Staphylococcus aureus

Mohammed and Flayyih

Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814 DOI:10.24996.ijs.2017.58.2B.4

ISSN: 0067-2904

Patterns of Phenotypic and Genotypic Resistance to Macrolides, Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump and Enzymatic Modification in Methicillin Resistant Staphylococcus aureus Luma Saeed Mohammed*, May Talib Flayyih Deprtment of Biology, College of Science, University of Baghdad, Baghdad, Iraq. Abstract The study was carried out to isolate Staphylococcus aureus isolates from differents clinical samples to detect resistance of isolates to methicillin and detect the phenotypic and genotypic patterns of resistance to macrolides, lincosamides and streptogramins (MLS). The results showed that from 300 clinical sample there were 40 isolate related to S.aureus and there were 38(95)% of isolates were methicillin resistance S.aureus (MRSA). The suscepltibility test showed that there was 55% of isolates were resistance to erythromycin , 35% were resistance to clindamycin and 2.5% had intermediate resistance to the last one . The resistance to streptogramins determined phenotypicallyby the using of vitek 2 compact system,the results showed that there were four types of MLS resistance (iMLS, cMLS, M phenotype and SAB). All isolates were subjected to polymerase chain reaction teqnique in a monoplex pattern to amplify resistance encoding genes msrA, msrB,linA/linA’ and vga .The results showed that 36(90)% of isolates contain msrA(940bp) and msrB(595bp) , 30 (75)% of isolates contain linA/linA’ (323bp) gene while a region of (470bp) of vga gene was not found in any isolate. Keywords: S. aureus, MRSA, iMLSB , cMLS, M phenotype, SAB, msrA , msrB, linA/linA’, vga.

‫االنماط المظهرية والوراثية المقاومة لمجموعة مضادات الماكروليدات واللنكوسأمايد‬

‫ المقاومة للمثيسيلين بألية الضخ خارج‬Staphylococcus aureus ‫والستربتوغرامين في بكتريا‬ ‫الخلية والتحوير االنزيمي‬

‫ مـــــــــــي طالــــــــــب فليـــــــــح‬،*‫لـمـــــى سعيــــد محمـــــد‬ .‫ العراق‬،‫ بغداد‬،‫ جامعة بغداد‬، ‫ كلية العلوم‬، ‫قسم علوم الحياة‬ ‫الخالصة‬

‫اجريت هذه الدراسة لعزل بكتريا المكورات العنقودية الذهبية من نماذج سريرية مختلفة والتحري عن‬

‫مقاومة ا لعزالت لمضاد المثيسيلين و عن االنماط الوراثية والمظهرية لمقاومة مجموعة مضادات الماكروليدات‬ 03 ‫ عينة سريرية تم الحصول على‬033 ‫ اوضحت النتائج ان من مجموع‬، ‫واللنكوسأمايد والستربتوغرامين‬ ، ‫( منها من النوع المقاوم للمثيسيلين‬%59( ‫ عزلة‬03 ‫ و‬Staphylococcus aureus

‫عزلة تابعة للنوع‬

‫ منها مقاوم‬%)09( ‫( من العزالت مقاومة لمضاد االريثرومايسين بينما‬%99( ‫بينت نتائج اختبار الحساسية ان‬

803



‫ تم اختبار حساسية العزالت‬. ‫( من العزالت لها مقاومة متوسطة للمضاد االخير‬%5,9( ‫للكليندامايسين و‬ ‫لمضاد الستربتوغرامين مظهرياً بأستخدام نظام الفايتك حيث اوضحت النتائج ان هناك اربعة انماط مظهرية‬ ‫ عرضت كل العزالت لتفاعل‬. )SAB‫ و‬M phenotype‫ و‬cMLS‫ و‬iMLS) ‫لمقاومة هذه المجموعة هي‬

(vga,linA/linA’,msrB,msrA)‫البلمرة المتسلسل ذو النمط االحادي لتضخيم الجينات المشفرة للمقاومة وهي‬ ‫ و‬msrA(940bp)

‫( من العزالت حاوية على الجينين‬%53( ‫ عزلة‬03 ‫اوضحت النتائج ان‬،

‫ بينما لم تحتوي اي عزلة‬linA/linA’ (323bp) ‫( حاوية على الجين‬%59( ‫ عزلة‬03‫ و‬msrB(595bp) .(470bp)vga ‫على الجين‬

Introduction Antimicrobial resistance is one of most serious health threats , infections from resistant bacteria are now too common and some pathogens have even become resistant to multiple types or classes of antibiotics , S. aureus has become a major public health concern as a result of the steadily increasing incidence of antimicrobial resistance particularly methicillin-resistant S. aureus (MRSA) [1]. Macrolides (e.g. erythromycin, azithromycin, spiramycin), lincosamides (e.g.,clindamycin, lincomycin), and streptogramin (e.g., quinupristin) are groups of antibiotic collectively name MLS , they are chemically different, but have similar inhibitory effects on bacterial protein synthesis , MLS commonly used in treatment of staphylococcal infections and clindamycin is a frequent choice for some staphylococcal infections particularly skin and soft tissue infections and it is an alternative in the penicillin-allergic patients [2]. Due to the high resistance to most of the antibiotics by MRSA, vancomycin is normally the drug of choice. As vancomycin has many side effects, it leads to interest in the alternatives for vancomycin especially MLS antibiotics [3]. The resistance phenotypes are: *M Phenotype: Staphylococcal isolates exhibiting resistance to erythromycin or while sensitive to clindamycin [4]. *Inducible MLS (iMLS) Phenotype:Staphylococcal isolates show resistance to erythromycin and clindamycin [5]. *Constitutive MLS Phenotype (cMLS): resistant to macrolide, lincosamide and streptogramin antibiotics [6]. *SAB: resistance to streptogramines A and B antibiotics [7]. Materials and Methods: Sample collection: Three hundreds clinical specimens including urine, ear, sputum, blood and skin swabs, were collected from patients attending Baghdad Hospitals, for the period from January to April 2015. Isolation of staphylococci: The isolation of staphylococci from various clinical sample by specific way depending on routine laboratory techniques, all samples were streaked on mannitol salt agar all plates were incubated aerobically for 24 hrs. at 37°C. [8]. S.aureus isolates were identified depending on the morphological features on culture media and biochemical tests according to Bergey’s Manual [9], and confirmed diagnosis by the use of vitek2 compact system. Detection of MRSA The detection of MRSA was carried out through cefoxitin screen test and susceptibility test of S. aureus isolates to oxacillin. MLS susceptibility pattern: Macrolide-lincosamide and streptogramines susceptibility pattern determined by using of vitek 2 compact system by estimation of MIC values of erythromycin and clindamycin, resistance to streptogramines determined phenotypically. DNA extraction from S.aureus isolates by using Wizard® Genomic DNA Purification Kit Promega (USA):

804



1. S.aureus isolates were streaked on mannitol salt agar, after incubated for 24 hrs. at 37ºC. There after the bacterial isolates were inoculated in tubes contained 5 ml of sterile brain heart infusion broth , incubated overnight 18 hrs. at 37 ºC. 2. From bacterial growth 1.5 ml was transferred to a 2ml microcentrifuge tubes and centrifuged at 14000g for 2 min. to pellet the cells, the supernatant was removed. 3. The pellet cells were resuspended in 480μl of 50mM EDTA and 120 μl of lysozyme was added to the resuspended cells and pipetting gently to mix, after incubation at 37ºC for 2hrs. in water bath, the microcentrifuge tubes were centrifuged for 2 min. at 14000g and the supernatant was removed. 4. Nuclei Lysis Solution 600μl was added to the pellet cells and pipetting gently to mix then incubated in water bath at 80ºC for 10 min., the microcentrifuge tubes allowed to cool at room temperature. 5. RNase solution 3µl was added to the cell lysate, the microfuge tubes were inverted gently to mix, the tubes were incubated in water bath for 60 min. at 37ºC. 6. Protein Precipitation Solution 200 µl was added to the RNase treated cell lysate, vortex vigorously at high speed for 20 sec. to mix the protein precipitation solution with the cell lysate, the microfuge tubes incubated in ice bath for 10 min. 7. The microcentrifuge tubes were centrifuged at 14000g for 3 min. 8. The supernatant contained DNA was transferred to new clean 1.5 microfuge tubes containing 600 µl of room temperature isopropanol at room temperature , gently mix by inversion until the thread-like strands of DNA form a visible mass, centrifuged the tubes at 14000g for 2 min. 9. The supernatant carefully poured off and the tubes drained on clean absorbant paper, 70% ethanol was added to wash the DNA pellet at room, centrifuged the tubes at 14000g for 2 min. and the ethanol was aspirated. 10. DNA Rehydration Solution 100μl was added to the DNA in the microfuge tubes and rehydrate through incubation at room temperature overnight. 11. The DNA was stored in -20ºC. Determination of DNA quality Estimating of DNA concentration and purity: The DNA concentration and purity were determined by using nano drop instrument from ACT gene (China), the principle of this instrument is measuring the absorbency of nucleic acid in the wave length 260/280 (according to company instructions). Agarose Gel Preparation and Electrophoresis: Agarose gel was prepared in 1% concentration for quality of the extracted DNA, by dissolving 1 gm of agarose powder in 100 ml of 1 x TBE buffer and melted, then the agarose gel was cooled to 5060ᵒC, 5 μL of ethidium bromide dye was added with mixing , DNA samples were first mixed with aloading dye, so that 8 μL of each DNA sample were mixed with 2 μL loading dye, then this 10 μL of loaded DNA were carefully transferred to a well of the agarose electrophoresis gel, electric current was matched (72 volt for 90 min.) [10]. Primers selection: All the primers listed in Table-1 were selected for this study, these primers were provided in a lyophilized form (Bioneer) , dissolved in sterile distilled water to give a final concentration of 100 pmol ∕ μL and stored in deep freezer until used in PCR amplification , vga primer also designed according to NCBI BLAST http://www.ncbi.nlm.gov. Table-1.

805



Table1-The primers and their sequnces used in convential PCR. Primer sequences5-3

PCR fragment size(bp)

References

MsrA F

GGCACAATAA GAGTGTTTAA AGG

940

[11]

msrA

MsrAR

AAGTTATATC ATGAATAGAT TGTCCTGTT

msrB

MsrB F

595

[11]

msrB

MsrB R

linA/linA′

linA/linA′ F

GGTGGCTGGG GGGTAGATGT ATTAACTGG

323

[12]

linA/linA′

linA/linA′ R

GCTTCTTTTG AAATACATGG TATTTTTCGA TC

Vga

Vga F

CCAGAACTGC TATTAGCAGA TGAA

470

[13]

Vga

Vga R

AAGTTCGTTT CTCTTTTCGA CG

Vga

Vga F

CTCTTTGTACGAGTATATGG

198

Promega /USA

Vga

Vga R

GTTTCTTAGTAGCTCGTTGAGC

Target gene

Primer name

msrA

TATGATATCC ATAATAATTA TCCAATC AAGTTATATC ATGAATAGAT TGTCCTGTT

Polymerase Chain Reaction (PCR) Technique: The extracted DNA, primers and PCR premix (promega), were thawed at 4ᵒC, vortex and centrifuged briefly to bring the contents to the bottom of the tubes.PCR mixture was set up in a total volume of 25 μL included 5μL of PCR premix 2 μL of each primer, 5 μL of template DNA have been used , the rest volume was completed with sterile neuclease free water water, then vortexed (tempalate DNA was added finally) , PCR reaction tubes were centrifuged briefly to mix and bring the contents to the bottom of the tubes then placed into thermocycler PCR instrument where DNA was amplified as indicating in the Tables-2 ,3 and 4 after optimization . Table 2- Program used to amplify the msrA and msrB gene. Stage Temperature (time) Initial denaturation 95°C (5min.) Denaturation 95°C (30sec.) Annealing 50°C (35sec.) 30 cycles Extension 72°C (50sec.)

806



Final extension

72°C (7min.)

Hold

4°C

Table 3- Program used to a mplify the linA/linA′ gene. Stage Initial denaturation Denaturation Annealing Extension

Temperature (time) 95°C (5min.) 95°C (30sec.) 57°C (35sec.) 72°C (50sec.)

30 cycles

Final extension

72°C (7min.)

Hold

4°C

Table 4- Program used to amplify the vga gene. Stage Temperature (time) Initial denaturation 95°C (5min.) Denaturation 95°C (30sec.) Annealing 54°C (35sec.) 30 cycles Extension 72°C (50sec.) Final extension

72°C (7min.)

Hold

4°C

Determination of PCR product: Agarose gel was prepared in 1 % concentration there after, 5 µl DNA ladder were placed in the first left well of the agarose electrophoresis gel, 5 μL of each PCR product loaded carefully to other wells of the agarose electrophoresis gel, then the electrophoresis tank closed with its special lid, and electric current was matched (72 volt for 90 mim.) [14]. Results and discussion: Based on biochemical characteristics , from 300 sampels 40 isolats (SA1 to SA40) were identified as S.aureus. Detection of MRSA: The detection of MRSA was carried out through cefoxitin screen test and susceptibility test of S. aureus isolates to oxacillin, these two tests confirmed phenotypically by presence of modification of mecA gene, the results showed that 38 (95) % of S. aureus isolates gave positive results to cefoxitin screen test indicated that these isolates were MRSA, 2 (5 %) isolates (SA34 and SA38) were negative for this test indicated that these two isolates were MSSA, 95 % of S. aureus isolates resistant oxacillin (MIC ≥ 4 μg/ml) and 5% of isolates were sensitive (MIC ≥ 0.5 μg/ml), Oxacillin-resistant S. aureus (ORSA), more commonly referred as MRSA [15]. The results showed that all S. aureus isolates which gave positive test of cefoxitin screen and resistance to oxacilline had modification of penicillin binding protein (mecA) (95 %). Susceptibility of S. aureus isolates to MLS antibiotics S.aureus isolates were 55% and 32.5% resistance to erythromycin and clindamycin respectively. (MIC>=8 µg/ml for both antibiotics and (