Sparus aurata

Marine Biotechnology https://doi.org/10.1007/s10126-018-9833-5

ORIGINAL ARTICLE

Characterization and Expression Dynamics of Key Genes Involved in the Gilthead Sea Bream (Sparus aurata) Cortisol Stress Response during Early Ontogeny A. Tsalafouta 1

&

E. Sarropoulou 2 & N. Papandroulakis 2 & M. Pavlidis 1

Received: 27 February 2018 / Accepted: 14 May 2018 # Springer Science+Business Media, LLC, part of Springer Nature 2018

Abstract The present study identified and characterized six key genes involved in the hypothalamic-pituitary-interrenal (HPI) axis of gilthead sea bream (Sparus aurata), a commercially important European aquaculture species. The key genes involved in the HPI axis for which gene structure and synteny analysis was carried out, comprised of two functional forms of glucocorticoid receptors (GR), as well as three forms of pro-opiomelanocortin (POMC) genes and one form of mineralocorticoid receptor (MR) gene. To explore their functional roles during development but also in the stress response, the expression profiles of gr1, gr2, mr, pomc_aI, pomc_aII, and pomc_β were examined during early ontogeny and after an acute stress challenge. The acute stress challenge was applied at the stage of full formation of all fins, where whole body cortisol was also measured. Both the cortisol and the molecular data implied that sea bream larvae at the stage of the full formation of all fins at 45 dph are capable of a response to stress of a similar profile as observed in adult fish. Keywords Sparus aurata . Stress . Ontogeny . Gene . GR

Introduction In teleost fish, stress leads to the activation of the hypothalamic-pituitary-interrenal (HPI) axis, which plays a central role in the regulation of stress response (Wendelaar Bonga 1997; Mommsen et al. 1999). During HPI activation, the pituitary is stimulated to synthesize and secrete proopiomelanocortin (POMC)-derived peptides (Wendelaar Bonga 1997; Slominski et al. 2000). POMC-derived peptides

A. Tsalafouta and E. Sarropoulou contributed equally to this work. Electronic supplementary material The online version of this article (https://doi.org/10.1007/s10126-018-9833-5) contains supplementary material, which is available to authorized users. * A. Tsalafouta [email protected] 1

Department of Biology, University of Crete, P.O. Box 2208, 714 09 Heraklion, Crete, Greece

2

Institute of Marine Biology, Biotechnology and Aquaculture, Hellenic Center for Marine Research, P.O. Box 2214, Heraklion, Crete, Greece

in turn stimulate adrenocorticotropic hormone (ACTH) (Smith and Funder 1988) that regulates cortisol synthesis and secretion. In teleosts, cortisol is the principal corticosteroid and plays an important role in the regulation of physiology including growth, immunoregulation, maintenance of energy balance, and reproduction (Mommsen et al. 1999; De Jesus et al. 1991; De Jesus and Hirano 1992; Vazzana et al. 2002). Additionally, in teleost fish, cortisol is also implicated in the maintenance of hydromineral balance, as they cannot synthesize aldosterone, and cortisol carries out this function (Wendelaar Bonga 1997; McCormick et al. 2008; Dean et al. 2003; Metz et al. 2003). Cortisol acts by binding to the glucocorticoid receptor(s) (GR) and the mineralocorticoid receptor (MR), a class of ligand-activated transcription factors (Prunet et al. 2006). The GR belongs to the nuclear receptor superfamily (Fuller 1991; Mangelsdorf et al. 1995; Kumar and Thompson 1999; Evans 2005) whose members act as ligand-dependent transcription factors. Following cortisol binding, intracellular GRs exert their activity on the expression of the target genes (Beato et al. 1996; Prunet et al. 2006; Bury and Sturm 2007). In teleosts, two GR genes have been described excluding the gilthead sea bream, for example, in rainbow trout (Oncorhynchus mykiss; Bury et al. 2003), Burton’s mouthbrooder (Haplochromis haplochromis;

Mar Biotechnol

Greenwood et al. 2003), and the European sea bass (Dicentrarchus labrax; Vazzana et al. 2010). It is proposed that the two GRs may have separated functions, which could result from differential expression, different affinity for the ligand, or different transactivation properties (Stolte et al. 2006). The roles of MR and its ligand are less clear. In mammals, salt and water balance is controlled via MR which binds aldosterone (Le Tallec and Lombes 2005). However, teleost fish lack aldosterone and it is believed that cortisol performs both glucocorticoid and mineralocorticoid actions (McCormick and Bradshaw 2006; Mommsen et al. 1999). On the other hand, 11-deoxycorticosterone (DOC) is a circulating corticosteroid that is present in teleosts in significant concentrations and it can interact with the fish’s MRs, but not with the GRs (Kiilerich et al. 2011; Milla et al. 2006, 2008; Sakamoto et al. 2011). Interestingly, the transcription of MR mRNA (mr) is relatively low in tissues involved in ion regulation, but considerably higher in the brains of most teleosts examined (Takahashi and Sakamoto 2012) and it is proposed that the mineralocorticoid system in fish may have biological actions in the brain and in behavior rather than in osmoregulation (Sakamoto et al. 2016). The pro-opiomelanocortin gene (POMC) is present early in the evolution of the chordates and it encodes for amelanocyte-stimulating hormone (a-MSH), adrenocorticotropic hormone (ACTH), and b-endorphin sequences. These products are released by post-translational proteolytic cleavage from a single precursor molecule (Douglass et al. 1984). Up until today, three POMC homologs and their expression patterns during stress have been described in teleost (Alsop and Vijayan 2009; Cardoso et al. 2011; Harris et al. 2014; Sarropoulou et al. 2016). Besides the role of cortisol during stress response, it also has important roles during larval development where it is implicated in the metamorphosis of larvae to juvenile fish (Kim and Brown 1997; Deane and Woo 2003). Several studies have examined endogenous cortisol content during early development in a variety of species (De Jesus et al. 1991; De Jesus and Hirano 1992; Hwang et al. 1992; Barry et al. 1995; Kumar et al. 1995, 1997; Yeoh et al. 1996), and specifically in the gilthead sea bream, the ontogenetic pattern of whole body cortisol concentrations was characterized and showed a gradual increase throughout development (Szisch et al. 2005). Furthermore, in the European sea bass (Dicentrarchus labrax), it has been shown that larvae are capable to respond to stress stimuli even at the stage of first feeding with the pattern (magnitude and duration) of cortisol response becoming similar to the adult fish at the stage of the full formation of all fins (Tsalafouta et al. 2014). In adult gilthead sea bream, the cortisol stress response after an acute stressor is characterized by low resting values that show maximum levels at 2 h post stress (Fanouraki et al. 2011). However, no information is available for the stress response in gilthead sea bream during early development in terms of

cortisol concentrations and expression of genes related to the HPI axis. In the present study, we describe two functional forms of glucocorticoid receptors in the gilthead sea bream (GR1 and GR2) and we further examined their temporal expression patterns at various stages during early ontogeny including also four other important genes of the HPI-axes (MR, POMC_αΙ, POMC_α2, and POMC_β). Additionally, to determine the timing and magnitude of the stress response at this developmental stage, in terms of cortisol concentrations and gene expression analysis, we subjected the gilthead sea bream to an acute stressor at the stage of the full formation of all fins.

Materials and Methods Experimental Design Samples (3 pools) were collected at specific stages of early development (embryos, hatch, first feeding, flexion, and formation of all fins; Fig. 1). An acute stress was applied at the stage of full formation of all fins and samples were collected prior to and after the acute stress application [high aeration (1000–1500 ml min−1 vs. 150–200 ml min−1), chasing with a net for 20 s, confinement (collection in beakers), and air exposure for 5 s before being transferred to baskets within a 500L tank]. Samples for endocrine (cortisol) and gene expression analysis were collected with a net at 0-, 0.5-, 1-, 2-, and 24-h post-stress, flash frozen in liquid N2, and stored at − 80 °C.

Whole Body Cortisol Cortisol extraction was performed in three pooled samples from each developmental stage/time point post stress according to De Jesus et al. (1991) and Fanouraki et al. (2011). Briefly, samples were partially thawed on ice and homogenized in 5× (w/v), ice-cold, phosphate-buffered saline (pH 7.4) with a rotor homogenizer. Cortisol was extracted by adding 3 ml of diethyl ether to 2 × 250 μl of homogenate. The liquid phase of the extract was allowed to freeze by placement of the tubes in − 80 °C and the combined diethyl ether layer was transferred into a new tube. The tubes were placed in a 45 °C water bath for 1 h and at room temperature for an additional 3 h in order to allow the ether to evaporate completely. Samples were then reconstituted in 250 μl of an enzyme immunoassay buffer. Cortisol was measured using commercial enzyme immunoassay (EIA) kits (Cayman Chemical, MI, USA).

RNA Extraction and cDNA Synthesis Samples of pre-larvae and larvae (pooled) were let to thaw on ice, disrupted, and homogenized using the TissueRuptor

Mar Biotechnol

(Qiagen, Hilden, Germany) for 20 s in 600 μl RLT plus buffer (RNeasy Plus Mini Kit Qiagen, Valencia, USA). Total RNA was isolated with the RNeasy Plus Mini Kit (Qiagen, Valencia, USA). RNA yield and purity was determined by measuring the absorbance at 260 and 280 nm using the Nanodrop® ND-1000 UV–Vis spectrophotometer (Peqlab, Erlangen, Germany), and its integrity was tested by electrophoresis in 1% agarose gels. Reverse transcription (RT) was carried out using 1 μg RNA with QuantiTect Reverse transcription kit (Qiagen).

Identification and Characterization of Sequences of Genes Related to the HPI Axes Sequences were retrieved from a previous RNAseq study investigating stress response during early development (Sarropoulou et al. 2016). To validate obtained sequences in terms of true paralogs, synteny as well as phylogenetic analysis was performed as previously described in Sarropoulou et al. 2016 (sequences in Supplemental files 1 & 2).

Primer Design Primer design was carried out using Primer3 (primer3.ut.ee) and primers for glucocorticoid receptor 1 (gr1), glucocorticoid receptor 2 (gr2), mineralocorticoid receptor, mineralocorticoid receptor (mr), proopiomelanocorticotrophin αI (pomc_αI), proopiomelanocorticotrophin αII (pomc_αII), proopiomelanocorticotrophin β (pomc_β), eukaryotic elongation factor 1 (eEF1a), 40S ribosomal protein S30 (Fau), and β-actin (β-actin) are listed in Table 1. In each case, the products of each primer pair were further validated by sequencing in order to confirm that the genes of interest were amplified.

as an internal control to determine differential gene expression.

Statistical Analysis All statistical analyses were performed with SigmaPlot 11.0 (Jandel Scientific). Data are presented as means ± standard deviation (SD). Statistical comparisons of gene expression between the different developmental stages were made using one-way ANOVA. Statistical analysis of temporal patterns of cortisol concentrations and gene expression before and after the acute stress application was made using one-way ANOVA. Holm-Sidak’s honestly significant difference test for multiple comparisons was used to determine significant differences among groups. The significant level used was P < 0.05.

Phylogenetic and Synteny Analysis of the two GR Homologs Phylogenetic analysis of GR was carried out using the maximum likelihood method based on the Tamura-Nei model (Tamura and Nei 1993) within Mega7 (Kumar et al. 2016). A total of 22 GR sequences of 12 important teleost species were used to generate the phylogenetic gene tree. The human receptor subfamily three group member (NR3C1, NM_000176.2) as well as the mouse (Mus musculus) NRC1 (NM_008173.3) sequence was used as outgroup. All positions containing gaps and missing data were eliminated. Sequences for phylogenetic tree analysis were retrieved from NCBI and Ensemble. Synteny analysis was performed applying the online BLAST search database (NCBI, https://www.ncbi.nlm. nih.gov/) as well as the online software Genomicus (http:// www.genomicus.biologie.ens.fr/genomicus-78.01/cgi-bin/ search.pl) (Louis et al. 2013).

Quantitative Real-Time PCR Gene Structure mRNA expression of genes encoding for gr1, gr2, mr, pomc_aI, pomc_aII, and pomc_β was determined with quantitative polymerase chain reaction (qPCR) assays using the KAPA SYBR® FAST qPCR Kit (Kapa Biosystems). Reactions were cycled and the resulting fluorescence was detected with MJ Mini Thermal Cycler (Bio-Rad) under the following cycling parameters: 95 °C for 3 min (HotStarTaq DNA Polymerase activation step), 94 °C for 15 s (denaturation step), 60 °C for 30 s (annealing step), 72 °C for 10 s (extension step), 40 cycles (step 2–step 4). Three reference genes were selected, i.e., β-actin, eEF1a, and Fau accordingly to be evaluated as reference genes. A relative standard curve and also a melt curve were generated for each gene, using four serial dilutions (1:5) of a pool of all cDNA samples and geNORM analysis (Vandesompele et al. 2002) was carried out. Finally, eEF1a and b-act were evaluated as appropriate

Genomic sequence of the European seabass, the three spine stickleback (Gasterosteus aculeatus), and medaka (Oryzias latipes) gr1 and gr2 were retrieved from NCBI genome database. Gene structure was obtained for both GR paralogs of the abovementioned species as well as for the gilthead sea bream using the genomic sequence of the European seabass. Gene structures were visualized applying GSD 2.0 gene feature visualization server (Hu et al. 2015).

Ethics Statement The laboratories of the Hellenic Centre for Marine Research are certified and obtained the codes for breeding animals for scientific purposes (EL-91-BIO-04). Furthermore, all

Mar Biotechnol Fig. 1 Sampling design. Ontogeny of the neuroendocrine stress response in gilthead sea bream (DPH days post hatch) and acute stress test application at the stage of full formation of all fins

procedures involving the handling and treatment of fish used during this study were approved by the HCMR Institutional Animal care and use committee following the three Rs (3Rs, replacement, reduction, refinement) guiding principles for more ethical use of animals in testing, in accordance with the Greek (PD 56/2013) and EU (Directive 63/2010) legislation on the care and use of experimental animals.

Results Identification and Characterization of gr1, gr2, mr, pomc_aI, pomc_aII, and pomc_β POMC_αI, POMC_αII, and POMC_β sequences were obtained from NCBI GenBank and paralog characterization was

described by Sarropoulou et al. (Sarropoulou et al. 2016). Gilthead sea bream GR paralogs were detected via BLAST search using GR1 and GR2 sequences of the European sea bass as query against the nr, EST, and SRA databases of NCBI. GR paralogs for further 23 teleost species were identified by BLAST searches against the NCBI nr, EST, and SRA databases. To evaluate identified paralogs, phylogenetic tree analysis was carried out (Fig. 2). GR paralogs were clearly separated in two groups reflecting the taxonomic relationship between the species. For GR1, transcripts for 11 fish species were used for phylogenetic tree construction, and for GR2, 10 out of the 11 as for zebrafish, only one paralog, GR1, was identified. All fish species belonging to the perciformes were grouped together with medaka and tilapia forming a separate cluster for both paralogs. In addition, synteny analysis showed the

Table 1 Primers’ design Gene

Primer pair

Primer sequence

Length (bp)

Ta

eEF

eEF_fwd

5′ GCCAGATCAACGCAGGTTACG 3′

222

60 °C

Fau

eEF_rev Fau_fwd

5′ GAAGCGACCGAGGGGAGG 3′ 5′ GACACCCAAGGTTGACAAGCAG 3′

149

60 °C

β-actin

Fau_rev β-act_fwd

5′ GGCATTGAAGCACTTAGGAGTTG 3′ 5′ CGCGACCTCACAGACTACCT 3′

218

60 °C

Gr1

β-act_rev Gr1_fwd

5′ AACCTCTCCATTGCCGATG 3′ 5′ GGTTCAGCAGCAGTTCCTC 3′

197

60 °C

Gr2

Gr1_rev Gr2_fwd

5′ GGTCTTGGTCGCCTTTATCC 3′ 5′ ATCGTCAAGAGGGAGGAGAAC 3′

187

60 °C

Mr

Gr2_rev Mr_fwd

5′ TTGGTATCTGGTTGGTGATGA 3′ 5′ CGCCTGGCTGGAAAGCAGATG 3′

189

60 °C

Pomc_αI

Mr_rev Pomc_αI_fwd

5′ GAGGTCAGGGGCAAAGTAGAGCAT 3′ 5′ CCGCTGCTCACGCTCTTC 3′

108

60 °C

Pomc_ αII

Pomc_αI_rev Pomc_αII_ fwd

5′ GGCTGCTCGTCTTCTGTCTCT 3′ 5′ GGAGGAGGCGGAGGAGGA 3′

88

60 °C

Pomc_β

Pomc_αII_rev Pomc_β_fwd

5′ AACAAGGAAAGGATACTGGACT 3′

123

60 °C

Pomc_β_rev

5′ GGTCTGAAGGATGCTGAGT 3′

5′ CCAGCGGAAGTGCTTCATCTTGTA 3′

Mar Biotechnol

Fig. 2 Molecular phylogenetic analysis by maximum likelihood method. The evolutionary history was inferred by using the maximum likelihood method based on the Tamura-Nei model. The tree with the highest log likelihood (− 22,459.21) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the maximum composite likelihood (MCL) approach,

and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 24 nucleotide sequences. Codon positions included were 1st + 2nd + 3rd + noncoding. All positions containing gaps and missing data were eliminated. There were a total of 1711 positions in the final dataset. Evolutionary analyses were conducted in MEGA7

different locations of each paralog (Table 2) as well as the different neighboring genes (Fig. 3). Open reading frames (ORFs) of the four homolog GRs are depicted in Fig. 3. Since genomic sequence of gilthead sea bream was absent, GR1 and GR2 of sea bream were mapped to the European sea bass genome. The genomic structures of the ORF of GR paralogs in the European sea bass as well as in the gilthead sea bream are illustrated in Fig. 4. GR1 in both species is shorter in length (~ 16 kb) than GR2 (~ 60 kb). GR1 has in total seven exons with the first one being the GR2 biggest one (~ 1.2 kb) and separated by the other six with an intron of about 12 kb. GR2 is comprised of nine exons again with the first one being the longest one (1.2 kb) and separated by an intron of about 40 kb of length.

Table 2

Mapping positions of GR1 and 2 in 10 teleost fish species GR1

GR2

Stickleback Medaka

IV 10

VII 14

Tetraodon Nile tilapia Zebrafish European sea bass Gilthead sea bream Spotted gar Coelacanth Cave fish

1 LG2 14 LG2 Chr. 18/RH22 LG6 JH126856.1 KB882258.1

7 GL831184-1 14 LG14 Chr.13/RH9 LG6 JH126856 KB882104.1

Mar Biotechnol

Fig. 3 Synteny analysis of GR1 and GR2 showing neighbored genes of each paralog. I.e.GR1: Left to right: ENSGACG00000018251; i rg 1 l ; ( E N S G A C G 0 0 0 0 0 0 1 8 2 5 0 ) ; s i : c h 2 11 - 1 5 3 b 2 3 . 5 ; ENSGACG00000018246; irg1l (ENSGACG00000018249); ENSGACG00000018245); rlim (ENSGACG00000018243); nexmifb (ENSGACG00000018242); abcb7 uprt (ENSGACG00000018229); ENSGACG00000018231); zdhhc15a ENSGACG00000018224); fgf16 (ENSGACG00000018221); atrx (ENSGACG00000018218); kif3a ENSGACG00000018214); sh3rf2 ENSGACG00000018213; kctd16a (ENSGACG00000018211); nr3c1 (ENSGACG00000018209); fgf1a (ENSGACG00000018207); gnpda1 ENSGACG00000018200); hspa4b (ENSGACG00000018188); uqcrq (ENSGACG00000018187); gdf9 (ENSGACG00000018186); sept8b (ENSGACG00000018181); ccng1 (ENSGACG00 000018175); nudcd2 (ENSGACG00000018171); gabra6a gabrb2 (ENSGACG00000018167); (ENSGACG00000018169); fbxl3l (ENSGACG00000018164); atp7a (ENSGACG00000018161); sfxn1 (ENSGACG00000018159); ppp2ca (ENSGACG00000018152); atp5o ENSGACG00000018149); and

WDR44 (ENSGACG00000020710); klhl13 GR2: Left to right: ENSGACG00000020712; ltbp3 (ENSGACG00000020711); (ENSGACG00000020713); nsg2 (ENSGACG00000020714); msx2b ENSGACG00000020715; drd1b (ENSGACG00000020716); rad50 ENSGACG00000020717); pou4f3 rbm27 ENSGACG00000020719); (ENSGACG00000020718); larsb (ENSGACG00000020720); plac8l1 grxcr2 ENSGACG00000020722); (ENSGACG00000020721); kctd16b (ENSGACG00000020723); yipf5 nr3c1 (ENSGACG00000020725) (ENSGACG00000020724). arhgap26 (ENSGACG00000020726); fgf1 spry4 (ENSGACG00000020728); ENSGACG00000020727); ndfip1l (ENSGACG00000020729); endou2 (ENSGACG00000020730); rnf14 (ENSGACG00000020731); hspa4a ENSGACG00000020732); zcchc10 (ENSGACG00000020733); aff4 (ENSGACG00000020734); ENSGACG00000020735; sowahaa (ENSGACG00000020736); sept8a ENSGACG00000020737); ccni2 (ENSGACG00000020738); gabrg2 (ENSGACG00000020739); gabra 1(ENSGACG00000020740)

Temporal Patterns of mRNA Expression of Genes Related to the HPI Axis at Early Development

increased to peak values at the stage of first feeding and declined during the following stages (P < 0.05). Expression of gr2 (Fig. 5b) was almost absent in embryos and showed a statistically significant increase (P < 0.05) at first feeding that remained at similar levels thereafter. The mRNA abundance of mr showed a gradual increase from minimum levels in

All genes assessed in the current study were expressed in all developmental stages examined. Transcripts of gr1 (Fig. 5a) showed minimum levels in embryos which gradually

Mar Biotechnol Fig. 4 GR1 and GR2 gene structure of medaka, three spine stickleback, European sea bass, and gilthead sea bream

embryos that reached peak values at the stage of the full formation of all fins with the first statistically significant increase at first feeding (P < 0.001; Fig. 5c). Expression of pomc_aI was detected in very low levels in embryos, gradually increased to show peak levels at the stage of flexion and decreased again at the formation of all fins (Fig. 2d; P < 0.05). Pomc_aII mRNA expression was comparatively low and did not show any statistically significant changes but remained stable throughout development (Fig. 5e). Expression of pomc_β appeared very low in embryos but gradually increased as development proceeds to show peak levels at the stage of flexion (Fig. 5f; P < 0.05).

The Acute Stress Response at the Stage of the Full Formation of All Fins Figure 6a shows the cortisol response prior to (0 h) and after (0.5, 1, 2, and 24 h) the application of the stressor at the stage of the full formation of all fins. Basal values (1.33 ± 0.5 pg mg−1) peaked at 1 h (3.75 ± 1.1 pg mg−1) post stress, showing a similar pattern as in adult fish (Fanouraki et al. 2011) but with a rather prolonged pattern (P < 0.05). In the case of adult fish, a peak in cortisol levels is observed at 2 h post stress that returns to basal levels at 4 h after the stressor. Gr1 mRNA expression was affect by the acute stress and appeared statistically higher at 2 h post stress and remained

Mar Biotechnol Fig. 5 Temporal patterns of gene expression at early ontogeny. a gr1, b gr2, c mr, d pomc_aI, e pomc_aII, and f pomc_β at the different developmental points/ stages (embryos EM, hatch HAT, first feeding FF, flexion FLX, formation of all fins FINS). Values are means ± standard deviation (n = 3). Means with different letters differ significantly from one another (P < 0.05)

high until 24 h post stress (Fig. 6b; P < 0.05). On the contrary, the acute stress did not affect the mRNA levels of gr2 (Fig. 6c). Pomc_aI and pomc_aII expressions were not altered following exposure to the acute stress (Fig. 6d–f). However, the acute stress application resulted in altered pomc_β expression showing a pattern characterized by a gradual elevation of the mRNA levels which peaked at 1 h post stress to return to basal levels 2 and 24 h post stress (Fig. 6g; P < 0.001).

Discussion In the present study, we investigated the expression profile of six genes involved in the HPI axis (gr1, gr2, mr, pomc_aI,

pomc_aII, and pomc_β) during the early ontogeny in the gilthead sea bream and the effect of an acute stress application on whole body cortisol concentrations and on the expression of the above genes at the stage of the full formation of all fins. Up until today, only one of the gilthead sea bream gr paralogs have been characterized (Acerete et al. 2007). Here, the existence of both gr paralogs, gr1 and gr2, in the gilthead sea bream has been proven as it is the case of other teleosts that have been examined, for example, the cichlid Haplochromis burtoni (Greenwood et al. 2003), rainbow trout (Bury et al. 2003), and D. labrax (Di Bella et al. 2008). Phylogenetic tree analysis was carried out including ten teleost fish species for which both paralogs were found as well as one gr from Lepisosteus oculatus and one from the model fish species

Mar Biotechnol Fig. 6 Cortisol response (a) and gene expression profiles (b–g) prior to (0 h) and after (0.5, 1, 2, 24) the application of the stressor at the stage of full formation of all fins. Values are means ± standard deviation (n = 3). Means with different letters differ significantly from one another (P < 0.05)

zebrafish (Danio rerio) which may have only one copy of the gr gene. The generated gene tree clearly confirms the existence of two gilthead sea bream gr paralogs, confirms

previous finding that duplicate gr genes are seen in salmonids as well as in percomorphs (Stolte et al. 2006), and may be the result of the genome duplication that occurred in ray-finned

Mar Biotechnol

fish 350 mya (Hoegg et al. 2004; Nelson 1994; Volff 2005). This is also supported by the mapping of the gr genes to different chromosomes or linkage groups as well as by synteny analysis (Table 2, Fig. 3). Among the teleost species studied, zebrafish seems to have lost the gr2 paralog as only one gr was identified which clustered to gr1 and is neighbored by the two for gr1 characteristic genes, kctd16a and fgf1a. Gr1 contains a nine-amino-acid insert and has been shown to be highly expressed than its paralog (Bury et al. 2003; Greenwood et al. 2003). The gene structure of the gilthead sea bream gr1 and gr2 is conserved as it has been also shown to be the fact for other teleosts (Stolte et al. 2006). The importance of the GR paralogs are further studied by investigating the temporal patterns of mRNA expression of genes related to the HPI axis at early development. There are very limited data available about the role of GR, MR, and POMC in fish development. In teleost fish, MR is considered to bind both cortisol and deoxycorticosterone (DOC) instead of the aldosterone which is the ligand in mammals. A recent study carried out in zebrafish showed that both gr and mr are present during embryogenesis and suggested that gr plays a more important role after hatching in zebrafish, whereas mr is suggested to be important at the earlier stages of development (Alsop and Vijayan 2008). Studies in zebrafish demonstrated that knocking down maternal gr leads to developmental defects in mesoderm formation and muscle development (Pikulkaew et al. 2011; Nesan et al. 2012), whereas mice lacking a functional gr survive until birth but die shortly thereafter due to impaired lung development (Cole et al. 1995). In the present study, apart from pomc_aII for which the expression appeared to be stable throughout development, the general pattern observed for all genes was characterized by very low mRNA abundance in embryos and a gradual increase as development proceeds. Gr1 transcripts show minimum levels in the embryos, but soon after hatching, the levels increased with sharp peak values at the stage of first feeding. On the other hand, gr2 and mr transcripts showed a gradual increase throughout development with minimum levels at the embryonic stage that reach a maximum at the stage of the full formation of all the fins, an expression profile that is in accordance with other studies during embryogenesis of Dicentrarchus labrax and zebrafish (Tsalafouta et al. 2014; Bella et al. 2008; Alsop and Vijayan 2008). Both pomc_aI and pomc_β expression profiles were very low at the embryonic stage but gradually reached a maximum at the stage of flexion that appeared decreased at the stage of the full formation of all the fins. The cortisol stress response and the regulation of genes related to the corticoid axis at the stage were studied for the first time during early ontogeny of gilthead sea bream. Larvae at the stage of the full formation of all fins were exposed to acute stressors to determine whether fish are capable of responding to

stress, in terms of whole body cortisol. Analysis of cortisol levels and mRNA expression at several time interval post stress revealed that the HPI axis is functional and the cortisol response is similar to that observed in adult fish (Fanouraki et al. 2011). The acute stress challenge at the stage of the full formation of all fins resulted in a cortisol response which was characterized by minimum levels at 0 h and peak values at 1 h post stress. The only genes that appeared to be affected by the acute stress application were gr1 and pomc_β whose expression was elevated after stress with peak values at 2 and 1 h post stress, respectively. These results, both the cortisol and the molecular data, imply that sea bream larvae at the stage of the full formation of all fins at 45 dph are capable of a response to stress of a similar profile as observed in adult fish. In conclusion, we show the existence of two GR paralogs in the gilthead sea bream as well as their implication during development and stress response. In addition, the present work revealed that cortisol response after a stress application showed peak levels at 1 h post stress, which is similar to the cortisol response observed in adults, where peak values are observed at 2 h post stress (Fanouraki et al. 2011). Our data also revealed that gr1 and pomc_b expressions were altered by the stress application with increased levels at 2 and 1 h post stress, respectively, suggesting a direct role of these genes in the stress response during ontogeny. The HPI axis system in gilthead sea bream appears to be mature already by the stage of the full formation of all fins, enabling the larvae to cope with external stressful stimuli and adapt to the environment. Acknowledgements We would like to thank Mr. N. Mitrizakis for his valuable assistance in larval rearing. Funding Information The research received funding from the European Union Seventh Framework Programme (FP7/2010-2014) under grant agreement no. [265957].

Compliance with Ethical Standards Conflict of Interest The authors declare that they have no conflict of interest.

References Acerete L, Balasch JC, Castellana B et al (2007) Cloning of the glucocorticoid receptor (GR) in gilthead seabream (Sparus aurata): differential expression of GR and immune genes in gilthead seabream after an immune challenge. Comp Biochem Physiol B Biochem Mol Biol 148:32–43 Alsop D, Vijayan M (2008) Development of the corticosteroid stress axis and receptor expression in zebrafish. Am J Phys Regul Integr Comp Phys 294:711–719 Alsop D, Vijayan MM (2009) Molecular programming of the corticosteroid stress axis during zebrafish development. Comp Biochem Physiol A Mol Integr Physiol 153:49–54

Mar Biotechnol Barry TP, Malison JA, Held JA, Parish JJ (1995) Ontogeny of the cortisol stress response in larval rainbow trout. Gen Comp Endocrinol 97: 57–65 Beato M, Chavez S, Truss M (1996) Transcriptional regulation by steroid hormones. Steroids 61:240–251 Bury NR, Sturm A (2007) Evolution of the corticosteroid receptor signaling pathway in fish. Gen Comp Endocrinol 153:47–56 Bury NR, Sturm A, Le Rouzic P, Lethimonier C, Ducouret B, Guiguen Y, Robinson-Rechavi M, Laudet V, Rafestin-Oblin ME, Prunet P (2003) Evidence for two distinct functional glucocorticoid receptors in teleost fish. J Mol Endocrinol 31:141–156 Cardoso JCR, Laiz-Carrion R, Louro B, Silva N, Canario AVM, Mancera JM, Power DM (2011) Divergence of duplicate POMC genes in gilthead sea bream Sparus auratus. Gen Comp Endocrinol 173: 396–404 Cole TJ, Blendy JA, Monaghan AP, Krieglstein K, Schmid W, Aguzzi A, Fantuzzi G, Hummler E, Unsicker K, Schutz G (1995) Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev 9:1608–1621 De Jesus EGT, Hirano T (1992) Changes in whole body concentrations of cortisol, thyroid hormones, and sex steroids during early development of the chum salmon, Oncorhynchus keta. Gen Comp Endocrinol 85:55–61 De Jesus EG, Hirano T, Inui Y (1991) Changes in cortisol and thyroid hormone concentrations during early development and metamorphosis in Japanese flounder, Paralichthys olivaceus. Gen Comp Endocrinol 82:369–376 Dean DB, Whitlow ZW, Borski RJ (2003) Glucocorticoid receptor upregulation during seawater adaptation in a euryhaline teleost, the tilapia (Oreochromis mossambicus). Gen Comp Endocrinol 132: 112–118 Deane EE, Woo NYS (2003) Ontogeny of thyroid hormones, cortisol, hsp70 and hsp90 during silver sea bream larval development. Life Sci 72:805–818 Di Bella ML, Vazzana M, Vizzini A, Parinello N (2008) Glucocorticoid receptor (DIGR1) is expressed in pre-larval and larval stages of the teleost fish Dicentrarchus labrax. Cell Tissue Res 333:39–47 Douglass J, Civelli O, Herbert E (1984) Polyprotein gene expression: generation of diversity of neuroendocrine peptides. Annu Rev Biochem 53:665–715 Evans RM (2005) The nuclear receptor superfamily: a rosetta stone for physiology. Mol Endocrinol 19:1429–1438 Fanouraki E, Mylonas CC, Papandroulakis N, Pavlidis M (2011) Species specificity in the magnitude and duration of the acute stress response in Mediterranean marine fish in culture. Gen Comp Endocrinol 173: 313–322 Fuller PJ (1991) The steroid receptor superfamily: mechanisms of diversity. FASEB J 5:3092–3099 Greenwood AK, Butler PC, White RB, DeMarco U, Pearce D, Fernald RD (2003) Multiple corticosteroid receptors in a teleost fish: distinct sequences, expression patterns, and transcriptional activities. Endocrinology 144:4226–4236 Harris RM, Dijkstra PD, Hofmann HA (2014) Complex structural and regulatory evolution of the pro-opiomelanocortin gene family. Gen Comp Endocrinol 195:107–115 Hoegg S, Brinkmann H, Taylor JS, Meyer A (2004) Phylogenetic timing of the fish-specific genome duplication correlates with the diversification of teleost fish. J Mol Evol 59:190–203 Hu B, Jin J, Guo A-Y, Zhang H, Luo J, Gao G (2015) GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics 31:1296– 1297 Hwang PP, Wu SM, Lin JH, Wu LS (1992) Cortisol content of eggs and larvae of teleosts. Gen Comp Endocrinol 86:189–196 Kiilerich P, Milla S, Sturm A, Valotaire C, Chevolleau S, Giton F, Terrien X, Fiet J, Fostier A, Debrauwer L, Prunet P (2011) Implication of the

mineralocorticoid axis in rainbow trout osmoregulation during salinity acclimation. J Endocrinol 209:221–235 Kim BG, Brown CL (1997) Interaction of cortisol and thyroid hormone in the larval development of Pacific threadfin. Am Zool 37:470–481 Kumar R, Thompson EB (1999) The structure of the nuclear hormone receptors. Steroids 64:310–319 Kumar R, Byers RE, Munro AD, Lam TJ (1995) Profile of cortisol during ontogeny of the Asian seabass, Lates calcarifer. Aquaculture 132: 349–359 Kumar R, Lee STL, Tan CH, Munro AD, Lam TJ (1997) Biosynthesis in vivo and excretion of cortisol by fish larvae. J Exp Zool 277:337– 344 Kumar S, Stecher G, Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 33: 1870–1874 Le Tallec PL, Lombes M (2005) The mineralocorticoid receptor: a journey exploring its diversity and specificity of action. Mol Endocrinol 19:2211–2221 Louis A, Muffato M, Roest Crollius H (2013) Genomicus: five genome browsers for comparative genomics in eukaryota. Nucleic Acids Res 41:D700–D705 Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M et al (1995) The nuclear receptor superfamily: the second decade. Cell 83:835–839 McCormick SD, Bradshaw D (2006) Hormonal control of salt and water balance in vertebrates. Gen Comp Endocrinol 147:3–8 McCormick SD, Regish A, O’Dea MF, Shrimpton JM (2008) Are we missing a mineralocorticoid in teleost fish? Effects of cortisol, deoxycorticosterone and aldosterone on osmoregulation, gill Na1, K1-ATPase activity and isoform mRNA levels in Atlantic salmon. Gen Comp Endocrinol 157:35–40 Metz JR, van den Burg EH, Bonga SE, Flik G (2003) Regulation of branchial Na(C)/K(C)-ATPase in common carp Cyprinus carpio L. acclimated to different temperatures. J Exp Biol 206:2273–2280 Milla S, Jalabert B, Rime H, Prunet P, Bobe J (2006) Hydration of rainbow trout oocyte during meiotic maturation and in vitro regulation by 17,20b-dihydroxy-4-pregnen-3-one and cortisol. J Exp Biol 209: 1147–1156 Milla S, Terrien X, Sturm A, Ibrahim F, Giton F, Fiet J, Prunet P, le Gac F (2008) Plasma 11- deoxycorticosterone (DOC) and mineralocorticoid receptor testicular expression during rainbow trout Oncorhynchus mykiss spermiation: implication with 17alpha, 20beta-dihydroxyprogesterone on the milt fluidity? Reprod Biol Endocrinol 6:19 Mommsen T, Vijayan M, Moon T (1999) Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Rev Fish Biol Fish 9:211–268 Nelson JS (1994) Fishes of the world. Wiley and Sons, Hoboken Nesan D, Kamkar M, Burrows J, Scott IC, Marsden M, Vijayan MM (2012) Glucocorticoid receptor signaling is essential for mesoderm formation and muscle development in zebrafish. Endocrinology 153:1288–1300 Pikulkaew S, Benato F, Celeghin A, Zucal C, Skobo T, Colombo L, Valle LD (2011) The knock-down of maternal glucocorticoid receptor mRNA alters embryo development in zebrafish. Dev Dyn 240: 874–889 Prunet P, Sturm A, Milla S (2006) Multiple corticosteroid receptors in fish: from old ideas to new concepts. Gen Comp Endocrinol 147: 17–23 Sakamoto T, Mori C, Minami S, Takahashi H, Abe T, Ojima D, Ogoshi M, Sakamoto H (2011) Corticosteroids stimulate the amphibious behavior in mudskipper: potential role of mineralocorticoid receptors in teleost fish. Physiol Behav 104:923–928 Sakamoto T, Yoshiki M, Takahashi H, Yoshida M, Ogino Y, Ikeuchi T, Nakamachi T, Konno N, Matsuda K, Sakamoto H (2016) Principal function of mineralocorticoid signaling suggested by constitutive

Mar Biotechnol knockout of the mineralocorticoid receptor in medaka fish. Sci Rep 6:37991 Sarropoulou E, Tsalafouta A, Sundaram AYM, Gilfillan GD, Kotoulas G, Papandroulakis N, Pavlidis M (2016) Transcriptomic changes in relation to early-life events in the gilthead sea bream (Sparus aurata). BMC Genomics 17:506–519 Slominski A, Wortsman J, Luger T, Paus R, Solomon S (2000) Corticotropin releasing hormone and proopiomelanocortin involvement in the cutaneous response to stress. Physiol Rev 80:979–1020 Smith AI, Funder JW (1988) Proopiomelanocortin processing in the pituitary, central nervous system, and peripheral tissues. Endocr Rev 9:159–179 Stolte EH, Verburg van Kemenade BML, Savelkoul HFJ, Flik G (2006) Evolution of glucocorticoid receptors with different glucocorticoid sensitivity. J Endocrinol 190:17–28 Szisch V, Papandroulakis N, Fanouraki E, Pavlidis M (2005) Ontogeny of the thyroid hormones and cortisol in the gilthead sea bream, Sparus aurata. Gen Comp Endocrinol 142:186–192 Takahashi H, Sakamoto T (2012) The role of ‘mineralocorticoids’ in teleost fish: relative importance of glucocorticoid signaling in the osmoregulation and ‘central’ actions of mineralocorticoid receptor. Gen Comp Endocrinol 181:223–228 Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10:512–526

Tsalafouta A, Papandroulakis N, Gorissen M, Katharios P, Flik G, Pavidis M (2014) Ontogenesis of the HPI axis and molecular regulation of the cortisol stress response during early development in Dicentrarchus labrax. Sci Rep 4:5525 Vandesompele J et al (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3:RESEARCH0034 Vazzana M, Cammarata M, Parrinello N (2002) Confinement stress in sea bass (Dicentrarchus labrax) depresses peritoneal leukocyte cytotoxicity. Aquaculture 210:231–243 Vazzana M, Vizzini A, Sanfratello MA, Celi M, Salerno G, Parrinello N (2010) Differential expression of two glucocorticoid receptors in seabass (teleost fish) head kidney after exogeneous cortisol inoculation. Comp Biochem Physiol A 157:49–54 Volff JN (2005) Genome evolution and biodiversity in teleost fish. Heredity 94:280–294 Wendelaar Bonga SE (1997) The stress response in fish. Physiol Rev 77: 591–625 Yeoh CG, Schreck CB, Feist GW, Fitzpatrick MS (1996) Endogenous steroid metabolism is indicated by fluctuations of endogenous steroid and steroid glucuronide levels in early development of the steelhead trout (Oncorhynchus mykiss). Gen Comp Endocrinol 103:107–114