Solute Transport Proteins and the Outer Membrane Protein NmpC ...

Download PDF
2 downloads 0 Views 273KB Size Report
Comment
Aug 13, 2010 - Lifang Ruan,† Aaron Pleitner, Michael G. Gänzle,* and Lynn M. McMullen ...... Mackey, B. M., C. A. Miles, E. Parsons, and D. A. Seymour. 1991.
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2011, p. 2961–2967 0099-2240/11/$12.00 doi:10.1128/AEM.01930-10 Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Vol. 77, No. 9

Solute Transport Proteins and the Outer Membrane Protein NmpC Contribute to Heat Resistance of Escherichia coli AW1.7䌤 Lifang Ruan,† Aaron Pleitner, Michael G. Ga¨nzle,* and Lynn M. McMullen Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, Alberta, Canada Received 13 August 2010/Accepted 6 March 2011

This study aimed to elucidate determinants of heat resistance in Escherichia coli by comparing the composition of membrane lipids, as well as gene expression, in heat-resistant E. coli AW1.7 and heat-sensitive E. coli GGG10 with or without heat shock. The survival of E. coli AW1.7 at late exponential phase was 100-fold higher than that of E. coli GGG10 after incubation at 60°C for 15 min. The cytoplasmic membrane of E. coli AW1.7 contained a higher proportion of saturated and cyclopropane fatty acids than that of E. coli GGG10. Microarray hybridization of cDNA libraries obtained from exponentially growing or heat-shocked cultures was performed to compare gene expression in these two strains. Expression of selected genes from different functional groups was quantified by quantitative PCR. DnaK and 30S and 50S ribosomal subunits were overexpressed in E. coli GGG10 relative to E. coli AW1.7 upon heat shock at 50°C, indicating improved ribosome stability. The outer membrane porin NmpC and several transport proteins were overexpressed in exponentially growing E. coli AW1.7. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of membrane properties confirmed that NmpC is present in the outer membrane of E. coli AW1.7 but not in that of E. coli GGG10. Expression of NmpC in E. coli GGG10 increased survival at 60°C 50- to 1,000-fold. In conclusion, the outer membrane porin NmpC contributes to heat resistance in E. coli AW1.7, but the heat resistance of this strain is dependent on additional factors, which likely include the composition of membrane lipids, as well as solute transport proteins.

transcriptional regulator activating genes involved in periplasmic functions (15), and those that encode the starvation-induced proteins UspA and GrpE (45). Intervention steps to control E. coli during beef processing include thermal treatments such as carcass steam pasteurization or hot water washes. Some strains of E. coli isolated from beef processing plants (7) exhibit exceptional heat resistance. E. coli DM18.3 and AW1.7, both isolated from beef carcasses after steam and lactic acid interventions, exhibit D60 values of more than 10 and 60 min, respectively (17). Counts of E. coli AW1.7 bacteria inoculated into ground beef formed into burger patties and cooked to an internal temperature of 71°C were reduced by only 5 log units (17). The heat resistance of E. coli AW1.7 exceeds the resistance observed in other strains after acid or heat adaptation or the constitutive expression of heat shock proteins (14, 17, 21, 37). It was therefore the aim of this study to elucidate determinants of heat resistance in E. coli by comparing gene expression in heat-resistant E. coli AW1.7 to gene expression in E. coli GGG10, a heat-sensitive isolate that also was obtained from a beef processing facility. Microarray hybridization of cDNA libraries was performed to compare gene expression, and selected microarray data were confirmed by qPCR and protein analysis.

Escherichia coli is a common contaminant of the food supply. The majority of the strains of this species are not pathogenic; however, their relatively high resistance to environmental insults and the occurrence of virotypes with a low infectious dose, particularly enterohemorrhagic E. coli, make E. coli an organism of major concern in the production of minimally processed foods, particularly produce and fresh beef (11). Most strains of E. coli have a D60 value (the duration of heat treatment at 60°C required to reduce the number of microorganisms to 1/10 of the initial value) of less than 1 min. However, the heat resistance of E. coli is highly variable among different strains and individual strains exhibit D60 values of up to 6.5 min (8, 21, 25, 37). The heat resistance of individual strains of E. coli relates to their ability adapt to heat stress by the homoviscous adaptation of the plasma membrane, as well as the synthesis of heat shock proteins (20, 43). The ␴32induced expression of heat shock proteins after sublethal thermal stress increases resistance to lethal heat treatment (43; for a review, see reference 6). Increased basal expression of the heat shock proteins DnaK, Lon, and ClpX was linked to the increased heat resistance of E. coli mutants LMM1010, LMM1020, and LMM 1030 (1, 21). The ␴S-mediated general stress response additionally contributes to acid, heat, pressure, and salt resistance in E. coli (2, 14, 22, 38). Other genes contributing to increased heat resistance include evgA, a master

MATERIALS AND METHODS Bacterial strains and growth conditions. Heat-resistant E. coli AW1.7 and heat-sensitive E. coli GGG10 were cultivated aerobically in Luria-Bertani (LB) medium at 37°C; broth cultures were agitated at 200 rpm. Cultures were inoculated from a single colony, incubated overnight, subcultured with a 1% inoculum, and grown to the late exponential growth phase, corresponding to an optical density at 600 nm of 0.6 to 0.7. Determination of the heat resistance of E. coli AW1.7 and GGG10. The heat resistance of E. coli AW1.7 and GGG10 was studied by incubation of late-

* Corresponding author. Mailing address: University of Alberta, Department of Agricultural, Food and Nutritional Science, 4-10 Ag/ For Centre, Edmonton, AB, Canada T6G 2P5. Phone: (780) 492-0774. Fax: (780) 492-4265. E-mail: [email protected]. † Present address: State Key Lab of Agricultural Microbiology, Huazhong Agricultural University, Wuhan, People’s Republic of China. 䌤 Published ahead of print on 11 March 2011. 2961

2962

RUAN ET AL.

exponential-phase cultures in 1.5-ml plastic tubes in a water bath maintained at 60 ⫾ 0.5°C for 5, 15, and 50 min. Cell counts were determined by plating serial 10-fold dilutions of the samples on LB agar. To determine the influence of the heating medium on heat resistance, cells from late-exponential-phase cultures were washed twice with 0.85% NaCl or with 0.85% NaCl–1% tryptone, resuspended in 0.85% NaCl or in 0.85% NaCl–1% tryptone, respectively, and incubated at 60°C. Experiments were carried out in triplicate, and means ⫾ standard deviations are reported. Analysis of membrane fatty acid composition. Cells from late-exponentialphase cultures or late-exponential-phase cells heat shocked by exposure to 50°C for 15 min were harvested by centrifugation and washed twice with Tris HCl (100 mM, pH 7.5). Cells were maintained at 37 and 50°C, respectively, throughout the washing and centrifugations steps by tempering centrifuges and washing buffers at 37 and 50°C, respectively. Cells were frozen in liquid nitrogen, freeze-dried, and shipped to the Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Germany) for analysis of their membrane fatty acid composition. RNA extraction and processing. RNA was isolated from late-exponentialphase cultures or from late-exponential-phase cells heat shocked by exposure to 50°C for 15 min. For RNA isolation, a 0.5 ml volume of the culture was mixed with 1 ml of RNAprotect (Qiagen, Ontario, Canada), and RNA was isolated using the RNeasy Mini kit (Qiagen). RNA was quantified with a Nanodrop spectrophotometer (Thermo Scientific, Wilmington, MA), and RNA quality was determined with a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA). RNA samples (approximately 30 ␮g) were treated with 1 U of RNase-free DNase I (Ambion, Streetsville, Ontario, Canada) at 37°C for 30 min, and 1 U of RNase inhibitor (Ambion) was added prior to storage at 4°C. RNA was reverse transcribed using the Array 900MPX Expression Array Detection Kit (Genisphere, Hatfield, PA) according to the instructions of the manufacturer. The cDNA was purified using the MinElute PCR Purification Kit (Qiagen), and the purified DNA was used for microarray and qPCR experiments. Determination of expression ratios by DNA microarray and qPCR analyses. The cDNA was labeled with the Array 900MPX Expression Array Detection Kit (Genisphere) according to the instructions of the supplier and hybridized to 3-by-6,000 E. coli microarray slides (Department of Biological Science, University of Alberta, Edmonton, Canada). The microarray slides contain 5,978 70-mer probes printed in triplicate, which represent open reading frames (ORFs) in the genomes of E. coli strains K-12, O157:H7 EDL933, and O157:H7 Sakai. Three independent biological repeats were analyzed, and technical repeats (dye swap) were performed for two of three biological repeats. Arrays were scanned with GenePix 4000B (Molecular Devices, Sunnyvale, CA). Raw data were normalized and log2 transformed with the Acuity 4.0 software package, and data with low fluorescence intensities were eliminated. Genes were considered to be differentially expressed if the absolute values of log2 mean expression ratios were ⱖ1. Student’s t test was used to test whether the difference in gene expression between AW1.7 and GGG10 was significant at the P ⬍ 0.05 level (data not shown). The expression ratio of selected genes representing different functional groups was verified by quantitative PCR (qPCR) using a StepOnePlus real-time PCR machine (Applied Biosystems, Concord, Ontario, Canada). Primers were designed to amplify 50 to 150 bp close to the 3⬘ end of the target genes (Table 1). PCR was carried out with cDNA as the template and the SYBR green reaction mixture (Applied Biosystems). PCR conditions were as follows: a hot start (2 min at 95°C), 35 cycles of 15 s at 95°C and 1 min at 60°C, and a melt curve stage (15 s at 95°C, 1 min at 60°C). Relative quantification of mRNA was achieved with the ⌬⌬CT calculation using gapA, which encodes glyceraldehyde 3-phosphate dehydrogenase, as the reference gene (41). A ⌬CT was calculated as CT (target gene) ⫺ CT (gapA), ⌬⌬CT values were calculated as ⌬CT (AW1.7) ⫺ ⌬CT (GGG10), and the expression ratios were calculated as 2⫺⌬⌬CT. Expression ratios were determined in three independent experiments. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and sequence analysis of membrane proteins. Total membrane proteins were extracted from 1 liter of late-exponential-phase cultures of E. coli AW1.7 and GGG10. Cells were harvested by centrifugation and resuspended in 100 ml of ME buffer (100 mM morpholinepropanesulfonic acid [MOPS], 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, pH 7.0). Cells were disrupted by passage through a French press 3 times, and the volume of the lysate was adjusted to 320 ml. Cellular debris was removed by centrifugation at 8,600 ⫻ g for 10 min at 4°C, and the membrane fraction was harvested by centrifugation at 117,734 ⫻ g for 1.5 h at 4°C. The membrane fraction was resuspended in 60 ml ME buffer, and 5 ml of the resuspended membranes was layered on top of 15 ml of 55% sucrose solution in 26-ml centrifuge tubes and overlaid with ME. Tubes were centrifuged at 117,734 ⫻ g for 1.5 h at 4°C, and the dark band representing the membrane fraction was collected and mixed with 50 ml ME buffer. The membrane fraction

APPL. ENVIRON. MICROBIOL. TABLE 1. Primers used to determine gene expression ratios in E. coli AW1.7 and GGG10 Primer

Sequence (forward/reverse)

gapA ...........GAAAGGCGTTCTGGGCTACA/GCAAACTTCGCCG TTGAAAT potH ...........ATCGTGCCGCTGACTAAAGG/GCAGTTCCGGGAT CACAAAC nmpC .........TTCGAAGTAGTTGCACAATATCAGTTC/CCCAAG TCTTTTCCTTTAGATTGC trs5-9 ..........AGGGATAACCGGGCAAACA/CGATGGAAGATGC TCTGTACGA tpx...............CGTTATCACCCTCTCCACTTTCC/AGTGGGCCATC AGCAATTG dnaK...........GTACGCGACGCAGAAGCTAAC/CAGATGGTCGC CCTGGTT rlpD ............GAAAAGCATCCTGTCCGAACTG/TTCGGCGCTTC TACAGAGAAC ompA..........CAAGATCTCCGCACGTGGTA/GCACGCTGTTTCA CGTTGTC dinJ.............CGCGTAAATCAAACGGCAAT/TGGGCATAACCCT CACA hokD ..........GGCCGGTTCGGATTCG/CGGCACTGGTAACGA GGAA fimA ...........CCTGAATAACGGAACCAATACCA/GCCCCGGTTG CAAAATAA

was collected by centrifugation at 117,734 ⫻ g for 1.5 h at 4°C and washed with ME buffer. The membrane preparation from 1 liter of culture was resuspended in 10 ml of ME buffer. The protein concentration of the membrane fractions was determined with the Bradford assay. Samples of membrane preparations representing 20 ␮g of protein were separated on 13.5% Tricine gel and stained with Coomassie blue. Bands of approximately 38 kDa were excised from the gel, reduced with 5 mM dithiothreitol, carbamidomethylated with 10 mM iodoacetamide, and digested overnight with 0.05 g/liter modified bovine trypsin (Promega, Madison, WI) at 30°C. Peptides were identified using liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis (Department of Chemistry, Mass Spectrometry Facility, University of Alberta, Edmonton, Canada). Mass spectra were analyzed using PEAKS Studio Software (Bioinformatics Solutions Inc., Waterloo, Canada). Expression of nmpC in E. coli GGG10 and yafQ-dinJ in E. coli AW1.7. The gene coding for NmpC was amplified from E. coli GGG10 and AW1.7 with forward and reverse primers ATAAAGCTTGGTTTATATAGTTAGAAGCAAGG TGTC and TAAAAGCTTCTCGCAGACAAAGCGGGTGTAAAT, respectively. The PCR conditions were as follows: a hot start (10 min at 95°C); 34 cycles of 45 s at 95°C, 45 s at 55°C, and 3 (GGG10) or 2 (AW1.7) min at 72°C; and 10 min at 72°C. The size of the nmpC amplicon from E. coli AW1.7 was 1,931 bp and included the 110-bp promoter sequence upstream of the nmpC coding region. Plasmid pYFP (Clontech, Mountain View, CA) was digested with XbaI to remove the insert yfp. The nmpC amplicon from E. coli AW1.7 was digested with HindIII and subcloned into pYFP to replace the gene coding for YFP. E. coli GGG10 was transformed with the resulting plasmid, pYFP-nmpC. The genes coding for yafQ-dinJ were amplified from GGG10 using the primers yafQ-dinJF (AAAAAGCTTAAACGGTTACACACGCCAGGA) and yafQ-dinJR (TACA AGCTTATGGCTGGTCATGCTTTAATGTTGC). The PCR conditions were as follows: a hot start (10 min at 95°C); 34 cycles of 45 s at 95°C, 45 s at 55°C, and 1 min at 72°C; and 10 min at 72°C. The PCR product of yafQ-dinJ from E. coli GGG10, 812 bp including the 137-bp promoter sequence upstream of the yafQ coding region, was digested with HindIII, subcloned into the vector pYFP to replace the gene coding for yellow fluorescent protein (YFP), and E. coli AW1.7 was transformed with the resulting plasmid, pYFP-yafQ-dinJ. The heat resistance of E. coli AW1.7 harboring pYFP or pYFP-yafQ-dinJ and E. coli GGG10 harboring pYFP or pYFP-nmpC was determined by exposure to 60°C in a water bath for 1, 2, and 3 min (E. coli GGG10) or 2, 4, 8, and 16 min (E. coli AW1.7). Cell counts were determined by plating 10-fold serial dilutions onto LB agar. Microarray data accession number. Microarray data were submitted to the Gene Expression Omnibus at www.ncbi.nlm.nih.gov/geo and assigned accession number GSE27607.

VOL. 77, 2011

MECHANISMS OF HEAT RESISTANCE OF E. COLI

TABLE 2. Membrane fatty acid compositions of E. coli AW1.7 and GGG 10 with and without heat shock % of total membrane fatty acids in: Late-exponentialphase cells

Compound

C12:0 C14:0 C15:0 C16:1 ISO I C16:1 C16:0 C17:0 cyclopropane C17:0 C18:1 C19:0 cyclopropane a b

Heat-shockeda cells

AW1.7

GGG10

AW1.7

GGG10

3.62 7.47 2.97 8.16 4.02 32.11 21.50 2.06 10.21 8.15

3.51 7.08 NDb 8.02 5.92 33.81 19.64 ND 13.03 5.76

3.65 7.65 2.98 8.37 4.87 32.36 20.13 2.03 9.02 8.51

3.69 7.33 ND 8.50 7.67 34.61 17.10 ND 12.94 4.88

For 15 min at 50°C. ND, not detected.

RESULTS Heat resistance of late-exponential-phase cultures of E. coli AW1.7 and GGG10. The exceptional heat resistance of E. coli AW1.7 that was previously observed in stationary-phase cultures (17) was confirmed for late-exponential-phase cultures. Incubation of E. coli GGG10 at 60°C for 15 min reduced cell counts by 4.43 ⫾ 0.18 log CFU/ml. In contrast, cell counts of E. coli AW1.7 were reduced by 1.6 ⫾ 0.4 log CFU/ml. Membrane fatty acid composition of E. coli AW1.7 and GGG10. Homoviscous adaptation of the cytoplasmic membrane through alteration of membrane lipid composition maintains bacterial membranes in a functional, liquid crystalline state during heat stress (5, 20, 39). To determine whether an altered profile of membrane lipids contributes to the heat resistance of E. coli AW1.7, the membrane fatty acid compo-

2963

sition of late-exponential-phase and heat-stressed cultures was compared to that of E. coli GGG10 (Table 2). The ratio of saturated to unsaturated fatty acids was higher in E. coli AW1.7 (2.16 and 2.18 at 37 and 50°C, respectively) than that of E. coli GGG10 (1.65 and 1.57, respectively). The proportion of 17:0 and 19:0 cyclopropane fatty acids was slightly higher in E. coli AW1.7 than in E. coli GGG10, corresponding to lower levels of 16:1 and 18:1 unsaturated fatty acids, which are substrates for conversion to cyclopropane fatty acids. The oddnumbered 15:0 and C17:0 saturated fatty acids were present in the heat-resistant but not in the heat-sensitive strain. No major differences in fatty acid composition between late-exponentialphase cultures and heat-shocked cultures were noted. Global analysis of gene expression in E. coli AW1.7 and GGG10. Global gene expression in late-exponential-phase cultures of E. coli AW1.7 was compared to that in E. coli GGG10 by microarray analysis. Nineteen genes with known or predicted functions were differentially expressed in late-exponential-phase cultures of E. coli AW1.7 and GGG10 (Table 3). Seven genes were overexpressed in E. coli AW1.7, i.e., those for one outer membrane porin and three (putative) transport proteins, two genes related to mobile genetic elements (transposases), and the gene for a putative epimerase (Table 3). Five genes overexpressed in E. coli GGG10 relate to mobile genetic elements (transposons and prophages), two genes relate vto the cell envelope (O antigen and pili), and two genes (dinJ and hokD) code for toxin-antitoxin systems. To determine whether the ability of strains to stage an effective heat shock response contributes to heat resistance, gene expression in cultures was analyzed after heat shock. Twentyseven genes were differentially expressed in E. coli AW1.7 and GGG10 after a heat shock for 15 min at 50°C (Table 4). Four genes with known or predicted functions were overexpressed in E. coli AW1.7, and potH, coding for a putrescine ABC trans-

TABLE 3. Differential gene expression of E. coli AW1.7 and GGG10 cultured at 37°C as determined by microarray analysis Genea

Genes overexpressed in E. coli AW1.7 nmpC trs5-5 trs5-9 potH Putative yicM hisM Genes overexpressed in E. coli GGG10 Putative Putative Putative sgcA Putative Putative ynjC dinJ ymcD hokD Putative fimA a

Fold expression (AW1.7/GGG10)

21 11 8.4 4.4 3.8 3.6 3.5 0.34 0.31 0.30 0.27 0.22 0.20 0.20 0.18 0.15 0.15 0.12 0.088

Hypothetical proteins with no known function are not listed.

Function

Outer membrane porin protein C precursor; locus of qsr prophage IS5 transposase and trans-activator IS5 transposase Putrescine ABC transporter permease protein PotH Putative UDP-galactose 4-epimerase Predicted transporter Histidine/lysine/arginine/ornithine transporter subunit Head-tail preconnector gp5 phage portal protein lambda family Putative ATP-dependent DNA helicase (together with 3 adjacent ORFs) Putative minor tail protein Putative phosphotransferase system enzyme II A component Partial putative tail component of prophage CP-933R Putative antitermination protein Q for prophage CP-933V Putative transport system permease protein YafQ-DinJ toxin-antitoxin system, damage-inducible protein J O-antigen formation Small toxin polypeptide destructive to membrane potential Putative transposase within prophage Major type 1 subunit fimbrin (pilin)

2964

APPL. ENVIRON. MICROBIOL.

RUAN ET AL.

TABLE 4. Differential gene expression of E. coli AW1.7 and GGG 10 cultured at 37°C and heat shocked at 50°C as determined by microarray analysis Genea

Fold expression (AW1.7/GGG10)

Function

Genes overexpressed in E. coli AW1.7 potH yicM yaeR yadL

9.2 6.0 5.7 2.6

Putrescine ABC transporter permease protein PotH Predicted transporter Predicted lyase Predicted fimbria-like adhesin protein

Genes overexpressed in E. coli GGG10 ompA Putative slyA dinJ dnaK ydfI nfi Putative rpsK

0.44 0.34 0.31 0.30 0.29 0.29 0.27 0.26 0.25

Outer membrane protein A Putative superinfection exclusion protein DNA-binding transcriptional activator Predicted antitoxin of YafQ-DinJ toxin-antitoxin system Chaperone DnaK, cochaperone with DnaJ Predicted mannonate dehydrogenase Endonuclease V Putative antitermination protein Q for prophage CP-933V 30S ribosomal subunit protein S11

Putative Putative yfiD rpsC fimA hokD cpxP yccV Putative Putative rplD yfiA rpmC rpsG

0.24 0.23 0.20 0.19 0.18 0.18 0.16 0.16 0.15 0.15 0.15 0.14 0.13 0.13

Unknown protein encoded by cryptic prophage CP-933P Unknown protein encoded by prophage CP-933K Pyruvate formate lyase subunit 30S ribosomal subunit protein S3 Major type 1 subunit fimbrin Small toxin polypeptide Periplasmic protein combats stress DNA-binding protein, hemimethylated Transcription regulator Ler Pseudogene, e14 prophage; predicted side tail fiber protein 50S ribosomal subunit protein L4 Cold shock protein associated with 30S ribosomal subunit 50S ribosomal subunit protein L29 30S ribosomal subunit protein S7

a

Hypothetical proteins with unknown function are not listed.

port protein, and the predicted-transporter-encoding gene yicM were overexpressed with and without heat shock. The genes dinJ and hokD, as well as those for several phage proteins, were overexpressed in E. coli GGG10 with and without heat shock. Additional genes overexpressed in E. coli GGG10 upon heat shock include ompA, coding for an outer membrane porin, and genes related to ribosome function (rpsK, rpsC, rplD, rpmC, and rpsG) or the stress response (dnaK, cpxP, and yfiA). The quantification of mRNA levels by qPCR confirmed the differential gene expression determined by microarray analysis in all cases (Fig. 1). For several genes, a higher expression ratio was observed by qPCR than by microarray analysis (Fig. 1). The nmpC gene could not be amplified with cDNA as the template in E. coli GGG10 and the primers shown in Table 1; likewise, fimA and dinJ were not expressed in E. coli AW1.7. The primers yafQ-dinJF and yafQ-dinJR, which target noncoding sequences upstream of yafQ and downstream of dinJ, respectively, amplified the operon with chromosomal DNA from E. coli GGG10 as the template but not from chromosomal DNA of E. coli AW1.7. However, dinJ was amplified with chromosomal DNA from E. coli AW1.7 as the template and primers targeting the coding region of dinJ (Table 1 and data not shown), indicating that dinJ may be silenced in E. coli AW1.7 by mutations upstream or downstream of the dinJ coding region.

Analysis of outer membrane porins in E. coli AW1.7 and GGG10. The porin NmpC is absent in most strains of E. coli, as nmpC expression is disrupted by an IS5 element near the 3⬘ end of the coding region (23, 35). The nmpC genes of E. coli

FIG. 1. Comparison of gene expression ratios determined by microarray analysis with the corresponding expression ratios as determined by qPCR. Filled symbols, expression of cells growing 37°C; open symbols, cells shocked at 50°C. Microarray and qPCR data are represented as means ⫾ standard deviations of three independent experiments. Genes that are not present in the genomes of one of the two strains are indicated.

VOL. 77, 2011

FIG. 2. Separation by SDS-PAGE of total membrane proteins isolated from E. coli AW1.7 and GGG10. A 20-␮g sample of protein was loaded per lane. Bands of interest were excised from the gel and sequenced by LC-MS/MS; the bands and the protein identification are indicated by arrows.

AW1.7 and GGG10 were amplified and sequenced. The molecular size of the nmpC amplicon from E. coli AW1.7 was 1,931 bp, and the size of the corresponding amplicon from E. coli GGG10 was 2,971 bp due to an insertion element in the coding region. To confirm the presence of NmpC in membranes of E. coli AW1.7, membrane proteins were separated by SDS-PAGE. The membrane protein patterns of these two strains were highly similar (Fig. 2). However, a band with an approximate Mr of 38,000 showed a higher intensity in E. coli AW1.7 than in E. coli GGG10. These bands were excised from SDS-PAGE gels for sequencing analysis by LC-MS/MS. Peptides present in the membrane fractions of E. coli AW1.7 matched NmpC (predicted Mr of 38,027; 39% coverage with a 99% score) and OmpC (predicted Mr of 38,307; 37% coverage with a 99% score). Only one outer membrane protein, OmpC (43% coverage with a 99% score), was detected in membrane fractions from E. coli GGG10. This result confirms, on the protein level, that the outer membrane porin NmpC is expressed in heat-resistant E. coli AW1.7 but not in heat-sensitive E. coli GGG10. Effect of amino acid supply on the heat resistance of E. coli AW1.7. Because several genes overexpressed in E. coli AW1.7 relate to the transport of amino acids or amines, the influence of the amino acid supply on the heat resistance of E. coli AW1.7 and GGG10 was determined. Numbers of E. coli AW1.7 bacteria were reduced from 9.3 ⫾ 0.2 to 6.9 ⫾ 0.5 log CFU/ml after treatment at 60°C for 50 min in saline with 1% tryptone; the lethal effect of the treatment was increased by 0.99 ⫾ 0.14 log if tryptone was omitted. In contrast, numbers of E. coli GGG10 bacteria were reduced from 9.5 ⫾ 0.2 to 6.7 ⫾ 0.7 log CFU/ml after treatment at 60°C for 5 min in saline with 1% tryptone, and the lethal effect was unchanged (difference of 0.0 ⫾ 0.16 log CFU/ml) if tryptone was omitted. This result indicates that the survival of heat-resistant E. coli AW1.7 at lethal temperatures is significantly affected by the supply of amino acids or peptides, while the survival of E. coli GGG10 is not dependent on the amino acid supply.

MECHANISMS OF HEAT RESISTANCE OF E. COLI

2965

FIG. 3. Cell counts of E. coli AW1.7 expressing yafQ-dinJ and E. coli GGG10 expressing nmpC after heating at 60°C. Genes coding for yafQ-dinJ were expressed in E. coli AW1.7 using plasmid pYFP, and the plasmid with the gene coding for YFP served as a control. The gene coding for nmpC was expressed in E. coli GGG10 using plasmid pYFP, and the plasmid with the gene coding for YFP served as a control. Symbols located on the x axis indicate cell counts below the detection limit of 2.7 log10 CFU ml⫺1.

Effect of nmpC and yafQ-dinJ expression on heat resistance of E. coli. The role of yafQ-dinJ in the heat resistance of E. coli was determined by expression in E. coli AW1.7. The heat resistance of E. coli AW1.7 harboring pYFP-yafQ-dinJ was not different from that of the control strain expressing YFP (Fig. 3). However, the survival of E. coli GGG10/pYFP-nmpC at 60°C was significantly improved compared to that of control strain E. coli GGG10/pYFP (Fig. 3). Cell counts were consistently higher throughout treatment and differed by about 3 and 2 log CFU/ml after 1 and 2 min of treatment; cell counts for both strains were below the detection limit after 3 min. The comparison of the heat resistance of isogenic E. coli strains GGG10/pYFP and GGG10/pYFP-nmpC clearly demonstrates a contribution of NmpC to heat resistance. However, E. coli GGG10/pYFP-nmpC remained substantially more susceptible to heat than did E. coli AW1.7, demonstrating that expression of NmpC alone explains only a part of the heat resistance and that other factors make a more substantial contribution. DISCUSSION This study aimed to elucidate the mechanisms contributing to the heat resistance of E. coli AW1.7. The comparison of gene expression in heat-resistant E. coli AW1.7 with that in heat-sensitive E. coli GGG10 and the overexpression of nmpC in E. coli GGG10 demonstrate that the outer membrane porin NmpC contributes to the heat resistance of E. coli AW1.7. However, heat resistance of E. coli AW1.7 is a complex phenotype and this study identified genes related to solute transport and the composition of the cytoplasmic membrane as likely additional contributors to heat resistance. Functional analysis of genes with an expression ratio of zero or infinity (nmpC in E. coli AW1.7 and yafQ-dinJ in E. coli GGG10) confirmed that analysis of differential gene expression is a suitable tool with which to identify genes that contribute to the heat resistance phenotype. However, because of the different origin of the strains, as well as differences in the sequences of specific genes, not all of the genes that are differentially expressed in the two strains were involved in heat resistance. The role of solutes in the heat resistance of E. coli AW1.7 and the

2966

RUAN ET AL.

contribution of mobile genetic elements to the acquisition of genes conferring heat resistance remain to be elucidated in further studies. Membrane fatty acid composition contributed to heat resistance in E. coli AW1.7. Adaptation to high growth temperatures increases levels of saturated fatty acids in the cytoplasmic membrane (16, 36). A higher ratio of saturated to unsaturated fatty acids is generally associated with a higher resistance to a lethal heat challenge (44). Acid adaptation in E. coli includes the synthesis of cyclopropane fatty acids from unsaturated fatty acids through the activity of ␴S-regulated CFA synthase. These changes in membrane fatty acid composition result in cells with lower membrane fluidity and increased acid and heat resistance (4, 9, 13). Levels of C17:0 and C19:0 cyclopropane fatty acids were higher in E. coli AW1.7 than in E. coli GGG10, with correspondingly lower levels of the respective precursor fatty acids. Two saturated fatty acids, 15:0 and 17:0, were detected in E. coli AW1.7 but not in E. coli GGG10. The higher concentrations of saturated and cyclopropane fatty acid in membranes of E. coli AW1.7 likely contribute to its heat resistance (4). Porins and heat resistance in E. coli AW1.7. NmpC is an outer membrane porin that forms pores in black lipid bilayers (24). Porins allow the selective movement of hydrophilic solutes through the outer membrane of Gram-negative bacteria (32). In most strains of E. coli, nmpC is not expressed, as it contains an IS5 insertion near the 3⬘ end of the coding region. In E. coli K-12, nmpC is located on the defective qsr⬘ prophage and can be activated by the loss of the IS5B insertion element (12, 23). The major porins normally present in E. coli are OmpC and OmpF (12). Porins are encoded by osmoresponsive genes in E. coli, are upregulated under osmotic stress, and contribute to the accumulation of high intracellular levels of compatible solutes (34). OmpC and OmpF are required for growth under hyperosmotic stress above pH 8 in E. coli (26). E. coli GGG10 harboring pYFP-nmpC exhibited substantially improved survival at 60°C. The increase in heat resistance observed upon the expression of NmpC in E. coli GGG10 was greater than the increase observed upon the induction of a heat shock response (20, 43), starvation (45), or overexpression of evgA, which encodes a transcriptional regulator (15). However, E. coli GGG10 harboring pYFP-nmpC was substantially less heat resistant than E. coli AW1.7. Moreover, among other slaughter plant isolates with D60 values of more than 10 min, a 1,931-bp amplicon encompassing nmpC, matching the genotype of E. coli AW1.7, was amplified from E. coli MB2.1 and GM11.5 but not from E. coli MB3.4, AW1.3, and DM18.3 (17; data not shown). Taken together, porin function and solute transport are linked to heat tolerance in E. coli AW1.7 but the contribution of NmpC expression alone does not explain the exceptional heat resistance of this strain. Transport proteins. Three of five genes overexpressed in E. coli AW1.7 code for transport proteins. Solute transport across the cytoplasmic membrane is necessary to complement NmpCmediated solute transport across the outer membrane. Cytoplasmic concentrations of amino acids and amines are modulated by the osmotic pressure of the medium. Levels of amino acids, primarily glutamate but also proline and histidine, are increased through transport or de novo biosynthesis upon osmotic upshock. Putrescine, the polyamine with the highest intracellular concentration in E. coli, is exported upon osmotic

APPL. ENVIRON. MICROBIOL.

upshock to balance the increase in the internal positive charge resulting from K⫹ uptake (31, 40). The response to hyperosmotic conditions increases the tolerance of E. coli and other bacteria to other stresses, including thermal inactivation (27, 29). The exceptional expression of NmpC and transport proteins likely contributes to the heat resistance of E. coli AW1.7 through an altered pool of cytoplasmic osmolytes. The observation that heat inactivation of E. coli AW1.7 but not that of E. coli GGG10 is dependent on the amino acid supply of the medium is in keeping with this hypothesis. Heat shock response. The constitutive expression of heat shock proteins was found to contribute to heat and pressure resistance in three strains of E. coli (1). However, heat shock proteins were not differentially expressed in E. coli AW1.7 and GGG10 at 37°C. However, E. coli GGG10 overexpressed the heat shock protein DnaK and several ribosomal proteins after exposure to 50°C. Ribosome dissociation is considered a major event in the thermal death of E. coli, and the 30S subunit is more temperature sensitive than the 50S subunit (28, 33). DnaK, a heat shock chaperone (2, 6), is also essential for ribosome assembly in heat-stressed E. coli (3). Simultaneous overexpression of 30S and 50S ribosomal subunits, DnaK, and the 30S ribosomal subunit-associated cold shock protein Yfia indicates that the ribosome stability of E. coli GGGF10 under heat shock conditions is lower than that of E. coli AW1.7. Mobile genetic elements and toxin-antitoxin systems. The genomic information of strains in the same species differs by up to 30%, particularly because of lateral gene transfer mediated by mobile genetic elements. Although the microarray slides employed in this study comprise all of the genes present in three strains of E. coli, it is possible that a substantial proportion of the genomic information in E. coli AW1.7 and GGG10 was not represented on the microarrays. Several differentially expressed genes relate to mobile genetic elements, including prophages, transposons, and toxin-antitoxin systems. Toxinantitoxin systems contribute to the maintenance of plasmids and other mobile genetic elements; however, they additionally may be involved in the adaptation to stress conditions (10, 18, 42). The E. coli relB operon consists of three genes designated relB, relE, and relF. HokD, encoded by relF (hokD), inhibits the growth of the host strain. Because significant relBEF mRNA is present in growing cells, hokD translation is probably inhibited posttranscriptionally (19). dinJ-yafQ is a chromosomally encoded antitoxin/toxin TA system in E. coli that shows significant similarity to relBE and also has been referred to as relBE-2 (18, 30). Induction of yafQ (relE-2) inhibits translation through mRNA degradation, but its toxicity is counteracted by the coexpression of dinJ (relB-2) (30). RelBE-mediated inhibition of translation may be advantageous in stressed cells, as it reduces translational errors and allows the cell to adapt to nutrient limitation (42). Components of two toxin-antitoxin systems were overexpressed in E. coli GGG10; however, expression of yafQ-dinJ in E. coli AW1.7 did not alter its heat resistance. Conclusions. Determination of the membrane composition of two beef isolates of E. coli differing in heat resistance and analysis of their gene expression revealed that the membrane composition of E. coli AW1.7 and its solute transport across the outer and cytoplasmic membranes are likely contributors to its heat resistance. The high heat resistance of E. coli AW1.7

VOL. 77, 2011

MECHANISMS OF HEAT RESISTANCE OF E. COLI

questions its inactivation by current thermal treatments in beef processing (17). Understanding of heat resistance may identify additional targets for better control of heat-resistant E. coli found on beef. ACKNOWLEDGMENTS This work was supported by grant 2007F085R from ALIDF. Michael Ga¨nzle acknowledges funding from the Canada Research Chairs Program. REFERENCES 1. Aertsen, A., et al. 2004. Heat shock protein-mediated resistance to high hydrostatic pressure in Escherichia coli. Appl. Environ. Microbiol. 70:2660– 2666. 2. Allen, K. J., D. Lepp, R. C. McKellar, and M. W. Griffiths. 2008. Examination of stress and virulence gene expression in Escherichia coli O157:H7 using targeted microarray analysis. Foodborne Pathog. Dis. 5:437–447. 3. Al Refaii, A., and J.-H. Alix. 2009. Ribosome biogenesis is temperaturedependent and delayed in Escherichia coli lacking the chaperones DnaK or DnaJ. Mol. Microbiol. 71:748–762. 4. Alvarez-Ordo ´n ˜ ez, A., A. Ferna ´ndez, M. Lo ´pez, R. Arenas, and A. Bernardo. 2008. Modifications in membrane fatty acid composition of Salmonella typhimurium in response to growth conditions and their effect on heat resistance. Int. J. Food Microbiol. 123:212–219. 5. Arneborg, N., A. S. Salskov-Iversen, and T. E. Mathiasen. 1993. The effect of growth rate and other growth conditions on the lipid composition of Escherichia coli. Appl. Microbiol. Biotechnol. 39:353–357. 6. Arse`ne, F., T. Tomoyasu, and B. Bukau. 2000. The heat shock response of Escherichia coli. Int. J. Food. Microbiol. 55:3–9. 7. Aslam, M., G. G. Greer, F. Natress, C. O. Gill, and L. M. McMullen. 2004. Genotypic analysis of Escherichia coli recovered from product and equipment at a beef-packing plant. J. Appl. Microbiol. 97:78–86. 8. Benito, A., G. Ventoura, M. Casadei, T. Robinson, and B. Mackey. 1999. Variation in resistance of natural isolates of Escherichia coli O157 to high hydrostatic pressure, mild heat, and other stresses. Appl. Environ. Microbiol. 65:1564–1569. 9. Brown, J. L., T. Ross, T. A. McMeekin, and P. D. Nichols. 1997. Acid habituation of Escherichia coli and the potential role of cyclopropane fatty acids in low pH tolerance. Int. J. Food. Microbiol. 37:163–173. 10. Buts, L., J. Lah, M. H. Dao-Thi, L. Wyns, and R. Loris. 2005. Toxin-antitoxin modules as bacterial metabolic stress managers. Trends Biochem. Sci. 30: 672–679. 11. Caprioli, A., S. Morabito, H. Bruge`re, and E. Oswald. 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet. Res. 36:289–311. 12. Castillo-Keller, M., P. Vuong, and R. Misra. 2006. Novel mechanism of Escherichia coli porin regulation. J. Bacteriol. 188:576–586. 13. Chang, Y. Y., and J. J. Cronan. 1999. Membrane cyclopropane fatty acid content is a major factor in acid resistance of Escherichia coli. Mol. Microbiol. 33:249–259. 14. Cheville, A. M., W. Arnold, C. Buchrieser, M.-M. Cheng, and C. W. Kaspar. 1996. rpoS Regulation of acid, heat, and salt tolerance in Escherichia coli O157:H7. Appl. Environ. Microbiol. 62:1822–1824. 15. Christ, D., and J. W. Chin. 2008. Engineering Escherichia coli heat-resistance by synthetic gene amplification. Prot. Eng. Design Select. 21:121–125. 16. De Mendoza, D., and J. E. Cronan, Jr. 1983. Thermal regulation of membrane lipid fluidity in bacteria. Trends Biochem. Sci. 8:49–52. 17. Dlusskaya, E., L. M. McMullen, and M. G. Ga ¨nzle. 2011. Characterization of an extremely heat resistant Escherichia coli obtained from a beef processing facility. J. Appl. Microbiol. 110:840–849. 18. Gerdes, K., and E. G. H. Wagner. 2007. RNA antitoxins. Curr. Opin. Microbiol. 10:117–124. 19. Gotfredsen, M., and K. Gerdes. 1998. The Escherichia coli relBE genes belong to a new toxin-antitoxin gene family. Mol. Microbiol. 29:1065–1076. 20. Guyot, S., L. Pottier, E. Ferret, L. Gal, and P. Gervais. 2010. Physiological responses of Escherichia coli exposed to different heat-stress kinetics. Arch. Microbiol. 192:651–661.

2967

21. Hauben, K. J. A., et al. 1997. Escherichia coli mutants resistant to inactivation by high hydrostatic pressure. Appl. Environ. Microbiol. 63:945–950. 22. Hengge-Aronis, R. 2002. Signal transduction and regulatory mechanisms involved in control of the ␴S (RpoS) subunit of RNA polymerase. Microbiol. Mol. Biol. Rev. 66:373–395. 23. Highton, P. J., Y. Chang, W. J. Marcotte, Jr., and C. A. Schnaitman. 1985. Evidence that the outer membrane protein gene nmpC of Escherichia coli K-12 lies within the defective qsr⬘ prophage. J. Bacteriol. 162:256–262. 24. Hindahl, M. S., G. W. Crockford, and R. E. Hancock. 1984. Outer membrane protein NmpC of Escherichia coli: pore-forming properties in black lipid bilayers. J. Bacteriol. 159:1053–1055. 25. Juneja, V. K., and M. Friedman. 2008. Carvacrol and cinnamaldehyde facilitate thermal destruction of Escherichia coli O157:H7 in raw ground beef. J. Food Prot. 71:1604–1611. 26. Kaeriyama, M., et al. 2006. OmpC and OmpF are required for growth under hyperosmotic stress above pH 8 in Escherichia coli. Lett. Appl. Microbiol. 42:195–201. 27. Laroche, C., and P. Gervais. 2003. Unexpected thermal destruction of dried, glass bead-immobilized microorganisms as a function of water activity. Appl. Environ. Microbiol. 69:3015–3019. 28. Mackey, B. M., C. A. Miles, E. Parsons, and D. A. Seymour. 1991. Thermal denaturation of whole cells and cell components of Escherichia coli examined by differential scanning calorimetry. J. Gen. Microbiol. 137:2361–2374. 29. Mille, Y., L. Beney, and P. Gervais. 2002. Viability of Escherichia coli after combined osmotic and thermal treatment: a plasma membrane implication. Biochim. Biophys. Acta 1567:41–48. 30. Motieju ¯naite, R., J. Armalyte, A. Markuckas, and E. Suziedeliene. 2007. Escherichia coli dinJ-yafQ genes act as a toxin-antitoxin module. FEMS Microbiol. Lett. 268:112–119. 31. Munro, G. F., K. Hercules, J. Morgan, and W. Sauerbier. 1972. Dependence of the putrescine content of Escherichia coli on the osmotic strength of the medium. J. Biol. Chem. 247:1272–1280. 32. Nguyen, T. X., E. R. Alegre, and S. T. Kelley. 2006. Phylogenetic analysis of general bacterial porins: a phylogenomic case study. J. Mol. Microbiol. Biotechnol. 11:291–301. 33. Niven, G. W., C. A. Miles, and B. M. Mackey. 1999. The effects of hydrostatic pressure on ribosome conformation in Escherichia coli: an in vivo study using differential scanning calorimetry. Microbiology 145:419–425. 34. Pichereau, V., A. Hartke, and Y. Auffray. 2000. Starvation and osmotic stress induced multiresistances: influence of extracellular compounds. Int. J. Food Microbiol. 55:19–25. 35. Prilipov, A., P. S. Phale, R. Koebnik, C. Widmer, and J. P. Rosenbusch. 1998. Identification and characterization of two quiescent porin genes, nmpC and ompN, in Escherichia coli BE. J. Bacteriol. 180:3388–3392. 36. Quinn, P. J. 1981. The fluidity of cell membranes and its regulation. Prog. Biophys. Mol. Biol. 38:1–104. 37. Riordan, D., et al. 2000. Effects of acid adaptation, product pH, and heating on survival of Escherichia coli O157:H7 in pepperoni. Appl. Environ. Microbiol. 66:1726–1729. 38. Robey, M., et al. 2001. Variation in resistance to high hydrostatic pressure and rpoS heterogeneity in natural isolates of Escherichia coli O157:H7. Appl. Environ. Microbiol. 67:4901–4907. 39. Sinensky, M. 1974. Homeoviscous adaptation: a homeostatic process that regulates the viscosity of membrane lipids in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 71:522–525. 40. Sleator, R. D., and C. Hill. 2002. Bacterial osmoadaptation: the role of osmolytes in bacterial stress and virulence. FEMS Microbiol. Rev. 26:49–71. 41. Snyder, J. A., et al. 2004. Transcriptome of uropathogenic Escherichia coli during urinary tract infection. Infect. Immun. 72:6373–6381. 42. Wilson, A. N., and K. H. Nierhaus. 2005. RelBE or not to be. Nat. Struct. Mol. Biol. 12:282–284. 43. Yamamori, T., and T. Yura. 1982. Genetic control of heat-shock protein synthesis and its bearing on growth and thermal resistance in Escherichia coli K-12. Proc. Natl. Acad. Sci. U. S. A. 79:860–864. 44. Yuk, H.-G., and D. L. Marshall. 2003. Heat adaptation alters Escherichia coli O157:H7 membrane lipid composition and verotoxin production. Appl. Environ. Microbiol. 69:5115–5119. 45. Zhang, Y., and M. W. Griffiths. 2003. Induced expression of the heat shock protein genes uspA and grpE during starvation at low temperatures and their influence on thermal resistance of Escherichia coli O157:H7. J. Food Prot. 66:2045–2050.