Somatic mutation of the Peutz-Jeghers syndrome gene, LKB1 ... - Nature

Oncogene (1999) 18, 1777 ± 1780 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $12.00 http://www.stockton-press.co.uk/onc

SHORT REPORT

Somatic mutation of the Peutz-Jeghers syndrome gene, LKB1/STK11, in malignant melanoma Per Guldberg*,1, Per thor Straten1, Vibeke Ahrenkiel1, Tina Seremet1, Alexei F Kirkin1 and Jesper Zeuthen1 1

Department of Tumour Cell Biology, Institute of Cancer Biology, Danish Cancer Society, Strandboulevarden 49, DK-2100 Copenhagen, Denmark

Mutations in LKB1/STK11, a gene mapping to chromosome 19p13.3 and encoding a widely expressed serine/threonine kinase, were recently identi®ed as the cause of Peutz-Jeghers syndrome. Despite the hamartomatous polyps and increased cancer risk associated with this syndrome, somatic alterations in LKB1/STK11 have not been identi®ed in human tumours. Prompted by another feature of the syndrome, lentigines of the lips and oral mucosa, we evaluated the status of LKB1/ STK11 expression, deletion, and mutation in cell lines and tumour samples from 35 patients with sporadic malignant melanoma. Two somatic mutations were identi®ed, a nonsense mutation (Glu170Stop) causing exon skipping and intron retention, and a missense mutation (Asp194Tyr) aecting an invariant residue in the catalytic subunit of LKB1/STK11. Our data suggest that LKB1/STK11 may contribute to tumorigenesis in a small fraction of malignant melanomas. Keywords: STK11; LKB1; tumour suppressor; malignant melanoma; Peutz-Jeghers syndrome; serine/threonine kinase

Sporadic cutaneous malignant melanoma accounts for approximately 80% of all melanoma cases. The incidence and mortality of this cancer have increased considerably this century and the prognosis remains one of the most unfavourable in medicine (Koh, 1991), yet many of the major genetic events involved in tumour progression remain to be elucidated (Albino, 1995; Welch and Goldberg, 1997). Cytogenetic, loss of heterozygosity (LOH), and functional studies of malignant melanoma cells have identi®ed multiple nonrandom chromosomal changes which have been taken as evidence for the existence of speci®c tumour suppressor genes. The most commonly altered targets identi®ed thus far include chromosome arms 1q, 6q, 9p, 10q and 11q (Albino, 1995; Welch and Goldberg, 1997). Recently, alterations of the tumour suppressor genes p16INK4/CDKN2 and PTEN/MMAC1 on 9p and 10q, respectively, have been demonstrated in signi®cant proportions of melanoma lesions and cell lines (Kamb et al., 1994; Bartkova et al., 1996; Castellano

*Correspondence: P Guldberg Received 22 September 1998; revised 8 October 1998; accepted 9 October 1998

et al., 1997; Guldberg et al., 1997; Walker et al., 1998; Tsao et al., 1998), and the AIM1 gene has been suggested as a good candidate for the putative tumour suppressor on chromosome 6 (Ray et al., 1997). In addition to the nearly consistent changes associated with malignant melanoma progression, occasional allelic losses have been demonstrated at several other genetic loci (Healey et al., 1996; Welch and Goldberg, 1997). Such allelic losses may represent random genetic changes that are not causally implicated in the behaviour of the tumour. Alternatively, they may represent molecular tumour-suppressive pathways that are abrogated only rarely in melanoma, or they may represent rarely altered components of commonly altered pathways. An example of the latter situation is the p16-cyclin D/ Cdk4-pRB pathway which is abrogated through alteration of one of its components in virtually all melanoma cell lines, yet with p16INK4/CDKN2 being by far the most common genetic target (Bartkova et al., 1996; Walker et al., 1998). Recently, the LKB1/STK11 gene encoding a widely expressed serine/threonine kinase was identi®ed and mapped to the telomeric region of chromosome 19 (Jenne et al., 1998; Hemminki et al., 1998). Loss-offunction mutations in this gene were demonstrated in the germline of several individuals aected by PeutzJeghers syndrome, a rare dominantly inherited disease characterized by hamartomatous polyps in the gastrointestinal tract, melanin spots on the lips and buccal mucosa, and predisposition to many types of cancer (Giardiello et al., 1987). Interestingly, LKB1/STK11 mutations have not been found in sporadic carcinomas of the breast, testis and colon, tumours that are characteristic of Peutz-Jeghers syndrome, suggesting that the sporadic and syndromic tumour forms involve dierent molecular pathways (Bignell et al., 1998; Avizienyte et al., 1998). Malignant melanoma is not a general feature of Peutz-Jeghers syndrome and has only been reported in a few cases (Wong and Rajakulendran, 1996; Braitman, 1979). Nevertheless, considering the putative function of LKB1/STK11, the mucocutaneous hyperpigmentation associated with Peutz-Jeghers syndrome, and the demonstration of translocations in melanoma involving chromosome 19p13.2-13.3 (Parmiter et al., 1986), we have studied the status of LKB1/STK11 in cell lines and tumour samples from 35 patients with sporadic malignant melanoma. We ®rst reverse transcribed mRNA from 35 low-passage (passages 3 ± 6) melanoma cell lines and ampli®ed overlapping regions of LKB1/STK11 by PCR. In all lines, LKB1/

LKB1/STK11 mutations in malignant melanoma P Guldberg et al

1778

STK11 was found to be expressed at robust levels. However, RT ± PCR analysis of a region encompassing exons 3, 4 and 5 revealed the occurrence of two aberrant transcripts in the metastatic cell line FM55M1. The same pattern was observed in two cell lines, FM55P and FM55M2, established from the primary melanoma and a second metastasis from the same patient, whereas only the normally sized transcript was present in RNA isolated from the patient's blood (Figure 1a). Cloning and sequence analysis showed that the smaller of the abnormally sized products corresponded to the absence of exon 4 (nucleotides 465 ± 598) of the published LKB1/STK11 cDNA (GenBank accession number U63333), creating a junction between exons 3 and 5 (Figure 1b,c). The larger of the abnormal transcripts contained the entire sequence of intron 4. This combination of exon skipping and intron retention strongly indicated the presence of a mutation with substantial impact on RNA splicing. Sequence analysis of genomic DNA isolated from the three cell lines and from the original tumours showed that the acceptor and donor splice sites of exons 3, 4 and 5 all were unaected. However, at the ®rst position of codon 170 in exon 4 (corresponding to position 508 of the cDNA sequence), we identi®ed a C to T transition, resulting in the substitution of the normal glutamine codon (CAG) with a premature-termination codon (TAG) (Figure 2). Skipping of constitutive exons is a commonly observed eect of nonsense mutations in human disease genes (Homeyer et al., 1998), which suggests that open reading frame recognition is important for exon de®nition. Whether intron retention, as observed in this study, may also be the result of a nuclear-scanning mechanism for premature-termination codons remains unknown at this stage. Sequence analysis of genomic DNA demonstrated that all three melanoma cell lines had lost the wild-type allele and had retained the mutant allele (Figure 2), suggesting that the cells are completely devoid of LKB1/STK11 activity.

We next examined the entire coding region and all splice junctions of LKB1/STK11 in genomic DNA from the 35 cell lines by PCR in combination with denaturing gradient gel electrophoresis (DGGE) and direct sequencing (PCR primers and DGGE conditions are given in Table 1). In addition to FM55, distinct mobility shifts caused by single nucleotide substitutions were observed in three of the cell lines (Table 2). Two of these substitutions, at codon 119 (AAC to AAT) and codon 328 (ACC to ACT), respectively, did not lead to a change of the amino acid. The third substitution, a G to T transversion at the ®rst position of codon 194, was found in cell line FM92 and is predicted to cause the substitution of aspartic acid (GAC) with tyrosine (TAC). This mutation could be demonstrated in the uncultured melanoma specimen from which the cell line was established, but not in normal tissue from the patient, establishing its somatic nature and excluding the possibility of an in vitro artifact. The residue aected in FM92, Asp-194, is located within the catalytic subdomain of LKB1/STK11 and appears to be invariant in all protein kinases (Hanks and Quinn, 1991). In cAMP-dependent protein kinase, this residue has been shown to be essential for kinase function and to play a critical role in the phospho-

Figure 2 Sequence analysis of exon 4 of the LKB1/STK11 gene in genomic DNA isolated from blood (lane 1) and cell line FM55M1 (lane 2) from the same patient reveals the somatic nucleotide substitution (C?T) causing the introduction of a premature-termination codon

Figure 1 Aberrant splicing of LKB1/STK11 in FM55 melanoma cell lines. (a) RT ± PCR analysis (using primers 5'AGCGTTTCCCAGTGTGCCAG-3' and 5'-AGATGTCCACCTTGAAGCCGG-3') of LKB1/STK11 mRNA from cell lines FM55P, FM55M1, and FM55M2 (lanes 2 ± 4), and from the patient's blood (lane 5). Lane 1, 100-bp ladder. (b) Sequence analysis of the long transcript (lane 1), the short transcript (lane 2), and the normally sized transcript (lane 3). (c) Schematic representation of the splicing pattern observed in FM55 cell lines


1779

Table 1 Ampli®cation primers for DGGE-based mutation analysis of the LKB1/STK11 gene Exon

Primer 1

Primer 2

1A 1B 2 3 4 5 6 7 8 9

[50GC]-CGGCGGGACTCCAGGACC GGCAAGTACCTGATGGGGGAC CACCCCTGTCCTCTGTCCC [45GC]-CGCCCCCTGAGCTGTGTG [50GC]-AGGACGGGTGTGTGCTGCC CTGAGGGCTGCACGGCACC [45GC]-CGCCTTTCTTCCCTCCCCTC [45GC]-TCCTCGCCGGCTTCTCCTC [56GC]-CACTGCTTCTGGGCGTTTGC [60GC]-CTCAGCTCAGGCCACACTTGC

CCGTAAGAGCCTTCCCCCAGC [40GC]-CCCCGACCCCAGCAAGC [40GC]-CCCCGCGGTCCCAACA CCACCCTGGCCCCTGC GGCCCCCCCTAGCACGTG [50GC]-GGGGGGGCGGGGCAC CGGGCAGAGGGATGAGGCT TCCCTGCAGCCTCGGCC [10GC]-GGGCCCCCGCCAGACTC GCGCCCCACCTGCAGG

Size (bp) 261 218 176 197 230 232 226 165 295 314

All PCR mixtures contained 5% DMSO and were subjected to the following cycling parameters: 38 cycles at 948C for 30 s, 658C for 30 s, and 728C for 30 s. Ampli®cation of exon 3 was preceded by a denaturation step at 998C for 10 min. PCR products were analysed in a 6% polyacrylamide gel containing a linearly increasing gradient of denaturant from 20 ± 90% (100% denaturant=7 M urea and 40% formamide) (Abrams et al., 1992). The gel was run at 160 V for 4 ± 6 h in 16TAE buer kept at a constant temperature of 588C

Table 2 Summary of LKB1/STK11 mutations and sequence variants in melanoma Cell line FM55 FM92 FM58 FM60 a

Exon

Codon

Nucleotidea

Predicted eect

4 4 2 8

170 194 119 328

C508T G580T C357T C984T

Glu?Stop Asp?Tyr Silent Silent

Numbering according to Gen Bank accession number U63333

transfer mechanism, probably by participating in the nucleophilic attack of the g-phosphate of ATP (Gibbs et al., 1992). DGGE and sequence analysis of genomic DNA from cell line FM92 demonstrated retention of the wild-type LKB1/STK11 allele; however, sequence analysis of cDNA from the same cell line showed predominance of the mutated transcript (not shown). Whether the Asp194Tyr mutation causes mRNA stabilization and may possibly act in a dominantnegative fashion is presently unknown and warrants further investigation. LKB1/STK11 is the third gene identi®ed that predisposes to the development of benign neoplasms of the hamartomatous type. Recently, germline mutations in the SMAD4/DPC4 gene were found in a subset of familial and sporadic juvenile polyposis cases (Howe et al., 1998), and the PTEN/MMAC1 gene have been implicated as the predisposing factor in Cowden disease (Liaw et al., 1997). Somatic PTEN/ MMAC1 mutations have also been found in a variety of human cancers (Steck et al., 1997; Li et al., 1997; Teng et al., 1997), and we and others have recently shown that 30 ± 40% of melanoma cell lines harbour PTEN/MMAC1 deletions or mutations (Guldberg et al., 1997; Tsao et al., 1998). Although the exact functions of LKB1/STK11 and PTEN/MMAC1 in

the regulation of cell growth and dierentiation remain to be elucidated, one appealing hypothesis would be that aberrations of LKB1/STK11 and PTEN/MMAC1 could confer similar phenotypic changes to melanocytes. However, both LKB1/STK11 and PTEN/ MMAC1 were found to be altered in the cell line FM92. This ®nding suggests that changes of LKB1/ STK11 and PTEN/MMAC1 are not mutually exclusive in melanoma, but probably act in independent molecular and phenotypic pathways, which may be in agreement with the divergent biochemical functions of the gene products. In conclusion, we have demonstrated somatic mutation of the LKB1/STK11 gene in two patients with sporadic cutaneous malignant melanoma. This is, to our knowledge, the ®rst demonstration of somatic mutations in the LKB1/STK11 gene, and our ®ndings substantiate the notion (Jenne et al., 1998; Hemminki et al., 1998) that LKB1/STK11 may be a tumour suppressor involved in the development of human cancer. The low mutation frequency, together with the previously observed low frequency of LOH at 19p in primary melanoma and benign melanocytic nevi (Healy et al., 1996), suggests that LKB1/STK11 may be a relatively rare target in malignant melanoma. It remains to be elucidated whether LKB1/STK11 is part of a molecular pathway with a central role in melanoma pathogenesis.

Acknowledgements This work was supported by grants from the Danish Cancer Society, the Danish Medical Research Council, the Novo Nordisk Foundation, the Astrid Thaysen Foundation, and the Kaarsen Foundation.

References Abrams ES and Stanton VP. (1992). Methods Enzymol., 212, 71 ± 104. Albino AP. (1995). Curr. Opin. Oncol., 7, 162 ± 169. Avizienyte E, Roth S, Loukola A, Hemminki A, Lothe RA, Stenwig AE, FossaÊ SD, Salovaara R and Aaltonen LA. (1998). Cancer Res., 58, 2087 ± 2090. Bartkova J, Lukas J, Guldberg P, Alsner J, Kirkin AF, Zeuthen J and Bartek J. (1996). Cancer Res., 56, 5475 ± 5483.

Bignell GR, Barfoot R, Seal S, Collins N, Warren W and Stratton MR. (1998). Cancer Res., 58, 1384 ± 1386. Braitman M. (1979). Cutis, 23, 617 ± 623. Castellano M, Pollock PM, Walters MK, Sparrow LE, Down LM, Gabrielli BG, Parsons PG and Hayward NK. (1997). Cancer Res., 57, 4868 ± 4875. Giardiello FM, Welsh SB, Hamilton SR, Oerhaus GJ, Gittelsohn AM, Booker SV, Krush AJ, Yardley JH and Luk GD. (1987). N. Engl. J. Med., 316, 1511 ± 1514.


1780

Gibbs CS, Knighton DR, Sowadski JM, Taylor SS and Zoller MJ. (1992). J. Biol. Chem., 267, 4806 ± 4814. Guldberg P, thor Straten P, Birck A, Ahrenkiel V, Kirkin AF and Zeuthen J. (1997). Cancer Res., 57, 3660 ± 3663. Hanks SK and Quinn AM. (1991). Methods Enzymol., 200, 38 ± 62. Healy E, Belgaid CE, Takata M, Vahlquist A, Rehman I, Rigby H and Rees JL. (1996). Cancer Res., 56, 589 ± 593. Hemminki A, Markie D, Tomlinson I, Avizienyte E, Roth S, Loukola A, Bignell G, Warren W, Amino M, Hoglund P, Jarvinen H, Kristo P, Pelin K, Ridanpaa M, Salovaara R, Toro T, Bodmer W, Olschwang S, Olsen AS, Stratton MR, de la Chapelle A and Aaltonen LA. (1998). Nature, 391, 184 ± 187. Homeyer S, NuÈrnberg P, Ritter H, Fahsold R, Leistner W, Kaufmann D and Krone W. (1998). Am. J. Hum. Genet., 62, 269 ± 277. Howe JR, Roth S, Ringold JC, Summers RW, JaÈrvinen HJ, Sistonen P, Tomlinson IM, Houlston RS, Bevan S, Mitros FA, Stone EM and Aaltonen LA. (1998). Science, 280, 1086 ± 1088. Jenne DE, Reimann H, Nezu J, Friedel W, Lo S, Jeschke R, Muller O, Back W and Zimmer M. (1998). Nature Genet., 18, 38 ± 43. Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian SV, Stockert E, Day RS III, Johnson BE and Skolnik MH. (1994). Science, 264, 436 ± 440. Koh HK. (1991). N. Engl. J. Med., 325, 171 ± 182. Li J, Yen C, Liaw D, Podyspanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B, Hibshoosh H, Wigler MH and Parsons R. (1997). Science, 275, 1943 ± 1947.

Liaw D, Marsh DJ, Li J, Dahia PL, Wang SI, Zheng Z, Bose S, Call KM, Tsou HC, Peacocke M, Eng C and Parsons R. (1997). Nature Genet., 16, 64 ± 67. Parmiter AH, Balaban G, Herlyn M, Clark Jr WH and Nowell PC. (1986). Cancer Res., 46, 1526 ± 1529. Ray ME, Wistow G, Su YA, Meltzer PS and Trent JM. (1997). Proc. Natl. Acad. Sci. USA, 94, 3229 ± 3234. Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swedlund B, Teng DH and Tavtigian SV. (1997). Nature Genet., 15, 356 ± 362. Teng DH, Hu R, Lin H, Davis T, Iliev D, Frye C, Swedlund B, Hansen KL, Vinson VL, Gumpper KL, Ellis L, ElNaggar A, Frazier M, Jasser S, Langford LA, Lee J, Mills GB, Pershouse MA, Pollack RE, Tornos C, Troncoso P, Yung WK, Fujii G, Berson A and Steck PA. (1997). Cancer Res., 57, 5221 ± 5225. Tsao H, Zhang X, Benoit E and Haluska FG. (1998). Oncogene, 16, 3397 ± 3402. Walker GJ, Flores JF, Glendening JM, Lin AH, Markl ID and Fountain JW. (1998). Genes Chromosom. Cancer, 22, 157 ± 163. Welch DR and Goldberg SF. (1997). Pathobiology, 65, 311 ± 330. Wong SS and Rajakulendran S. (1996). Br. J. Dermatol., 135, 439 ± 442.