PRPF8-27. G>C trans. 175. Table S2, related to experimental procedures. DNA/mRNA concentrations used for transfection experiments. DNMT3B. PRPF8 gene.
Stem Cell Reports, Volume 5 Supplemental Information
Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts Sara E. Howden, John P. Maufort, Bret M. Duffin, Andrew G. Elefanty, Edouard G. Stanley, and James A. Thomson
Figure S1
Figure S2
Figure S3
Supplemental Figure Legends Figure S1, related to Figure 2. Gene targeting of the OCT4 locus. (A) Schematic diagram of the OCT4 locus and the donor template used for gene targeting. pA (polyA signal), Ex (exon), UTR (untranslated region). (B) Phase contrast and fluorescent images of an iPS cell colony generated after simultaneous reprogramming and gene targeting of OCT4 locus. The higher magnification image on the right shows correct nuclear localization of the OCT4-EGFP fusion protein. (C) Flow cytometric analysis of an iPS cell clone with EGFP fused to OCT4 generated by a one-step reprogramming/ gene targeting strategy. Figure S2, related to Figure 2. Gene targeting of the DNMT3B locus in ADA-SCID fibroblasts. Phase contrast and fluorescent images of an iPS cell colony generated after simultaneous reprogramming and gene targeting of DNMT3B locus in fibroblasts derived from an infant with ADA-SCID, acquired approximately three weeks post-electroporation. Figure S3, related to Figure 4. Characterization of gene-corrected iPS cell lines derived from ADA-SCID fibroblasts (A) The pluripotent potential of two gene-corrected iPS cell lines (clones L and Dd) was confirmed after 5
injection of ≈2–5 × 10 iPS cells into the hind-limb muscle of SCID/Beige mice. Teratomas were harvested approximately 8 weeks after injection, sectioned, and stained with hematoxylin and eosin. Derivatives of all three primary germ layers were observed. Scale bars = 0.1mm. (B) Karyotype analysis of two gene-corrected iPS cell lines derived from ADA-SCID patient fibroblasts revealed no abnormalities. (C) PCR analysis of iPS cell lines to detect residual reprogramming vector sequences. PCR was performed using primers specific to the C-terminal region of the EBNA1 gene, which is carried by three of the reprogramming vectors, or the AmpR gene which is carried by all four reprogramming vectors. PCR was performed using genomic DNA from three gene-corrected and three uncorrected iPS cell lines derived from ADA-SCID patient fibroblasts. PCR was also performed on the genomic DNA from the parental ADA-SCID fibroblast line (fib con) and 1 pg of reprogramming plasmid DNA for negative and positive controls respectively. PCR was performed over 40 cycles.
Table S1, related to Figure 5. Mutations identified following sequencing analysis of cloned oligonucleotides Clone ID
Mutation
ADA-4 ADA-8 ADA-12
1 bp ins 1 bp del 1 bp del 1 bp del C>T trans 1 bp del 1 bp del 1 bp del 1 bp del 1 bp ins 3 bp del 1 bp del 1 bp del G>A trans 1 bp del 1 bp del 1 bp del 1 bp del 1 bp del 1 bp del 1 bp del G>C trans
Table S2, related to experimental procedures. DNA/mRNA concentrations used for transfection experiments PRPF8 gene ADA gene DNMT3B correction correction pEP4EO2SEN2L
15 µg
15 µg
15 µg
pEP4EO2SET2K
15 µg
15 µg
15 µg
pEP4EO2SEM2K
15 µg
15 µg
15 µg
pSimple-miR302/367
15 µg
15 µg
15 µg
EBNA1 mRNA
15 µg
15 µg
15 µg
sgRNA plasmid
15 µg
15 µg
15 µg
hCas9 (Sp)
-
15 µg
15 µg
Cas9 mRNA (Nm)
20 µg
-
-
DNMT3B-EGFPpuro PCR product
5 µg
-
-
Repair oligonucleotide
-
0.3 nmol
0.3 nmol
Table S3, related to experimental procedures. Oligonucleotide sequences Purpose Forward Generation of PCR product for targeting EGFP to DNMT3B CTCGTTCTCTATCTAATCCTGG (amplified from DNMT3B-EGFP BAC DNA) Confirm targeting of EGFP to CGTCCAGCTCGACCAGGATGG DNMT3B locus Amplification of PRPF8 exon 43 CAGGATGTCACCACCCATG Sequencing of PRPF8 PCR product GCCAGAACACAGACAAGG Amplification of ADA exon 11 AATGACCAGGCTAACTACTCG Sequencing of ADA PCR product GACAGTGGACAAATCCTTCC Amplification of ADA transcript CCCGTTAAGAAGAGCGTGG (following cDNA synthesis) Sequencing of ADA RT-PCR product N/A Detection of reprogramming CGCCGGTGTGTTCGTATATGG plasmids (EBNA1 gene) Detection of reprogramming CATAACCATGAGTGATAACAC plasmids (AmpR gene) Generation of DNMT3B sgRNA CACCGGATCTCCGGGGTGCGGAT plasmid AGCCT Generation of PRPF8 sgRNA CACCGGGTCATGCCGAACACCTT plasmid C Generation of ADA sgRNA plasmid CACCGTTTGGCCACATTGATGTTC