Rush and Konigsberg have identified Tyr766 as the site for cross-linking of a photoaffinity ..... Boyd, D. B. (1969) J. Am. Chem. Soc. 91, 1200-1205. Laemmli ...
Eur. J. Biochem. 214,59-65 (1993) 0 FEBS 1993
Site directed mutagenesis of DNA polymerase I (Klenow) from Escherichia coli The significance of Arg682 in catalysis Virendra N. PANDEY', Neerja KAUSHIK', Rita P. SANZGIRI', Manohar S. PATIL', Mukund J. MODAK? and Sailen BARIK3
'
Radiation Biology and Biochemistry Division, Bhabha Atomic Research Center, Bombay, India University of Medicine and Dentistry of New Jersey, New Jersey Medical School, Newark, USA Department of Molecular Biology, The Cleveland Clinic Foundation, Cleveland, USA
(Received January 12, 1993) - EJB 93 0045/1
We have reported that a domain containing Arg682 in the Klenow fragment of Escherichia coli DNA polymerase I (pol I) is important for the template-dependent dNTP-binding function [Pandey, V. N., Kaushik, N. A., Pradhan, 0. S. & Modak, M. J. (1990) J. Biol. Chem. 265, 3679-38841. In order to further define the role of Arg682 in the catalytic process, we have performed site-directed mutagenesis of this residue. For this purpose the Klenow-coding region of the DNA-pol-I gene was selectively amplified from the genomic DNA of E. coli and was cloned in an expression vector, PET-3a. This clone under appropriate conditions overproduces the Klenow fragment in E. coli. Using this clone (PET-3a-K) as the template, two mutant polymerase clones were constructed in which arginine has been replaced with either alanine, [R682A] pol I, or lysine [R682K] pol I. Both mutant enzymes showed significantly lower specific activity as compared to the wild-type enzyme. The kinetic analyses of the mutant enzymes indicated a 3-4-fold increase in the K,,, for the substrate dNTP, a 20-25-fold decrease in the V,,, and an overall decrease in the processive nature of DNA synthesis in both the mutant enzymes. The reverse mutation of Ala682 to the wild-type form Arg682 fully restored the processive nature and the polymerase activity of the enzyme. These observations suggest that the positively charged guanidino group in the side chain of Arg682 is catalytically important but not absolutely essential for synthesis of DNA. Furthermore it appears to maintain high processivity of the DNA synthesis catalyzed by the enzyme.
The proteolytically derived large fragment of Escherichia coli DNA polymerase I (pol I; Klenow) has served as an ideal model for understanding the enzymic and molecular mechanisms of DNA synthesis. This fragment contains both DNA polymerase and 3'-5' exonuclease activities and has been crystallized. Its three-dimensional X-ray crystal structure has revealed that the 68 kDa polypeptide is folded into two distinct structural domains [l]. The smaller N-terminal domain represents the center for 3'-5' exonuclease activity while the larger C-terminal domain consists of the DNApolymerase function [2]. The polymerase domain contains a large cleft which can accommodate both the dNTP substrate and DNA-template primer. Site-specific chemical modifications of the enzyme have enabled identification of several amino-acid residues in the large cleft, which either participate in the dNTP-binding or in the DNA-template-binding functions. Thus, Pandey et al. [5], by using ultraviolet-mediated cross-linking of dNTP to the Klenow fragment, have shown that His881 is the site for dNTP cross-linking [ 3 ] . Rush and Konigsberg have identified Tyr766 as the site for
cross-linking of a photoaffinity dNTP analog, 8- azido dATP [4] ; Pandey et al. [5] and Pandey and Mod& [6] have identified Arg682 as the probable site interacting with phosphoryl groups of dNTP. Site-directed mutagenesis together with chemical modifications have further demonstrated that DNAtemplate primer also interacts within the large cleft [7-91. However, recent molecular modeling of Klenow fragment has suggested that in the prepolymerization complex there is no direct contact between Arg682 and the triphosphate chain of dNTP [lo]. Arg682 is the only positive residue in the active-site cleft which has been proposed to accept the PP, group released from dNTP after the nucleotidyl-transferase reaction [lo]. In order to further clarify the role of this residue in the catalytic process, site-directed mutagenesis of Arg682 was performed. Arg682 was replaced with a conserved and a non-conserved residue. To achieve this objective we have constructed a over-producing clone of the enzyme and used this clone to perform out site-directed mutagenesis to examine the role of Arg682 in the catalytic function.
Correspondence to V. N. Pandey, Department of Biochemistry and Molecular Biology, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, 185 South Orange Avenue, Newark, NJ 07103 USA Abbreviations. pol I, Esckerickia coli DNA polymerase I; PCR, polymerase chain reaction.
EXPERIMENTAL PROCEDURES Materials Expression vector PET-3a and expression strain E. coli BL-21 (DE3) were purchased from Novagen, USA. Tuq DNA
60 polymerase, dNTP and restriction enzymes were obtained from M/S Boehringer while the T7 DNA sequencing kit was from US Biochemicals. Synthetic template primers were obtained from Pharmacia and [32P]dNTPand [32P]ATPwere the products of BRIT, Bhabha Atomic Research Center, Bombay. Centriprep ultrafiltration units were from Amicon and were used according to the accompanying instructions. All other chemicals were of high-purity grade obtained from SISCO Research Lab.
Methods Polymerase-chain-reaction(PCR) amplification of the Klenow-coding region of the pol-I gene from E. coli genomic DNA
ing the cell suspension on ice for 45 min, 5 M NaCl and 20% Triton X-100 was added to a final concentration of 100 mM and 0.2%, respectively. The suspension was homogenized, sonicated briefly to decrease the viscosity and centrifuged at 12000Xg for 30 min to obtain the crude extract. The Klenow polypeptide from the crude extract was purified either by following the protocol of Joyce and Grindley [13] or by immunoaffinity column chromatography as described below. Polyclonal antibodies against the Klenow fragment were raised in rabbit and antibodies specific to the enzyme were purified by Klenow-Sepharose-4B affinity column essentially as described previously [14]. Monospecific antibodies thus obtained were used to prepare an immunoaffinity column by covalently linking them to protein-A Sepharose as described previously [lS]. The column containing 5 ml protein-A Sepharose linked with anti-Klenow immunoglobulins was activated by washing with 10 column volumes each of 3.5 M MgC1, in SO mM Tris/HCl, pH 8.0, SO mM Tris/HCl, pH 8.0, and finally with 100 mM NaCl in the same buffer. The crude extract was applied on the antibody column at a very slow flow rate (0.2 ml/min). The flow-through was collected and reapplied on the column twice. The column was washed thoroughly with 10 column vol. 100 mM NaCl in SO mM Tris/ HC1, pH 8.0 (TrisNaCl buffer). The Klenow polypeptide bound to the antibody column was eluted with 2 column vol. 3.5 M MgCl,. The eluates were dialyzed extensively against several changes of TrisNaCl buffer, concentrated by dialyzing against solid PEG 6000 and finally against 50% glycerol in TrisNaCl buffer containing 1 mM dithiothreitol.
Genomic DNA was isolated from E. coli HBlOl grown in Luria-Bertani medium following the standard protocols [ll]. The Klenow-coding region of E. coli pol-I gene was amplified by PCR with reagents from Boehringer Mannheim and a DNA thermal cycler from Perkin Elmer Cetus. PCR mixtures contained 50 mM KC1, 20 mM Tris/HCl, pH 8.4, 1.5 mM MgCl,, gelatin (1 mg/ml), 200 pM each of four dNTP, 2.5 U Taq DNA polymerase, 100 ng E. coli genomic DNA and 0.5 pg each of upstream and downstream primers/ 100 p1 reaction mixture. Thermal cycle parameters were 94"C, 2 min (denaturation); 42"C, 2 min (annealing); 72"C, 3 rnin (elongation) and a total of 30 cycles. A time delay of 7 rnin at 94°C (for initial denaturation of genomic DNA) and 5 rnin at 72°C (final extension) was introduced at the beginning and at the end, respectively. The following oligonucleotides were synthesized in an Applied Biosystem DNA synthesizer (model 380B) with phosphoramidite chemistry. Site-directed mutagenesis of cloned pold (Klenow) gene The upstream primer was TATGGGGCCATATGATTTCTTConstruction of the overproducer Klenow clone PET-3aATGAC and downstream primer was TATAGGGCAAGCT- K and the subsequent purification of biologically active TTTAGTGGGCCTGATCC. The upstream primer contains a Klenow enzyme have been described above. For the siteNdeI site (CATATG) and downstream primer contains a Hin- directed mutagenesis at Arg682, oligonucleotides corredIII site (AAGCTT), as underlined. Nucleotides near the 3' sponding to nucleotides 2031-2063 of the pol-I gene and ends of the upstream and downstream primers have hom- encoding the desired mutational changes at codon 682 ology with the 5' and 3' ends of the Klenow-gene fragment, ([R682A] or [R682K]) were synthesized in an Applied Biorespectively [121. Both primers contain additional nucleot- systems DNA synthesizer as described above. Mutations ides (clamping sequences) at the 5' end for optimal restric- were introduced in the appropriate region in a two-step PCR tion-enzyme recognition. [16, 171 using PET-3a-K as the template. First PCR was performed using a mutant oligonucleotide as the upstream primer along with a downstream primer (containing a HindIII Cloning and expression site; [13]) to amplify the 0.8 kb of the 1.8-kb Klenow gene The PCR product was gel purified, restricted with NdeI encoding the C-terminal region (residue 677 -928) of and HindIII, and ligated with PET-3a restricted with these Klenow polypeptide (Fig. 1). The PCR mixture and thermal two enzymes. Initial transformation and screening was per- cycle were as described above, except that 0.25 pg superformed in E. coli HB101. Prospective clones (PET-3a-K) coiled PET-3a-K was used as template along with 0.5 pg each were then introduced into E. coli BL-21 (DE3) for ex- of the mutant oligonucleotide and the downstream primer, pression. For the production of Klenow fragment, E. coli and the extension time at 72°C was 1.5 min. The 0.8-kb PCR BL21 (DE3) transformed with PET-3a-K was grown at 37°C product was gel-purified and the whole of the purified prodin Luria-Bertani medium containing 100 pg/ml ampicillin. uct was used as the downstream primer (megaprimer) in the When the culture reached an A,,, of 0.3, isopropyl thio-P-D- second PCR, along with 0.5 pg of the upstream primer (congalactopyranoside was added to 100 pM and growth was taining a NdeI site) to amplify the full-length 1.8-kb mutated continued for another 2 h, after which the culture was quickly Klenow gene. The double-stranded megaprimer was used dichilled and cells were harvested by centrifugation. rectly without strand separation; the amount of PET-3a-K template was increased to 1.S - 3 pg for effective competition for the priming strand of the megaprimer which is essential Purification of the Klenow polypeptide for successful amplification. The final PCR product was gel The cells grown and harvested as above were resus- purified, restricted with NdeI and HindIII and ligated with pended in the lysis buffer (1 ml/l00 mg cells) containing PET-3a which was restricted with the same enzyme. Screen0.2% lysozyme. The lysis buffer contained SO mM Tris/HCI, ing of the prospective clones was performed in E. coli HB pH 8.0, 1 mM dithiothreitol and 2 mM EDTA. After incubat- 101. The size of the 1.8 kb insert and mutations were con-
61 firmed by restriction analysis and dideoxy sequencing [ 181 of several clones of each mutant. Purification of (R682Al and [R682K] Klenow fragments The two PET-3a-K clones containing the desired mutational changes in codon 682 of the Klenow (R+A and R-K) were introduced in E. coli BL-21 (DE3). The mutant proteins were induced and purified as described for wildtype Klenow enzyme except that a gel-filtration step was also included to remove any contaminating DNA pol I arising from the host cell. Determination of processivity
10 pmol (27.4 ng) (dA), was labeled with [32P]ATPat its 5' end and was annealed with 4 pmol (1.21 pg) (dT)400.It was then used as the template primer for the determination of the processive nature of DNA synthesis. The appropriate enzyme was first incubated with the template primer in an incubation mixture containing 50 mM Tris/HCl, pH 7.5, 2 mM MgCl,, 3 nM primer termini and 100 nM Klenow fragment in a total volume of 2 p1. After incubation for 1 min at room temperature, the polymerase reaction was initiated by the addition of 3 pl 100 pM dATP, DNA trap equivalent to approximately 50 pM primer termini, 50 mM TrisMCl, pH 7.5, and 2 mM MgCl,. The DNA trap was prepared from calf thymus DNA essentially as described by Joyce [19]. The reaction was allowed to continue for 1 min then terminated by the addition of 1 p1 1% SDS, 100 mh4 EDTA, followed by freezing in dry ice. Samples were analyzed on a denaturing 20% polyacrylamide gel, autoradiographed and the moll 100 mol of each DNA product was quantified by densitometric scanning of the autoradiogram. The processivity was calculated from this data as described by McClure and Chow
Fig. 1. Amplification of the 1.8-kb fragment of pol-I gene corresponding to the Klenow-coding region. Amplification by PCR was performed as described in Materials and Methods using upstream and downstream oligonucleotides as the primers and E. coli genomic DNA as the template.
POI. Enzyme assay Polymerase activity of the Klenow fragment was assayed as described before [3, 5 , 61 using activated calf thymus DNA or synthetic template primers and [3H]dNTP or [a32P]dNTPas the source of radiolabeled substrates.
PCH AMPLIFIED hLENOW GENE FRAGMENT
1 RESTRICT W I M Nde I AND Hmd I l l
L
LIGATE INTO DET 3d
RESULTS Cloning and expression of Klenow-coding region of pol I gene Using E . coli genomic DNA as template and synthetic oligonucleotides with overhanging NdeI and HindIII sequences as primers, the pol-I-gene fragment corresponding to the Klenow-coding region was selectively amplified by PCR (Fig. 1). The 3.8-kb PCR product was inserted into an expression vector PET-3a (Fig. 2). Initial transformation and screening of the recombinant PET-3a-K containing the Klenow-coding region was performed in E. coli HB 101. Several positive clones were subjected to DNA sequencing [18] and restriction analysis to determine the presence of the 1.8-kb Klenow insert. The prospective PET-3a-K clones were then introduced into an expression strain E. coli BL-21 (DE3), a lysogen containing the /z derivative prophage DE3 in which the T7RNA-polymerase gene is under the control of the UV-5 promoter [21]. The transformants were induced with isopropyl-
, I
, t
*I ' I
Of
- .-.
-
- NLY. .........a A G G A G A T A ~A c A TAT=
mRNA
+m
TAATACGACTCACTAT;~GGGAGA
SD
Met
Fig. 2. Cloning of PCR-amplified (Klenow-coding) 1.8-kb pol-Igene fragment into PET-3a.The 1 .S-kb PCR product was restricted with NdeI and HindIII and ligated to vector PET-3a digested with the same restriction enzymes. The positive clones were screened in E. coli HB101. SD, Shine- Dalgarno sequence; On, origin of plasmid replication ; bla, ,f?-lactamase-codingregion.
thio-P-D-galactopyranoside and total cellular proteins were analyzed by SDSPAGE. Several positive clones were induced and each of them expressed a major polypeptide of 68 kDa matching with the standard Klenow fragment
62 Oligonucleotides c 0 1 1 t a i n i ng m u t a t e d codon 2063
2031
*03 f3CAAAACATTCCGGT&AACGAAGAAGGTC(?063
682
