Simian Immunodeficiency Virus SIVmac239 ... - Journal of Virology

JOURNAL OF VIROLOGY, Jan. 2007, p. 349–361 0022-538X/07/$08.00⫹0 doi:10.1128/JVI.01841-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Vol. 81, No. 1

Simian Immunodeficiency Virus SIVmac239 Infection of Major Histocompatibility Complex-Identical Cynomolgus Macaques from Mauritius䌤 Roger W. Wiseman,1† Jason A. Wojcechowskyj,1† Justin M. Greene,1 Alex J. Blasky,1 Tobias Gopon,1 Taeko Soma,1 Thomas C. Friedrich,1 Shelby L. O’Connor,2 and David H. O’Connor1,2* Wisconsin National Primate Research Center, University of Wisconsin—Madison, Madison, Wisconsin 53706,1 and Department of Pathology and Laboratory Medicine, University of Wisconsin—Madison, Madison, Wisconsin 537062 Received 23 August 2006/Accepted 2 October 2006

Nonhuman primates are widely used to study correlates of protective immunity in AIDS research. Successful cellular immune responses have been difficult to identify because heterogeneity within macaque major histocompatibility complex (MHC) genes results in quantitative and qualitative differences in immune responses. Here we use microsatellite analysis to show that simian immunodeficiency virus (SIV)-susceptible cynomolgus macaques (Macaca fascicularis) from the Indian Ocean island of Mauritius have extremely simple MHC genetics, with six common haplotypes accounting for two-thirds of the MHC haplotypes in feral animals. Remarkably, 39% of Mauritian cynomolgus macaques carry at least one complete copy of the most frequent MHC haplotype, and 8% of these animals are homozygous. In stark contrast, entire MHC haplotypes are rarely conserved in unrelated Indian rhesus macaques. After intrarectal infection with highly pathogenic SIVmac239 virus, a pair of MHC-identical Mauritian cynomolgus macaques mounted concordant cellular immune responses comparable to those previously reported for a pair of monozygotic twins infected with the same strain of human immunodeficiency virus. Our identification of relatively abundant SIV-susceptible, MHC-identical macaques will facilitate research into protective cellular immunity. to study the influence of the entire gene-dense MHC region on SIV pathogenesis in unrelated rhesus macaques. We became interested in Mauritian cynomolgus macaques (MCM) as a model of SIV pathogenesis because of their unique natural history. Historical records suggest that European seafarers introduced cynomolgus macaques to the small Indian Ocean island of Mauritius within the last 500 years (36). Mitochondrial and Y chromosome DNA analyses indicate that the current MCM population of between 25,000 and 35,000 monkeys descended from a very small founder population that is most likely to have originated from Sumatra and has remained isolated for approximately 80 to 100 generations (22; A. J. Tosi and C. S. Coke, submitted for publication). In the contemporary Finnish human population, which descends from a limited number of ancestors within approximately the same number of generations as MCM, entire shared MHC haplotypes are common (17). Thus, we hypothesized that the unusual natural history of MCM might portend the presence of high-frequency MHC haplotypes (20). We discovered that six high-frequency haplotypes encompassing both the MHC class I and class II loci account for almost all MHC diversity in MCM. We also demonstrated broadly similar cellular immune responses in MHC-identical MCM infected with SIVmac239.

Nonhuman primates are important models for major human infectious diseases, including AIDS (6). As vaccine candidates increasingly focus on eliciting cell-mediated immunity against human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV), there is intense interest in the genes of the major histocompatibility complex (MHC) that define the specificity of the cellular immune response. In humans, the genetics of the MHC are well defined, with only a single polymorphic HLA-A, HLA-B, and HLA-C locus per chromosome. In contrast, MHC haplotypes in macaques contain a variable number of expressed polymorphic class I (7, 9, 21, 29, 39, 40) and class II (10, 12) loci. AIDS research has motivated study of MHC genetics in nonhuman primates, most notably in rhesus macaques of Indian origin. More than 130 MHC class I alleles and 160 MHC class II alleles as well as two genomic sequences of the MHC region from rhesus macaques are currently in GenBank. The large number of defined MHC alleles highlights the heterogeneity of these animals. Unfortunately for SIV research, this diversity generally limits investigators to MHC matching animals for single class I alleles, such as Mamu-A*01, rather than entire MHC haplotypes (6, 14). Shared MHC haplotypes, comprising MHC class IA and IB genes, MHC class II genes, and tightly linked genes involved in antigen processing and inflammation (16), have been identified only in rhesus macaques related by descent (31, 42). Therefore, it is exceedingly difficult

MATERIALS AND METHODS Animals and SIVmac239 challenge. Blood samples from feral MCM were purchased directly for genetic analyses (Charles River BRF, Houston, TX). Our initial microsatellite analysis focused on five MCM that were examined previously in an MHC class I allele discovery study (20). Subsequently, blood from another 112 feral MCM was obtained in two independent shipments from Charles River BRF for MHC class I genotyping. A pair of male MHC-identical MCM (CY0111 and CY0113) was selected based on microsatellite and reference strand conformation analysis. Both ani-

* Corresponding author. Mailing address: University of Wisconsin— Madison, 555 Science Drive, Madison, WI 53711. Phone: (608) 8900845. Fax: (608) 265-8084. E-mail: [email protected]. † R.W.W. and J.A.W. contributed equally to this study. 䌤 Published ahead of print on 11 October 2006. 349

350

WISEMAN ET AL.

J. VIROL.

TABLE 1. MHC microsatellite primers and multiplex PCR amplification conditionsa Locus

Forward primer

Reverse primer

Dye

Panel

Primer concn (␮M)

Source or reference

D6S2972 D6S2970b D6S2854b D6S2704b D6S2847b C4_2_25b D6S2691b 9268 MICA D6S2793b D6S2782 D6S2669 D6S2892b DRA-CA D6S2876 D6S2747 D6S2745b D6S2771b

AAATGTGAGAATAAAGGAGA TCCCATGGTCAAGTTCTCAG TCATGAGCGTGGCACTGCAC TTTTGCCACTCTGGAGGATGGG TATTGGACAGCACTGCTCTGG ATGTTAGTTTTAGAAGATAACACTC GTAGCTGTGGAAACAGTGTCCATG AGGCTGAGGCTGGAGAATG CCTTTTTTTCAGGGAAAGTGC CTACCTCCTTGCCAAACTTGCTATTTGT TTTACTTGCTCTCACTCTCAGGCC TGCCTTCCGTAAGCCTCAGTCT TGCATGTCCTGTGAGGTAAG TGGAATCTCATCAAGGTCAG GGTAAAATTCCTGACTGGCC AGGAATCTAGTGCTCTCTCC CCTAGAGATTCCTCCACATTA ATTCCTTTCACTAGTTCTGG

GATAAAGGGGAACTACTACA TCATGGATCTTATCAGCCTC CCGTATGTTGCAACCAGGAG GAGCATAATATCTGGTCTACTGC TGCCATTCAGATTGGTTTTTCTG TCTTCTGTGCAAGCAAGCACTGTAC CTTGACTTGAAACTCAGAGACC TCACGCATTCAGTTTGAACCTT CCTTACCATCTCCAGAAACTGC AATAGCCATGAGAAGCTATGTGGGGGA GGAAGACATTAACTTGTTAGCA TTAAGGACAGCAAAGCCAGCAGCA ACTCAACCCTGCTGTTGTAG ACATTTGTATGCTTCAGATG GACAGCTCTTCTTAACCTGC CTCTAGCAAAAGGAAGAGCC CCAATGTTTGATAGCAGACTGGGGT CCACTTTAAGAAATTAGAAAAG

FAM FAM HEX FAM FAM FAM TAMRA FAM TAMRA HEX HEX FAM FAM FAM FAM HEX HEX FAM

4 1 —c 2 —c 2 3 —c 2 5 5 5 3 4 1 3 1 —c

0.3 0.3 0.08 0.3 0.08 0.3 0.3 0.2 0.6 0.04 0.04 0.04 0.3 0.3 0.3 0.15 0.3 0.15

33 16 16 16 16 16 16 Novel 33 16 16 16 16 33 33 16 16 16

a Sequences of forward and reverse primers used for microsatellite analysis are given. Forward primers were labeled with the listed dyes, and multiplex panels were established by varying primer concentrations. HEX, 6-carboxy-2⬘, 4, 4⬘, 5⬘, 7, 7⬘-hexachlorofluorescein; TAMRA, 6-carboxytetramethylrhodamine. b Sequences of human microsatellite primers for these loci were modified to reflect rhesus macaque MHC genomic sequences. c Dashes indicate single-locus PCR amplification.

mals were challenged intrarectally with a single dose of 5 ⫻ 104 TCID50 (tissue culture dose sufficient to infect 50% of cells) of molecularly cloned SIVmac239 Nef open virus (19). SIV-infected animals were cared for according to the regulations and guidelines of the University of Wisconsin Institutional Animal Care and Use Committee. Microsatellite analysis. Multiplex PCR assays were developed for 18 microsatellite loci spanning the MHC region (Table 1). Four of these loci were adapted for cynomolgus macaques from a previous study with rhesus macaques (31). Additional microsatellites were identified by screening human MHC primer pairs (15) for specificity against the rhesus MHC genomic sequence (9) with BLASTn (2). Three human primer pairs were used directly, while another 10 microsatellite primer sequences were modified to reflect differences in the rhesus genomic MHC sequence. Finally, the 9268 locus was identified by searching for novel microsatellites in the rhesus genomic MHC sequence using ETANDEM (EMBOSS suite of software) (34), and primers were designed with Primer3 software (http://frodo.wi.mit.edu). Microsatellite PCRs were carried out with PTC-225 thermocyclers (MJ Research) as 10-␮l reactions containing 1⫻ Phusion master mix (New England BioLabs, Ipswich, MA), 10 ng genomic DNA, and 0.08 to 0.3 ␮M primers (Table 1). The following touchdown PCR program was used: 98°C for 30 s; 3 cycles of 98°C for 5 s, 64°C for 5 s, 72°C for 20 s; 3 cycles of 98°C for 5 s, 62°C for 5 s, 72°C for 20 s; 3 cycles of 98°C for 5 s, 60°C for 5 s, 72°C for 20 s; 6 cycles of 98°C for 5 s, 58°C for 5 s, 72°C for 20 s; 25 cycles of 98°C for 5 s, 50°C for 5 s, 72°C for 20 s; and a final extension at 72°C for 5 min. Fragment analysis of PCR products was performed with an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA). One microliter of PCR product and 0.4 ␮l of ROX-ET550 DNA ladder (GE Health Care, Piscataway, NJ) were diluted in 8.6 ␮l HiDi formamide (Applied Biosystems) and denatured for 1 min at 98°C. Samples were electrokinetically injected at 2.5 kV for 15 s and run at 15 kV for 2,000 s using POP7 polymer (Applied Biosystems). Data were analyzed using DAx data acquisition analysis software (Van Mierlo Software Consultancy, Eindhoven, The Netherlands). MHC class I RSCA. Transcribed MHC class I alleles were genotyped by reference strand conformation analysis (RSCA) of cDNA heteroduplexes from peripheral blood mononuclear cells or whole blood essentially as described previously (20) with the following modification. A 304-bp amplicon was amplified by PCR from cDNA in order to scan additional polymorphic sites in the highly variable peptide binding domains encoded by exons 2 and 3 using the 5⬘ phosphate (Phos)-modified primer 5⬘P-Refstrand (5⬘-[Phos]GCTACGTGGACGAC ACGC-3⬘) and Short3⬘RSCA (5⬘-TTCAGGGCGATGTAATCC-3⬘). The reference strand providing optimal resolution of MCM heteroduplexes was MamuB*-07. A Mamu-B*07 clone was amplified using the dye-labeled primer 6FAM5⬘-Refstrand (5⬘-6-carboxyfluorescein [FAM]CTACGTGGACGACACGC-3⬘)

and the 5⬘ phosphate-modified primer Short3⬘RSCA-P (5⬘-[Phos]TTCAGGGC GATGTAATCC-3⬘). Heteroduplex mobilities were determined relative to a ROX-ET900 size standard (GE Health Care) using DAx data acquisition analysis software (Van Mierlo Software Consultancy). MHC class I allele cloning and sequencing. MHC class I cDNAs were amplified by PCR using a high-fidelity polymerase (Phusion; New England BioLabs), cloned into pCR-Blunt (Invitrogen, Carlsbad, CA), and sequenced essentially as previously described (20). In order to obtain sequences containing complete predicted open reading frames, cDNAs were amplified using PCR primers optimized for known rhesus macaque MHC class I sequences. Each cDNA pool was amplified with consensus primers (5⬘MHC UTR, 5⬘-GGACTCAGAATCTCCC CAGACGCCGAG-3⬘; and 3⬘MHC UTR A, 5⬘-CAGGAACAYAGACACATT CAGG-3⬘, or an alternate reverse primer 3⬘MHC UTR B, 5⬘-GTCTCTCCAC CTCCTCAC-3⬘). Sequences were compiled for a minimum of 192 cDNA clones from a representative homozygote of each MCM haplotype. Sequences were analyzed using Aligner software (CodonCode Corp.). DRB genotyping. Sequence-specific PCR assays for 14 DRB alleles identified in MCM by Leuchte et al. (23) were optimized using the following conditions: 1⫻ Phusion master mix, 0.05 ␮M concentration of each forward and reverse primer, and 10 ng of genomic DNA. Samples were amplified on MJ Research PTC-225 thermocyclers at 98°C for 30 s; 35 cycles of 98°C for 5 s, 62°C to 72°C for 5 s, 72°C for 20 s; and a final extension at 72°C for 5 min (specific annealing temperatures are available upon request). PCR products were then resolved on a 2.5% agarose gel and visualized with ethidium bromide and UV light. Plasma virus analysis. The plasma virus concentration was determined using a modification of methods described previously (41). Viral RNA was reverse transcribed and amplified using a SuperScript III Platinum one-step quantitative reverse transcription-PCR system (Invitrogen, Carlsbad, CA) in a LightCycler 1.2 (Roche Diagnostics, Indianapolis, IN). The final reactions (20 ␮l) contained 0.2 mM each deoxynucleoside triphosphate, 3 mM MgSO4, 0.015% bovine serum albumin, 150 ng random hexamers (Promega, Madison, WI), 0.8 ␮l SuperScript III reverse transcriptase and Platinum Taq DNA polymerase in a single enzyme mix, 600 nM each amplification primer (5⬘-GTCTGCGTCATCTGGTGCATT C-3⬘ and 5⬘-CACTAGCTGTCTCTGCACTATGTGTTTTG-3⬘), and 100 nM probe (5⬘-[FAM] CTTCCTCAGTGTGTTTCACTTTCTCTTCTGCG-3⬘). The reverse transcriptase reaction was performed at 37°C for 15 min and then 50°C for 30 min. An activation temperature of 95°C for 2 min was followed by 50 amplification cycles of 95°C for 2 min and 62°C for 1 min, with ramp times set to 3 degrees per second. Serial dilutions of an SIV gag in vitro transcript were used to generate a standard curve for each run. Copy numbers were determined by interpolation onto the standard curve with the LightCycler software, version 4.0. IFN-␥ ELISPOT analysis. Peripheral blood mononuclear cells were isolated by Ficoll-Hypaque gradient centrifugation. A total of 1 ⫻ 105 to 2 ⫻ 105 cells

VOL. 81, 2007

SIVmac239 AND MHC-IDENTICAL MAURITIAN MACAQUES

351

FIG. 2. Microsatellite analysis of cynomolgus macaques (A1M, A2M, A4M, A5M, and A6M) carrying high-frequency MHC class I alleles. Microsatellite allele sizes (in base pairs) are shown for each animal. The shaded box indicates the common haplotype (H1) that is shared between each of these MCM.

considered positive if the difference between the sample and background wells was above 2 standard deviations at two or more time points. Viral sequence analysis. Cell-free plasma was obtained by Ficoll density gradient centrifugation of EDTA anticoagulated whole blood, and viral RNA was isolated as for measurements of plasma virus concentration. Amplification of viral sequences was performed using a QIAGEN one-step reverse transcriptionPCR kit (QIAGEN, Valencia, CA). For time points with plasma virus concentrations of ⬎103 viral RNA copies/ml of plasma, amplicons of ⬃500 to 1,000 base pairs were generated throughout the SIV genome as previously described (28). For time points with plasma virus concentrations of ⬍103 viral RNA copies/ml of plasma, amplicons of ⬃150 to 200 base pairs were generated around targeted sites of interest within the SIV genome. Primer sequences and PCR conditions are available upon request. Amplicons were purified using a QIAquick gel extraction kit (QIAGEN, Valencia, CA) and then directly sequenced using a DYEnamic ET Terminator cycle sequencing kit (GE Health Care). Sequencing reactions were resolved on an ABI 3730 (Applied Biosystems, Foster City, CA) and edited using CodonCode Aligner software (CodonCode Corp., Dedham, MA). Nucleotide sequence accession numbers. Novel MHC class I sequences were deposited in GenBank (accession numbers DQ979878 to DQ979886).

FIG. 1. Localization and properties of microsatellite markers in the MHC region of cynomolgus macaques. The schematic map is extrapolated from the MHC genomic sequence of rhesus macaques (9). Approximate positions of microsatellites and shaded boxes for the class IA, IB, and II gene clusters are given on a kilobase scale, oriented with the telomere at the top. Microsatellite properties, including observed heterozygosity [Het (obs)], nucleotides comprising the repeat unit, and number of alleles observed, are given to the right of each marker.

were incubated in duplicate or triplicate overnight with pools of overlapping 15-mer peptides in gamma interferon (IFN-␥) enzyme-linked immunospot (ELISPOT) plates (Mabtech, Columbus, OH). Plates were developed per the manufacturer’s instructions. Spots were imaged with an ELISPOT reader (AID, Strassberg, Germany) and counted by an ELISPOT reader, version 3.1.1, to limit bias. The mean number of spot-forming units (SFU) of background wells (without peptide) was subtracted from the mean of the sample wells. Responses were

RESULTS Microsatellite analysis of Mauritian cynomolgus macaques. In order to define MHC haplotypes in MCM, we identified a panel of 18 microsatellite markers spanning the entire 5-Mb MHC region of macaques; 10 of these loci lie within the MHC class I region (Fig. 1). The majority of the primers used to amplify these markers were adapted to reflect rhesus genomic sequences (Table 1) (9, 15, 31). First, we used these markers to genotype DNA from five MCM previously shown to possess the MHC class I alleles Mafa-B*430101, Mafa-B*440101, and Mafa-B*460101 (20). One of these animals, A4M, was homozygous at all 18 microsatellite loci (Fig. 1 and 2), while the other four animals had one copy of the same putative haplotype that we termed H1. These results demonstrate that the Mafa-

352

WISEMAN ET AL.

B*430101, Mafa-B*440101, and Mafa-B*460101 cluster is a component of an expansive, well-conserved haplotype that encompasses the entire 5-Mb MHC region. We then extended our MHC microsatellite analysis to a cohort of 112 additional feral MCM. Allele frequencies for these 18 loci in MCM are given in Table 2. The number of allele sizes per locus ranged from two (C4_2_25) to nine (D6S2691). Overall, 46/117 (39%) of this cohort carried at least one complete copy of the H1 haplotype (Fig. 3 and 4), and 9/117 (8%) animals were homozygous for H1. Additionally, we identified 14 more MCM that were homozygous at all 18 microsatellite loci (Fig. 4). From these 14 animals, we defined an additional five haplotypes (H2 to H6) (Fig. 3). Taken together, two-thirds of the 234 chromosomes examined bore microsatellite signatures of one of these six common haplotypes (Fig. 3), and simple recombination events could generally account for the remaining haplotypes (Fig. 4). This extensive sharing of MHC haplotypes is unprecedented among macaques (6, 29, 31). RSCA of selected MCM confirms MHC haplotypes. To verify that the haplotypes inferred from microsatellite mapping are linked with specific MHC alleles, we performed MHC class I RSCA. RSCA is a modified heteroduplex assay that is particularly well suited for characterizing complex gene families, such as MHC class I and class II (3, 18, 20). After heteroduplex formation with a fluorescently labeled reference strand, individual alleles are distinguished from one another on a nondenaturing polyacrylamide gel. As expected, RSCA from representative homozygotes resulted in distinct peak profiles, reflecting the differing MHC class I allele repertoires on each haplotype (Fig. 5). Moreover, each of the homozygous haplotype profiles was additive in the respective heterozygous animals (Fig. 5). In addition, MHC class I RSCA was used to test our hypothesis that almost all MCM MHC haplotypes either are intact or result from simple recombination events between H1 through H6. In animals where the predicted recombination region is distal to the MHC class I loci, transcribed allele patterns matched the relevant haplotype in the class I region. When the putative recombination breakpoint occurred within the MHC class I loci, chimeric allele profiles were observed (data not shown). Identification of transcribed MHC class I alleles for each common haplotype. Next, we identified the specific transcribed MHC class I alleles associated with the H1 through H6 haplotypes. Cloning and sequencing of PCR-amplified cDNAs from representative homozygous animals unambiguously linked specific MHC class I alleles with each of the six haplotypes (Table 3). The H1 haplotype carries Mafa-B*430101, Mafa-B*440101, and Mafa-B*460101, a result that confirmed our previous speculation that these alleles are inherited on a common haplotype (20). This haplotype also carries two MHC class IA alleles, Mafa-A*290101 and Mafa-A*250301. Surprisingly, these MHC class IA alleles are conserved between the three most common haplotypes, H1, H2, and H3. All three haplotypes carry identical Mafa-A*290101 alleles and either Mafa-A*250201 or Mafa-A*250301, which differ by only a single amino acid in the signal peptide. Therefore, more than 90% of MCM are predicted to possess these class IA alleles (Fig. 4). In contrast, “high-frequency” MHC class I alleles in

J. VIROL.

TABLE 2. Microsatellite allele frequencies and observed and expected heterozygosities in MCMa Allele size (bp)

Frequency or heterozygosity value

D6S2972

118 120 126 He Ho

0.45 0.25 0.30 0.65 0.62

D6S2970

293 301 305 309 313 351 He Ho

0.19 0.31 0.21 0.06 0.17 0.06 0.79 0.72

D6S2854

191 195 211 He Ho

0.71 0.22 0.07 0.44 0.42

D6S2704

143 145 152 163 165 He Ho

0.16 0.22 0.07 0.54 0.01 0.62 0.56

318 320 He Ho

0.92 0.08 0.14 0.14

233 235 He Ho

0.77 0.23 0.36 0.34

249 253 255 263 281 285 290 294 298 He Ho

0.15 0.01 0.29 0.01 0.07 0.03 0.26 0.07 0.11 0.80 0.75

220 224 228 235 Null He Ho

0.14 0.10 0.29 0.47

195 201 204 207 He Ho

0.09 0.56 0.30 0.06 0.59 0.56

Locus

D6S2847

C4_2_25

D6S2691

9268

MICA

Allele size (bp)

Frequency or heterozygosity value

D6S2793

243 266 274 276 He Ho

0.51 0.19 0.29 0.01 0.62 0.54

D6S2782

321 334 338 340 344 He Ho

0.30 0.24 0.21 0.20 0.06 0.77 0.70

D6S2669

95 108 110 129 141 He Ho

0.08 0.06 0.18 0.49 0.18 0.68 0.68

D6S2892

200 203 204 206 He Ho

0.35 0.06 0.18 0.41 0.68 0.64

DRA-CA

234 263 265 269 He Ho

0.32 0.23 0.26 0.19 0.74 0.72

D6S2876

203 209 214 216 He Ho

0.06 0.43 0.32 0.19 0.67 0.64

D6S2747

190 201 204 206 208 Null He Ho

0.18 0.25 0.05 0.41 0.11

297 301 309 Null He Ho

0.54 0.25 0.22

392 396 397 He Ho

0.16 0.38 0.46 0.62 0.62

Locus

D6S2745

0.67 0.67 D6S2771

0.72 0.74

0.60 0.66

a Microsatellite allele sizes are given along with the frequency of each allele and the expected (He) and observed (Ho) heterozygosity values for each locus in this MCM cohort (n ⫽ 234 chromosomes). Several examples of null microsatellite alleles were noted for specific haplotypes, e.g., the 9268 locus for H3 and H4. These are likely to result from mismatches between the target locus and the primer binding sequences.

VOL. 81, 2007


353

FIG. 3. Microsatellite haplotypes for the MHC region of Mauritian cynomolgus macaques. (a) Microsatellite allele sizes (in base pairs) characteristic for each microsatellite locus were associated with each MHC haplotype. The six common haplotypes were designated H1 to H6 and assigned colors (H1, black; H2, red; H3, blue; H4, green; H5, yellow; and H6, gray) for illustrative purposes throughout the figures. In several instances, multiple microsatellite alleles for a specific locus were associated with an MHC haplotype, e.g., the D6S2691 locus for H2 and H3. null, undetectable amplification due to primer mismatch or absence of target locus. (b) Microsatellite analysis was used to determine the frequency of common and recombinant MHC haplotypes (n ⫽ 234 chromosomes).

Indian rhesus macaques, such as Mamu-A*01, are rarely found in more than 25% of captive-bred monkeys. Common MHC haplotypes extend through the DRB locus in MCM. To verify that the microsatellite haplotype signatures associate with discrete MHC class II genotypes, we examined the highly polymorphic MHC class II-DRB locus (4, 23, 31). We used allele-specific PCR with representative homozygous MCM genomic DNAs to assign 11 of 15 known Mauritian DRB alleles to haplotypes H1 through H6 (Table 3). Both the allelic composition and relative frequencies of our microsatellite-based MHC haplotypes are consistent with short-range (⬃150 kb) DRB haplotypes defined previously in two independent cohorts of MCM (4, 23). High-resolution cloning and sequencing from homozygous MCM will be necessary to more rigorously define the complete gene content of the MHC class II region.

High frequency of MHC class I- and MHC class II-identical MCM. As illustrated in Fig. 6, more than one-quarter of this feral MCM cohort (32/117) comprises clusters of 7 or more MHC-identical individuals. If the MHC class I region is considered alone, 72/117 (62%) MCM have one or more fully matched individuals distributed among 14 distinct homozygous and heterozygous haplotype combinations (Fig. 4 and 6). This unique population of animals provides opportunities to perform a wide variety of studies in which genetic control over the MHC of the subjects might be important and that have been previously unattainable with nonhuman primates. SIVmac239 challenge of MCM. We infected two MHC class I-identical MCM with SIVmac239 to examine the predictability and reproducibility of SIV pathogenesis and cellular immunity in animals with identical MHC genetics. This pair of MCM

354

WISEMAN ET AL.

J. VIROL.

FIG. 4. Microsatellite MHC haplotypes of Mauritian cynomolgus macaques. Six common MHC haplotypes were inferred based on microsatellite analysis of 117 feral MCM obtained from Charles River BRF. Solid colored bars indicate intact MHC haplotypes, while mixed colors represent recombinant chromosomes. For example A3M and A4M are homozygous for H4 (green) and H1 (black), respectively, while A6M is a simple heterozygote for the H1 and H6 haplotypes. In contrast, A8M carries H4 plus a recombinant haplotype with the H2 class IA region and H6 for the rest of the MHC region. Hatched boxes define ambiguous regions resulting from identical microsatellite allele sizes between neighboring haplotype blocks. Individual boxes indicate variant microsatellite allele sizes relative to the expected common haplotype; these rare variants generally differ by the addition or loss of a single repeat unit.

VOL. 81, 2007


355

FIG. 4—Continued.

was originally selected based on RSCA that demonstrated that they share identical profiles of transcribed MHC class I alleles (data not shown). As illustrated in Fig. 7A, microsatellite analysis revealed that CY0113 carries an H2/H3 recombinant hap-

lotype with a Mafa-A*250301 allele that differs by only a single residue in the signal peptide compared to the H3 haplotype in CY0111. After challenge with SIVmac239, these animals exhibited very similar plasma virus levels for the first 16 weeks of

356

WISEMAN ET AL.

J. VIROL.

FIG. 4—Continued.

infection (Fig. 7B) before beginning to diverge. After 40 weeks of infection, plasma virus concentrations differed by approximately 2 log units. We predicted that these two MHC-identical animals would exhibit similar CD8⫹-T-lymphocyte (CTL) responses and that these responses, in turn, would select similar viral escape variants (28). CTL responses were measured in this pair of animals by IFN-␥ ELISPOT. During the chronic phase of infection, we consistently detected 11 CTL responses against regions of Rev, Nef, Gag, Tat, Env, and Pol in CY0113 (Fig. 7C). Six of these responses were also detected in CY0111, though the magnitudes of these responses were often lower. Interestingly, CY0111 did not mount any unique responses that were not also detected in CY0113. Unfortunately, sample limitations precluded whole-proteome analyses of acute-phase cellular immune responses in these animals. Given the similarities in immunological responses in the two animals, we hypothesized that their immune responses would select similar viral variants. The higher plasma virus concentrations (greater than 1,000 copies/ml) in CY0113 allowed analyses of a majority of the viral genome at multiple time points spanning the course of infection. In CY0111, the low chronic-phase plasma virus concentrations (fewer than 1,000 copies/ml) precluded sequencing of the entire SIV genome. Therefore, we used our analysis of viral sequences from CY0113 to focus on a subset of regions for examination in virus isolated from CY0111 (Fig. 7D). We designed small amplicons (150 to 200 bp) to specifically amplify and sequence these targeted regions. Four regions of the genome with viral variation consistent with CTL escape were identified in CY0113 and subsequently evaluated in CY0111 (Fig. 7D). Remarkably, both MHC-identical animals exhibited mutations in these regions, though the affected amino acids were distinct in each animal. With the exception of the Tat26–36 region, strong CTL responses were detected at 3 weeks postinfection in at least

one of the two animals (data not shown), strongly suggesting that the shared variability results from immune escape. DISCUSSION In this study, we discovered that six haplotypes account for almost all of the MHC diversity in feral Mauritian cynomolgus macaques. Combining genetic mapping with polymorphic microsatellite markers, MHC class I RSCA, high-throughput cloning and sequencing, and MHC class II-DRB allele-specific PCR, we were able to infer the entire MHC class I and class II-DRB genotypes of more than 100 animals. Sizable groups of completely MHC-identical animals, including a cluster homozygous for the most frequent MHC haplotype, were identified. We also successfully infected a pair of MCM with identical MHC class I and class II genetics with SIVmac239. To our knowledge, this is the first study to show successful SIVmac239 infection of Mauritian cynomolgus macaques, though the susceptibility of these animals is not surprising in light of recent data showing susceptibility to other pathogenic SIVs, including SIVmac251 and SHIV89.6P (32). Our initial results suggest that SIV-specific cellular immune responses are generally uniform in specificity in MHC-identical animals. This study mirrored two recent evaluations of monozygotic twins infected at the same time with the same stock of HIV (13, 44). We identified four regions of SIV that accumulated variation by 16 weeks postinfection. CTL against all four regions were detected during infection, suggesting that the variation results from CTL selective pressure. The pattern of chronic-phase epitope recognition in our animals was very similar to the twins monitored by Yang and colleagues (44). Animal CY0113 mounted 11 CTL responses. Six of the same responses were detected in CY0111, though the magnitude of the responses was lower. Lower plasma virus concentrations in CY0111 may account for the weaker CTL responses, a phe-

VOL. 81, 2007


357

FIG. 5. RSCA of transcribed MHC class I alleles. RSCA was performed with a Mamu-B*07 reference strand and cDNA PCR products from homozygous and heterozygous animals representing H1 through H5. RSCA assesses differences in electrophoretic mobility that result from the unique heteroduplex conformations that form between sequence-mismatched MHC alleles and a fluorescently labeled reference strand. These profiles are characteristic for each homozygous haplotype, with three to six peaks per haplotype that correspond to individual class I alleles. The hatched heteroduplex peaks with an apparent mobility of 525 bp are the Mafa-A*25 variant alleles that are shared between H1 through H3 (see Table 3). Several samples contain a residual Mamu-B*07 homoduplex that migrates just before 300 bp.

nomenon which was also noted in the twins monitored by Yang et al. (44). Despite the similar CTL responses in these animals, plasma viremia became substantially higher in CY0113 after the first 16 weeks of infection. The different clinical outcomes in these two animals could result from subtle differences in epitope specificity not resolved with IFN-␥ ELISPOT, antibody responses, innate immune responses, stochastic differences in T-cell receptor utilization, and different patterns of

viral evolution. Unlike the two studies that relied on the serendipitous identification of twins infected with the same strain of HIV, it should be possible to infect additional MHC-identical MCM with SIVmac239 to study why animals with identical MHC genetics and similar CTL responses nonetheless exhibit differences in SIV pathogenesis. The genetic simplicity of the MCM MHC is unprecedented among macaques and will fundamentally expand the scope of

358

WISEMAN ET AL.

J. VIROL. TABLE 3. MHC class I and II alleles detected for six common MCM haplotypesa Allele

Haplotype H1

H2

H3

H4

A*250201, A*290101

Class IA

A*250301, A*290101

A*250301, A*290101

Class IB

B*430101, B*440101, B*460101

B*480101, B*600101, B*450101, B*510101, B*470101, B*620101, B*630101 I*100101 I*110101

Class II-DRB DRB6*0101, DRB*W2101, DRB1*1001, DRB*W501 DRB*W402

DRB1*1002

A*300101, A*310101

H5

H6

A*330101

A*320101

B*110102, B*12, B*500101, B*610101

B*490101, B*640101, B*650101, I*100201

DRB1*0401, DRB5*0301, DRB1*0401, DRB5*0301 DRB1*0402, DRB*W401 DRB4*0101

a MHC class IA and IB alleles were identified for each haplotype by cDNA cloning and sequencing. cDNA cloning was performed with mRNA from the following animals homozygous for the class I region: A4M (H1), CR013 (H2), CR011 (H3), A3M (H4), CR001 (H5), and CR079 (H6). Class II-DRB alleles were determined by sequence-specific PCR with genomic DNA from representative homozygous and heterozygous animals. The MHC haplotypes deduced from our MCM cohort by microsatellite analysis are consistent with MCM DRB haplotypes reported previously (4, 23).

SIV studies that can be undertaken with nonhuman primates. MCM that share identical MHC haplotypes (are MHC haploidentical) or that carry completely distinct MHC haplotypes can be easily identified using polymorphic microsatellite mapping and selected for further studies. Adoptive lymphocyte transfer studies, such as those with inbred strains of mice that have defined the correlates of protective immunity in Friend retrovirus infections, will be possible with MCM that are completely matched for both MHC haplotypes (11, 25). For the first time, it may be possible to study the in vivo correlates of protective cellular immunity by transferring SIV-specific lymphocytes from a donor animal into naive recipients immediately prior to SIV challenge. These studies could directly test the hypothesis that the failure of cellular immunity to control SIV infection results from an inability of CTL to mobilize to sites of viral replication early during infection (33). Additionally, in vitro data suggest that certain CTL specificities suppress SIV and HIV replication far more effectively than others (24, 43). The use of MCM for adoptive transfers of individual CTL specificities could provide a useful method for both iden-

tifying and characterizing the shared biological attributes of effective CTL response. MCM with defined MHC haplotypes may also be very useful for vaccine studies that seek to elicit cellular immunity. MamuA*01-positive Indian rhesus macaques are often used in SIV vaccine research, primarily because these animals consistently mount an immunodominant Gag181-189CM9 CTL response that provides a convenient biomarker for assessing the induction of cellular immune responses. The magnitude of Gag181-189CM9 responses varies approximately 10-fold between Mamu-A*01-positive animals receiving identical vaccine formulations (1, 8) and SIV challenges (26). The magnitude of Gag181-189CM9 responses may be indirectly modified by alleles other than Mamu-A*01, since competition between expressed class I alleles could lead to differential Mamu-A*01 cell surface expression (37, 38). MCM that possess completely identical MHC genes eliminate this source of variability and therefore may improve the consistency of vaccine-elicited cellular immune responses. The evolutionary basis for the MHC genetic simplicity of

FIG. 6. Complete MHC identity among a cohort of 117 Mauritian cynomolgus macaques. Only instances where seven or more homozygotes or simple heterozygotes with identity across the entire 5-Mb MHC region were observed are illustrated. Our cohort contained 11 additional animals representing five distinct haplotype combinations with complete MHC identity. The physical order of loci within each gene cluster is unknown.

VOL. 81, 2007


359

FIG. 7. SIVmac239 infection of MHC class I-identical Mauritian cynomolgus macaques. (a) Microsatellite haplotypes were determined and used to infer the complete complement of class I and class II-DRB transcribed alleles for CY0111 and CY0113. (b) Plasma virus concentrations for each animal were measured at various time points throughout infection. The plasma virus concentrations are quantified as the number of copies of viral RNA per milliliter of plasma. (c) IFN-␥ ELISPOT analysis was used to measure SIV-specific CTL responses in the chronic phase. Either single peptides or peptide pools spanning the indicated amino acid sequences of the specific SIV proteins were used. A ⫹ indicates 50 to 99 SFU per million cells, ⫹⫹ indicates 100 to 499 SFU per million cells, and ⫹⫹⫹ indicates ⱖ500 SFU per million cells; a ⫺ indicates ⬍50 SFU. (d) Viral sequences in four specific regions of the SIV genome were analyzed to determine whether similar mutation patterns occurred in both animals. The SIV proteins and the wild-type amino acid sequences are indicated. Dots represent identity with the wild-type sequence. Amino acid replacements that resulted from a mixed population of nucleotides are indicated with a lowercase letter of the variant amino acid. Amino acid replacements that resulted from a complete nucleotide replacement are indicated with an uppercase letter of the variant amino acid. “ND” indicates that the sequence was not determined; wk, weeks.

360

WISEMAN ET AL.

MCM is unclear. The limited MHC repertoire of MCM may reflect selective advantages of these haplotypes for the Mauritian environment. It appears more likely that the limited MHC diversity described here is the result of a classic population bottleneck or founder effect (22, 30, 36; A. J. Tosi and C. S. Coke, submitted for publication). Consequently, there is little reason to assume that the relative genetic homogeneity of MCM is restricted to the MHC. Given the excitement surrounding gene mapping with isolated human populations (5, 35), MCM may provide an outstanding resource for mapping and identifying non-MHC loci associated with differences in SIV pathogenesis. Studies with HIV-infected individuals have revealed a number of such polymorphic non-MHC loci associated with AIDS restriction (27). Fortunately, the population of MCM available for research and the selection of genetically defined macaques are relatively abundant. In 2005 alone, 1,670 MCM were imported to the United States by a single distributor (Tami Lass, Charles River BRF, personal communication). Based on our results, approximately 130 H1 homozygous animals should be available annually. Likewise, when all simple homozygotes and heterozygotes for the common haplotypes are included, the number of MCM estimated to populate MHC-identical clusters exceeds 600 per year. These numbers could likely be increased significantly with only a modest effort at selective breeding using MHC microsatellite markers such as those described here. In conclusion, the high frequency of identical MHC haplotypes in MCM is extraordinary among nonhuman primates used in experimental biology. MCM represent an exceptional source of MHC-identical nonhuman primates with broad applications for AIDS vaccine and pathogenesis investigations.

J. VIROL.

6. 7.

8.

9. 10.

11. 12.

13.

14.

15.

ACKNOWLEDGMENTS This work was supported by NIAID contract number HHSN266200400088C/N01-AI-40088 and NIH grant 1R21AI06848801A2. This publication was made possible in part by grant number P51 RR000167 from the National Center for Research Resources (NCRR), a component of the National Institutes of Health (NIH), to the Wisconsin National Primate Research Center, University of Wisconsin—Madison. This research was conducted in part at a facility constructed with support from Research Facilities Improvement Program grant numbers RR15459-01 and RR020141-01. This publication’s contents are solely the responsibility of the authors and do not necessarily represent the official views of NCRR or NIH. We thank Eva Rakasz, Shari Piaskowski, Jessica Furlott, Kim Weisgrau, Gemma May, and Robert DeMars for helpful discussions. We also thank Jody Hegeland, Amy Schara, Eric Peterson, Mike Dobbert, Casey Fitz, and staff at the Wisconsin National Primate Research Center for technical assistance and veterinary care.

16.

17. 18.

19. 20. 21.

REFERENCES 1. Allen, T. M., T. U. Vogel, D. H. Fuller, B. R. Mothe, S. Steffen, J. E. Boyson, T. Shipley, J. Fuller, T. Hanke, A. Sette, J. D. Altman, B. Moss, A. J. McMichael, and D. I. Watkins. 2000. Induction of AIDS virus-specific CTL activity in fresh, unstimulated peripheral blood lymphocytes from rhesus macaques vaccinated with a DNA prime/modified vaccinia virus Ankara boost regimen. J. Immunol. 164:4968–4978. 2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403–410. 3. Arguello, J. R., M. Perez-Rodriguez, A. Pay, G. Fisher, A. McWhinnie, and J. A. Madrigal. 2003. HLA typing with reference strand-mediated conformation analysis. Methods Mol. Biol. 210:173–189. 4. Blancher, A., P. Tisseyre, M. Dutaur, P. A. Apoil, C. Maurer, V. Quesniaux, F. Raulf, M. Bigaud, and M. Abbal. 2006. Study of Cynomolgus monkey (Macaca fascicularis) MhcDRB (Mafa-DRB) polymorphism in two populations. Immunogenetics 58:269–282. 5. Bonnen, P. E., I. Pe’er, R. M. Plenge, J. Salit, J. K. Lowe, M. H. Shapero,

22. 23.

24.

25. 26.

R. P. Lifton, J. L. Breslow, M. J. Daly, D. E. Reich, K. W. Jones, M. Stoffel, D. Altshuler, and J. M. Friedman. 2006. Evaluating potential for wholegenome studies in Kosrae, an isolated population in Micronesia. Nat. Genet. 38:214–217. Bontrop, R. E., and D. I. Watkins. 2005. MHC polymorphism: AIDS susceptibility in non-human primates. Trends Immunol. 26:227–233. Boyson, J. E., C. Shufflebotham, L. F. Cadavid, J. A. Urvater, L. A. Knapp, A. L. Hughes, and D. I. Watkins. 1996. The MHC class I genes of the rhesus monkey. Different evolutionary histories of MHC class I and II genes in primates. J. Immunol. 156:4656–4665. Casimiro, D. R., F. Wang, W. A. Schleif, X. Liang, Z. Q. Zhang, T. W. Tobery, M. E. Davies, A. B. McDermott, D. H. O’Connor, A. Fridman, A. Bagchi, L. G. Tussey, A. J. Bett, A. C. Finnefrock, T. M. Fu, A. Tang, K. A. Wilson, M. Chen, H. C. Perry, G. J. Heidecker, D. C. Freed, A. Carella, K. S. Punt, K. J. Sykes, L. Huang, V. I. Ausensi, M. Bachinsky, U. Sadasivan-Nair, D. I. Watkins, E. A. Emini, and J. W. Shiver. 2005. Attenuation of simian immunodeficiency virus SIVmac239 infection by prophylactic immunization with DNA and recombinant adenoviral vaccine vectors expressing Gag. J. Virol. 79:15547–15555. Daza-Vamenta, R., G. Glusman, L. Rowen, B. Guthrie, and D. E. Geraghty. 2004. Genetic divergence of the rhesus macaque major histocompatibility complex. Genome Res. 14:1501–1515. de Groot, N., G. G. Doxiadis, N. G. de Groot, N. Otting, C. Heijmans, A. J. M. Rouweler, and R. E. Bontrop. 2004. Genetic makeup of the DR region in rhesus macaques: gene content, transcripts, and pseudogenes. J. Immunol. 172:6152–6157. Dittmer, U., and K. J. Hasenkrug. 2000. Different immunological requirements for protection against acute versus persistent Friend retrovirus infections. Virology 272:177–182. Doxiadis, G. G., A. J. Rouweler, N. G. de Groot, A. Louwerse, N. Otting, E. J. Verschoor, and R. E. Bontrop. 2006. Extensive sharing of MHC class II alleles between rhesus and cynomolgus macaques. Immunogenetics 58:259– 268. Draenert, R., T. M. Allen, Y. Liu, T. Wrin, C. Chappey, C. L. Verrill, G. Sirera, R. L. Eldridge, M. P. Lahaie, L. Ruiz, B. Clotet, C. J. Petropoulos, B. D. Walker, and J. Martinez-Picado. 2006. Constraints on HIV-1 evolution and immunodominance revealed in monozygotic adult twins infected with the same virus. J Exp. Med. 203:529–539. Evans, D. T., L. A. Knapp, P. Jing, J. L. Mitchen, M. Dykhuizen, D. C. Montefiori, C. D. Pauza, and D. I. Watkins. 1999. Rapid and slow progressors differ by a single MHC class I haplotype in a family of MHC-defined rhesus macaques infected with SIV. Immunol. Lett. 66:53–59. Gourraud, P. A., S. Mano, T. Barnetche, M. Carrington, H. Inoko, and A. Cambon-Thomsen. 2004. Integration of microsatellite characteristics in the MHC region: a literature and sequence based analysis. Tissue Antigens 64:543–555. Horton, R., L. Wilming, V. Rand, R. C. Lovering, E. A. Bruford, V. K. Khodiyar, M. J. Lush, S. Povey, C. C. J. Talbot, M. W. Wright, H. M. Wain, J. Trowsdale, A. Ziegler, and S. Beck. 2004. Gene map of the extended human MHC. Nat. Rev. Genet. 5:889–899. Karell, K., N. Klinger, P. Holopainen, A. Levo, and J. Partanen. 2000. Major histocompatibility complex (MHC)-linked microsatellite markers in a founder population. Tissue Antigens 56:45–51. Kennedy, L. J., S. Quarmby, N. Fretwell, A. J. Martin, P. G. Jones, C. A. Jones, and W. E. Ollier. 2005. High-resolution characterization of the canine DLA-DRB1 locus using reference strand-mediated conformational analysis. J. Hered. 96:836–842. Kestler, H. W., III, Y. Li, Y. M. Naidu, C. V. Butler, M. F. Ochs, G. Jaenel, N. W. King, M. D. Daniel, and R. C. Desrosiers. 1988. Comparison of simian immunodeficiency virus isolates. Nature 331:619–622. Krebs, K. C., Z. Jin, R. Rudersdorf, A. L. Hughes, and D. H. O’Connor. 2005. Unusually high frequency MHC class I alleles in Mauritian origin cynomolgus macaques. J. Immunol. 175:5230–5239. Kulski, J. K., T. Anzai, T. Shiina, and H. Inoko. 2004. Rhesus macaque class I duplicon structures, organization and evolution within the alpha block of the major histocompatibility complex. Mol. Biol. Evol. 21:2079–2091. Lawler, S. H., R. W. Sussman, and L. L. Taylor. 1995. Mitochondrial DNA of the Mauritian macaques (Macaca fascicularis): an example of the founder effect. Am. J. Phys. Anthropol. 96:133–141. Leuchte, N., N. Berry, B. Kohler, N. Almond, R. LeGrand, R. Thorstensson, F. Titti, and U. Sauermann. 2004. MhcDRB-sequences from cynomolgus macaques (Macaca fascicularis) of different origin. Tissue Antigens 63:529– 537. Loffredo, J. T., E. G. Rakasz, J. P. Giraldo, S. P. Spencer, K. K. Grafton, S. R. Martin, G. Napoe´, L. J. Yant, N. A. Wilson, and D. I. Watkins. 2005. Tat28–35SL8specific CD8⫹ T lymphocytes are more effective than Gag181–189CM9-specific CD8⫹ T lymphocytes at suppressing simian immunodeficiency virus replication in a functional in vitro assay. J. Virol. 79:14986–14991. Messer, R. J., U. Dittmer, K. E. Peterson, and K. J. Hasenkrug. 2004. Essential role for virus-neutralizing antibodies in sterilizing immunity against Friend retrovirus infection. Proc. Natl. Acad. Sci. USA 101:12260–12265. Mothe, B. R., H. Horton, D. K. Carter, T. M. Allen, M. E. Liebl, P. Skinner,

VOL. 81, 2007

27. 28.

29.

30. 31.

32.

33.

34. 35.


T. U. Vogel, S. Fuenger, K. Vielhuber, W. Rehrauer, N. Wilson, G. Franchini, J. D. Altman, A. Haase, L. J. Picker, D. B. Allison, and D. I. Watkins. 2002. Dominance of CD8 responses specific for epitopes bound by a single major histocompatibility complex class I molecule during the acute phase of viral infection. J. Virol. 76:875–884. O’Brien, S. J., and G. W. Nelson. 2004. Human genes that limit AIDS. Nat. Genet. 36:565–574. O’Connor, D. H., A. B. McDermott, K. C. Krebs, E. J. Dodds, J. E. Miller, E. J. Gonzalez, T. J. Jacoby, L. Yant, H. Piontkivska, R. Pantophlet, D. R. Burton, W. M. Rehrauer, N. Wilson, A. L. Hughes, and D. I. Watkins. 2004. A dominant role for CD8⫹-T-lymphocyte selection in simian immunodeficiency virus sequence variation. J. Virol. 78:14012–14022. Otting, N., C. M. Heijmans, R. C. Noort, N. G. de Groot, G. G. Doxiadis, J. J. van Rood, D. I. Watkins, and R. E. Bontrop. 2005. Unparalleled complexity of the MHC class I region in rhesus macaques. Proc. Natl. Acad. Sci. USA 102:1626–1631. Peltonen, L., A. Palotie, and K. Lange. 2000. Use of population isolates for mapping complex traits. Nat. Rev. Genet. 1:182–190. Penedo, M. C., R. E. Bontrop, C. M. Heijmans, N. Otting, R. Noort, A. J. Rouweler, N. de Groot, N. G. de Groot, T. Ward, and G. G. Doxiadis. 2005. Microsatellite typing of the rhesus macaque MHC region. Immunogenetics 57:198–209. Reimann, K. A., R. A. Parker, M. S. Seaman, K. Beaudry, M. Beddall, L. Peterson, K. C. Williams, R. S. Veazey, D. C. Montefiori, J. R. Mascola, G. J. Nabel, and N. L. Letvin. 2005. Pathogenicity of simian-human immunodeficiency virus SHIV-89.6P and SIVmac is attenuated in cynomolgus macaques and associated with early T-lymphocyte responses. J. Virol. 79:8878–8885. Reynolds, M. R., E. Rakasz, P. J. Skinner, C. White, K. Abel, Z. M. Ma, L. Compton, G. Napoe´, N. Wilson, C. J. Miller, A. Haase, and D. I. Watkins. 2005. CD8⫹ T-lymphocyte response to major immunodominant epitopes after vaginal exposure to simian immunodeficiency virus: too late and too little. J. Virol. 79:9228–9235. Rice, P., I. Longden, and A. Bleasby. 2000. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 16:276–277. Service, S., J. DeYoung, M. Karayiorgou, J. L. Roos, H. Pretorious, G. Bedoya, J. Ospina, A. Ruiz-Linares, A. Macedo, J. A. Palha, P. Heutink, Y. Aulchenko, B. Oostra, C. van Duijn, M. R. Jarvelin, T. Varilo, L. Peddle, P. Rahman, G. Piras, M. Monne, S. Murray, L. Galver, L. Peltonen, C. Sabatti, A. Collins, and N. Freimer. 2006. Magnitude and distribution of linkage

36.

37.

38.

39.

40.

41.

42.

43.

44.

361

disequilibrium in population isolates and implications for genome-wide association studies. Nat. Genet. 38:556–560. Sussman, R. W., and I. Tattersall. 1986. Distribution, abundance, and putative ecological strategy of Macaca fascicularis on the island of Mauritius, southwestern Indian Ocean. Folia Primatol. 46:28–43. Tourdot, S., and K. G. Gould. 2002. Competition between MHC class I alleles for cell surface expression alters CTL responses to influenza A virus. J. Immunol. 169:5615–5621. Tourdot, S., M. Nejmeddine, S. J. Powis, and K. G. Gould. 2005. Different MHC class I heavy chains compete with each other for folding independently of B2-microglobulin and peptide. J. Immunol. 174:925–933. Uda, A., K. Tanabayashi, O. Fujita, A. Hotta, K. Terao, and A. Yamada. 2005. Identification of the MHC class I B locus in cynomolgus monkeys. Immunogenetics 57:189–197. Uda, A., K. Tanabayashi, Y. K. Yamada, H. Akari, Y. J. Lee, R. Mukai, K. Terao, and A. Yamada. 2004. Detection of 14 alleles derived from the MHC class I A locus in cynomolgus monkeys. Immunogenetics 56:155–163. Wilson, N. A., J. Reed, G. S. Napoe´, S. Piaskowski, A. Szymanski, J. Furlott, E. J. Gonzalez, L. J. Yant, N. J. Maness, G. E. May, T. Soma, M. R. Reynolds, E. Rakasz, R. Rudersdorf, A. B. McDermott, D. H. O’Connor, T. C. Friedrich, D. B. Allison, A. Patki, L. J. Picker, D. R. Burton, J. Lin, L. Huang, D. Patel, G. Heindecker, J. Fan, M. Citron, M. Horton, F. Wang, X. Liang, J. W. Shiver, D. R. Casimiro, and D. I. Watkins. 2006. Vaccineinduced cellular immune responses reduce plasma viral concentrations after repeated low-dose challenge with pathogenic simian immunodeficiency virus SIVmac239. J. Virol. 80:5875–5885. Wojcechowskyj, J. A., L. J. Yant, R. W. Wiseman, S. L. O’Connor, and D. H. O’Connor. 2007. Control of simian immunodeficiency virus SIVmac239 is not predicted by inheritance of Mamu-B*17-containing haplotypes. J. Virol. 81:406–410. Yang, O. O., P. T. Sarkis, A. Trocha, S. A. Kalams, R. P. Johnson, and B. D. Walker. 2003. Impacts of avidity and specificity on the antiviral efficiency of HIV-1-specific CTL. J. Immunol. 171:3718–3724. Yang, O. O., J. Church, C. M. Kitchen, R. Kilpatrick, A. Ali, Y. Geng, M. S. Killian, R. L. Sabado, H. Ng, J. Suen, Y. Bryson, B. D. Jamieson, and P. Krogstad. 2005. Genetic and stochastic influences on the interaction of human immunodeficiency virus type 1 and cytotoxic T lymphocytes in identical twins. J. Virol. 79:15368–15375.