Springer 2006
Conservation Genetics (2006) 7:153–156 DOI 10.1007/s10592-005-5387-y
Single fish egg DNA extraction for PCR amplification Futoshi Aranishi Department of Biological and Environmental Sciences, Miyazaki University, Miyazaki 889-2192, Japan (Phone: +81-(0)985-58-7224; Fax: +81-(0)985-58-2884; E-mail:
[email protected]) Received 21 February 2005; accepted 13 April 2005
Key words: Chelex, DNA extraction, fish egg, PCR amplification, stock management
Abstract Modern stock researches on marine biomass are basically genetic and rely increasingly on PCR-based manipulations of informative DNA markers for detecting the genetic diversity. This study developed a simple and rapid single tube method for DNA extraction from a single fish egg. The 15 min protocol was based on the use of Chelex 100 resin and urea to breakdown membrane and connective tissue of eggs. From various sizes of a single egg of walleye pollack (Theragra chalcogramma), the amounts of total nucleic acids were reproducibly obtained to be 18.25 ± 1.92 lg per egg. Using DNA templates diluted ranging 1/100–1/ 105, PCR amplification for the mitochondrial cytochrome b (Cytb) gene was successfully performed, and the 1/102 diluted template yielded the best result in PCR amplification for three different DNA marker genes. This method is quite simple and economical, and enables to provide the high throughput often demanded by the stock identification of marine biomass, in which large numbers of specimens of single fish eggs must be analyzed.
Introduction The question of stock identity of marine living resources for practical management purposes is a primary research topic to meet not only the social demands; sustainable use of reproducible marine biomass solves upcoming serious food problem, but also the ecological demands; we ought to conserve the marine biodiversity. Hence, marine stock management lies at the juncture of fishery biology and conservation biology (Bowen 1999). Early stock researches focused on morphological characteristics, which benefit from incorporation of both environmental and genetic information but suffer from the absence of information on their respective contributions. Meanwhile, modern stock researches are basically genetic and reflect time, selection pressure and the degrees of taxonomical isolation (Waldman 1999). In the last decades, phylogenetic investigations on marine fish have relied increasingly on molecular
biological techniques using PCR-based manipulations of informative DNA markers for detecting the genetic diversity. These analytical techniques are limited by DNA of acceptable quality and quantity for PCR amplification, which is obtained from small amounts of specimens (Gurvitz et al. 1994; Fukushima 1999). When minute pieces of fish liver and muscle are used as a DNA source, these tissues are the multicellular nature, and DNA of the quality and quantity enough for PCR amplification can be obtained even by shortcut DNA extraction protocols, e.g. microwave-based method (Banerjee et al. 1995) and boiling method (Valsecchi 1998). From unique fish tissues such as scale (Estoup et al. 1996; Nelson et al. 1998; Adcock et al. 2000; Yue and Orban 2001) and fin (Wilson Jr and Donaldson 1998; Nam et al. 2003; Wasko et al. 2003), a variety of specialized methods for DNA extraction have been also reported. There are however few specialized methods for DNA extraction from fish eggs. The lipid-rich
154 nature greatly diminishes the recovery of DNA and leaves residual egg materials that might inhibit PCR amplification (Cary 1996). This study was undertaken to develop a simple and rapid, yet inexpensive one-tube method for DNA extraction from a single fish egg. The 15 min protocol was based on the use of Chelex 100 chelating resin (Walsh et al. 1991) and urea to effectively breakdown membrane and connective tissue of eggs, and provided DNA templates applicable for PCR amplification of polymorphic mitochondrial DNA (mtDNA) genes that are useful for phylogenetic investigations of marine fish (Aranishi et al. 2005).
each primer, and 1 ll of DNA template in a Techgene thermal cycler (Techne). PCR conditions and primers used are shown in Table 1, and the numbers of thermal cycling were 30 for the cytochrome b (Cytb) gene and 35 for the cytochrome oxidase I (COI) and 12S ribosomal RNA (12S rRNA) genes. A 5 ll portion of PCR amplicon was run at 15 V/cm for 40 min on a 2.0% agarose gel and then photographed under UV illumination in an EDAS290 Gel Documentation System (Invitrogen).
Results In independent experiments using eight different specimens of single pollack eggs ranging 513– 690 lg in weight, the amounts of total nucleic acids were reproducibly obtained to be 18.25 ± 1.92 lg per egg, corresponding to approximately 26.5 ng nucleic acids per lg egg. However, these values might contain considerable amounts of RNA, since no step to remove RNA from total nucleic acids was included in the protocol. Although subsequent DNA isolation steps such as silica treatment (Neudecker and Grimm 2000) and conventional phenol-chloroform extraction were examined, measurable amounts of DNA were inconsistently recovered. This could be due to the interference by abundant lipids present in fish eggs (Saldanha et al. 1984). In order to verify appropriate concentrations of DNA templates in PCR amplification, 1 ll portions of the final DNA extract and diluted extracts ranging 1/101–1/105 were used in 10 ll of PCR amplification for the Cytb gene (Figure 1). From all but the undiluted extract, a 558 bp PCR product was generated, and the 1/102 diluted extract yielded the best result. Presumably, this
Materials and methods Eggs were collected from eight specimens of walleye pollack (Theragra chalcogramma) and stored in a laboratory freezer at )20 C for several months until DNA preparation. A single egg was placed into a 1.5 ml eppendorf tube, and 100 ll of extraction buffer containing 4 M urea, 1% Tween 20, 1% Nonidet P-40 and 5% Chelex 100 (all from Sigma) was added and mixed by vortex. The tube was boiled in a water bath for 8 min. Following centrifugation at 15,000 · g for 5 min, the precipitate containing the chelating resin and egg debris was discarded. The supernatant containing nucleic acids was collected, and 1 ll of 100TE (1 M Tris–HCl, pH 8.0, 100 mM EDTA, pH 8.0) was added to adjust pH at 8.0. The amount and quality of obtained nucleic acids were evaluated in a BioPhotometer (Eppendorf). PCR amplification of the mtDNA genes was performed in 10 ll of PCR buffer containing 10 mM Tris–HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 2 mM MgCl2, 200 lM each dNTP, 0.25 unit Taq DNA polymerase (Promega), 0.5 lM
Table 1. PCR amplification conditions and oligonucleotide primers used in this study Gene
Primer
Sequence (5¢–3¢)
Denaturation*
Cytb
TR-14F TR-571R UCOI-F UCOI-R SSU-1 SSU-2
GGAAAACCCATCCAATCCTA CAGCAACAACAAAGGGGAAT ATYGGNGGNTTYGGNAAYTG ATNGCRAANACNGCNCCYAT GTGGATCCATTAGATACCC ACTGGTACCTTGTTACGACTT
94 10 94 20 94 15
COI 12S rRNA
*Temperature and duration during thermal cycling.
C sec C sec C sec
Annealing* 58 10 47 20 45 15
C sec C sec C sec
Extension* 72 40 72 60 72 45
C sec C sec C sec
Reference Aranishi et al. (2005) Matsumoto (2003) Berschick (1997)
155 was because of significant amounts of lipids and other materials left in the undiluted DNA extract, which might inhibit PCR amplification. Using the 1/102 diluted extracts of four different specimens, PCR amplification for the Cytb, COI and 12S rRNA genes was all successful resulting in intensive products (Figure 2).
Discussion This study developed a simple and rapid, yet inexpensive one-tube method for DNA extraction
Figure 1. PCR amplification of the mtDNA Cytb gene from 1 pollack egg DNA. Values indicate the dilution ratios of DNA template. M, molecular weight marker (Kb).
from single fish eggs. The protocol was ascertained by the quality of obtained DNA applicable for PCR amplification of three polymorphic mtDNA genes, all of which have been useful markers for phylogenetic researches on aquatic organisms (Berschick 1997, Matsumoto 2003, Aranishi et al. 2005). The procedure consisted of two steps performable in a single tube: (1) boiling a egg in a lysis buffer; (2) removal of egg debris by centrifugation, and both steps proved to be essential to obtain DNA applicable for PCR amplification. The lysis buffer was composed of Chelex 100 chelating resin, mixed non-ionic detergents, and a high concentration of urea. As all components are potential denaturants for protein, the lysis buffer effectively broke down connective tissue and membrane of eggs during a short boiling. The boiling step therefore becomes a good alternative to mechanical tissue homogenization and allows us to save time and labor, particularly when large numbers of samples must be processed. From a small number of marine fish eggs, the modified Isoquick DNA extraction protocol was reported to repeatedly yield DNA templates applicable for PCR amplification (Cary 1996). The author described that fish egg DNA obtained using several commercially available kits as well as the STET and PCR buffer-based boiling protocols resulted in poor PCR amplification. In contrast, the one-tube method developed in this study consistently provided the quality and quantity of DNA template, which equally suited for PCR amplification with that obtained using the modified Isoquick extraction. However, our method is highly advantageous in saving both time and cost
Figure 2. PCR amplification of the mtDNA Cytb, COI and 12S rRNA genes from 1 pollack egg DNA. Each lane represents one individual. M, molecular weight marker (Kb).
156 and the recovery yield of nucleic acids, rather than the Cary’s protocol that requires the commercial Isoquick reagent and contains the matrix-binding step for yielding only 25–50 ng of total nucleic acids from a single egg. In conclusion, our one-tube method for DNA extraction from fish eggs is quite simple and rapid and extremely cost-effective, and PCR amplification of obtained DNA is reproducible for different mtDNA genes (Figure 2). The protocol was applied to not only single fertilized eggs but also juveniles of marine fish with equal success (data not shown). It enables to provide the high throughput often demanded by the stock identification of marine biomass, in which large numbers of specimens of single fish eggs must be analyzed. Although not yet attempted in our laboratory, the method appears suited for adapting to a 96-wells format.
Acknowledgement This work was supported in part by grants from the Agriculture, Forestry and Fisheries Research Council of Japan.
References Adcock GJ, Ramirez JHB, Hauser L, Smith P, Carvalho GR (2000) Screening of DNA polymorphisms in samples of archived scales from New Zealand snapper. Journal of Fish Biology, 56, 1283–1287. Aranishi F, Okimoto T, Izumi S (2005) Identification of gadoid species (Pisces, Gadidae) by PCR-RFLP analysis. Journal of Applied Genetics, 46, 69–73. Banerjee SK, Makdisi WF, Weston AP, Mitchell SM, Campbell DR (1995) Microwave-based DNA extraction from paraffinembedded tissue for PCR amplification. Biotechnology, 18, 768. Berschick P (1997) One primer pair amplifies small subunit ribosomal DNA from mitochondria, plastids and bacteria Biotechniques, 23, 494–498.
Bowen BW (1999) Preserving genes, species, or ecosystems? Healing the fractured foundations of conservation policy Molecular Ecology, 12, S5–10. Cary SC (1996) PCR-based method for single egg and embryo identification in marine organisms Biotechniques, 21, 998–1000. Estoup A, Largiader CR, Perrot E, Chourrout D (1996) Rapid one-tube DNA extraction for reliable PCR detection of fish polymorphic markers and transgenes. Molecular Marine Biology and Biotechnology, 5, 295–298. Fukushima H (1999) Forensic DNA analysis – past and future Nippon Hoigaku Zasshi, 53, 276–284 (in Japanese). Gurvitz A, Lai LY, Neilan BA (1994) Exploiting biological materials in forensic science. Australas Biotechnol, 4, 88–91. Matsumoto M (2003) Phylogenetic analysis of the subclass Pteriomorphia (Bivalvia) from mtDNA COI sequences Molecular Phylogenetics and Evolution, 27, 429–440. Nam YK, Park JE, Kim KK, Kim DS (2003) A rapid and simple PCR-based method for analysis of transgenic fish using a restricted amount of fin tissue. Transgenic Research, 12, 523–525. Nelson RJ, Beacham TD, Small MP (1998) Microsatellite analysis of the population structure of a Vancouver Island sockeye salmon (Oncorhynchus nerka) stock complex using nondenaturing gel electrophoresis. Molecular Marine Biology and Biotechnology, 7, 312–319. Neudecker F, Grimm S (2000) High-throughput method for isolating plasmid DNA with reduced lipopolysaccharide content. Biotechniques, 28, 106–108. Saldanha J, Gannicliffe A, Itzhaki RF (1984) An improved method for preparing DNA from human brain. Journal of Neuroscience Methods, 11, 275–279. Valsecchi E (1998) Tissue boiling: a short-cut in DNA extraction for large-scale population screenings Molecular Ecology, 7, 1243–1245. Waldman JR (1999) The importance of comparative studies in stock analysis Fisheries Research, 43, 237–246. Walsh PS, Metzger DA, Higuchi R (1991) Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques, 10, 506–513. Wasko AP, Martins C, Oliveira C, Foresti F (2003) Nondestructive genetic sampling in fish. An improved method for DNA extraction from fish fins and scales. Hereditas, 138, 161–165. Wilson Jr RR, Donaldson KA (1998) Restriction digest of PCRamplified mtDNA from fin clips is an assay for sequence genetic ‘‘tags’’ among hundreds of fish in wild populations. Molecular Marine Biology and Biotechnology, 7, 39–47. Yue GH, Orban L (2001) Rapid isolation of DNA from fresh and preserved fish scales for polymerase chain reaction. Marine Biotechnology, 3, 199–204.
