A. sojae and A. oryzae are widely used in koji preparation in the Orient (9). ..... Saito, M., O. Tsuruta, P. Siriacha, S. Kawasugi, and M. Manabe. 1989. Atypical ...
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 1995, p. 40–43 0099-2240/95/$04.0010 Copyright q 1995, American Society for Microbiology
Vol. 61, No. 1
Sequence Variability in Homologs of the Aflatoxin Pathway Gene aflR Distinguishes Species in Aspergillus Section Flavi PERNG-KUANG CHANG,1 DEEPAK BHATNAGAR,2* THOMAS E. CLEVELAND,2 1 AND JOAN W. BENNETT Department of Cell and Molecular Biology, Tulane University, New Orleans, Louisiana 70118,1 and Southern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, New Orleans, Louisiana 701242 Received 20 June 1994/Accepted 10 October 1994
The Aspergillus parasiticus aflR gene, a gene that may be involved in the regulation of aflatoxin biosynthesis, encodes a putative zinc finger DNA-binding protein. PCR and sequencing were used to examine the presence of aflR homologs in other members of Aspergillus Section Flavi. The predicted amino acid sequences indicated that the same zinc finger domain, CTSCASSKVRCTKEKPACARCIERGLAC, was present in all of the Aspergillus sojae, Aspergillus flavus, and Aspergillus parasiticus isolates examined and in some of the Aspergillus oryzae isolates examined. Unique base substitutions and a specific base deletion were found in the 5* untranslated and zinc finger region; these differences provided distinct fingerprints. A. oryzae and A. flavus had the T-G-A-A-X-C fingerprint, whereas A. parasiticus and A. sojae had the C-C-C-C-C-T fingerprint at the corresponding positions. Specific nucleotides at positions 290 (C or T) and 2132 (G or A) further distinguished A. flavus from A. oryzae and A. parasiticus from A. sojae, respectively. A. sojae ATCC 9362, which was previously designated A. oryzae NRRL 1988, was determined to be a A. sojae strain on the basis of the presence of the characteristic fingerprint, A-C-C-C-C-C-C-T. The DNAs of other members of Aspergillus Section Flavi, such as Aspergillus nomius and Aspergillus tamarii, and some isolates of A. oryzae appeared to exhibit low levels of similarity to the A. parasiticus aflR gene since low amounts of PCR products or no PCR products were obtained when DNAs from these strains were used. in Aspergillus nidulans) (13, 26), omt-1 (29, 30), and aflR (3, 20, 27), have been cloned from A. parasiticus and A. flavus. The aflR genes of these two species, which encode a putative DNAbinding protein, exhibit 98% similarity (3). In light of the morphological similarity of species in Aspergillus Section Flavi, we investigated the presence of aflR homologs in members of Aspergillus section Flavi; we also examined sequence variability in aflR and its homologs.
Aspergillus Section Flavi, commonly referred to as the Aspergillus flavus group, includes Aspergillus oryzae (Ahlb.) Cohn, Aspergillus sojae Sakaguchi and Yamada, Aspergillus tamarii Kita, Aspergillus flavus Link, Aspergillus parasiticus Speare, and Aspergillus nomius Kurtzman and Hesseltine. A. oryzae has been used for decades in the production of food grade enzymes (1). A. sojae and A. oryzae are widely used in koji preparation in the Orient (9). In contrast, A. flavus and A. parasiticus produce carcinogenic aflatoxins that contaminate food and feeds (10). A. nomius is morphologically similar to A. flavus but produces series B and G aflatoxins like A. parasiticus. To date, there have been only a few reports of isolation of A. nomius from food-related sources (21, 24); the significance of this species in aflatoxin contamination has yet to be determined. In many ways, A. flavus is morphologically similar to A. oryzae and A. parasiticus is morphologically similar to A. sojae. Differentiation of these species is based primarily on conidiophore structure, conidial size and ornamentation, and culture morphology (15, 23). On the basis of DNA complementarity data, Kurtzman et al. (17) proposed that A. parasiticus, A. oryzae, and A. sojae should be reduced to varietal status. Previously, a variety of methods have been used to classify the Aspergillus Section Flavi taxa which have commercial or public health significance; these methods include characterization of secondary metabolites (7), DNA complementarity (16, 17), restriction fragment length polymorphism (14, 18, 19), electrophoretic karyotypes (12), and isozyme profiles (6, 28). However, no single method can be used to classify these taxa. Recently, several aflatoxin pathway genes, including nor-1 (4), ver-1 (verA
MATERIALS AND METHODS Fungal strains. The isolates belonging to Aspergillus Section Flavi used in this study are listed in Table 1. Cultures were obtained from the U. S. Department of Agriculture Southern Regional Research Center collection (SRRC). Other fungal isolates used included Aspergillus niger SRRC 1158; A. nidulans SRRC 1079 (5 ATCC 32610), SRRC 273 (5 FGSC-4), and SRRC 329; Aspergillus fumigatus SRRC 43 and SRRC 2006; Aspergillus versicolor SRRC 108b, SRRC 109, and SRRC 111; Penicillium aurantiogriseum SRRC 2227 (5 ATCC 8507); Penicillium griseofulvum SRRC 2285 (5 ATCC 48928); and Chaetomium thielaviodeum SRRC 2094 (5 ATCC 46098). Some of the nonaflatoxigenic aspergilli, such as A. nidulans SRRC 273 and SRRC 1079 (2, 8), A. versicolor SRRC 108b and SRRC 109 (22), and C. thielaviodeum, produce sterigmatocystin, an intermediate in aflatoxin biosynthesis. Preparation of fungal genomic DNA. All fungal strains were grown in flasks containing 500 ml of 0.5% yeast extract–2% glucose medium for 48 to 72 h. Mycelia were collected on Miracloth (Calbiochem, La Jolla, Calif.), rinsed with deionized water, blotted dry, and quickly frozen in liquid nitrogen. The frozen mycelia were ground to fine powders in the presence of liquid nitrogen with a mortar and pestle. Each mycelial powder was resuspended in extraction buffer (400 mM NaCl, 40 mM EDTA, 100 mM Tris-HCl, 2% sodium dodecyl sulfate [pH 8.0]), and the preparation was incubated at 688C for 20 min. Mycelial debris was pelleted by centrifugation, and 1/16 volume of 8 M potassium acetate (pH 4.2) was added to the supernatant. The resulting mixture was extracted with phenol-chloroform (1:1, vol/vol) and then with chloroform prior to isopropanol precipitation. PCR. The oligonucleotide primers used in the PCR are shown in Table 2. The sequence numbers correspond to the numbers on the A. parasiticus aflR cDNA sequence. The primers were purchased from The Midland Certified Reagent Co., Midland, Tex. PCR were carried out with a DNA thermal cycler (Perkin Elmer Cetus, Norwalk, Conn.). Amplification was performed in 50-ml reaction
* Corresponding author. Mailing address: Southern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 1100 Robert E. Lee Boulevard, New Orleans, LA 70124. Phone: (504) 286-4388. Fax: (504) 286-4419. 40
SEQUENCE VARIABILITY IN HOMOLOGS OF aflR
VOL. 61, 1995
41
TABLE 1. Aspergillus Section Flavi isolates used in this study Strain
A. A. A. A. A. A. A. A. A. A. A. A. A. A. A. A.
Other designation(s)
oryzae SRRC 304 oryzae SRRC 2044 oryzae SRRC 2103 oryzae SRRC 2104 oryzae SRRC 2353 flavus NRRL 3357 flavus #70 parasiticus SRRC 143 parasiticus SRRC 2043 sojae SRRC 1123 sojae SRRC 1126 sojae SRRC 299 tamarii SRRC 99 tamarii SRRC 1088 nomius SRRC 362 nomius SRRC 375
ATCC 12892, NRRL 1808 FRR 2874 ATCC 10196 MRC196 ATCC 20386 ATCC ATCC ATCC ATCC ATCC ATCC
56775, NRRL 5862, SU-1 62882, CP-461 20245, IFO 4200 42251, IAM 2669 9362, A. oryzae NRRL 1988 16865, NRRL 429
NRRL 5919 ATCC 15546, NRRL 13137
mixtures containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, each deoxynucleoside triphosphate at a concentration of 200 nM, 100 pmol of each primer, and 1.25 U of AmpliTaq DNA polymerase. Approximately 0.2 mg of genomic DNA was used in each PCR. PCR mixtures were heated at 948C for 2 min and then subjected to 30 cycles consisting of denaturation at 948C for 10 s, annealing at 608C for 30 s, and extension at 728C for 1 min. A final 5-min extension step at 728C was also included. A 7-ml portion of each PCR product was electrophoresed on 1.2 or 1.5% agarose (Bio-Rad, Richmond, Calif.) in 13 Tris-borate-EDTA buffer. The PCR products were visualized with UV light after the gels were stained with ethidium bromide (0.5 mg/ml) for 20 min. DNA sequencing. The PCR products generated with primers F0 and R0 (Table 2) were directly cloned without further purification with a TA cloning kit (Invitrogen Corp., San Diego, Calif.). Dideoxy sequencing (25) was performed from both directions with a sequencing kit (U. S. Biochemical, Cleveland, Ohio). Nucleotide sequence accession number. The GenBank accession number of the A. parasiticus aflR cDNA sequence is L26222.
Source
Moldy bran, United States Maize, New Zealand Pine panel, Virginia Casava, Mozambique Soy sauce, Japan Moldy peanut, United States Cotton seed, Arizona Peanut, Uganda Peanut, Georgia Koji (?), Japan Koji, Japan Soy sauce, People’s Republic of China Soy sauce, People’s Republic of China Cotton seed, Tennessee Moldy wheat, United States Diseased alkali bee, Wyoming
PCR products (Fig. 1 and Table 3). These results suggest that if counterparts of aflR are present in these organisms, the sequences that encode the DNA-binding domain exhibit low levels of similarity to the sequence that encodes aflR. To further investigate genomic DNA similarity among the members of Aspergillus Section Flavi, we synthesized three other pairs of primers, F2 and R2, F3 and R3, and F4 and R4 (Table 2), whose PCR products encompassed the majority of the aflR
RESULTS AND DISCUSSION Presence of aflR homologs as determined by PCR amplification. To determine if homologs of the DNA-binding domain of the A. parasiticus aflR gene were present in Aspergillus Section Flavi isolates and other isolates, we used primers F1 and R1 (Table 2) to amplify genomic DNAs from the fungal species listed in Table 1. PCR products were obtained only when we used the taxonomically related species A. oryzae, A. sojae, A. flavus, and A. parasiticus. Isolates which have been reported to produce sterigmatocystin, an intermediate that is present during aflatoxin biosynthesis, including A. nidulans SRRC 273 and SRRC 1079, A. versicolor SRRC 108b and SRRC 109, and C. thielaviodeum, and some A. oryzae isolates did not generate
TABLE 2. A. parasiticus aflR primers used in PCR a
Primer
Sequence
Positionsb
F0 F1 F2 F3 F4
59-ACGCAGGTGCTAAAGATC-39 59-TCGGTACGTAAACAAGGAAC-39 59-CCGATTTCTTGGCTGAGT-39 59-GGATTGTGTGGATGAGGA-39 59-TATCGATTACCTGCATCGAG-39
2287 to 2325 2206 to 2195 581 to 598 1083 to 1100 1310 to 1329
R0 R1 R2 R3 R4
59-GGACTCTGGTGAGAAAG-39 59-TCTGATGGTCGCCGAGTTGA-39 59-TCCTCATCCACACAATCC-39 59-ACCATGACAAAGACGGATCC-39 59-CTCTTCACCCTGCTTCTTGT-39
452 to 435 245 to 226 1100 to 1083 1527 to 1508 1719 to 1700
a Primers F0 through F4 are forward primers, and primers R0 through R4 are reverse primers. b Numbers correspond to numbers in the A. parasiticus aflR cDNA sequence.
FIG. 1. PCR amplification of genomic DNAs from fungal strains. The primers used were F1 and R1, which generated 450-bp PCR products when A. parasiticus genomic DNA was used. Lane M, fX174 replicative-form HaeIII fragments; lane 1, A. niger SRRC 1158; lane 2, A. nidulans SRRC 273; lane 3, A. nidulans SRRC 1079; lane 4, A. sojae SRRC 1123; lane 5, A. sojae SRRC 1126; lane 6, A. oryzae SRRC 2353; lane 7, A. oryzae SRRC 2104; lane 8, A. flavus #70; lane 9, A. parasiticus SRRC 143; lane 10, A. tamarii SRRC 99; lane 11, A. tamarii SRRC 1088; lane 12, A. versicolor SRRC 108b; lane 13, A. versicolor SRRC 109; lane 14, C. thielaviodeum SRRC 2094.
42
CHANG ET AL.
APPL. ENVIRON. MICROBIOL.
TABLE 3. PCR profiles of Aspergillus strains obtained with four pairs of primers PCR profiles obtained with: Strain
A. A. A. A. A. A. A. A. A.
tamarii SRRC 99 tamarii SRRC 1088 oryzae SRRC 2103 oryzae SRRC 2104 oryzae SRRC 2353 sojae SRRC 1123 nomius SRRC 362 nomius SRRC 375 parasiticus SRRC 143
Primers F1 Primers F2 Primers F3 Primers F4 and R2 and R3 and R4 and R1a
2b 2 2 2 111 111 2 2 111
1 1 1 1 111 2 2 1 111
2 2 2 2 111c 111 1 2 111
1 1 1 1 111c 111 1 1 111
a See Table 2 for sequences of forward primers F1 through F4 and reverse primers R1 through R4. b 2, no PCR products were obtained; 1, low levels of PCR products were obtained; 111, high levels of PCR products were obtained, as determined by agarose gel electrophoresis. c Slightly larger PCR products were obtained.
cDNA. The DNA segments from which the primers (including primers F1 and R1) were derived represented about 4% of the aflR cDNA sequence. The PCR products generated with these primers were in an aflR coding region (primers F2 and R2), a coding and 39 untranslated region (primers F3 and R3), and a 39 untranslated region (primers F4 and R4). PCR products were obtained with A. flavus and A. parasiticus isolates. Some discrepancies, however, were found with other members of Aspergillus Section Flavi (Table 3). Generally speaking, one of the reasons why no PCR products were generated is that the level of similarity between the primers and the target DNA probably was too low to allow annealing under the PCR amplification conditions used. Another possible explanation is that there may have been mismatches at the 39 end between the primers and the target DNA, which resulted in a failure to extend. On the other hand, low levels of PCR products indicated that there was a low level of similarity between the primers and the target DNA, which resulted in less efficient annealing and extension. The PCR profiles obtained with several pairs of primers usually provide a better representation of the overall level of sequence similarity. On the basis of our PCR profiles, it seemed that A. oryzae SRRC 2103 and SRRC 2104 exhibited low levels of DNA similarity to A. parasiticus. A. tamarii SRRC 99 and SRRC 1088 also seemed to exhibit low levels of DNA similarity to A. parasiticus, because we obtained PCR products that were the same size but the quantities of these products were lower. In A. sojae SRRC 1123, either a sequence alteration occurred around primer F2 or a mismatched nucleotide was present in the position corresponding to the 39 end of primer R3, since no PCR products were obtained with primers F2 and R2 but PCR products were obtained with primers F3 and R3 (R2 differs from F3 only in orientation [Table 2]). The PCR products obtained with primers F3 and R3 and primers F4 and R4 from A. oryzae SRRC 2353 were slightly larger, suggesting that an insertion occurred in the region between F4 and R3 (between positions 1329 and 1508). Low level of DNA similarity between A. nomius and A. parasiticus. The PCR profile of A. nomius SRRC 375 was similar to the PCR profiles of A. tamarii SRRC 99 and SRRC 1088 and A. oryzae SRRC 2103 and SRRC 2104 but was different from the PCR profile of A. parasiticus; only low levels of PCR products were generated with primers F2 and R2 and primers F4 and R4 (Table 3). A. nomius SRRC 362 and SRRC 375 did not
FIG. 2. Comparison of nucleotide sequences containing the 59 untranslated region and the zinc finger domain region of aflR and its homologs. The nucleotide at position 1 is the first nucleotide in the initiation codon (ATG) of wild-type aflatoxigenic strain A. parasiticus SRRC 143 aflR cDNA. The dots indicate identical nucleotides. Nucleotide substitutions are indicated by letters; an X indicates a deletion. The subscript A at position 260 in A. flavus #70 (5) indicates that an extra nucleotide (insertion) is present. Only parts of the DNAs sequenced are shown (positions 2132 to 102). The rest of the zinc finger domain and its downstream region, which have identical sequences in all of the strains, are not shown (the zinc finger domain is from position 85 to position 168).
produce the same PCR products when primers F2 and R2 and primers F3 and R3 were used. Our results suggest that these organisms had sequence variations in one or more regions corresponding to the positions of A. parasiticus primers F2, R2 (F3), and R3. The A. nomius SRRC 362 F3-to-R3 region was cloned and sequenced to examine sequence variability in A. nomius and A. parasiticus. Part of the nucleotide sequence of this region exhibited 75 to 85% identity with the corresponding region in A. parasiticus aflR. We also found two stretches, which were 45 and 65 nucleotides long, that apparently were not similar at all. The sequence of primer F4 used in the PCR was TATCGATTACCTGCATCGAG, but the corresponding sequence of A. nomius SRRC 362 was TATTAATTCCCTG CAGCAAG, which had five mismatches. Nevertheless, low levels of PCR products were obtained when primers F4 and R4 were used. This finding suggests that failures in some of the PCR amplification experiments might have been due in part to levels of similarity between the primers and the target DNA of less than 75%. The sequence data seem to substantiate the reports of low levels of DNA relatedness (39 to 47%) between A. parasiticus and A. nomius and between A. sojae and A. nomius, as predicted by the results of DNA complementarity experiments (16). Studies in which mitochondrial DNA and nuclear DNA restriction fragment length polymorphism were used (18, 19) also showed that A. flavus, A. parasiticus, and A. nomius are three distinct taxa. The high level of sequence variability raises questions concerning the origin of aflR and the mechanism of regulation of aflatoxin biosynthesis in A. nomius. Existence of GAL4 type zinc finger motifs in A. oryzae and A. sojae genomic DNAs. The PCR products obtained from A. oryzae, A. sojae, A. flavus, and A. parasiticus with primers F0 and R0 were cloned and sequenced to determine if there were discernible differences in the regions encoding the putative zinc finger DNA-binding domain. Around 400 bp were sequenced for each isolate. A comparison of the nucleotide sequences showed that they exhibited extremely high levels of homology (approximately 98 to 100%) (Fig. 2). A region which was translated into the Cys-2-Cys-6-Cys-6-Cys-2-Cys-6-Cys GAL4 binuclear type of zinc finger motif (11) was identified in all of the strains whose sequences were determined (see below). The specific transition (C 3 T or T 3 C) at position 102 did not change the predicted amino acid residue, serine. Therefore, the putative zinc finger motifs of the A. oryzae and A. sojae isolates which we studied had exactly the same amino acid sequence, CTSCASSKVRCTKEKPACARCIERGLAC, that has been found in A. parasiticus and A. flavus.
SEQUENCE VARIABILITY IN HOMOLOGS OF aflR
VOL. 61, 1995
Characteristic fingerprints in A. oryzae and A. flavus and in A. parasiticus and A. sojae. On the genomic DNAs sequenced, highly conserved base changes and deletions were found between positions 2115 and 102 (Fig. 2) in the 59 untranslated and zinc finger region of aflR and its homologs; few random base substitutions were found. Highly specific base variations, including two transitions (at positions 2115 and 102), three transversions (at positions 289, 272, and 261), and a deletion (at position 243), were identified (Fig. 2). The two distinct patterns constituted characteristic fingerprints (T-G-A-A-X-C and C-C-C-C-C-T), and these fingerprints differentiated A. flavus and A. oryzae from A. parasiticus and A. sojae. In a recent study, Woloshuk et al. (27) showed that the Southern hybridization patterns of the aflR genes of A. parasiticus SU-1 (5 SRRC 143), A. parasiticus NRRL 2999, A. sojae NRRL 5594, and A. oryzae NRRL 3483 are identical but are different from the A. flavus NRRL 3357 pattern. The distinct fingerprints obtained in this study can be used to better classify these taxa. Moreover, the presence of the characteristic T residue in the three A. oryzae strains and the presence of a C residue in the two A. flavus strains at position 290 further distinguished these two species. A. oryzae SRRC 2353 has micromorphological characteristics like those of A. flavus, but its macromorphological characteristics are similar to those of A. oryzae. These observations indicate that this isolate would best be placed in A. flavus. A sequence comparison, however, revealed that strain SRRC 2353 had the same fingerprint as A. oryzae SRRC 304 and SRRC 2044. The fact that little or no PCR product was obtained from A. oryzae SRRC 2103 or SRRC 2104, along with the observations described above, indicates that there is some genetic variability within A. oryzae. The presence of G or A at position 2132 also distinguished A. parasiticus from A. sojae strains. It is worth noting that A. sojae SRRC 299 (5 ATCC 9362) was originally identified as A. oryzae. The distinct fingerprint of this organism, A-C-C-C-C-C-C-T, clearly indicates that it is an A. sojae strain. Kurtzman et al. (17) have proposed that A. oryzae, A. flavus, A. parasiticus, and A. sojae represent morphological and physiological variants of a single species. The results of a nucleotide sequence comparison indicate that these four taxa are closely related. Nevertheless, the fingerprints obtained in this study should be useful in correctly identifying these four closely related aspergilli for practical purposes. ACKNOWLEDGMENT We greatly appreciate the excellent technical assistance of Les Scharfenstein.
7.
8.
9.
10. 11. 12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25. 26.
REFERENCES 1. Berka, R. M., N. Dunn-Coleman, and M. Ward. 1992. Industrial enzymes from Aspergillus species, p. 155–195. In J. W. Bennett and M. A. Klich (ed.), Aspergillus—biology and industrial applications. Butterworth-Heinemann, Stoneham, Mass. 2. Branch, K. R., J. W. Bennett, and D. Bhatnagar. 1993. Sterigmatocystin production by Aspergillus nidulans. Fungal Genet. Newsl. 40:20–21. 3. Chang, P.-K., J. W. Cary, D. Bhatnagar, T. E. Cleveland, J. W. Bennett, J. E. Linz, C. P. Woloshuk, and G. A. Payne. 1993. Cloning of the Aspergillus parasiticus apa-2 gene associated with the regulation of aflatoxin biosynthesis. Appl. Environ. Microbiol. 59:3273–3279. 4. Chang, P.-K., C. D. Skory, and J. E. Linz. 1992. Cloning of a gene associated with aflatoxin B1 biosynthesis in Aspergillus parasiticus. Curr. Genet. 21:231– 233. 5. Cotty, P. 1989. Virulence and cultural characteristics of two Aspergillus flavus strains pathogenic on cotton. Phytopathology 79:808–814. 6. Cruickshank, R. H., and J. I. Pitt. 1990. Isoenzyme patterns in Aspergillus
27.
28.
29.
30.
43
flavus and closely related species, p. 259–267. In R. A. Samson and J. I. Pitt (ed.), Modern concepts in Penicillium and Aspergillus classification. Plenum Press, New York. Dorner, J. W., R. J. Cole, and U. L. Diener. 1984. The relationship of Aspergillus flavus and Aspergillus parasiticus with reference to production of aflatoxins and cyclopiazonic acid. Mycopathologia 87:13–15. Hajjar, J. D., J. W. Bennett, D. Bhatnagar, and R. Bahu. 1989. Sterigmatocystin production by laboratory strains of Aspergillus nidulans. Mycol. Res. 94:548–551. Hara, S., K. Kitamoto, and K. Gomi. 1992. New developments in fermented beverages and foods with Aspergillus, p. 133–154. In J. W. Bennett and M. A. Klich (ed.), Aspergillus—biology and industrial applications. ButterworthHeinemann, Stoneham, Mass. Jelinek, C. F., A. E. Pohland, and G. E. Wood. 1989. Review of mycotoxins in food and feeds—an update. J. Assoc. Off. Anal. Chem. 72:223–230. Johnston, M. 1987. A model fungal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbiol. Rev. 51:458–476. Keller, N. P., T. E. Cleveland, and D. Bhatnagar. 1992. Variable electrophoretic karyotypes of members of Aspergillus section Flavi. Curr. Genet. 21: 371–375. Keller, N. P., N. J. Kantz, and T. H. Adams. 1994. Aspergillus nidulans verA is required for production of the mycotoxin sterigmatocystin. Appl. Environ. Microbiol. 60:1444–1450. Klich, M. A., and E. J. Mullaney. 1987. DNA restriction enzyme fragment polymorphism as a tool for rapid differentiation of Aspergillus flavus from Aspergillus oryzae. Exp. Mycol. 11:170–175. Klich, M. A., and J. I. Pitt. 1988. Differentiation of Aspergillus flavus from Aspergillus parasiticus and other closely related species. Trans. Br. Mycol. Soc. 91:99–108. Kurtzman, C. P., B. W. Horn, and C. W. Hesseltine. 1987. Aspergillus nomius, a new aflatoxin-producing species related to Aspergillus flavus and Aspergillus tamarii. Antonie Leeuwenhoek J. Microbiol. 53:147–158. Kurtzman, C. P., M. J. Smiley, C. J. Robert, and D. T. Wicklow. 1986. DNA relatedness among wild and domesticated species in the Aspergillus flavus group. Mycologia 78:955–959. Moody, S. F., and B. M. Tyler. 1990. Restriction enzyme analysis of mitochondrial DNA of the Aspergillus flavus group: A. flavus, A. parasiticus, and A. nomius. Appl. Environ. Microbiol. 56:2441–2452. Moody, S. F., and B. M. Tyler. 1990. Use of nuclear DNA restriction fragment length polymorphism to analyze the diversity of the Aspergillus flavus group: A. flavus, A. parasiticus, and A. nomius. Appl. Environ. Microbiol. 56: 2453–2461. Payne, G. A., G. J. Nystorm, D. Bhatnagar, T. E. Cleveland, and C. P. Woloshuk. 1993. Cloning of the afl-2 gene involved in aflatoxin biosynthesis from Aspergillus flavus. Appl. Environ. Microbiol. 59:156–162. Pitt, J. I., A. D. Hocking, K. Bhudhasamai, B. F. Miscamble, and K. A. Wheeler. 1993. The normal mycoflora of commodities from Thailand. I. Nuts and oilseeds. Int. J. Food Microbiol. 20:211–226. Rabie, C. J., A. Lubben, and M. Stery. 1976. Production of sterigmatocystin by Aspergillus versicolor and Bipolaris sorokiniana on semisynthetic liquid and solid media. Appl. Environ. Microbiol. 32:206–208. Raper, K. B., and D. I. Fennell. 1965. Aspergillus flavus group, p. 357–404. In K. B. Raper and D. I. Fennell (ed.), The genus Aspergillus. The Williams and Wikins Co., Baltimore. Saito, M., O. Tsuruta, P. Siriacha, S. Kawasugi, and M. Manabe. 1989. Atypical strains of Aspergillus flavus isolated in maize fields. Jpn. Agric. Res. Q. 23:151–154. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467. Skory, C. D., P.-K. Chang, J. W. Cary, and J. E. Linz. 1992. Isolation and characterization of a gene from Aspergillus parasiticus associated with the conversion of versicolorin A to sterigmatocystin in aflatoxin biosynthesis. Appl. Environ. Microbiol. 58:3527–3537. Woloshuk, C. P., K. R. Foutz, J. F. Brewer, D. Bhatnagar, T. E. Cleveland, and G. A. Payne. 1994. Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Appl. Environ. Microbiol. 60:2408–2414. Yamatoya, T., J. Sugiyama, and H. Kuraishi. 1990. Electrophoretic comparison of enzymes as a chemotaxonomic aid among Aspergillus taxa: (2) Aspergillus section Flavi, p. 395–405. In R. A. Samson and J. I. Pitt (ed.), Modern concepts in Penicillium and Aspergillus classification. Plenum Press, New York. Yu, J., J. W. Cary, D. Bhatnagar, T. E. Cleveland, N. P. Keller, and F. S. Chu. 1993. Cloning and characterization of a cDNA from Aspergillus parasiticus encoding an O-methyltransferase involved in aflatoxin biosynthesis. Appl. Environ. Microbiol. 59:3564–3571. Yu, J., P.-K. Chang, D. Bhatnagar, and T. E. Cleveland. Submitted for publication.
