recently, Jothikumar et al. (10) developed a highly sensitive real-time RT-PCR assay that reportedly performed better than the Kageyama assay, and Loisy et al. (17) also stated that the Kageyama assay was insensitive for NoV genogroup I in shellfish samples. Vainio and Myrmel (26), using human stool samples from Norwegian outbreaks, found that the Jothikumar assay performed best of the four assays they evaluated but did not include environmental samples. Unfortunately, no PoNoV strain was available for evaluation; hence, the specificity towards PoNoV can be assessed only theoretically by the high homology of the SW GI/II a and b forward primers, the SW GII reverse primers, and the SW GII probe towards a broad spectrum of PoNoVs (Table 1). Whether the assay reliably and sensitively detects PoNoVs remains to be determined. The assay will not distinguish between genogroup II HuNoV and PoNoV when applied to environmental samples. However, as most NoV RT-PCR and real-time RT-PCR assays are primarily designed to detect HuNoVs in clinical specimens, the deliberate exclusion of PoNoV sequences was not one of the design criteria. Therefore, it is possible that all existing assays designed to detect HuNoV GII are also sensitive for PoNoV. A literature survey indicated that the incidence of BoNoV
(NoV-GIII) has not been investigated in many countries, but where it has been looked for it has been found, suggesting that BoNoV may be endemic to most countries (3, 4, 23, 27). Consistent with this trend, we found that 15 of the 28 bovine fecal specimens tested using the new multiplex assay were positive for BoNoV. This, therefore, is the first report of the occurrence of BoNoV in the southern hemisphere. The bovine fecal specimens were collected from two farms and included calves (⬍12 months old), yearlings (⬎1.5 years old), and mature milking cows (⬎2 years old). Positive BoNoV specimens were obtained from each age group. In a German study, Deng et al. (4) reported that about 9% of 1- to 4-week-old calves with diarrhea were positive by an enzyme-linked immunosorbent assay for GIII/1-like viral particles and that 99% of cattle from Thuringia (central Germany) had immunoglobulin G antibodies to that virus. Smiley et al. (23) found that caliciviruses related to GIII/1- and GIII/2-like strains were present in three out of four sampled veal herds. van der Poel et al. (27) also found bovine caliciviruses frequently in veal calves. Although most of the reported BoNoV detections have been among calves, BoNoVs are also known to infect adult cattle sporadically (27). To our knowledge, all the cattle in this study were asymptomatic, which is in agreement with the results of Smiley et al. (23), who found no association between the occurrence of bovine enteric caliciviruses and diarrhea in calves on two farms in Ohio, although those authors state that the experimental design of their study may have precluded the association. Fur-
VOL. 73, 2007
RT-PCR FOR DETECTION OF HUMAN AND ANIMAL NOROVIRUSES
ther research should be carried out to examine the prevalence among cattle herds of the southern hemisphere and elsewhere, although as determined from both the literature and our own findings, a high prevalence of BoNoV is likely. There have been no reports linking BoNoV and human diarrheal outbreaks to date. This study showed that only the bovine fecal specimens were positive for BoNoV, which is consistent with the results of Oliver et al. (20), who found no evidence that BoNoV strains were circulating in both humans and cattle and inferred that BoNoV did not pose a threat to human health. In contrast, however, Widdowson et al. (35) found immunoglobulin G reactivity to recombinant capsid protein of BoNoV in 22% of a test group of 840 persons, including 210 veterinarians and 630 persons in a control group. The authors therefore concluded that BoNoV may infect humans, although less frequently than HuNoV strains do. However, the absence of reported transmissions of this virus to humans or other animals does not exclude the possibility of a broader host range. The nondetection of BoNoV in humans may be due to the limited number of surveys which have included animal-specific assays. The routine clinical testing for NoV is generally carried out only with assays specific for human NoV GI and GII. This aspect deserves focused attention in future research and suggests an immediate use for the herein-described multiplex real-time RT-PCR in helping to answer this question. Possible applications of this multiplex assay are for the detection of NoV in clinical specimens and in fecal specimens of pigs and cattle, and for environmental studies, including NoV detection in shellfish samples. Further, the inclusion of an animal-specific assay (BoNoV) could be an appropriate tool for tracing the sources of fecal contamination in the environment.
9.
10.
11.
12. 13.
14. 15.
16. 17. 18. 19.
20.
21.
ACKNOWLEDGMENTS This work was supported by the New Zealand Ministry of Health as part of the ESR 2006-7 contract for scientific services. We gratefully acknowledge the technical assistance of Marilyn Grubner for the sequencing of noroviruses.
22. 23.
REFERENCES 1. Ando, T., S. S. Monroe, J. R. Gentsch, Q. Jin, D. C. Lewis, and R. I. Glass. 1995. Detection and differentiation of antigenically distinct small roundstructured viruses (Norwalk-like viruses) by reverse transcription-PCR and Southern hybridization. J. Clin. Microbiol. 33:64–71. 2. Ando, T., J. S. Noel, and R. L. Fankhauser. 2000. Genetic classification of Norwalk-like viruses. J. Infect. Dis. 181(Suppl. 2):336–348. 3. Costantini, V., F. Loysi, L. Joens, F. S. Le Guyader, and L. J. Saif. 2006. Human and animal enteric caliciviruses in oysters from different coastal regions of the United States. Appl. Environ. Microbiol. 72:1800–1809. 4. Deng, Y., C. A. Batten, B. L. Liu, P. R. Lambden, M. Elschner, H. Guenther, P. Otto, P. Schnuerch, W. Eichhorn, W. Herbst, and I. N. Clarke. 2003. Studies of epidemiology and seroprevalence of bovine noroviruses in Germany. J. Clin. Microbiol. 41:2300–2305. 5. Greening, G. E., M. Miriams, and T. Berke. 2001. Molecular epidemiology of ‘Norwalk-like viruses’ associated with gastroenteritis outbreaks in New Zealand. J. Med. Virol. 64:58–66. 6. Hill, V. R., A. L. Polaczyk, D. Hahn. J. Narayanan, T. L. Cromeans, J. M. Roberts, and J. E. Amburgey. 2005. Development of a rapid method for simultaneous recovery of diverse microbes in drinking water by ultrafiltration with sodium polyphosphate and surfactants. Appl. Environ. Microbiol. 71: 6878–6884. 7. Ho ¨hne, M., and E. Schreier. 2004. Detection and characterization of norovirus outbreaks in Germany: application of a one-tube RT-PCR using a fluorogenic real-time detection system. J. Med. Virol. 72:312–319. 8. Ho ¨hne, M., and E. Schreier. 2006. Detection of norovirus genogroup I and
24.
25. 26. 27. 28. 29. 30. 31.
5469
II by multiplex real-time RT-PCR using a 3⬘-minor groove binder-DNA probe. BMC Infect. Dis. 6:69. Jiang, X., P. W. Huang, W. M. Zhong, T. Farkas, D. W. Cubitt, and D. O. Matson. 1999. Design and evaluation of a primer pair that detects both Norwalk- and Sapporo-like caliciviruses by RT-PCR. J. Virol. Methods 83: 145–154. Jothikumar, N., J. A. Lowther, K. Henshilwood, D. N. Lees, V. R. Hill, and J. Vinje´. 2005. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71: 1870–1875. Kageyama, T., S. Kojima, M. Shinohara, K. Uchida, S. Fukushi, F. B. Hoshino, N. Takeda, and K. Katayama. 2003. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J. Clin. Microbiol. 41:1548–1557. Karst, S. M., C. E. Wobus, M. Lay, J. Davidson, and H. W. Virgin. 2003. STAT1-dependent innate immunity to a Norwalk-like virus. Science 299: 1575–1578. Kubista, M., J. M. Andrade, M. Bengtsson, A. Forootan, J. Jonak, K. Lind, R. Sinelka, R. Sjoback, B. Sjogreen, L. Strombom, A. Stahlberg, and N. Zoric. 2006. The real-time polymerase chain reaction. Mol. Asp. Med. 27: 95–125. Le Guyader, F., M. K. Estes, M. E. Hardy, F. H. Neill, J. Green, D. W. Brown, and R. L. Atmar. 1996. Evaluation of a degenerate primer for the PCR detection of human caliciviruses. Arch. Virol. 141:2225–2235. Lewis, G. D., and T. G. Metcalf. 1988. Polyethylene glycol precipitation for recovery of pathogenic viruses, including hepatitis A virus and human rotavirus, from oyster, water, and sediment samples. Appl. Environ. Microbiol. 54:1983–1988. Liu, B. L., P. R. Lambden, H. Gunther, P. Otto, M. Elschner, and I. N. Clarke. 1999. Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. J. Virol. 73:819–825. Loisy, F., R. L. Atmar, P. Guillon, P. Le Cann, M. Pommepuy, and F. S. Le Guyader. 2005. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods 123:1–7. Lopman, B. A., M. H. Reacher, Y. van Duijnhoven, F. X. Hanon, D. Brown, and M. Koopmans. 2003. Viral gastroenteritis outbreaks in Europe, 1995– 2000. Emerg. Infect. Dis. 9:90–96. Mohamed, N., S. Bela ´k, K. O. Hedlund, and J. Blomberg. 2006. Experience from the development of a diagnostic single tube real-time PCR for human caliciviruses, norovirus genogroups I and II. J. Virol. Methods 132:69–76. Oliver, S. L., A. M. Dastjerdi, S. Wong, L. El-Attar, C. Gallimore, D. W. D. Brown, J. Green, and J. C. Bridger. 2003. Molecular characterization of bovine enteric caliciviruses: a distinct third genogroup of noroviruses (Norwalk-like viruses) unlikely to be at risk to humans. J. Virol. 77:2789–2798. Pfaffl, M. W. 2004. Quantification strategies in real-time PCR, p. 1–23. In S. A. Bustin (ed.), A-Z of quantitative PCR. International University Line (IUL), La Jolla, CA. Smiley, J. R., K. O. Chang, J. Hayes, J. Vinje´, and L. J. Saif. 2002. Characterization of an enteropathogenic bovine calicivirus representing a potentially new genus. J. Virol. 76:10089–10098. Smiley, J. R., A. E. Hoet, M. Tråve´n, H. Tsunemitsu, and L. J. Saif. 2003. Reverse transcription-PCR assays for detection of bovine enteric caliciviruses (BEC) and analysis of the genetic relationships among BEC and human caliciviruses. J. Clin. Microbiol. 41:3089–3099. Straub, T. M., K. Ho ¨ner zu Bentrup, P. Orosz-Coghlan, A. Dohnalkova, B. K. Mayer, R. A. Bartholomew, C. O. Valdez, C. J. Bruckner-Lea, C. P. Gerba, M. Abbaszadegan, and C. A. Nickerson. 2007. In vitro cell culture infectivity assay for human noroviruses. Emerg. Infect. Dis. 13:396–403. Sugieda, M., H. Nagaoka, Y. Kakishima, T. Ohshita, S. Nakamura, and S. Nakajima. 1998. Detection of Norwalk-like virus genes in the caecum contents of pigs. Arch. Virol. 143:1215–1221. Vainio, K., and M. Myrmel. 2006. Molecular epidemiology of norovirus outbreaks in Norway during 2000 to 2005 and comparison of four norovirus real-time reverse transcriptase PCR assays. J. Clin. Microbiol. 44:3695–3702. van der Poel, W. H. M., J. Vinje´, R. van der Heide, M. I. Herrera, A. Vivo, and M. P. G. Koopmans. 2000. Norwalk-like calicivirus genes in farm animals. Emerg. Infect. Dis. 6:36–41. van der Poel, W. H. M., R. van der Heide, F. Verschoor, H. Gelderblom, J. Vinje´, and M. P. G. Koopmans. 2003. Epidemiology of Norwalk-like virus infections in cattle in The Netherlands. Vet. Microbiol. 92:297–309. Vennema, H., E. de Bruin, and M. Koopmans. 2002. Rational optimization of generic primers used for Norwalk-like virus detection by reverse transcriptase polymerase chain reaction. J. Clin. Virol. 25:233–235. Vinje´, J., and M. P. G. Koopmans. 1996. Molecular detection and epidemiology of small round-structured viruses in outbreaks of gastroenteritis in The Netherlands. J. Infect. Dis. 174:610–615. Vinje´, J., H. Vennema, L. Maunula, C.-H. von Bonsdorff, M. Hoehne, E. Schreier, A. Richards, J. Green, D. Brown, S. S. Beard, S. S. Monroe, E. de Bruin, L. Svensson, and M. P. G. Koopmans. 2003. International collabo-
5470
WOLF ET AL.
rative study to compare reverse transcriptase PCR assays for detection and genotyping of norovirus. J. Clin. Microbiol. 41:1423–1433. 32. Vinje´, J., R. A. Hamidjaja, and M. D. Sobsey. 2004. Development and application of a capsid VP1 (region D) based reverse transcription PCR assay for genotyping of genogroup I and II noroviruses. J. Virol. Methods 15:109–117. 33. Wang, Q. H., M. G. Han, S. Cheetham, M. Souza, J. A. Funk, and L. J. Saif.
APPL. ENVIRON. MICROBIOL. 2005. Porcine noroviruses related to human noroviruses. Emerg. Infect. Dis. 11:1874–1881. 34. Reference deleted. 35. Widdowson, M. A., B. Rockx, R. Schepp, W. H. M. van der Poel, J. Vinje´, Y. T. van Duynhoven, and M. P. Koopmans. 2005. Detection of serum antibodies to bovine norovirus in veterinarians and the general population in the Netherlands. J. Med. Virol. 76:119–128.
