Environmental Biology of Fishes 68: 261–267, 2003. © 2003 Kluwer Academic Publishers. Printed in the Netherlands.
Silver carp, Hypophthalmichthys molitrix, in the Poyang Lake belong to the Ganjiang River population rather than the Changjiang River population Zhongwei Wang, Qingjiang Wu, Jianfeng Zhou, Yuzhen Ye & Jingou Tong State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, People’s Republic of China (e-mail:
[email protected]) Received 20 June 2002
Accepted 29 July 2003
Key words: mitochondrial DNA, RFLP Synopsis The Poyang Lake is the largest lake and the main nursery area in the middle basin of the Changjiang (Yangtze) River. We compared molecular genetic markers of silver carp among populations of the Changjiang River, the Ganjiang River and the Poyang Lake using the ND5/6 region of mtDNA. Analysis of restriction fragment length polymorphisms (RFLPs) of this region revealed distinct variation between the Ganjiang River and the Changjiang River populations. The Poyang Lake is linked with the Ganjiang River and the Changjiang River. Shared RFLP fragments between the Ganjiang River population and the Poyang Lake population are as high as 61.4%. The value is 47.74% between the populations of the Changjiang River and that of the Poyang Lake. Frequencies of bands peculiar to the Ganjiang River population are the same as in the Poyang Lake population. We conclude that the Poyang Lake silver carp population consists mainly of the Ganjiang River population. The water level of the Poyang Lake outlet, which is higher than that of the Changjiang River in the silver carp spawning season, supports this conclusion. Introduction The main tributary of the middle Changjiang River links with several subsidiary streams and lakes. This river–lake ecosystem has the appearance of a long main stem of a melon with branch stems holding large, middle and small melons. These lakes act as flood controllers and are major feeding grounds for fishes. The Poyang Lake is the largest lake and is a main nursery ground in the middle basin of the Changjiang River. The Ganjiang River runs into its upper part, and a narrow outlet at its lower part links with the Changjiang River (Figure 1). The spawning ground of Chinese main cultured carps, silver carp, Hypophthalmichthys molitrix, big-head carp, Aristichthys nobilis, grass carp, Ctenopharyngodon idella, and black carp, Myopharyngodon piceus, are distributed not only in main stream but also in its tributary streams, such as the Hanjiang River, the Xiangjiang River and
the Ganjiang River (Yi et al. 1988, Liu & He 1992). It is important to know the difference in genetic structure between the Ganjiang and the Changjiang Rivers, and the population structure and source of silver carp in the Poyang Lake. Fish ecologists and fishery scientists have long been concerned with intraspecific genetic differentiation. Previous studies on enzymatic variation revealed no significant differences in genetic variation among local populations of silver carp in the stem stream of the Changjiang River (Li et al. 1990, Zhao & Li 1995). The establishment of the polymerase chain reaction (PCR) technique threw new light on studies of the genetic composition of populations. In particular, AMP-restriction fragment length polymorphism (RFLP) analysis of genetic polymorphism of mitochondrial DNA in aquatic animals has been used to great advantage in genetic composition analyses (Whitmore 1992, Chow et al. 1993, Cronin et al. 1993). Compared to allozymes, mtDNA analysis in silver carp
262
Figure 1. Map of the Poyang Lake showing the connection with the Changjiang River and the Ganjiang River and the sampling sites.
of the Changjiang River has provided a better resolution of fish population structure. Those results have revealed that juvenile silver carp from different sampling locations in the Changjiang River belong to genetically distinct populations (Lu et al. 1997). The Poyang Lake, into which the Ganjiang River drains, is believed to be a main nursery area. However, it is still not clear which local population of silver carp, the Ganjiang River population or the Changjiang River midstream population, contributes most to the Poyang Lake population. In this paper, we compare RFLP of the mitochondrial DNA ND5/6 region of silver carp in the Changjiang River, the Ganjiang River and the Poyang Lake populations.
Materials and methods
Isolation of total DNA About 0.5 g of preserved fin was washed in STE (10 mmol/l Tris–HCl, 1 mol/l EDTA, pH 8.0), clipped into small pieces, and 1 ml cell lysis solution was added. Proteinase K was added to a final solution of concentration in 100 mg/ml, then bathed in 55◦ C water for 4–6 h. After that, DNA was isolated according to the routine phenol–chloroform extraction method. PCR amplified and restriction endonuclease digestion Regions amplified covered the mtDNA ND5/6 gene. A pair of primers (Park et al. 1993) was used and their sequences are as follows: ND5G: CAACGGTGGTTCTTCAAGTC
Fish samples We sampled wild populations of silver carp from the Jianli County and the Shishou City river sections of the Changjiang River midstream, the Ganjiang River near Nanchang City and the Poyang Lake nearby Hukou County, respectively (Figure 1). We collected at least 20 fish from each sample site. Fin tissues of the live fish were immediately soaked in 95% ethanol, then stored at −20◦ C.
ND6L: GGAACCAAAAACTCTTGGTGCAACTCC The PCR was performed in a total reaction volume of 25 µl, including 2.5 µl 10 × reaction buffer, l µl dNTP (10 mmol/l), 1 µl primer each (5 µmol/l), 0.5 µl of Taq DNA (2 U/µl), 19 µl H2 O and 1 µl total DNA (100 ng). After pre-denaturation at 94◦ C for 5 min, samples were processed through 40 cycles consisting of denaturation at 94◦ C for 30 s, annealing at 48◦ C for 30 s and extension at 72◦ C for 2.5 min. The final extension at
263 72◦ C was performed for 10 min. The region of mtDNA ND5/6 was digested by 12 restriction endonuclease. They were Hha I, Alu I, Dde I, Msp I, Rsa I, Hinf I, Hae III, Bge II, EcoR I, Hind III, Hpa II and Nci I. We followed the digestion conditions recommended by the manufacture. The digested products were analyzed with 1.4% agarose gel electrophoresis and stained with ethidium bromide. Data alignment and phylogenetic analysis The bands were analyzed and 1, 0 stand for existence and absence of bands, respectively (Hillis et al. 1996). The sizes of the digestion fragments were calculated. Genetic distances (Nei & Li 1979) among the samples were estimated with the REAP software package (McElroy et al. 1992). The UPGMA phylogram was constructed according to the mean genetic distances of three populations with the Mega version 2.1 (Kumar et al. 2001). The hierarchical partition of genetic variation among and within the three populations of silver carp was tested by AMOVA software (Analysis of Molecular Variation, version 1.55) (Excoffier et al. 1992) and the statistics significance was tested with 9 999 permutations.
Results Amplification of mtDNA ND5–ND6 region and its RFLP A 2.6-kb fragment was amplified by means of ND5/6 primer in all samples from three local silver carp populations. The mtDNA ND5-ND6 fragment from each sample was digested with 12 restriction endonucleases, respectively. Bge II, EcoR I, Hind III, Hpa II and Nci did not cleave the mtDNA fragment. Hha I, Alu I, Dde I, Msp I, Rsa I, Hinf I, Hae III all had more than two cleavage sites and showed polymorphisms among three local populations. The sizes of the digested fragment and the digestion patterns were shown in Table 1. The sums of the fragment size were less than 2.6 kb in some individuals, which may result from the unseparated bands with the same molecular weight or unseen little bands. Hha I produced four cleavage sites and two digestion patterns A and B, among three local populations. Alu I had eight cleavage sites and two digestion patterns A and B. Dde I also produced 10 cleavage sites but three
digestion patterns in three local populations. Msp I had nine cleavage sites and four digestion patterns. Hinf I and Rsa I produced 10 cleavage sites and four digestion patterns in three local populations, respectively. Hae III produced 12 cleavage sites and five digestion patterns. A total of 57 bands were recorded among three local populations after ND5/6 fragments were digested. As shown in Table 1, among the three local populations the Ganjiang River population with 46 bands displayed the highest genetic variation, while the Changjiang River population with 27 bands showed low level of genetic variation. The Ganjiang River population and the Poyang Lake population shared 35 bands taking 61.4% of all observed bands. The shared bands between the Poyang Lake and the Changjiang River populations were 27, taking 47.36% of all observed bands. Bands peculiar to the Ganjiang River population In the comparison of digestion patterns among three local populations some bands peculiar to the Ganjiang River population were found. These bands never appear in the Changjiang River population but are found only in the Poyang Lake population. For example, bands of Hae III-0.55, Hinf I-1.35, Hinf I-0.13, Msp I-1.19, Msp I-0.15 and Dde I-0.30 peculiar to the Ganjiang River population were found in individuals from the Ganjiang River and the Poyang Lake. Moreover, frequencies of some bands were almost the same in the two populations, but these bands had never been found in the Changjiang River population (Table 2 and Figure 2). Genetic distance and genetic variation analysis Mean genetic distance is 0.021 between the Poyang Lake population and the Ganjiang River population, 0.026 between the Poyang Lake population and the Changjiang River population and 0.032 between the Changjiang River population and the Ganjiang River population (Table 3). The phylogenetic tree (Figure 3) showed that the Ganjiang River and the Poyang Lake populations were in the same cluster. The results of variance analysis and statistics tests are shown in Tables 3 and 4, and PhiST between pairs of populations from AMOVA tests is shown in Table 5.
A B C D E
A B C D
A B C D
A B C D
A B C
A B
A B
Haplotypes
+
+ + 1.0
1.35
2.25
1.31 +
1.15 + +
+ 0.93 +
1.75
+
+ 0.81
0.8 + +
+
1.90
+
+ 1.19
+ 0.90
0.70
1.45 +
Band sizes
0.68 + + + + +
0.60 +
1.06 + + + + 1.45
+ 0.84 +
0.60
0.90 +
+
+
0.55
+
0.56
+ 1.34 +
+ 0.82
0.60
+ 0.55 +
0.60
+
0.50
0.52 + + +
0.56 + +
+
+ + 0.52
0.53
0.50 +
+ and blanks stand for existence and absence of band, respectively.
Hae III
Hinf I
Rsa I
Msp I
Dde I
Alu I
Hha I
Enzymes
+ 0.42 +
0.40
+ 0.48 +
0.40
+ 0.42 + +
0.45
0.38 + + + + +
0.34 + +
0.28
+
+ + 0.28
0.35 + + 0.35
+
0.35
0.26 + +
0.22
+
0.15 + + 0.11 + + + 0.25
Table 1. Sizes of restriction segments for ND5/6 and haplotype frequencies of silver carp.
+
0.30
+
0.13
0.15
+ +
0.15
+
0.28
+
0.10
0.1
+
0.26 +
0.22 + + +
0.18 + + +
0.13
0.87
1
0.80 0.20
0.93 0.07
1
1
1
Changjiang River (n = 30)
0.166
0.50 0.166 0.166
0.66 0.17 0.17
0.17
0.66 0.17
0.17
0.5 0.33
0.667 0.066 0.166
0.83 0.17
0.83 0.17
Ganjiang River (n = 24)
0.50 0.166 0.166 0.166
0.17
0.66 0.17
0.66 0.17 0.17
0.5 0.33 0.17
0.67 0.33
1
1
Poyang Lake (n = 24)
264
265 Discussion
genetic differences between populations will evolve in the course of time if there is little or no gene flow between them. However, whether spawners of different spawning grounds have significant genetic differences is doubtful since there is not any physical barrier to prevent gene flow between populations of silver carp which live in the mainstream of the Changjiang River. However, the spawning grounds of silver carp are distributed in tributaries of the Changjiang River, such as the Xiangjiang River, the Hanjiang River, the Ganjiang River and Huaihe River (Liu & He 1992). Analysis of three mtDNA fragments (ND5/6, D-loop and cytb) indicated that juvenile silver carp from three sampling sites, Swan Oxbow at midstream, Ruichang County located mid-downstream and Wuhu at downstream of the Changjiang River belonged to genetically distinct populations (Lu 1997). The significant genetic differences between samples from Wuhu City, downstream, and Ruichang County and Swan Oxbow, midstream, may be a consequence of the samples from the section of Wuhu City being composed of a mixture of populations from the Hanjiang River and the Ganjiang River. Our samples were taken from Shishou City and Jianli
According to results of the spawning ground survey of the four main Chinese culture carp in the Changjiang River from Yichang City to Pengze County of Anhui Province, 25 spawning grounds of silver carp were detected in the main stream of the Changjiang River (Yi et al. 1988). These 25 spawning grounds were scattered over a stretch of 900 km. The closest distance between two spawning grounds is 3 km. According to Chakraborty & Leimar (1987) and Slatkin (1973), Table 2. Comparisons of frequencies among three local populations. Fragment
Ganjiang River
Poyang Lake
Changjiang River
Hae III-0.55 Hinf I-1.35 Hinf I-0.13 Msp I-1.19 Msp I-0.15 Dde I-0.30
0.332 0.17 0.17 0.33 0.83 0.332
0.166 0.17 0.17 0.33 0.51 0.33
0.00 0.00 0.00 0.07 0.07 0.00
M
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
Figure 2. Digestion pattern of silver carp by Msp I. 1–6, the Changjiang River population; 7–12, the Ganjiang River population; 13–18, the Poyang Lake population. Table 3. Analysis of variance of silver carp by AMOVA (Excoffier et al. 1992) with 9 999 permutations. Variance component
Variance
% total
Measures
P-value
Among groups Variance among populations within groups Within populations
0.475 0.341
8.50 6.10
PHiCT = 0.085 PHiSC = 0.067
