MAJOR ARTICLE
Increased Frequency of Genomic Alterations in Staphylococcus aureus during Chronic Infection Is in Part Due to Phage Mobilization Christiane Goerke,1 Saskia Matias y Papenberg,1 Simone Dasbach,1 Klaus Dietz,2 Rita Ziebach,3 Barbara C. Kahl,4 and Christiane Wolz1 Instituts fu¨r 1Allgemeine Hygiene und Umwelthygiene and 2Medizinische Biometrie, and 3Universita¨tsklinik fu¨r Kinderheilkunde und Jugendmedizin, Universita¨t Tu¨bingen, Tu¨bingen, and 4Medizinische Mikrobiologie, Universita¨t Mu¨nster, Mu¨nster, Germany
We assessed the nature and frequency of genome alterations in Staphylococcus aureus during chronic lung infection in patients with cystic fibrosis (CF) and during colonization of the nares in healthy individuals. Only individuals harboring the same S. aureus clone on consecutive samplings were included in the present study. Clone definition was based on pulsed-field gel electrophoresis (PFGE) analysis. Minor fragment variations in consecutive clones were interpreted as genome alterations. The frequency of genome alterations was significantly higher in S. aureus derived from patients with CF (mean time, 1.03 years) than in isolates derived from healthy individuals (mean time, 13.4 years). In total, 19 S. aureus strain pairs showing genome alterations were available for molecular analysis to clarify the nature of recombinational events in the host environment. In 8 cases, genome alteration could be linked to phage mobilization. Phage conversion of b-toxin production was evident in 7 pairs. In 1 strain pair, changes in the PFGE pattern were accompanied by deletion of a phage similar to ETA. Obviously, phage mobilization plays an important role in vivo. During long-term lung infection in patients with CF, the specific host response and/or the regular exposure to antibiotics exercises strong selective pressure on the pathogen. Genome plasticity may facilitate the adaptation to various host conditions. Genetic variation is a requirement for the biological evolution of bacterial pathogens. The extent of variation is determined by the frequencies of mutation and recombination within a given population. The resulting differences in gene content and allelic variations are presumably advantageous for adaptation to various host conditions. The rate of recombination seems to be species specific, leading to considerable differences in the population structure of various pathogens [1, 2]. By use of multilocus sequence typing, an intermittent recombination frequency was assessed for the human pathogen Staphylococcus aureus, compared with Esch-
Received 3 June 2003; accepted 15 August 2003; electronically published 29 January 2004. Financial support: Deutsche Forschungsgemeinschaft (grants Wo 578/3-2 and Wo 578/3-3); Mukoviszidose e.V. Reprints or correspondence: Dr. Christiane Goerke, Institut fu¨r Allgemeine Hygiene und Umwelthygiene, Universita¨t Tu¨bingen, Wilhelmstr. 31, 72074 Tu¨bingen, Germany (
[email protected]). The Journal of Infectious Diseases 2004; 189:724–34 2004 by the Infectious Diseases Society of America. All rights reserved. 0022-1899/2004/18904-0022$15.00
724 • JID 2004:189 (15 February) • Goerke et al.
erichia coli with very low recombination frequencies representing one end of the scale and Neisseria meningitidis with very high frequencies representing the other end [3]. Microarray analysis revealed that genetic variation between S. aureus lineages is extensive, with 22% of the genome comprising strain-specific material [4]. Accordingly, publication of the genome sequence of 3 S. aureus strains revealed the presence of multiple mobile elements—such as bacteriophages, pathogenicity islands, and transposons [5, 6]. S. aureus asymptomatically colonizes the anterior nares of humans but also causes a wide spectrum of acute and chronic diseases. Evolution of the species was probably driven by adaptation to the environment of the nose, which is thought to be the primary reservoir for subsequent infection [7]. On the other hand, during the course of infection, the specific host response or subinhibitory antibiotic concentrations may exercise selective pressure, resulting in microevolutionary processes in the pathogen. In patients with cystic fibrosis (CF), S. aureus causes a chronic lung infection, which
is regularly treated with antibiotics. However, complete eradication of the pathogen is not achieved. An extensive adaptation to the CF lung has been described for Pseudomonas aeruginosa. This adaptation is characterized by elevated mutation frequencies [8] and genome alterations [9], resulting in a fixed CF phenotype. Whether such extensive adaptations occur in S. aureus during lung infection related to CF is unclear. In the present study, we assessed the nature and frequency of genome alterations during chronic lung infection in patients with CF and during colonization of the nares in healthy individuals. Genome analysis by pulsed-field gel electrophoresis (PFGE) enables us to register DNA rearrangements and the acquisition or loss of genetic elements. It also allows high-resolution discrimination of strains [10] and has been successfully used to define clonal lineages within the S. aureus species [11–13]. We were able to show that the frequency of genome alterations during lung infection in patients with CF was significantly higher than that during colonization of the nares in healthy individuals. In a subset of strains, genome alterations could be traced to phage mobilization.
SUBJECTS, MATERIALS, AND METHODS Study design. S. aureus isolates were obtained from sputum specimens or throat swabs obtained from 118 patients with CF attending 3 European CF clinics and from nose swabs obtained from 208 healthy individuals. Informed consent was obtained from patients or their parents or guardians, and the humanexperimentation guidelines of the University of Tu¨bingen were followed in the conduct of clinical research. Standard procedures were used to isolate and identify S. aureus from the different specimens. Genome types were assigned to each isolate by typing with PFGE. Only consecutive intervals with the same S. aureus genome type were included in the study, reducing the study population to 26 patients with CF and 38 healthy control subjects. One interval was available from 11 patients with CF, 2 intervals were available from 7 patients, 3 intervals were available from 4 patients, 4 intervals were available from 2 patients, and 6 intervals were available from 3 patients. One interval was available from 23 healthy individuals, 2 intervals were available from 7 individuals, 3 intervals were available from 7 individuals, and 4 intervals were available from 1 individual. In the CF group, intervals varied between 6 and 538 days (median, 91 days), and, in the control group, intervals varied between 31 and 304 days (median, 133 days). Genome typing with PFGE. PFGE was performed after restriction endonuclease digestion of whole chromosomal DNA, with SmaI (Roche Biochemicals) and EagI (EclXI; Roche Biochemicals), as described elsewhere [14]. The restriction fragments were separated by a contour-clamped homogeneous electric field (CHEF-DRII system; BioRad) in 0.5⫻ Tris-borate EDTA
buffer at 12C and 200 V. Running conditions for SmaI-digested DNA were 1–15 s for 12 h, followed by 30–70 s for 12 h; and those for EagI-digested DNA were 1–15 s for 12 h, followed by 20–50 s for 12 h. Digested whole chromosomal DNA of S. aureus strain COL was used as size standard. The gels were evaluated by use of WinCam3 software (Cybertech). Isolates showing differences in the fragment pattern that could be explained by 1 or 2 genetic events (insertions, deletions, point mutations, or transposition) were classified as belonging to 1 clonal lineage. Southern hybridization of PFGE gels. Ethidium bromide– stained PFGE gels were nicked twice, from both sides, in a UV chamber with 60 mJ. Depurination was performed in 0.25 mol/ L HCl for 15 min, followed by 2 cycles of denaturation in 3 mol/L NaCl and 0.4 mol/L NaOH for 15 min. Gels were blotted by capillary transfer onto positively charged nylon membranes (Roche Biochemicals) with denaturation buffer. Highstringency hybridization was performed in accordance with the instructions given by the manufacturer of the digoxigenin labeling and detection kit (Roche Biochemicals); signals were detected by chemiluminescence. Phage typing, antibiotic-resistance pattern, and polymorphisms of the agr locus. Phage typing and antibiotic-resistance determination were performed by the reference laboratory (Robert Koch-Institut, Wernigerode, Germany), by use of standard methods. The following antibiotics were tested: penicillin, oxacillin, gentamicin, erythromycin, clindamycin, tetracycline, teicoplanin, chloramphenicol, vancomycin, ciprofloxacin, trimethoprim-sulfamethoxazole, fusidic acid, mupirocin, linezolid, and moxifloxacin. Identification of agr locus restriction fragment–length polymorphisms was performed as described elsewhere [15, 16]. In brief, the variable part of the agr operon was amplified, and the generated amplicons were digested with DraI (Roche Biochemicals). Genome stability in vitro. Five S. aureus strains were analyzed for changes after prolonged subculturing in vitro. Two pairs of clinical isolates showing genome alterations in vivo (strain pairs i1/i2 and s2/s3) and the prototypic S. aureus strain RN6390 [17] were chosen. In 1 series of experiments, the 5 isolates were subcultured on sheep blood agar plates daily for 33 days. Every 10th passage was stored for typing. Each plate was inspected for the occurrence of phenotypic variants (hemolysis pattern and colony morphology). These variants were stored and subcultured separately. In a second approach, liquid medium (CYPG [18]) was inoculated with single colonies of isolate i2 and RN6390 and cultured at 37C into deep stationary phase (48 h). Both cultures were sequentially subcultured 14 times every other day by use of 1:100 dilutions in fresh medium. Colony-forming units and changes in phenotype were determined on sheep blood agar plates. Phenotypic variants were separately stored Genomic Alterations in S. aureus • JID 2004:189 (15 February) • 725
and typed. After 48 h, a decline in variable counts of ∼1 log was observed, indicating stress conditions. Generation of fragment-specific amplicons and probes. For the molecular characterization of genome alterations, PFGE was performed with SmaI-digested genomic DNA from isolates of interest, as described above. Differing fragments were excised from the agarose gel, were washed with polymerase chain reaction (PCR)–grade water, and were stored at 4C. Random PCR was performed in 50-mL volumes containing small pieces of the following agarose plugs: 0.2 mmol/L dNTP mix, 2 mmol/ L MgCl2, 2.5 U of HotStar Taq polymerase (Qiagen), and 10 pmol of arbitrary primers tt-AB4 (CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNAGATT) or ct-AB4 (CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNAGACT). A nested PCR was performed by use of primer AB4 (CAGTTCAAGCTTGTCCAGGAATTC), which consisted of the conserved part of the arbitrary primers. PCR amplicons were cloned in the pCR2.1 TOPO vector (Invitrogen) and were transformed in E. coli TOP10. Plasmid DNA was purified by use of the Wizard Minipreps system (Promega) and were sequenced by use of M13 forward and reverse sequencing primers. Digoxigenin-labeled fragment-specific probes were generated by PCR labeling (Roche Biochemicals) with the AB4 primer, by use of the TOPO vectors containing the cloned PCR amplicons as a template. Hybridization probes directed against known genes and against sequences spanning the SmaI and EagI restriction sites were generated by use of the specific primers listed in table 1. Suppressive subtractive hybridization (SSH). Genomic subtraction was performed by use of the PCR-Select Bacterial Genome Subtraction Kit (Clontech) using strain m47 as the tester
and strain m46 as the driver. In brief, 2 mg of genomic DNA from each strain was digested with AluI, and 2 different PCR adaptors were ligated to 2 aliquots of the tester DNA. Two hybridizations in which an excess of driver DNA was added were then performed at 50C. PCR products obtained after SSH were cloned in the pCR2.1 TOPO vector and were sequenced. PCR. Long-range PCR was performed by use of the TripleMaster PCR System (Eppendorf), in accordance with the manufacturer’s instructions for amplification of 10-kb targets. The following primer pairs were used for amplification of the region nt 875,220–931,123 in N315: primer 1 (forward, ACTTTTATCCTCAGTTTTGT; reverse, TTATGCACTTAGTCGAAGCT), primer 2 (forward, AATTGAACTAAAATCATTGCAATG; reverse, AAAACAAGCATCTGCGTCAC), primer 3 (forward, TCGAGGAAAATTCCAGATAAATT; reverse, GTGGCATATTACTAAAGTCTCTTGC), primer 4 (forward, GGCACCGTTTAAGACGAATT; reverse, GTTATCAAACACCCGAAACA), primer 5 (forward, CGTATAGCGTTTTTCAAAATGGCT; reverse, GTGCTTCTTCTTTACCGTATCTTTC), and primer 6 (forward, GCAGACAAAGATTTCTCTGT; reverse, GCTTTGCGATCAGTGATATC). The attB site of phage ETA was amplified by use of standard PCR with the published primers [19]. The resulting PCR fragment of strain m46 was sequenced (4base lab, Reutlingen, Germany). The attB site of phage L54 was amplified by use of the primers TGGTCATGATGCAAGAGAAG and CTTCAACACGCAACAAGTCA. DNA sequence analysis. All sequencing was performed by 4base lab by use of the DYNAMIC Sequence Kit (Amersham Biosciences). Arbitrary primers used for random PCR were designed by M. Bayer (4base lab).
Table 1. Target sites of fragment-specific hybridization probes and primers used for generation of probes. Primer(s)a
Probe
N315 coordinates, nt
Amplicon 17
1,033,254–1,033,844
fmt
AB4
Amplicon 19
1,206,110–1,206,748
cfxE
AB4
Amplicon 3
1,971,268–1,971,870
pcrA
AB4
Amplicon 4
1,159,978–1,160,530
pbpA
AB4
Amplicon 5
2,156,808–2,157,400
atpG
AB4
clfA
848,484–851,453
Clumping factor A
GGCGTGGCTTCAGTGCTTGTA; CACCAGTTACCGGCGTTTCTTC
Eag7
980,667–982,053
SA0867
GATGAAAATAGACAAAAGAT; CGTGATGATACCAAGCAAATG
hla
1,140,562–1,141,521
a-hemolysin
hlb
2,049,532–2,050,410
b-hemolysin
RNAIII
2,079,076–2,079,210
hld
sae
755,280–765,335
saeS
NOTE.
Target site, ORF
AGCTTCAAACTTAAATGTCA; GCTATCATTATCGAATCCAC CCATTTACGCCTTAACTTTA; TAGTCATATCCCCAAACTT
ORF, open-reading frame.
a
Primer sequence for amplicons are listed in Subjects, Materials, and Methods; primer sequences for hla and RNAIII are listed in [37].
726 • JID 2004:189 (15 February) • Goerke et al.
Figure 1. Example of 5 Staphylococcus aureus strain pairs showing genome alterations after pulsed-field gel electrophoresis of SmaI- or EagI-digested genomic DNA.
Sequence data were analyzed by use of Vector NTI software (version 8; InforMax). The sequence of strain N315 was obtained from the European Molecular Biology Laboratory nucleotide database (accession number BA000018), and the sequence of strain COL was obtained from The Institute of Genomic Research (TIGR; ftp://ftp.tigr.org/pub/data/s_aureus_COL). Statistical analysis. The transformation rates (frequency of genome alterations) were estimated in the 2 groups by the maximum-likelihood method. This model assumes an exponential (e) distribution until the time of transformation. If a transformation was observed during an interval of t, then the contribution to the likelihood was given by the expression 1 ⫺ e (⫺lt), where l is the transformation rate to be estimated. The inverse of l is the expected time to transformation. If there was no transformations during an interval of t, then the contribution to the likelihood was e (⫺lt). To compare the observations with the model, we calculated Kaplan-Meier curves for the transformation-free time by imputing the most likely time of transformation, using a uniformly distributed time during the intervals for which a transformation was observed. Intervals without transformation were entered in the Kaplan-Meier estimates as censored observations. Relative frequencies were compared by use of Fisher’s exact test. RESULTS Frequency of S. aureus genome alterations in vivo. Consecutive S. aureus isolates were obtained from sputum specimens or throat swabs from patients with CF and from nose swabs from healthy control subjects. These isolates were genome typed by use of PFGE. Only individuals harboring the same S. aureus clone on consecutive samplings (1 interval) were
included in the study. Clone definition was based on the PFGE result after restriction digestion with 2 enzymes (SmaI and EagI). Fragment variations detected in consecutive isolates of the same clonal lineage, after digestion with both enzymes, were interpreted as genome alterations (figure 1). A total of 93 isolates from 26 patients with CF were available for analysis of genome variations over time, representing 59 intervals, with a mean duration of 91 days (minimum, 6 days; maximum, 538 days). A total of 102 isolates were available from 38 healthy control subjects, representing 62 intervals, with a mean duration of 133 days (minimum, 31 days; maximum, 304 days). Significantly more patients with CF (13/26) harbored S. aureus clones showing genome alterations than did healthy control subjects (2/38) (P ! .0001). The 2 alterations detected in S. aureus clones from the control group were obtained from 2 different individuals. In 1 patient with CF, 3 independent genome alterations in the infecting S. aureus clones were detected over time; in 2 patients, 2 independent genome alterations were found. Multiple intervals from 1 patient were treated as independent episodes. On the basis of the changes observed in S. aureus within given intervals, a mean time for the observed genome alterations was calculated for both groups. The S. aureus clones showed changes in the PFGE pattern after a mean of 1.03 years (95% confidence interval [CI], 0.66–1.74 years) in the CF group and after a mean of 13.4 years (95% CI, 4.3–80.3 years) in the control group (figure 2). The calculated time difference for S. aureus genome alterations between patients with CF and healthy control subjects was significant (P ! .0001). Association between clonal lineages and genome alterations. Isolates from 26 patients with CF and from 38 healthy control subjects could be differentiated by PFGE typing into 20 distinct S. aureus genome types (table 2). The clonality of Genomic Alterations in S. aureus • JID 2004:189 (15 February) • 727
Figure 2. Kaplan-Meier curves for the observed frequencies of genome alterations in the cystic fibrosis (CF) group and in the group of healthy individuals. The dotted lines show the expected frequencies. To compare the observations with the model, we calculated Kaplan-Meier curves for the transformation-free time by imputing the most likely time of transformation, using a uniformly distributed time during the intervals for which a transformation was observed. Intervals without transformations were entered in the Kaplan-Meier estimates as censored observations.
isolates assigned to the same genome type was further confirmed by additional typing methods (phage typing and agr group polymorphism). Consecutive isolates were always identical by phage and agr group. No variation in antibiotic-resistance patterns was detected between consecutive isolates. In 1 of the strain pairs, both isolates were methicillin resistant (data not shown). Several epidemiologically unrelated persons were colonized with the same S. aureus clone. Eleven of 20 genome types were obtained from 11 individual, and none was specifically associated with patients with CF. Genome alterations were observed in 11 of 20 S. aureus genome types. No association was observed between the frequency of genome alterations and certain clonal lineages of S. aureus. Genome alterations in vitro. To analyze whether genome alterations can also occur during extended in vitro subculturing, 2 pairs of clones showing alterations in vivo and the laboratory strain RN6390 were passaged 33 times on sheep blood agar plates. Although nonhemolytic variants arose during subcultivation in all 5 isolates, this was not accompanied by changes in the PFGE pattern. In general, none of the descendents of the original 5 isolates showed genome alterations. To further evaluate whether starvation induces alterations, isolates were grown to deep stationary phase in liquid medium and were subcultured 14 times. Again, although phenotypic variations occurred, no changes in the PFGE pattern were detected. Molecular analysis of genome alterations. In total, 19 strain pairs showing alterations in the SmaI and EagI restriction pattern after PFGE were available for molecular analysis. These 728 • JID 2004:189 (15 February) • Goerke et al.
strains are described in more detail in table 3. To map the affected regions in the genome, fragments of interest were excised from the PFGE gels and were subjected to random PCR. Southern hybridization was performed by use of digoxigeninlabeled probes derived from the generated amplicons. Probes reacted with the excised PFGE fragment and the altered fragment in the consecutive strain. To identify the altered region, amplicons were sequenced and mapped to the published N315 genome [5]. In general, amplicons derived from a given fragment clustered within a distinct region of the N315 genome. The same clustering was observed when the genome sequence of S. aureus COL (TIGR) was used. Thus, the gene order seems to be conserved, and we supposed a similar organization in our strains. Therefore, hybridization probes directed against known genes and against sequences spanning the SmaI and EagI restriction sites from the region in question were used to narrow the sites of variation. We concentrated on the molecular characterization of genome alterations in selected pairs in which we could assume that the differences between the strains were solely due to insertions or deletions. Genome alteration due to deletion of a phage ETA homologue. In 1 strain pair (m46/m47), a deletion of ∼50 kb was evident in the SmaI restriction pattern of the second isolate, m47 (figure 3B). In the EagI pattern, 2 fragments (110 and 90 kb) in strain m46 were replaced by a single fragment of 160 kb in strain m47. After the generation of fragment-specific amplicons, hybridization, and sequencing of the probes (amplicon 4, amplicon 17, and amplicon 19), this alteration was mapped to the SmaI fragment nt 824,846–1,268,383 in N315, encompassing, for instance, clfA and hla (figure 3A and 3B). On the basis of the hybridization analysis, we concluded that strain m46 contains an additional stretch of DNA (40–50 kb long) that has no counterpart in strain m47 or N315 and that is probably located in the region corresponding to nt 875,220–931,123 in N315. Overlapping primers for long-range PCR were generated for this region. The region corresponding to nt 883,225–886,164 in N315 could not be amplified from strain m46. To identify the stretch of additional DNA, the strain pair m46/m47 was subjected to suppressive subtractive hybridization. Two resulting clones had a high degree of homology to ETA, a phage of 43 kb [19]. Thus, the genome alterations in the strain pair m46/m47 could be explained by insertion of either phage ETA or an ETA homologue in m46. The attachment site for phage ETA was mapped to an open-reading frame (ORF) coding for a hypothetical protein on the chromosome of COL [19]. This ORF corresponds to SA0778 in N315, which lies in the predicted region of the insertion site in m46. Phage conversion was further verified by amplification with primers specific for the attachment site of phage ETA (figure 3C). An amplicon of the expected size was detected in strain m47 and in N315. In the phage-positive strain m46, a fragment of 750
Table 2. Distribution of 20 distinct Staphylococcus aureus genome types (GT) in patients with cystic fibrosis (CF) and healthy control subjects and no. of genome alterations in each clonal lineage. Healthy control subjects
Patients with CF No. of patients harboring GT (no. of intervals)a
No. of genome alterations
No. of control subjects harboring GT (no. of intervals)a
No. of genome alterations
1 2
2 (7) 6 (9)
3 4
1 (1) 8 (10)
0 0
7 16 17
2 (3) 3 (8) 2 (2)
2 2 1
5 (8) 3 (3) 0 (0)
0 0 0
19 30 36 48
2 0 3 1
(3) (0) (7) (1)
0 0 1 0
54 109 Rareb (8, 15, 18, 31, 40, 43, 49, 88, 108)
1 (3) 2 (8)
0 1
2 (3) 1 (1)
0 0
5 (8)
3
4 (6)
2
GT
a b
2 3 10 1
(3) (6) (20) (1)
0 0 0 0
Two consecutive S. aureus isolates with identical GTs were obtained during 1 interval. Genome types that were isolated in only 1 individual.
bp was amplified. Sequencing of this fragment revealed that part of phage ETA (128 bp at the 3 end), the attR site, and part of the flanking region were amplified because of false priming of the upper primer within the phage. The sequences obtained for the partial phage ETA and the attR site were identical to the published sequences (GenBank accession numbers AB046707 and AP001553). Further results obtained by subtractive hybridization indicate that the phage present in m46 has a mosaic structure: 2 of the analyzed clones showed homology only to phage 11 or 12, respectively. Probes generated from these clones hybridized to the same EagI fragments in m46 as did the phage ETA–specific clones. To further clarify whether phage ETA conversion is responsible for genome alterations in other strain pairs, we amplified the attB site for phage ETA. In all the strains, amplification resulted in the predicted fragment, indicating that none is phage ETA positive. Genome alteration due to mobilization of phage 42 and its derivates. In another strain pair (cfs425/cfs555), the alteration was mapped to 2 neighboring SmaI fragments, nt 1,922,490– 2,031,794 and nt 2,031,794–2,109,683, in phage N315 by use of amplicon 3, amplicon 5, and RNAIII as probes. The SmaI site separating these 2 fragments is localized on phage N315. This phage is homologous to phage 42 and its derivates, which have their attachment site in the gene for b-hemolysin (hlb). Phage insertion leads to negative conversion of hlb expression [20]. Strain cfs425 showed no Hlb production on sheep blood agar plates, whereas strain cfs555 was positive. Thus, a phage 42-like phage was probably deleted in strain cfs555. Accordingly, hlb was detected on 2 fragments in strain cfs425 and on 1 fragment in
strain cfs555, by Southern hybridization with an hlb-specific probe (figure 4A and 4B). As with strain N315, phage insertion resulted in an additional SmaI restriction site in strain cfs425, creating 2 fragments of 100 kb and 60 kb, respectively. Furthermore, we screened for Hlb expression in all 19 strain pairs showing genome alterations. In 7 cases, conversion of hlb expression was observed: in 2 cases, the phenotype changed from Hlb positive to Hlb negative, whereas, in the other 5 cases, strains were rendered positive. All conversions were accompanied by a shift of the fragment reacting with the hlb probe, indicating phage involvement (figure 4B). Phage insertion resulted in the addition of an SmaI restriction site in 6 cases; in 1 case, the phage carried no SmaI site. In 3 of 7 cases, phage integration was the sole cause of the detected fragment alterations. In the remaining 4 cases, additional fragment alterations not linked to hlb conversion were evident from the PFGE pattern. No genome alteration due to mobilization of phage L54. Insertion of phage L54 in the lipase gene (geh) inactivates glycerol ester hydrolase production in S. aureus [21]. To clarify whether phage L54 conversion is responsible for genome alterations in our strain pairs, we amplified the attB site for phage L54 (GenBank accession number STAL54BOB). In all the strains, amplification resulted in the predicted fragment, indicating that none is phage L54 positive. DISCUSSION To understand the evolution of pathogens, it is essential to establish the nature and frequency of recombination, as well as the driving forces behind it. Here, we have analyzed genome Genomic Alterations in S. aureus • JID 2004:189 (15 February) • 729
Table 3. Characteristics of 19 Staphylococcus aureus strain pairs showing genome alterations isolated from the group of patients with cystic fibrosis (CF) and from healthy individuals (H).
Pair
Subject
1
18cf
Group CF
Isolate i54
Interval, days
GT
486
17 17
k150 2
33cf
CF
i102
304
k106b 3
37cf
CF
k119
182
k145 4
D
CF
s87
451
s90 5
H
CF
s113
6
H
CF
s126
CF
CG17A
8
Ital.J
CF
CG23C
CF
s147
10
Ku
CF
s152
CF
s155
12
Ku
CF
s165
13
MF
CF
cfs46
14
R
CF
s64
SE
CF
m46
SK
CF
cfs425
3M
H
i1
Mi54
H
Mi54A Mi54B
III
s
+
2
52, 80
III
Pen, Cip
⫺
2
29, 52, 80
III
Pen
⫺
7
95
Ia
Pen
⫺
7
95
Ia
Pen
+
29, 52, 52A, 80, 42E
I
Pen, Gen
⫺ ⫺
80
I
Pen, Gen
+
18
47, 54
II
Pen, Oxa, Gen, Ery, Cip
⫺
60
47, 54
II
Pen, Oxa, Gen, Ery, Cip
⫺
2
29, 52, 52A, 80, 95
III
Pen
⫺
2
52
III
Pen
⫺
109
53
I
Pen
+
18 63
122
53
I
s
⫺
1
94, 96
I
Pen, Gen, Cip
⫺
1
94, 96
I
Pen, Gen, Cip
+
294
1
94, 96
I
Pen, Gen, Cip
+
1
94, 96
I
Cip
+
285
1
94, 96
I
Pen, Gen, Cip
⫺
1
94, 96
I
Pen, Gen, Cip
+
14
2
29, 52, 52A, 79, 80
III
Pen
⫺
29, 52
III
Pen
⫺
314
31
29, 52, 52A, 80, 6, 53, 54, 75, 85, 95
II
Pen, Cmp
⫺
31
29, 52, 52A, 80, 6, 53, 54, 75, 85, 95
II
Pen
⫺
31
29, 52, 80, 6, 53, 54, 75, 85, 95
II
Pen
⫺
31
29, 52, 80, 6, 53, 75, 85, 95
II
Pen
⫺
36
3A, 3C
II
Pen
⫺
36
3A, 3C, 55, 71
II
Pen
⫺
7
95
Ia
Pen, Ery
⫺
7
95
Ia
Pen, Ery
+
15
NT
Ia
Pen
⫺
15
NT
Ia
Pen
⫺
43
NT
II
Pen
+
43
NT
II
Pen
⫺
109 262
2
266
88
96
91
i2 19
29, 52, 80
16
cfs555 18
2
⫺
m47 17
⫺
Pen, Gen
s84 16
s
Pen, Gen
s72 s80
III
I
cfs72
CF
29, 52, 80
I
s168
R
+
2
52, 52A, 80
s158
15
+
Pen, Gen, Sxt, Fus
80
s155 Ku
Pen, Gen, Ote, Sxt, Fus
I
16
s148
11
I
80, 3A, 6, 42E, 54
16
CG8B K
80, 6, 42E, 47, 75
a
157
CG29B
9
b-hemolysis
16
s129 Ital.B
Antibiotic resistance
119
s116
7
agr group
LT
62
NOTE. +, Hemolytic; ⫺, nonhemolytic; Cip, ciprofloxacin; Cmp, chloramphenicol; Ery, erythromycin; Fus, fusidic acid; Gen, Gentamicin; GT, genome type assessed by pulsed-field gel electrophoresis; LT, phage type; NT, not typeable; Ote, Tetracyclin; Oxa, oxacillin; Pen, Penicillin; s, sensitive against all antibiotics tested; Sxt, trimethoprim-sulfamethoxazole. a
b-hemolysis assessed by hot-cold hemolysis on sheep blood agar plates.
Figure 3. Molecular analysis of the genome alteration in strain pair m46/m47. A, Schematic drawing of region nt 714,871–1,268,383 in strain N315. Locations of SmaI and EagI restriction sites and of the genes sae, clfA, and hla and of amplicons (a) 17, 4, and 19 are given for N315. Restriction sites in parenthesis are not found in N315 but were deduced either from strain COL (EagI at position nt 819,311) or from the phage ETA sequence. From hybridization experiments, the additional stretch of DNA present in strain m46 was mapped to nt 875,220–931,123 (hatched box). The attB site of phage ETA is situated in open-reading frame SA0778 in N315. B, Examples of Southern blots of SmaI- and EagI-digested genomic DNA from strain pair m46/ m47. The specific probes against clfA, Eag7, and a19 hybridized to the altered fragments. C, Polymerase chain reaction for the attB site of phage ETA in m46, m47, and N315.
plasticity in S. aureus during chronic lung infection in patients with CF and during nasal colonization in healthy individuals. The frequency of genome alterations, assessed on the basis of PFGE restriction polymorphisms, was significantly higher in S. aureus derived from patients with CF (mean time of occurrence, 1.03 years) than in commensal isolates derived from healthy individuals (mean time of occurrence, 13.4 years). This indicates that, during long-term lung infection in patients with CF, the specific host response and/or the regular antibiotic exposure exerts strong selective pressure on the pathogen. S. aureus is predominately localized in the viscous mucus of obstructed airways in the infected lungs of patients with CF [22]. Chronic lung infection related to CF is characterized by reduced mucocilliary clearance and by the infiltration of polymorphonuclear leukocytes. The pathogen is not effectively eradicated by either the host response or antibiotic therapy and can persist for decades [23, 24]. No systematic analysis of recombination frequency in vivo is available for S. aureus, although changes in the PFGE pattern have been mentioned occasionally. For instance, in a long-term
study of nose colonization in healthy individuals, genome alterations were observed in 2 of 5 persistent carriers after 12 years [25]. This frequency correlates well with our estimates for isolates from healthy individuals. In conclusion, the genomes of commensal strains may evolve slowly in an individual over time. One could argue, of course, that S. aureus evolved over the millennia by adaptation to the nasal environment, and, therefore, evolutionary changes that can be witnessed over the short term are rare in colonizing strains. In follow-up studies of clinical methicillin-resistant S. aureus (MRSA) strains, fragment alterations in the PFGE pattern have been described. Changes occurred in 4 of 20 S. aureus isolates collected within a mean interval of 78 days [26] and in 5 of 25 isolates collected within a mean interval of 9 months [27]. These data suggest that the transformation rate was higher in these MRSA collections than in commensal strains. Unfortunately, the studies fail to mention whether the isolates were derived from an infectious site or from a colonizing site, nor do they state whether antibiotics were used. As a result, one can only speculate whether these strains were under any selecGenomic Alterations in S. aureus • JID 2004:189 (15 February) • 731
Fig. 4. Examples of Staphylococcus aureus strain pairs where genome alterations were linked to conversion of hlb expression. A, Pulsed-field gel electrophoresis after SmaI digestion of genomic DNA. Fragments hybridizing with the hlb probe are indicated with white arrows. B, Southern hybridization with digoxigenin-labeled hlb-specific probe.
tive pressure. On the other hand, MRSA recently evolved and spread from a limited number of clonal lineages—so these clones may be naturally more adaptable than others. We observed genome alterations in methicillin-sensitive strains of different genetic backgrounds. Thus, genome plasticity is not a trait of certain clonal lineages but instead seems to be a prerequisite for a strain’s ability to adapt to hostile environments. In contrast to the in vivo setting, no genome alterations were detected after in vitro subculturing under a variety of conditions. The stability of the PFGE patterns is commonly accepted and is one of the reasons for the widespread application of this method for strain typing. In Campylobacter jejuni as well, genetic recombination occurred only after intestinal passage in chickens, but not during growth in vitro [28]. Furthermore, it has been shown for S. epidermidis examined in human infection and in a foreign-body model that these in vivo environments are conducive to genetic exchange [29]. Thus, genomic plasticity is an important characteristic of pathogens, equipping them for survival in various hosts. 732 • JID 2004:189 (15 February) • Goerke et al.
In total, 19 S. aureus strain pairs were available for molecular analysis to clarify the nature of recombinational events in the host environment. In at least 8 cases, phage mobilization was the molecular basis for the genome alterations. In 1 strain pair, the observed genome alteration was due to the deletion of a phage similar to ETA. In the parental strain m46, the phage was integrated at the known attB site for the phage family [19]. The m46 phage was observed to have a mosaic structure, with homology to the phages ETA, 11, and 12. Mosaic structure has been described as a general feature of phage genomes [30]. Screening of our isolates showed no other strains with integrated ETA-like phages. This is consistent with the observation of Yamaguchi et al. [19] that phage ETA preferentially lysogenizes S. aureus strains of phage group 3A and 3C. In the strain collection in the present study, only the pair m46/m47 belonged to this phage group. Phage conversion of b-toxin production was evident in 7 pairs. Conversion is mediated by insertion of phage 42 and its variants into a conserved attachment site in hlb [20, 31]. The ensuing change in the PFGE pattern results either in the shift of an SmaI fragment or in the separation into 2 fragments due to an SmaI restriction site within the phage [31]. Both types of changes were observed, indicating that different variants of phage 42 were present in our strain collection. Obviously, phage mobilization plays an important role during infection. S. aureus phages may either carry accessory virulence factors (e.g., sak, sea, or eta) or interrupt chromosomal virulence genes (e.g., hlb or geh). Therefore, both insertion and deletion of phages can be accompanied by the augmentation of a virulence trait. However, no apparent advantage of any of these factors is evident in the environment of the CF host. Alternatively, the observed phage involvement may mirror an enhanced potency of lateral gene transfer, for which phages are the primary vehicle between S. aureus strains. Theoretically, homologous recombination mediated by transduction occurs all over the chromosome, providing the organism with a chance for broad genetic variation. In combination with a higher mutation frequency, it may provide advantages under conditions of severe selective pressure. Hypermutable strains of P. aeruginosa are selected during chronic lung infection related to CF and persist for years in most patients [8]. However, the occurrence of hypermutators in S. aureus strain collections from patients with CF is controversial [32, 33]. Increasing the recombination frequency may be another method of ensuring variation in this pathogen. Many prophages are induced by environmental conditions that lead to DNA damage, including exposure to reactive oxygen species generated by leukocytes or exposure to exogenous agents such as antibiotics [34]. Both conditions are present in the infected lungs of patients with CF and could lead to the phage mobilization detected in our strains. In addition, Broudy
et al. discovered a soluble phage-inducing factor elaborated by human pharyngeal epithelial cells that induces the SpeCencoding phages of streptococci [35]. Horizontal gene movements between different strains are likely to be favored when the donor and recipient strains occupy the same site. Cocolonization with multiple S. aureus strains occurs regularly in the CF lung but is rarely observed in the nose [16]. Alternatively, there might be a changing proportion over time of lysogenized and phage-free bacterial cells in the infected lungs of patients with CF. Additionally, free phages may be present at the site of colonization or infection. Besides the importance of phage mobilization during infection, one must keep in mind that genome alterations could be traced to phages in only a subset of our strain pairs. A preliminary analysis of the remaining pairs leads us to believe that intrachromosomal alterations, such as inversions or duplications, might occur and could be mediated by insertion sequence elements [36] or transposons. The clarification of these events requires the extensive mapping of the strains in question. This is an ongoing project.
11.
12.
13.
14.
15.
16.
17.
18.
Acknowledgment
We would like to thank W. Witte (Robert Koch-Institut, Wernigerode) for phage typing and antibiotic-resistance testing of isolates.
References 1. Smith JM, Smith NH, O’Rourke M, Spratt BG. How clonal are bacteria? Proc Natl Acad Sci USA 1993; 90:4384–8. 2. Smith JM, Feil EJ, Smith NH. Population structure and evolutionary dynamics of pathogenic bacteria. Bioessays 2000; 22:1115–22. 3. Feil EJ, Holmes EC, Bessen DE, et al. Recombination within natural populations of pathogenic bacteria: short-term empirical estimates and long-term phylogenetic consequences. Proc Natl Acad Sci USA 2001; 98:182–7. 4. Fitzgerald JR, Sturdevant DE, Mackie SM, Gill SR, Musser JM. Evolutionary genomics of Staphylococcus aureus: insights into the origin of methicillin-resistant strains and the toxic shock syndrome epidemic. Proc Natl Acad Sci USA 2001; 98:8821–6. 5. Kuroda M, Ohta T, Uchiyama I, et al. Whole genome sequencing of meticillin-resistant Staphylococcus aureus. Lancet 2001; 357:1225–40. 6. Baba T, Takeuchi F, Kuroda M, et al. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 2002; 359:1819–27. 7. von Eiff C, Becker K, Machka K, Stammer H, Peters G. Nasal carriage as a source of Staphylococcus aureus bacteremia. N Engl J Med 2001; 344:11–6. 8. Oliver A, Canton R, Campo P, Baquero F, Blazquez J. High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection. Science 2000; 288:1251–4. 9. Romling U, Schmidt KD, Tummler B. Large genome rearrangements discovered by the detailed analysis of 21 Pseudomonas aeruginosa clone C isolates found in environment and disease habitats. J Mol Biol 1997; 271:386–404. 10. Tenover FC, Arbeit RD, Goering RV, et al. Interpreting chromosomal
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
DMA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995; 33:2233–9. Goerke C, Kraning K, Stern M, Do¨ring G, Botzenhart K, Wolz C. Molecular epidemiology of community-acquired Staphylococcus aureus in families with and without cystic fibrosis patients. J Infect Dis 2000; 181:984–9. Oliveira DC, Tomasz A, de Lencastre H. Secrets of success of a human pathogen: molecular evolution of pandemic clones of meticillin-resistant Staphylococcus aureus. Lancet Infect Dis 2002; 2:180–9. Booth MC, Pence LM, Mahasreshti P, Callegan MC, Gilmore MS. Clonal associations among Staphylococcus aureus isolates from various sites of infection. Infect Immun 2001; 69:345–52. Schlichting C, Branger C, Fournier JM, et al. Typing of Staphylococcus aureus by pulsed-field gel electrophoresis, zymotyping, capsular typing, and phage typing: resolution of clonal relationships. J Clin Microbiol 1993; 31:227–32. Papakyriacou H, Vaz D, Simor A, Louie M, McGavin MJ. Molecular analysis of the accessory gene regulator (agr) locus and balance of virulence factor expression in epidemic methicillin-resistant Staphylococcus aureus. J Infect Dis 2000; 181:990–1000. Goerke C, Ku¨mmel M, Dietz K, Wolz C. Evaluation of intraspecies interference due to agr polyporphism in Staphylococcus aureus during infection and colonization. J Infect Dis 2003; 188:250–6. Novick RP, Projan SJ, Kornblum J, et al. The agr P2 operon: an autocatalytic sensory transduction system in Staphylococcus aureus. Mol Gen Genet 1995; 248:446–58. Novick RP. Genetic systems in staphylococci. Methods Enzymol 1991; 204:587–636. Yamaguchi T, Hayashi T, Takami H, et al. Phage conversion of exfoliative toxin A production in Staphylococcus aureus. Mol Microbiol 2000; 38:694–705. Coleman DC, Sullivan DJ, Russell RJ, Arbuthnott JP, Carey BF, Pomeroy HM. Staphylococcus aureus bacteriophages mediating the simultaneous lysogenic conversion of b-lysin, staphylokinase and enterotoxin A: molecular mechanism of triple conversion. J Gen Microbiol 1989; 135:1679–97. Lee CY, Iandolo JJ. Lysogenic conversion of staphylococcal lipase is caused by insertion of the bacteriophage L54a genome into the lipase structural gene. J Bacteriol 1986; 166:385–91. Ulrich M, Herbert S, Berger J, et al. Localization of Staphylococcus aureus in infected airways of patients with cystic fibrosis and in a cell culture model of S. aureus adherence. Am J Respir Cell Mol Biol 1998; 19:83–91. Kahl BC, Herrmann M, Everding AS, et al. Persistent infection with small colony variant strains of Staphylococcus aureus in patients with cystic fibrosis. J Infect Dis 1998; 177:1023–9. Branger C, Gardye C, Lambert-Zechovsky N. Persistence of Staphylococcus aureus strains among cystic fibrosis patients over extended periods of time. J Med Microbiol 1996; 45:294–301. VandenBergh MF, Yzerman EP, van Belkum A, Boelens HA, Sijmons M, Verbrugh HA. Follow-up of Staphylococcus aureus nasal carriage after 8 years: redefining the persistent carrier state. J Clin Microbiol 1999; 37: 3133–40. Hartstein AI, Phelps CL, Kwok RY, Mulligan ME. In vivo stability and discriminatory power of methicillin-resistant Staphylococcus aureus typing by restriction endonuclease analysis of plasmid DNA compared with those of other molecular methods. J Clin Microbiol 1995; 33:2022–6. Maslow JN, Brecher S, Gunn J, Durbin A, Barlow MA, Arbeit RD. Variation and persistence of methicillin-resistant Staphylococcus aureus strains among individual patients over extended periods of time. Eur J Clin Microbiol Infect Dis 1995; 14:282–90. Hanninen ML, Hakkinen M, Rautelin H. Stability of related human and chicken Campylobacter jejuni genotypes after passage through chick intestine studied by pulsed-field gel electrophoresis. Appl Environ Microbiol 1999; 65:2272–5. Van Eldere J, Peetermans WE, Struelens M, Deplano A, Bobbaers H.
Genomic Alterations in S. aureus • JID 2004:189 (15 February) • 733
30.
31. 32.
33.
Polyclonal staphylococcal endocarditis caused by genetic variability. Clin Infect Dis 2000; 31:24–30. Hendrix RW, Smith MC, Burns RN, Ford ME, Hatfull GF. Evolutionary relationships among diverse bacteriophages and prophages: all the world’s a phage. Proc Natl Acad Sci USA 1999; 96:2192–7. Smeltzer MS, Hart ME, Iandolo JJ. The effect of lysogeny on the genomic organization of Staphylococcus aureus. Gene 1994; 138:51–7. O’Neill AJ, Chopra I. Insertional inactivation of mutS in Staphylococcus aureus reveals potential for elevated mutation frequencies, although the prevalence of mutators in clinical isolates is low. J Antimicrob Chemother 2002; 50:161–9. Prunier AL, Malbruny B, Laurans M, Brouard J, Duhamel JF, Leclercq R. High rate of macrolide resistance in Staphylococcus aureus strains from patients with cystic fibrosis reveals high proportions of hypermutable
734 • JID 2004:189 (15 February) • Goerke et al.
strains. J Infect Dis 2003; 187:1709–16. 34. Wagner PL, Waldor MK. Bacteriophage control of bacterial virulence. Infect Immun 2002; 70:3985–93. 35. Broudy TB, Pancholi V, Fischetti VA. The in vitro interaction of Streptococcus pyogenes with human pharyngeal cells induces a phage-encoded extracellular DNase. Infect Immun 2002; 70:2805–11. 36. Ziebuhr W, Dietrich K, Trautmann M, Wilhelm M. Chromosomal rearrangements affecting biofilm production and antibiotic resistance in a Staphylococcus epidermidis strain causing shunt-associated ventriculitis. Int J Med Microbiol 2000; 290:115–20. 37. Goerke C, Campana S, Bayer MG, Do¨ring G, Botzenhart K, Wolz C. Direct quantitative transcript analysis of the agr regulon of Staphylococcus aureus during human infection in comparison to the expression profile in vitro. Infect Immun 2000; 68:1304–11.
