Simple and Highly Sensitive Molecular Diagnosis ... - ACS Publications

Article pubs.acs.org/ac

Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays Dohwan Lee,†,‡ Yong Shin,‡,§,∥ Seok Chung,⊥ Kyo Seon Hwang,# Dae Sung Yoon,*,○ and Jeong Hoon Lee*,† †

Department of Electrical Engineering, Kwangwoon University, 447-1 Wolgye, Nowon, Seoul 01897, Republic of Korea Department of Convergence Medicine, Asan Medical Center, University of Ulsan College of Medicine, Ulsan, Republic of Korea ∥ Biomedical Engineering Research Center, Asan Institute of Life Sciences, Asan Medical Center, 88 Olympicro-43gil, Songpa-gu, Seoul, Republic of Korea ⊥ School of Mechanical Engineering and ○School of Biomedical Engineering, Korea University, Seoul, 136-703, Republic of Korea # Center for BioMicrosystem, Korea Institute of Science and Technology (KIST), Seoul 136-791, Korea §

S Supporting Information *

ABSTRACT: We have developed a simple, user-friendly, and highly sensitive Zika virus (ZIKV) detection method by incorporating optimized reverse transcription loop-mediated isothermal amplification (RT-LAMP) and a lateral flow assay (LFA). The optimized RT-LAMP reaction was carried out using Bst 3.0 polymerase, which has robust and fast isothermal amplification performance even in the presence of high concentrations of inhibitors; this permitted the amplification of ZIKV RNA in pure water and human whole blood. In addition, the strong reverse transcription activity of Bst 3.0 polymerase enabled specific ZIKV RNA amplification without extra addition of reverse transcriptase. The RT-LAMP condition was optimized by adjusting the Mg2+ and dNTP mix concentration to extirpate nontarget amplification, which is caused by nonspecific primer dimers amplification. After 30 min of RT-LAMP reaction, the resultant amplicons were simply and rapidly analyzed by the LFA test in less than 5 min. The optimized RT-LAMP combined with the LFA allowed specific ZIKV RNA detection down to the single copy level within 35 min.

I

infections.10,11 Thus, reliable methods for distinguishing ZIKV from dengue and chikungunya viruses is essential in practical applications. The conventional method for specific ZIKV analysis is based on the reverse transcription-polymerase chain reaction (RT-PCR).12−14 However, RT-PCR requires a bulky and expensive thermal cycler, prolonged reaction time, and trained technicians; these resources are not available in many low and middle income countries.15−17 Moreover, the RT-PCR reaction is vulnerable to inhibitors (blood, plasma, and urine), demanding painstaking and cumbersome RNA extraction

n 2015, an outbreak of Zika virus (ZIKV) in Brazil resulted in more than 4000 cases of microcephaly in newborns and the infection of 1.5 million people. Explosive spreading of ZIKV in the Americas triggered the World Health Organization to declare it a public health emergency of international concern in February 2016;1−4 this is since ZIKV is suspected as a major cause of congenital microcephaly,5,6 Guillain-Barré syndrome7,8 and other neurologic syndromes.3 ZIKV is a single-stranded, positive-polarity RNA virus of the family Flaviviridae and the genus Flavivirus; it is transmitted by Aedes mosquitoes, which also transmit dengue and chikungunya viruses across tropical and subtropical regions around the world.9 In addition, antigenic similarity between ZIKV and dengue virus gives rise to serological cross-reactivity, precluding antibody-based assays from reliably distinguishing between ZIKV and dengue virus © 2016 American Chemical Society

Received: September 2, 2016 Accepted: November 15, 2016 Published: November 15, 2016 12272

DOI: 10.1021/acs.analchem.6b03460 Anal. Chem. 2016, 88, 12272−12278

Article

Analytical Chemistry steps.18−20 Recently, a variety of isothermal RNA amplification techniques have been developed to overcome such limitations.21−25 Among them, reverse transcription loop-mediated isothermal amplification (RT-LAMP) is a rapid, robust, and highly sensitive isothermal RNA amplification technique that uses four to six primers to amplify specific RNA sequences at 60−65 °C even in the presence of the inhibitors.26−28 Despite these advantages, the conventional LAMP assays occasionally suffer from nontarget amplification yielding false positive results. This is since the higher concentration of primers, ions, and dNTPs in RT-LAMP compared with regular RT-PCR, as well as a relatively low reaction temperature, contribute to stabilization of nonspecific primer dimers.29−31 Besides, RT-LAMP inevitably requires the addition of reverse transcriptase to convert viral RNA to DNA. To overcome such drawbacks, we utilized a Bst 3.0 polymerase and optimized RT-LAMP conditions to specifically amplify ZIKV RNA without nontarget amplification; the resultant amplicons were analyzed using a simple but highly sensitive lateral flow assay (LFA). The LFA is a superior nucleic acid diagnostic tool owing to its high sensitivity, simplicity, user-friendliness, and easy interpretation of results.32−34 The Bst 3.0 polymerase used in this study has robust and fast isothermal amplification performance even in the presence of high concentrations of inhibitors. It also has strong reverse transcription activity at elevated temperatures up to 72 °C. By utilizing these features of Bst 3.0 polymerase, we could rapidly and specifically amplify ZIKV RNA contained in pure water and human whole blood at relatively high temperatures; this was possible without addition of exogenous reverse transcriptase. We also completely eliminated nontarget amplification (caused by excessive free Mg2+ ions) by strictly controlling the Mg2+ and dNTP mix concentration in RT-LAMP. In addition, we employed the LFA as an amplicon analysis tool to perform simple, rapid, and user-friendliness detection of ZIKV RNA by merely observing a colorimetric signal with the naked eye. To the best of our knowledge, this is the first demonstration that the combination of optimized RT-LAMP and the LFA can enable rapid and specific ZIKV RNA detection at the single copy level.

Figure 1. Design and operation procedures of the LFA. (A) The detailed structure of the LFA. (B) The schematic illustration of the LFA operation procedures: (i) 1 μL RT-LAMP products was loaded into the conjugate pad, (ii) 45 μL of diluent buffer was dropped to buffer loading pad, and (iii) The capillary flow transferred AuNPs from conjugate pad to the test and control line.

antidigoxigenin and biotin were also affixed at the test line and control line, respectively. The schematic illustration of the LFA operation procedures are shown in Figure 1B. First, 1 μL of digoxigenin and biotin-labeled RT-LAMP products was loaded into the conjugate pad, so that the biotin-labeled RT-LAMP products formed a complex with AuNPs via streptavidin−biotin interactions. Next, 45 μL of diluent buffer was added to the buffer loading pad, and the capillary flow transferred AuNPs from the conjugate pad to the test and control line. The AuNP/ RT-LAMP complexes were immobilized at the test line by interaction between digoxigenin and antidigoxigenin, whereas the AuNPs that did not form complexes were captured by biotin. Complexed and noncomplexed AuNPs are indicated by violet bands at the test and control line, respectively. The colorimetric signal was easily visible to the naked eye within 5 min. Specific RT-LAMP Primer Design. To clearly distinguish ZIKV from other arboviruses such as dengue and chikungunya viruses, highly specific RT-LAMP primers that do not crossreact with other arboviruses is essential. The envelope protein coding region of ZIKV is highly homologous between ZIKV strains, but highly divergent from the other flaviviruses.35 Therefore, we selected the envelope protein coding region as a target gene. The genomic sequence of ZIKV (accession No. AY632535) was obtained from Genbank and six RT-LAMP primers, including inner primers (FIP/BIP), outer primers (F3/B3), and loop primers (LF/LB), were designed using the

■

EXPERIMENTAL SECTION Materials. NATtrol Zika Virus External Run Control (Catalog# NATZIKV-ERCM, strain MR 766), which contains intact ZIKV particles that have been chemically modified to render them noninfectious and refrigerator stable, was purchased from ZeptoMetrix Corporation (NY, U.S.A.). ZIKV RNA was extracted using AccuPrep Viral RNA Extraction Kit (Bioneer, Seoul, Korea). Bst 3.0 DNA polymerase, 10× Isothermal Amplification Buffer II, and 100 mM MgSO4 were obtained from New England BioLabs (MA, U.S.A). dGTP, dATP, dCTP, dTTP solutions (100 mM) and 1 mM of biotin18-dUTP were provided by Jena Bioscience (Jena, Germany). Primers specifically targeting ZIKV were synthesized by Bioneer (Seoul, Korea) and LFA kits and diluent buffer were purchased from Medisensor Inc. (Daejeon, Korea). Single donor human whole blood was obtained from Innovative Research, Inc. Design and Operation of the LFA. Figure 1A shows the detailed setup of the LFA in this study. The LFA platform contains a buffer loading pad, a conjugate pad, a test line, a control line, and an absorbent pad. Streptavidin-coated gold nanoparticles (AuNPs) were gathered in the conjugate pad, and 12273


Article

Analytical Chemistry Table 1. Specific RT-LAMP Primer Sequences target gene Zika virus envelope protein

primer inner primer loop primer outer primer

FIP BIP LF LB F3 B3

sequence (5′ to 3′)

length (bp)

GGCGTGGGCATCCTTGAATTCTGCAGACACCGGAACTCCA GGCAAACCGTCGTCGTTCTGGCTCAGCCTCTAGAGCTCCA (digoxigenin) TGCCTCTTTGTTGTTCCAGTG (digoxigenin) AGCCGTTCACACGGCTC TGACATCCCATTGCCTTGG CTTCCCTTTGCACCATCCAT

40 40 21 17 19 20

Primer Explorer V4 program available on the Eiken Web site (https://primerexplorer.jp/e/), as shown in the Supporting Information (Figure S-1). Then, each of six primers was checked to verify their specificity by conducting BLAST searches. Figure S-2 shows that the RT-LAMP primers were highly specific for ZIKV. LF and LB primers required for accelerating the amplification were labeled with digoxigenin, allowing the resultant amplicons to be captured on the test line. The primer sequences are shown in Table 1, and the ZIKV strains that can be detected using our primers are listed in Figure S-3. Since our primers were designed based on the ZIKV strain MR 766 (Uganda), most of African lineages are specifically detectable using our primers. However, these might not be suitable for Latin American and Asian lineages owing to several points of mismatch in the primer sequence. To cover all ZIKV lineages, extra primers based on Latin American and Asian lineages are expected to be required. Specific RT-LAMP-Dependent Amplification of ZIKV RNA. To amplify ZIKV RNA under isothermal conditions without nontarget amplification, we utilized the optimized RT-LAMP reaction and Bst 3.0 DNA polymerase. Bst 3.0 DNA polymerase has improved isothermal amplification performance and strong reverse transcription at elevated temperatures (up to 72 °C), so that total reaction time was reduced to 30 min, and addition of exogenous reverse transcriptase is not required. The stability of Bst 3.0 at elevated temperatures minimizes nontarget amplification problem by preventing the formation of primer dimers. The RT-LAMP reaction was carried out in a 25 μL reaction mixture containing 1× Isothermal Amplification Buffer II (20 mM Tris-HCl, 10 mM (NH4)2SO2, 150 mM KCl, 2 mM MgSO4, 0.1% Tween 20), an additional 2 mM MgSO4, dNTP mix included with biotin-dUTP (2.2 mM dGTP, dATP, dCTP, 1.375 mM dTTP, and 0.0825 mM biotin-dUTP), target-specific primer mixture (0.8 μM forward and reverse inner primers, 0.4 μM digoxigenin-labeled loop primers, and 0.2 μM forward and reverse outer primers, see Table 1), 8 U of Bst 3.0 DNA polymerase, and 2 μL of a purified ZIKV RNA or human whole blood spiked with ZIKV RNA ranging from 106 copies to single copy. The RT-LAMP reaction mixture was incubated at 72 °C for 30 min. Preparation of Purified ZIKV RNA and Human Whole Blood Sample Spiked with ZIKV RNA. Intact ZIKV particles in a purified protein matrix were artificially injected into human whole blood. ZIKV RNA was extracted using AccuPrep Viral RNA Extraction Kit (Bioneer, Seoul, Korea), and the concentration of the purified RNA was quantified using a Colibri Microvolume Spectrometer (Titertek Berthold, Germany). Then, the extracted ZIKV RNA was serially diluted to control the concentration from 106 copies to a single copy per 2 μL. In direct RT-LAMP experiments, the extracted ZIKV RNA was spiked into human whole blood to mimic real ZIKV blood specimens. Then, human whole blood was serially diluted with more blood to control the concentration from 106 copies to a

Figure 2. Optimization of Mg2+ concentrations. The indicated Mg2+ concentrations were examined by (A) agarose gel electrophoresis and (B) the LFA. The “+” symbols and “−” symbols indicate positive controls using 106 copies per 2 μL of ZIKV RNA and the negative control (no ZIKV RNA), respectively.

single copy per 2 μL and directly used as a sample without additional RNA extraction and purification steps. Optimization of the RT-LAMP Reaction. To optimize RT-LAMP assays, nontarget amplification must be completely eliminated. This is achieved by strictly controlling the concentration of Mg2+ and dNTPs.30,31,36 We optimized the concentration of Mg2+ and dNTP mix, wherein the ratio of dTTP and biotin-dUTP in dNTP was fixed to 55:3.3 based on previous reports.34,37 Four different Mg2+ concentrations (2, 4, 6, and 8 mM) and five different concentrations of dNTP (0.6, 1, 1.4, 1.8, and 2.2 mM) were examined to determine their optimal concentrations. 12274


Article

Analytical Chemistry

Figure 4. RT-LAMP reaction time control. Reaction times between 10 and 50 min were evaluated, and the amplicons were analyzed by (A) agarose gel electrophoresis and (B) the LFA with a single copy of ZIKV RNA. (C) Negative controls were also evaluated by the LFA. All experiments were repeated three times.

Figure 3. Optimization of dNTP mix concentrations. The indicated dNTP mix concentrations were examined by (A) agarose gel electrophoresis and (B) the LFA. The “+” symbols and “−” symbols indicate positive control using 106 copies per 2 μL of ZIKV RNA) and the negative control (no ZIKV RNA), respectively.

Mg2+. At this concentration, no bands or signals representing nontarget amplification were present (this experiment was repeated 10 times). We also optimized the concentration of dNTP mix (Figure 3) while fixing the Mg2+ concentration at 4 mM. Although there was a slight difference in the amplification pattern between positive and negative controls in the gel electropherogram (Figure 3A), nontarget amplification clearly occurred at dNTP mix concentrations less than 1.8 mM. Similar results were obtained in the LFA (Figure 3B). Specifically, distinctive ZIKV detection in the gel electropherogram and the corresponding LFA was obtained only with 2.2 mM dNTP mix. Importantly, the above tests were all conducted at 72 °C for 30 min, using Bst 3.0 polymerase without addition of exogenous reverse transcriptase. From these results, we conclude that the optimal concentrations of Mg2+ and dNTP mix for optimized RT-LAMP reaction are 4 and 2.2 mM, respectively. RT-LAMP Reaction-Time Control. After the optimization of Mg2+ and dNTP mix concentration, we investigated the minimal reaction time required to produce reliable bioassay results. Figure 4A shows that an amplification band first appeared after 30 min, and the band intensities appeared to saturate after 40 min. The trends of results from the LFA were similar (Figure 4B) and negative samples did not show the band on the test line (Figure 4C). The above results imply that a RT-LAMP reaction-time of less than 20 min is insufficient to detect ZIKV. Accordingly, we selected 30 min as the minimum reaction time for subsequent tests.

■

RESULTS AND DISCUSSION Optimization of Mg2+ and dNTP Mix Concentrations. When new RT-LAMP assays are optimized, nontarget amplification caused by nonspecific primer dimers must be confirmed. Although Mg2+ ions act as a cofactor for Bst polymerase, excessive free Mg2+ ions can stabilize nonspecific primer dimers, resulting in a pseudopositive result, even in the negative sample. Moreover, they can also bind to dNTPs and templates, which can also produce a misleading result. Owing to the multifunctionality of Mg2+ mentioned above, it is plausible that Mg2+ ions significantly affect the specificity of LAMP assays.15,30,36 In addition, dNTPs directly chelate a proportional number of Mg2+ ions, affecting the concentration of available free Mg2+ ions in LAMP reaction buffer.38−40 Accordingly, optimizing the concentration of Mg2+ and dNTP mix required to set up a reliable ZIKV bioassay. First, we performed agarose gel electrophoresis to optimize the concentration of Mg2+ ions in the RT-LAMP reaction (Figure 2A) and the LFA (Figure 2B); this was performed at a fixed (2.2 mM) concentration of dNTP mix. At 2 mM Mg2+, both positive and the negative controls failed to produce any amplification owing to insufficient Mg2+ ions. At 6 and 8 mM Mg2+, both of the positive and the negative controls displayed the amplification bands, indicating nontarget amplification. The only concentration that clearly distinguished between positive and negative controls was 4 mM 12275


Article


Figure 5. (A) Limit of detection test using extracted RNA. The extracted ZIKV RNA was serially diluted (from 106 copies to a single copy per 2 μL) and used as a template. (B) Calibration curve showing linear relationship (R2 = 0.91139) between the colorimetric intensities on the test line and the copy number of extracted ZIKV RNA. (C) Limit of detection test without RNA extraction. Human whole blood spiked with ZIKV RNA was serially diluted with blood (from 106 copies to a single copy per 2 μL) and directly used as a sample. (D) Calibration curve showing a linear relationship (R2 = 0.96498) between the colorimetric intensities on the test line and the copy number of ZIKV RNA in human whole blood.

Limit of Detection Test Using Extracted RNA. Encouraged by the successful optimization of ZIKV RT-LAMP reaction, we performed a limit of detection test on the LFA to evaluate whether our method is indeed highly sensitive. The extracted ZIKV RNA was serially diluted to from 106 copies to a single copy per 2 μL. Figure 5A shows the ZIKV RNA detection results for the LFA. The signal intensities on the test line gradually declined as the concentration of ZIKV RNA decreased. Notably, the existence of even a single copy of ZIKV RNA could be detected with the LFA. The calibration curve indicated a linear relationship (R2 = 0.91139) between the colorimetric intensities on the test line and the copy number of extracted ZIKV RNA (Figure 5B). Although the quantitative accuracy of the LFA is debated, we believe that these results indicate that extracted ZIKV RNA can be simply quantified by measuring the colorimetric intensities on the test lines. Thus, the combination of our optimized RT-LAMP reaction and the LFA identifies ZIKV RNA more rapidly and with a higher sensitivity than previously reported methods (Table S-1). Limit of Detection Test Using Nonpurified RNA. Since Bst polymerase used in the conventional LAMP assays is less affected by inhibitors, the LAMP format can be used to amplify the target DNA even in the presence of biological fluids such as blood, plasma, urine, and saliva.26−28,37 The Bst 3.0 polymerase used in this study retains both improved isothermal amplification performance and strong reverse transcription activity,

allowing us to avoid the inhibition of reverse transcription by biological substances. By utilizing the advantages of Bst 3.0 polymerase, we demonstrated a direct RT-LAMP reaction and LFA detection of ZIKV RNA in human whole blood, which did not require any RNA extraction steps (Figure 5C). In common with the results for extracted RNA, the LFA results from blood samples showed a gradual reduction of signal intensity on the test line as the concentration of ZIKV RNA was decreased. Again, even a single copy of ZIKV RNA was also detectable. Taken together, these results imply that our method has great potential utility for the effective diagnosis of ZIKV infections. Quantification analysis of the LFA for human whole blood was also conducted. There was a linear (R2 = 0.96498) relationship between the colorimetric intensities on the test line and the copy number of ZIKV RNA (Figure 5D).

■

CONCLUSIONS In this study, we successfully identified ZIKV RNA in pure water and human whole blood by a combination of RT-LAMP and the LFA. The procedure is highly sensitive, rapid, and simple to perform. Optimizing the RT-LAMP reaction by controlling the concentrations of Mg2+ and dNTP mix completely eliminated nontarget amplification. In addition, the direct RT-LAMP reaction could directly amplify ZIKV RNA from human whole blood without the need of special equipment such as an 12276


Article


(7) Cao-Lormeau, V.-M.; Blake, A.; Mons, S.; Lastère, S.; Roche, C.; Vanhomwegen, J.; Dub, T.; Baudouin, L.; Teissier, A.; Larre, P.; Vial, A.-L.; Decam, C.; Choumet, V.; Halstead, S. K.; Willison, H. J.; Musset, L.; Manuguerra, J.-C.; Despres, P.; Fournier, E.; Mallet, H.-P.; Musso, D.; Fontanet, A.; Neil, J.; Ghawché, F. Lancet 2016, 387, 1531−1539. (8) Oehler, E.; Watrin, L.; Larre, P.; Leparc-Goffart, I.; Lastere, S.; Valour, F.; Baudouin, L.; Mallet, H.; Musso, D.; Ghawche, F. Euro Surveill. 2014, 19, 7−9. (9) Surveillance and Control of Aedes aegypti and Aedes albopictus in the United States. http://www.cdc.gov/chikungunya/resources/ vector-control.html (accessed July 25). (10) Revised diagnostic testing for Zika, chikungunya, and dengue viruses in U.S. Public Health Laboratories. https://www.cdc.gov/zika/ pdfs/denvchikvzikv-testing-algorithm.pdf (accessed July 25). (11) Dejnirattisai, W.; Supasa, P.; Wongwiwat, W.; Rouvinski, A.; Barba-spaeth, G.; Duangchinda, T.; Sakuntabhai, A.; Malasit, P.; Rey, F. A.; Mongkolsapaya, J.; Screaton, G. R. Nat. Immunol. 2016, 17, 1102. (12) Faye, O.; Faye, O.; Dupressoir, A.; Weidmann, M.; Ndiaye, M.; Alpha Sall, A. J. Clin. Virol. 2008, 43, 96−101. (13) Faye, O.; Faye, O.; Diallo, D.; Diallo, M.; Weidmann, M.; Sall, A. A. Virol. J. 2013, 10, 311. (14) Gourinat, A. C.; O’Connor, O.; Calvez, E.; Goarant, C.; Dupont-Rouzeyrol, M. Emerging Infect. Dis. 2015, 21, 84−86. (15) Zhao, Y.; Chen, F.; Li, Q.; Wang, L.; Fan, C. Chem. Rev. 2015, 115, 12491−12545. (16) Chang, C. C.; Chen, C. C.; Wei, S. C.; Lu, H. H.; Liang, Y. H.; Lin, C. W. Sensors 2012, 12, 8319−8337. (17) Connelly, J. T.; Rolland, J. P.; Whitesides, G. M. Anal. Chem. 2015, 87, 7595−7601. (18) Schrader, C.; Schielke, A.; Ellerbroek, L.; Johne, R. J. Appl. Microbiol. 2012, 113, 1014−1026. (19) Alaeddini, R. Forensic Sci. Int.: Genet. 2012, 6, 297−305. (20) Khan, G.; Kangro, H. O.; Coates, P. J.; Heath, R. B. J. Clin. Pathol. 1991, 44, 360−365. (21) Compton, J. Nature 1991, 350, 91−92. (22) Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Nucleic Acids Res. 2000, 28, e63. (23) Vincent, M.; Xu, Y.; Kong, H. EMBO Rep. 2004, 5, 795−800. (24) Piepenburg, O.; Williams, C. H.; Stemple, D. L.; Armes, N. A. PLoS Biol. 2006, 4, 1115−1121. (25) Fire, a; Xu, S. Q. Proc. Natl. Acad. Sci. U. S. A. 1995, 92, 4641− 4645. (26) Safavieh, M.; Kanakasabapathy, M. K.; Tarlan, F.; Ahmed, M. u.; Zourob, M.; Asghar, W.; Shafiee, H. ACS Biomater. Sci. Eng. 2016, 2, 278−294. (27) Nyan, D.-C.; Ulitzky, L. E.; Cehan, N.; Williamson, P.; Winkelman, V.; Rios, M.; Taylor, D. R. Clin. Infect. Dis. 2014, 59, 16− 23. (28) Nie, K.; Qi, S. x.; Zhang, Y.; Luo, L.; Xie, Y.; Yang, M. j.; Zhang, Y.; Li, J.; Shen, H.; Li, Q.; Ma, X. j. PLoS One 2012, 7, e52486. (29) Senarath, K. D.; Usgodaarachchi, R. B.; Navaratne, V.; Nagahawatte, A.; Wijayarathna, C. D.; Alvitigala, J.; Goonasekara, C. L. J. Tuberc. Res. 2014, 2, 168−172. (30) Wang, D. G.; Brewster, J. D.; Paul, M.; Tomasula, P. M. Molecules 2015, 20, 6048−6059. (31) Liu, J.; Xu, L.; Guo, J.; Chen, R.; Grisham, M. P.; Que, Y. BioMed Res. Int. 2013, 2013, 1. (32) Posthuma-Trumpie, G. A.; Korf, J.; Van Amerongen, A. Anal. Bioanal. Chem. 2009, 393, 569−582. (33) Sajid, M.; Kawde, A. N.; Daud, M. J. Saudi Chem. Soc. 2015, 19, 689−705. (34) Jung, J. H.; Oh, S. J.; Kim, Y. T.; Kim, S. Y.; Kim, W.-J.; Jung, J.; Seo, T. S. Anal. Chim. Acta 2015, 853, 541−547. (35) Song, J.; Mauk, M. G.; Hackett, B. A.; Cherry, S.; Bau, H. H.; Liu, C. Anal. Chem. 2016, 88, 7289−7294. (36) Su, Y.; Yang, Y.; Peng, Q.; Zhou, D.; Chen, Y.; Wang, Z.; Xu, L.; Que, Y. Sci. Rep. 2016, 6, 23994.

ultracentrifuge or thermal cycler. The resultant amplicons were also easily quantifiable by the LFA. We thus report a simple, rapid, and user-friendly ZIKV detection method that can be exploited as part of an economic and simple point-of-care (POC) system. Although we have developed new effective ZIKV assay, we conceded that evaluation of real infected patients’ blood as well as validation of other samples such as urine, semen, amniotic fluid, and cerebrospinal fluid are seen to be necessary. We are now trying to do ongoing works for addressing these issues by cooperating with hospital.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.analchem.6b03460. Figure S-1: Primer design; Figure S-2: Specificity validation using BLAST program; Figure S-3: Detectable ZIKV strains; Table S-1: The comparison with other ZIKV assays (PDF).

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. ORCID

Jeong Hoon Lee: 0000-0001-6002-1557 Author Contributions ‡

These authors contributed equally.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Research Foundation of Korea Grant funded by the Korean Government (MEST; NRF-2015R1D1A1A01059806 and NRF-2015R1A5A7037674) and by a Grant of the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health and Welfare, Republic of Korea (Grant No.: HI16C0272). J.H.L. was also supported by a Research Grant from Kwangwoon University in 2016.

■

REFERENCES

(1) Lessler, J.; Chaisson, L. H.; Kucirka, L. M.; Bi, Q.; Grantz, K.; Salje, H.; Carcelen, A. C.; Ott, C. T.; Sheffield, J. S.; Ferguson, N. M.; Cummings, D. A. T.; Metcalf, C. J. E.; Rodriguez-barraquer. Science 2016, 353, aaf8160. (2) Zika virus outbreak: These places are most at risk. http://www. cbsnews.com/pictures/zika-virus-outbreak-these-places-are-most-atrisk/ (accessed July 25). (3) WHO statement on the first meeting of the International Health Regulations (2005; IHR 2005) Emergency Committee on Zika virus and observed increase in neurological disorders and neonatal malformations. http://www.who.int/mediacentre/news/statements/ 2016/1st-emergency-committee-zika/en/ (accessed July 25). (4) Focosi, D.; Maggi, F.; Pistello, M. Clin. Infect. Dis. 2016, 63, 1− 26. (5) Schuler-Faccini, L.; Ribeiro, E.; Feitosa, I.; Horovitz, D.; Cavalcanti, D.; Pessoa, A.; Doriqui, M.; Neri, J.; Neto, J.; Wanderley, H.; Cernach, M.; El-Husny, A.; Pone, M.; Serao, C.; Sanseverino, M. MMWR Morb Mortal Wkly Rep 2016, 65, 59−62. (6) Victora, C. G.; Schuler-Faccini, L.; Matijasevich, A.; Ribeiro, E.; Pessoa, A.; Barros, F. C. Lancet 2016, 387, 621−624. 12277


Article

Analytical Chemistry (37) Lee, D.; Kim, Y. T.; Lee, J. W.; Kim, D. H.; Seo, T. S. Biosens. Bioelectron. 2016, 79, 273−279. (38) Waterfall, C. M.; Cobb, B. D. Nucleic Acids Res. 2001, 29, e119. (39) Qiu, X.; Li, T.; Zhang, G.; Cao, J.; Jin, Y.; Xing, G.; Liao, M.; Zhou, J. Virol. J. 2012, 9, 318. (40) Roux, K. H. Cold Spring Harb. Protoc. 2009, 4, 1−7.

12278
