Structural and functional organization of the Yersinia pestis bacteriocin ...

Printed in Great Britain

Microbiology (1996), 142, 3415-3424

Structural and functional organization of the Yersinia pestis bacteriocin pesticin gene cluster Alexander Rakin,' Elena Boolgakowa* and Jurgen Heesemann' Author for correspondence: Alexander Rakin. Tel: +49 89 5160 5200. Fax: +49 89 5380 584.

1

Max von Pettenkofer lnstitut filr Hygiene und Medizinische Mikrobiologie der Universitat Milnchen, PettenkoferstraBe 9a, 80336 Milnchen, Germany

2

Institute for Plague Control "Microbe", Saratov, Russia

The primary structure of a 2671 bp DNA fragment between the pla gene (encoding plasminogen activator) and the origin of replication of the wild-type Yersinia pestis plasmid pYP358 was determined. Two ORFs of 1074 and 426 bp with opposite transcription polarities were identified on both strands. They encode a 357 aa pesticin activity protein (Pst) and a 141 aa pesticin immunity polypeptide (Pim). A GC-rich palindromic structure located between pst and pim can form a hairpin loop and serve as a rho-independent transcription terminator sequence for both genes. The site for the interaction with the LexA repressor of the SOS system was found in another palindromic structure preceding the pst structural gene. A deduced 399 kDa Pst polypeptide is devoid of a signal peptide, indicating a Sec-independent mode of export. Pst carries a pentapeptide typical of TonB-dependent colicins (TonB box) that is necessary for the interaction with the yersiniabactidpesticin receptor and for active energyldependent transport through the outer membrane. The substitution of the last five C-terminal amino acids did not significantly influence the bactericidal activity of the truncated pesticin. The pesticin lost its ability to kill sensitive bacteria and to bind to a pesticin receptor after deletion of the last 57 C-terminal amino acids. A deduced 16 kDa Pim protein has an Nterminal hydrophobic amino acid stretch with features typical of prokaryotic signal peptides. Pim is a slightly hydrophilic protein with a basic pl. The immunity protein was localized in the periplasmic space and in the outermembrane fraction after its overexpression under the polymerase T7 promoter. Several other ORFs were identified on the sequenced 2671 bp fragment, but none of them seemed to encode a typical lysis peptide, which is necessary for the release of the pesticin. In the promoter region and in the regions preceding and following the pst operon, the DNA sequence has high (> 70%) identity with other colicin genes. The DNA sequence located 284 bp upstream of the pim gene showed more than 90% similarity to antisense RNA I of the ColEl replicon. This defined the location of the pYP358 origin of ColE1type replication. Keywords : Yersinia pestis, pYP358 plasmid, pesticin activity and immunity genes

INTRODUCTION Many species of both Gram-negative and Gram-positive bacteria produce bacteriocins, polypeptides of diverse size which are directed against a limited number of closely related micro-organisms and provide an advantage for the producing cells in their ecological niche (Konisky, 1982; Braun e t al., 1994). The most studied bacteriocins are The EMBL accession number for the sequence data reported in this paper is 254145.

0002-08330 1996 SGM

colicins produced by Escbericbia cali (Konisky, 1982). The mode of colicin action involves three steps: binding to specific receptors located in the outer membrane, translocation across the membrane, and direct action on their targets. Specific colicin domains can be assigned to each of these functions. Colicins usually use outer-membrane receptors which are receptors for iron chelators or vitamins. Depending on the utilized energy-coupled transport system, colicins can be divided into TonBdependent and TolA-dependent groups (Braun e t al., 1994). TonB-dependent colicins exploit the TonB ap3415

A. R A K I N , E. B O O L G A K O W A a n d J. H E E S E M A N N

paratus in order to interact with their cognate receptors and to translocate across the outer membrane, while uptake of group A bacteriocins is mediated by the To1 system. Colicins display nuclease activity, form pores or inhibit murein synthesis (Konisky, 1982; Braun e t al., 1994). Colicin-producing cells are immune to the lethal activity of the colicin due to the production of the cognate immunity protein (Konisky, 1982). Colicins are devoid of signal peptide sequences, and thus they need an additional lysis peptide to facilitate colicin transport through membranes (Braun e t al., 1994). This lysis gene and the colicin activity and immunity genes are clustered on plasmids.

Yersinia pestis, the aetiological agent of plague, produces a bacteriocin, designated pesticin (Hu & Brubaker, 1974), which is encoded by a 9.5 kb plasmid, pYP (Kol'tsova e t al., 1973; Ferber & Brubaker, 1981). Pesticin is active against just a few closely related species represented by Yersinia psendotnbercnlosis 01, Yersinia enterocolitica biot ype 1B strains and certain E. coli strains (Hu e t al., 1972; Hu & Brubaker, 1974). It exhibits N-acetylglucosaminidase activity (Ferber & Brubaker, 1979). Pesticin can utilize the FyuA receptor that is responsible for the transport of the yersiniae iron chelator, yersiniabactin (Heesemann e t al., 1993; Rakin e t al., 1994; Fetherston e t al., 1995). The expression of pesticin is thought to be controlled by the SOS system (Hu etal., 1972),and its transport through the outer membrane and interaction with the cognate FyuA receptor is TonB-dependent (Ferber e t al., 1981). Y.pestis is immune to pesticin, but nothing is known about the presence of a lysis peptide. Pesticin activity and immunity genes were mapped on a 9.5 kb plasmid by Sodeinde & Goguen (1988), and the possible transcriptional polarity of both genes was defined by Sorokin e t al. (1989). The work was aimed at elucidating the primary structure and organization of the Y.pestis bacteriocin pesticin gene cluster, which includes genes encoding pesticin activity (Pst) and immunity (Pim) proteins, and possibly a lysis peptide. METHODS Bacterial strains and culture media. The wild-type Y.,bestis strain 358 (Kutyrev e t al., 1989), cured of the 70 kb virulence plasmid, was used as a source of the pesticin-encoding plasmid pYP358. Y.pestis 358 and pesticin-sensitive Y.pestis strain 1146 cured of a pesticin plasmid were from the collection of the Institute " Microbe ", Saratov, Russia. Y.pestis EV76 and E. coli Phi (Ferber et al., 1981) were from R. R. Brubaker, Michigan State University, USA. Y.enterocolitica YVA-314 and YVAC (Heesemann, 1987) and E. coli DH5a (Hanahan, 1983) and WM1576(pGP1-2) (Tabor & Richardson, 1985) strains were from the collection of the Max von Pettenkofer Institut, Munchen, Germany. pBluescript I1 KS (pKS) (Stratagene) and a pBR322 derivative, pAT153, were used as cloning vehicles. Recombinant plasmids constructed in the course of this study are presented in Table 1. The pesticin assay was performed as described previously by Hu & Brubaker (1974). The production of Pst was induced by the addition of 0.5 pg mitomycin C ml-'. Strains were grown in Luria broth or on Luria-Bertani agar plates (Difco) at 28 OC (Yersinia spp.) or at 37 "C (E. colz].

3416

Table 1. Recombinant plasmids constructed in this study Plasmid

pKSS pEK9 pKSP2 pKSPS3 pKSPS3ARV pEK14 pEKl1 pKSIl pIRV pCDS pCDH pIMEV pPSIY4 pPSIY44 pPSIY 1 pPSIY 15

Relevant characteristics

Vector

S ~ U I , ~ ~ , - S ~ U Iof, , ,pYP358 , Cld2651-Cl~14585 of pYP358 of pEK9 Cld2651-Cl~14565 J~~1302s-Cl~14565 of pKSP2 S~~I,,,,-E~~RV4,,, of pKSPS3 HincI14151-HincI16,,5of pYP358 Cl~14565-S~~17260 of pYP358 C l ~ 1 , ~ , ~ - H i ~ ~of 1 1pYP358 ~,,~ E ~ ~ R V , , , , - H ~ ~ C Iof I ~pKSIl ,,~ Cl~12651-D~~I,,,5 of pKSP2 subcloned in ClaI-SmaI of pKS C ~ L Z I ~ ~of ~pKSP2 ~ - D ~ ~ subcloned in ClaI-HincII of pKS p.926-p. 1114 PCR fragment p.344-p.1114 PCR fragment SalI-ClaI fragment of pPSIY4 subcloned in SalI-ClaI of pKS PCR fragment obtained by mispriming of p.344-p.l114* MI-Cia1 fragment of pPSIY 15 subcloned in SalI-ClaI of pKS

PKS pATl53 PKS PKS PKS pATl53 pATl53 PKS PKS PKS IPKS ~ ~ ~ ~ PMOS PMOS PKS PMOS PKS

*The PCR fragment subcloned by A-tailing in pPSIYl was obtained as a result of a mispriming of p.344 with a DNA sequence starting from bp 2119 (Fig. 2), and thus generated a fragment 342 bp shorter than the one normally obtained for p.344-p.1114 (e.g. in pPSIY4). Therefore, the pPSIYl plasmid carries a truncated nonfunctionalpim gene and a complete copy of a gene encoding possible ORF3.

DNA manipulations. DNA was isolated, digested with restriction endonucleases and ligated by standard methods (Sambroook e t al., 1989). Self-designed oligonucleotides which were used as amplification and sequencing primers are depicted in Fig. 2.

PCR amplification reactions were performed in an automated thermal cycler (Biometra) using Taq polymerase (Eckert & Kunkel, 1990) as described by Saiki e t al. (1988). The initial denaturation step (94 OC; 5 min) was followed by 30 cycles of denaturation, annealing and extension with a single final extension step. The temperature and time of the last two steps varied according to the primers utilized. PCR amplicons were purified and concentrated with Jet Pure beads (Genomed). In certain cases, PCR amplicons were cloned by A-tailing using a pMOSBlue T-vector kit (Amersham). DNA sequencing of both strands was performed by the chain-termination method in a model 373A DNA sequencer (Applied Biosystems). DNA sequences were aligned and analysed with the GCG sequence analysis software package (University of Wisconsin, USA). Expression studies. Expression of the pY P358-encoded polypeptides was studied in vitro in an E . coli S30 extract system (Zubay, 1973) using a prokaryotic-DNA-directed translation kit (Amersham), and in vivo using the T7 RNA polymerase/ promoter system of Tabor & Richardson (1985). Bacterial cells producing high amounts of the immunity protein under the T7 promoter were fractionated as described by Olschlager & Braun

Y.pestis bacteriocin pesticin gene cluster (1987), i.e. the sediment obtained from 10 ml of the in vivo labelled cells was resuspended in 1.3 m13 mM Tris/HC130 mM sucrose/0.03 mM EDTA solution, pH 8, containing 10 pg lysozyme. The suspension was twice frozen and thawed. After 45 min at room temperature it was centrifuged. The supernatant contained the periplasmic and some cytoplasmic proteins. The sediment was resuspended in 1.2 ml 20 mM MgC1, containing 5 pg bovine DNase. After 1 h incubation, the suspension was centrifuged at 30000 g for 60 min. Cytoplasmic proteins present in the supernatant were precipitated with ethanol. The total membrane fraction in the sediment was resuspended in 0.2 ml 50 mM Tris/HC1/10 mM MgC1,/1% (v/v) Triton X-100, pH 8. After 30 min at room temperature, the suspension was centrifuged for 10 min at 15000 r.p.m. in a microcentrifuge. The sediment consisted of the outer membrane, and the supernatant contained the dissolved components of the cytoplasmic membrane. The proteins were precipitated by the addition of 0-2 ml chloroform and 0.48 ml methanol. Pellets were resuspended in 100 p1 cracking buffer, boiled for 5 min, and 20 pl aliquots were loaded onto an SDS-PAGE gel. The expression of the T7 RNA polymerase was induced by a temperature shift (43 "C; 30 min). Inhibition of the expression of host proteins was achieved by the addition of 200pg rifampicin ml-'. Newly synthesized proteins were labelled with 10 pCi (370 kBq) [35S]methl~nine(Amersham) for 5 min at 30 "C. Samples were boiled for 5 min and were subjected to SDS-PAGE separation. Gels were dried and autoradiographed.

RESULTS Pesticin activity protein, Pst

A detailed restriction endonuclease cleavage map of pYP358 isolated from Y.pestis strain 358 was constructed by double and triple digests (Fig. 1). Restriction enzymes

7280

I

Hincll . ...._.. Hincll

pYP358 9500bp

EcoRV

..........................................

...................................... ......................................... ..................................

Fig. 7. Cleavage map of Y. pestis plasmid pYP358 encoding the pesticin activity (pst), pesticin immunity (pim) and plasminogen activator (pla) genes (Sodeinde & Goguen, 1988). The position of the IS100 insertion sequence (Podladchikova et a/., 1994) is indicated. The arrows show the transcriptional polarity. Numbers indicate the distance of the restriction sites clockwise from the Pael restriction site.

ScaI, Sad, M I , XboI, XbaI and M l d had no cleavage sites in pYP358. Restriction enzymes HindIII, KpnI, BamHI, PstI and Pa d had a unique cleavage site. This refined map complements already existing ones constructed for pesticin-encoding plasmids from other Y. pestis strains (Mishankin e t al., 1984; Sodeinde & Goguen, 1988; Podladchikova e t al., 1994). Pesticin activity (pst) and immunity (pim) genes were fragment that localized on a 4251 bp SmaI,,,,-SmaI,,,, was subcloned into pBluescript I1 KS to produce plasmid pKSS. A 1074 bp ORF (bp 685-1758) capable of encoding a 357 aa polypeptide was localized on one DNA strand (Fig. 2). The ATG start codon in preceded by a strong ribosomebinding site (GAGGA; bp 674-678) and the TAA stop codon is followed by a hairpin-loop structure capable of forming a rho-independent terminator structure (bp 1764-1787). The expression of pesticin is thought to be controlled by the SOS system (Hu e t al., 1972) and, accordingly, a binding site for interaction with the LexA repressor was localized immediately upstream of a putative pst promoter (bp 605-621). The second site for potential LexA binding could be identified on the second DNA strand in a palindromic P1 structure (bp 603-637) (Fig. 2). The homology search in the EMBL database revealed the highest score to be the pst gene with the colicin 10 gene (50.2 YO identity over 1561 bp) (Pilsl & Braun, 1995); 46% identity was found for colicin El (Yamada e t al., 1982) and colicin B (Schramm etal., 1987) sequences. The comparison of thepst DNA sequence with the colicin E l promoter region gave an even higher score - 86-2YO over 68 bp. The 150 bp promoter regions of several bacteriocins were aligned (Fig. 3). The identity ranged from 68% for colicin 10 to 76% for colicin N (Pugsley, 1987). The 357 aa polypeptide predicted from the DNA sequence of thepst gene has a molecular mass of 39.9 kDa, which correlates well with its mobility in SDS-PAGE gels (Fig. 4). The Pst protein is devoid of a signal peptide, indicating a Sec-independent mode of export. Pesticin carries a highly conserved N-terminal pentapeptide typical of all TonB-dependent bacteriocins (Schramm e t al., 1987) that is identical to that of colicin B: Asp-Thr-Met-Val-Val (aa 3-7) (Fig. 2). The homology search showed no significant homology of the Pst protein with other bacteriocins. The highest scores were found for colicin D (26.9 YO identity over 26 aa) (Roos e t al., 1989), colicin A (33.3 YOidentity over 21 aa) (Morlon e t al., 1983) and colicin M (38.5 YOidentity over 13 aa) (Kock e t al., 1987). The main region of similarity with TonB-dependent colicins (colicins B, D, Ia, Ib, M) resides in the TonB-interacting N-terminal region. Pst is an acidic protein with a calculated PI of 5.56. This feature unites Pst with other acidic bacteriocins like colicin B (PI 4-67), colicin D (PI 4.82) and colicin 10 (PI 5.2) in contrast to basic colicin El (PI 9-72), colicin N (PI 10.02) and colicin M (PI 9.1). 3417


A A T A T G C I T C G l T A ~ T A A A ~ C A G C A C C T C ~ A C G C m C T1440

Cla I/Eco RV Crp T ~ C G m T C T C G T C G T C l G A ~ C ' I T K X ~ W 60 C

AsnMetLeuArgGlyLysGluAlaTyrAspLysValArgThrAlaProLeuThrLeuSer

G G T G C A A A A T A T C C A O O G A A A T A l G A T C ~ ~ ~ ~ G A ~ C G A12 ~ 0C ~

G A T A A T G A A D C T C A T C T C ~ A T C T ~ T A ' I T T A T A T P C A T A 1500

CCITGAGCCGATGOTACTGATAACGGGAGTl'AEGTAAATCTI'CCCGTI'CCTGCCC~ *I

GGTCTPrPCAATCACCCTAATATCGCPCTPCOGTPCACCGCCGT

180

240 stu I C T C G C C T G G T A A A T C G C A X G T ~ ~ C T G T C C ~ C A C C G ' X ' A C ~ ~ C T300 G

~lTCCACCCC"CCGG~CGCICAGGTA'ITTACGGGCGAGACGAAmGT

ACCAGATGGCGCAGGTCGGCCTG~TCAGTGTGTAMiCGT

360

GCTGTCCGlTCTPCGTATCCGGCAACGACAAGTGCAGCC

420

C T C A G T C G G T G G C G A C C A G A ~ ~ ~ C G T P A T C T 480

A T G T I ' A C C C G C T C C T T C C T C C G A A T C T P C C ~ C T G A ~ A T ~ G ~540

-35

T

T

A

C

A G lexA

A

T

C

A

C

P1 sd

p 8 t ==>

A

P57

A

T

A

-10

T

I

'

A

P

m A A C l T A T ' E l " l T TonB-box

TTl?ATGTGTOAAA~TlTlTA~AGATACAATGGFAG'IGAA'KG"CAGG'R%T MetSer~p~tV.lV~AsnGl~erGlyGly ValProAlaPheLeuPheSerClySerThrLeuSerSe~ArgProAsnPh~luAla Dra I

ThrAlaLeuValSerIleGl~GlnLysGlyPheLysLeuSerArgThrAlaProThr p1114

G

T

A

l

C

G

A

A

T

X

A

A

G

AsnSerIleThrIleAlaLeuProHisTyrValAsp~uProOlyArgSerAsnPheLys

52

ClGATGTACA'X'ATGGGG~CGAT'EATACGGAGAEGAGAAAGACA~TAmA

900 72

A A T A A G A T C C G C G T ~ ~ C ~ G G G A C C G ~ A Y 60 C ~ ~ G 92 AsnLysIleArg01nG1uSerLysIleSerLysThrGluGlyThrVa1SerTyrGlUG~n Acc I A M A T A A C P G T P G A A A C A O G T C A C G A A A A A C A C G G T G ~ C ~ X A ' K G ~ 1020 112 LysIleThrValGluThrGlyGlnGluLys~pGlyValLysVa1TyrArgValMetVa1 p537 1080 CT P GA GGGA A C G A" E CCG AAT C T AT E A A C A T C~ C A W 132 LeuGluGlyThrIlaAlaGluSerIlffiluWisLeuAspLysLysGluAsnGl~pIle CTOAATAATAACCGAAATC~TCGTCCTAOCCOACAACA LeuAsnAsnAsnArgAsnArgIleValLeuAlaAspAsnThrValIleAsnPhaAspAsn Hinc I1 Hinc I1

1140 152

A l T ~ W T I l l T A C G T C G T l ' C G G T A A A T A A~ CCG A T A T

1200 172

312

P CTIGTAAAWXTTTI'AATAATA'X'

1680 332

ValTrpAsnLysValIleAlaLysAspTrpAmGlyLeuVa~nAlaPheAsnAsnIle Eco RV/Cla I

G T K ; A T O G A A T G T C T G T A A A C ~ G C X T G G ~1740 ~

352

ValAspGlyMetSerAspArg~gLysArgGluGlyAlaLeuValGlnLysAspIleAsp T

AATATACAG'XCAACCAGGGATAGA~'ITTATlTCTlTCACTACTATAAAGmCAG

32

1560 292

A C A G C A C T G G T O T C T A ~ m G T A T I X C ~ A T C C A G A A ~ T C C C A 1620 ~

660

A A T T C G A T I ' A C A A T P O C A l T A T G ~ T C m C ~ C ~ ~ A84A0 ~

LeuMetTyrIleMetGlyPheProIleAspThrGluMetGluLysAspSerG~u~rSer

GlyLeuPheAsnAspAlaAsnIleGlyLeuArgPheSerAspLeuProLeuArgThr€Ug Eco RV

1500

G T P C C G G C m T C T C ~ C C D A A G T A C A G A C ~ ~ T780

272

AspAsnGluAlaHisLeuLeuSerAsnI1eTyrIlaAspLysPheSerHisLysIleGlu

AGlEGATX"AAAATX@CCA-T-TAmUTGAT SerGlyLeuLeuLys'.'

720 12

252

1800 141

Hi sTyr

1860 120 TyrValThrCysGlyProI1eSerL~Ly~Il~l~ysValValIlePh~snGlySer p160 A m T A C T T m T T A T A A G T A C A G C A T G T A T I X C T A G A G G A T G T A P TTAGAG 1920 100 LysValLysLysIleLeuLeuProHisIleAlaValTyrTgIleLeuSer Acc I Eco RV A G A A A T C ~ G A C ~ ~ ~ ~ T C ~ A A T X C T A G 1980 T A ~ A A ~ 80 PheAspGluPheCysValThrTyrGluAspArgLysIleGlyLeuIleL~sLeuSerIle ~

T

C

C

A

~

G

~

A

~

T

A

A

G

~

T

G

~

~

T

MethpSerAsnAspLysAsnIleLeuAlaIleHisLysLys~r~nSerLysI~eAsn p124 TGCCAlGAGACMTGMT

TPGTAAACTCGG

ThrPheGluThrGlnLysPheThrThrGlnLysGlyTyrIleGlyHisSerLeuSerAsn T

G

C

C

A

A

G

A

T

G

T

C

~

T

A

T

A

T

G

2040 G ~ 60 2100 40

E 2160 ~

GlyPheThrAsnLeuGluLeuAsnGlnLeu11eAapLysAlaThrTyrThrAsnLysG~u p2 52 70%) to the intergenic region which is located upstream of colicin 10 (Pilsl & Braun, 1995). Another stretch of DNA showing high homology to RNA I of the ColEl plasmid (Morita & Oka, 1979; Tomizawa e t al., 1981) can be identified upstream of the pim gene, bp2501-2612. The presence of an RNA I encoding sequence which is highly homologous to RNA I of colicinogenic plasmid ColEl defines the Col-type origin of replication of the pYP358 plasmid.

DISCUSSION Bacteria frequently produce bacteriocins, gaining benefit by defending their ecological niche against closely related species. Competitors are killed by a bacteriocin and the producing cell is protected by its own immunity factor. In addition, the bacteriocin-encoding plasmids usually encode additional factors important for the survival of the plasmid-harbouring cell. Y . pestis is no exception. Wildtype strains produce the bacteriocin pesticin directed against closely related species and sensitive Y.pestis cells which have lost their immunity to pesticin as a result of curing of the 9.5 kb pYP plasmid. In addition to pesticin, pYP encodes a plasminogen activator (Sodeinde & Goguen, 1988, 1989). Thus, the pesticin plasmid has a dual function - to kill competing cells and to support the high invasion potential of the Y.pestis population. We have mapped precisely the position of the pesticin gene cluster on one of the pYP plasmids, pYP358, cloned the genes encoding pesticin activity and immunity proteins, and determined the primary structure of the DNA fragment from thepla gene to the origin of the pYP358 replication. The arrangement of the pesticin gene cluster of Y. pestis plasmid pYP358 resembles the arrangement of the genes of the pore-forming colicins A, B, E l , Ib, Ia, K and N and of colicin M, which inhibits murein biosynthesis (Braun e t al., 1994) (Fig. 6). Thepim gene is also transcribed with opposite polarity to thepst gene, and thus they are subject -

342 1


to different control. The pst gene has a mitomycininducible SOS promoter, while pin- seems to be constitutively expressed like other colicin immunity genes (Waleh & Johnson, 1985). Inverted orientation of thegim gene may provide an additional control of the low-level expression of bactericidal Pst protein in uninduced cells. Both genes utilize the same rho-independent transcriptional termination sequence (Fig. 2), thus increasing the degree of compactness of the pesticin cluster. The efficiency of transcription termination can be different for the pst and pim genes. It seems to be more effective for pim, which has a string of Ts following a GC-rich dyad symmetry element, and less effective for pst. This readthrough effect can be used for transcription of genes located downstream of pst.

+

Both the pst and pim genes have a low G C content (40 mol%), like the third gene pla (39.9 molY~),which is located on the same replicon. Such a low G + C content indicates a similar origin for all of the pYP-encoded genes which is different from the origin of the Yersitzia chromosome, which has a higher G + C content (46-50 m o l Y ; Bercovier & Mollaret, 1984). Interestingly, thefytlA gene of Yersinia, which encodes the receptor of yersiniabactin and pesticin, has a G C content of 56.2 mol YO,which is higher than that of the Yersitzia chromosome (Rakin e t al., 1995), and thus may originate from a different source.

+

Pst, like other colicins, has no signal peptide, and must be released with the help of a lysis peptide which is usually encoded in the vicinity of the colicin activity gene (Braun e t al., 1994). The lysis peptide resides in the same operon as the colicin activity gene and is subject to SOS control (Waleh & Johnson, 1985). The lysis proteins are small lipoproteins which exhibit a high degree of sequence homology (Cavard, 1991; Lau e t al., 1987). The cleaved signal peptide comprises between 17 and 19 aa, and the mature proteins between 28 and 35 aa (Cavard & Oudega, 1992). We identified several small ORFs in the region between the pim gene and the origin of the pYP358 replication. Only ORF4 seems to be able to encode a possible lipoprotein. A predicted 31 aa peptide contains three cysteine residues and a typical lipoprotein cleavage box (Pugsley, 1993). However, we were not able to find sufficient homology with other lysis peptides as well as to shown the expression of ORF4 in T7 promoter system. Still, we cannot exclude the possible lytic effect of the pesticin itself, which exhibits N-acetylglucosaminidase activity (Ferber & Brubaker, '1979). Truncated pesticin encoded by pEK9 exhibits lytic activity in the absence of the immunity and possible lysis proteins. The imbalance of the pesticin activity in the absence of the immunity protein can lead to the hydrolysis of the glycan backbone without additional requirement for a special lysis peptide. N-Acetylglucosaminidase activity of pesticin resembles the N-acetylmuramidase activity of bacteriophage T4/ egg white lysozymes, and the N-acetylglucosaminidase activity of autolytic enzymes of B. stlbtilis. Therefore, the existence of an active pesticin lysis protein is not obvious 3422

as it is in the case of colicin M, which has a similar site of action (Harkness & Olschlager, 1991). Pesticin has evolved to utilize the yersiniabactin receptor, FyuA, which is responsible for the siderophore-facilitated iron transport in highly pathogenic yersiniae (Heesemann e t al., 1993; Rakin e t al., 1994, 1995; Fetherston e t al., 1995). Yersiniabactin transport into the cell is dependent on the TonB function; the same is true for the transport of the cytotoxic pesticin. Pst contains a well-conserved TonB box pentapeptide to interact with the TonB machinery (Fig. 2). The colicins have a domain structure, each domain being responsible for a specific function: binding to a specific receptor, transport through the membrane and specific activity. The N-terminal domain of pesticin carrying the TonB box is responsible for the translocation, while the C-terminus, by analogy with the other colicins, must be responsible for its activity. The last two C-terminal lysine and arginine residues were shown to be extremely important for colicin M killing activity (Braun e t al., 1992). Yet in the case of pesticin, the substitution of the last five C-terminal residues by 15 aa encoded by the vector sequence did not significantly influence the pesticin lytic activity. Perhaps this is the result of preservation of the C-terminal secondary structure of the wild-type pesticin in the truncated one (Fig. 5). Only the abolition of the last 57 C-terminal aa residues resulted in the inactivation of pesticin. This significantly truncated pesticin was also not able to prevent the lethal action of the wildtype pesticin, and thus did not compete for the FyuA receptor. One can assume that such an extended deletion damaged, at least partially, the pesticin-binding domain, or affected its conformation. Pim is encoded by the antisense strand and pim is transcribed in the opposite direction to the pst orientation (Figs 2 and 6). This is confirmed by the position and orientation of the transcription of the promoters identified and mapped on the pesticin-encoding plasmid (Sorokin e t al., 1989).pim shares the same terminator structure as pst. A possible read-through can still take place as in the case of the 8-lactamase gene that was transcribed from the strong T7 promoter through the terminator of the pesticin immunity gene in PMOS-derived plasmids (Fig. 8). The same mechanism may be responsible for the expression of the possible lysis gene from the SOS-induced pesticin promoter that is separated from the lysis gene by the same rho-independent terminator. Pim, in contrast to Pst, seems to possess a putative signal peptide with a typical Gly-Ala SecA peptidase recognition site, which can be used for its transport through the inner membrane. The inhibition of the SecA peptidase by NaN, resulted in an accumulation of the larger 16 kDa peptide, which could represent the premature form of the 14 kDa immunity peptide (Fig. 8). The same effect was noticed for the otherprotein subjected to T7 control under the same conditions, 8-lactamase of the vector molecule. The high content of methionine residues in the 8-lactamase molecule (one in the signal peptide plus nine in the mature

Y.pestis bacteriocin pesticin gene cluster molecule) could explain its higher [35S]methionine-binding activity in comparison with Pim (one plus one). The presence of the signal peptide differs between Pim and the colicin M immunity protein. The latter contains a hydrophobic stretch that could function as a signal peptide, but does not end in a typical signal peptidase cleavage site (Olschlager e t al., 1991). Pst manifests its activity in the periplasmic space by attacking the peptidoglycan layer. Therefore, it is not surprising that Pim has been found predominantly in the periplasmic space of overexpressing cells. Low-level constitutive expression ofpim makes it difficult to localize Pim under physiological conditions. Nevertheless, it seems that the periplasmic space is the area not only for interaction of the pesticin with its target, but also for interaction of the pesticin with its immunity protein. The slightly hydrophilic character of the immunity peptide contrasts with the hydrophobicity of the colicin El immunity protein (Bishop e t al., 1985) and resembles hydrophilic properties of the immunity proteins of colicin E3 and cloacin DF13, known to inhibit protein synthesis in membrane-free systems (van den Elzen e t al., 1980). Neither the pst nor the pim genes show pronounced homology with other colicins. However, several regions of high identity (> 70 YO)can be identified on the DNA fragment covering the region between thepla gene and the origin of the pYP358 replication (Fig. 6). The first region resides in the SOS promoter of the pst gene, indicating a similar mechanism of regulation of the pesticin to the other colicins (Fig. 3) (Lotz, 1978; Ebina & Nakazawa, 1983; Eraso & Weinstock, 1992). The other region of high homology can be identified upstream of the pim gene. It shows high identity with RNA I of the ColEl plasmid, and thus defines the precise position of the origin of the pYP358 replication. The third region of high homology with the sequence located upstream of the colicin 10 activity gene (Pilsl & Braun, 1995) resides in the region upstream of the pst gene promoter and spreads towards thepla gene. This region has two ORFs of 10 and 15 kDa located on both DNA strands which have no identified function. Both ORFs have no ribosome-binding sites, yet the conservation of those ORFs in different bacteria documents their possible importance for the host cell. ACKNOWLEDGEMENTS We thank Anette Philipowski, Angelika Meier and Barbara Bogner for excellent technical assistance. This study was supported by a grant from the Deutsche Forschungsgemeinschaft to J.H. (HE 1297/2-3). The work of E.B. was partially supported by the grant of the International Science Foundation N NS2000.

REFERENCES Bercovier, H. & Mollaret, H. H. (1984). Family I. Enterobacteriaceae. Genus XIV. Yersinia. In Bergg’s Mantlal of Systematic Bacteriolou, pp. 498-506. Edited by N. R. Krieg & J. M. Holt. Baltimore: Williams & Wilkins. Bishop, L. J., Bjes, E. S., Davidson, V. L. & Cramer, W. A. (1985).

Localization of the immunity protein-reactive domain in unmodified and chemically modified COOH-terminal peptides of colicin El. J Bucterioll64, 237-244. Braun, V., Gaisser, S., Glaser, C., Harkness, R., Olschlager, T. & Mende, J. (1992). Import and export of colicin M. In Bacteriocins, Microcins and Lantibiotics, pp. 225-242. NATO AS1 series H65. Edited by R. James, C. Lazdunski & F. Pattus. Berlin, Heidelberg: Springer-Verlag . Braun, V., Pilsl, H. & GroB, P. (1994). Colicins : structures, modes of action, transfer through membranes, and evolution. Arch Microbiol 161, 199-206. Cavard, D. (1991). Synthesis and functioning of the colicin E l lysis protein : comparison with the colicin A lysis protein. J Bacterioll73, 191-1 96. Cavard, D. & Oudega, B. (1992). General introduction to the secretion of bacteriocins. In Bacteriocins, Microcins and Lantibiotics, pp. 297-305. NATO AS1 series H65. Edited by R. James, C. Lazdunski & F. Pattus. Berlin : Springer-Verlag. Chou, P. Y. & Fasman, G. D. (1974). Prediction of protein conformation. Biochemistry 13, 222-245. Ebina, Y. & Nakazawa, A. (1983). Cyclic AMP-dependent initiation and p-dependent termination of colicin El gene transcription. J Biol Cbem 258,7072-7078. Eckert, K. A. & Kunkel, T. A. (1990). High fidelity DNA synthesis by the Tbermus aquaticus DNA polymerase. Nucleic Acids Res 18, 3739-3744. van den Elzen, P., Gaastra, W., Spelt, C. E., de Graaf, F. K., Veltkamp, E. & Nijkamp, J. J. (1980). Molecular structure of the immunity gene and immunity protein of the bacteriocinogenic plasmid CloDFl3. Nucleic Acids Res 8, 4349-4363. Eraso, J. M. & Weinstock, G. M. (1992). Anaerobic control of colicin El production. J Bacteriol 174, 5101-5109. Ferber, D. M. & Brubaker, R. R. (1979). Mode of action of pesticin: N-acetylglucosaminidase activity. J Bacteriol139, 495-501. Ferber, D. M. & Brubaker, R. R. (1981). Plasmids in Yersiniapestis. Infect Immun 31, 839-841. Ferber, D. M., Fowler, 1. M. & Brubaker, R. R. (1981). Mutations to tolerance and resistance to pesticin and colicins in Escbericbia coli Phi. J Bacterioll46, 506-51 1. Fetherston, J., Lillard, J. & Perry, R. (1995). Analysis of the pesticin receptor from Yersinia pestis: role in iron-deficient growth and possible regulation by its siderophore. J Bacterioll77, 1824-1 833. Fuller, R. S., Funnell, B. E. & Kornberg, A. (1984). The DnaA protein complex with the E. coli chromosomal replication origin (oriC) and other DNA sites. Cell 38, 889-900. Hanahan, D. (1983). Studies on transformation of Escbericbia coli with plasmids. J Mol Biol 166, 557-580. Harkness, R. E. & Olschlager, T. (1991). The biology of colicin M. F E M S Microbiol Rev 88, 27-42. Heesemann, J. (1987). Chromosomal-encoded siderophores are required for mouse virulence of enteropathogenic Yersinia species. F E M S Microbiol Lett 48, 229-233. Heesemann, J., Hantke, K., Vocke, T., Saken, E., Rakin, A., Stojiljkovic, 1. & Berner, R. (1993). Virulence of Yersinia enterocolitica is closely associated with siderophore production, expression of an iron-repressible outer membrane protein of 65000 Da and pesticin sensitivity. Mol Microbiol 8, 397-408. Hu, P. C. & Brubaker, R. R. (1974). Characterization of pesticin: separation of antibacterial activities. J Biol Cbem 249, 4749-4753. Hu, P. C., Yang, G. C. H. & Brubaker, R. R. (1972). Specificity, induction, and absorption of pesticin. J Bacteriolll2, 212-219.

3423

A. RAKIN, E. B O O L G A K O W A a n d J. H E E S E M A N N

Izard, J. W. & Kendall, D. A. (1994). Signal peptides: exquisitely designed transport promoters. Mol Microbioll3, 765-773. Keck, J., Olschllger, T., Kamp, R. M. & Braun, V. (1987). Primary structure of colicin M, an inhibitor of murein biosynthesis. J Bacteriol 169, 3358-3361. Kol'tsova, E. G., Suchkov, Yu. G. & Lebedeva, S.A. (1973). Transmission of a bacteriocinogenic factor in Pasteurella pestis. Sov Genet 7 , 507-510. Konisky, 1. (1982). Colicins and other bacteriocins with established modes of action. Annu Rev Microbiol36, 123-144. Kutyrev, V. V., Filippov, A. A., Shavina, N. Yu. & Protsenko, 0. A. (1989). Genetic analysis and modelling of virulence in Yersinia pestis. Mol Genet Mikrobiol Virusol8, 42-47. Lau, P. C., Hefford, M. A. & Klein, P. (1987). Structural relatedness of lysis proteins from colicinogenic plasmids and icosahedral coliphages. Mol Biol Evol4, 544-558. Lob, W. (1978). Effect of guanosine tetraphosphate on in vitro protein synthesis directed by E l and E3 colicinogenic factors. J Bacterioll35, 707-712. Mishankin, B. N., Goncharov, E. K., Marchenkov, V. I., Kravtsov, A. N. & Sorokin, V. M. (1984). Molecular cloning of Yersiniapestis

plasmid coding for pesticin synthesis, immunity protein, fibrinolysin and coagulase. Mol Genet Mikrobiol Virusol 10, 12-16. Morita, M. & Oka, A. (1979). The structure of a transcriptional unit on colicin El plasmid. Ear J Biochem 97, 4 3 5 4 3 .

Morlon, J., Lloubes, R., Varenne, S., Chartier, M. & Lazdunski, C. (1983). Complete nucleotide sequence of the structural gene for colicin A, a gene translated at non-uniform rate. J Mol Biol 170, 271-285. Olschllger, T. & Braun, V. (1987). Sequence, expression, and localization of the immunity protein for colicin M. J Bacteriol 169, 4765-4769. Olschllger, T., Turba, A. & Braun, V. (1991). Binding of the immunity protein inactivates colicin M. Mol Microbiol5,1105-1111. Pilsl, H. & Braun, V. (1995). Novel colicin 10: assignment of four domains to TonB- and TolC-dependent uptake via the Tsx receptor and to pore formation. Mol Microbioll6, 57-67. Podladchikova, 0. N., Dikhanov, G. G., Rakin, A. V. & Heesemann, 1. (1994). Nucleotide sequence and structural organization of Yersinia pestis insertion sequence IS 100. F E M S Microbiol Lett 121, 269-274. Pugsley, A. P. (1987). Nucleotide sequencing of the structural gene for colicin N reveals homology between the catalytic C-terminal domains of colicin A and N. Mol Microbiol 1, 317-325. Pugsley, A. P. (1993). The complete general secretory pathway in Gram-negative bacteria. Microbiol Rev 57, 50-108.

3424

Rakin, A,, Saken, E., Harmsen, D. & Heesemann, J. (1994). The pesticin receptor of Yersinia enterocolitica : a novel virulence factor with dual function. Mol Microbioll3, 253-263. Rakin, A., Urbitsch, P. & Heesemann, J. (1995). Evidence for two evolutionary lineages of highly pathogenic Yersinia species. J Bacteriol 177, 2292-2298. Roos, U., Harkness, R. E. 8t Braun, V. (1989). Assembly of colicin genes from a few DNA fragments. Nucleotide sequence of colicin D. Mol Microbiol3, 891-902. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, 5. J., Higuchi, R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988). Primer directed enzymatic amplification of DNA with thermostable DNA polymerase. Science 239,487491. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratoy Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Schramm, E., Mende, J., Braun, V. & Kamp, R. M. (1987). Nucleotide sequence of the colicin B activity gene cba: consensus pentapeptide among TonB-dependent colicins and receptors. J Bacterioll69, 3350-3357. Sodeinde, 0. A. & Goguen, J. D. (1988). Genetic analysis of the 9.5-kilobase virulence plasmid of Yersinia pestis. Infect Immun 56, 2743-2748. Sodeinde, 0. A. & Goguen, J. D. (1989). Nucleotide sequence of the plasminogen activator of Yersiniapestis: relationship to ompT of Escherichia coli and gene E of Salmonella typhimurium. Infect Immun 57, 1517-1523. Sorokin, V. M., Goncharov, E. K. & Mishankin, B. N. (1989). Transcription map of a recombinant plasmid carrying a gene for the synthesis of pesticin I and a protein for pesticin I immunity in the plague microbe. Mol Genet Mikrobiol Virusol6, 39-42. Tabor, 5. & Richardson, C. C. (1985). A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci U S A 82, 1074-1078. Tomizawa, Y., Itoh, T., Selzer, G. & Som, T. (1981). Inhibition of ColEl RNA primer formation by a plasmid-specified small RNA. Proc Natl Acad Sci U S A 78, 1421-1425. Waleh, N. 5. & Johnson, P. H. (1985). Structural and functional organization of the colicin El operon. Proc Natl Acad Sci U S A 82, 8389-8393. Yamada, M., Ebina, Y., Migata, T., Nakazawa,T. & Nakazawa, A. (1982). Nucleotide sequence of the structural gene for colicin El and predicted structure of the protein. Proc Natl Acad Sci U S A 79, 2827-2831. Zubay, G. (1973). In vitro synthesis of protein in microbial systems. Annu Rev Genet 7 , 267-287. Received 25 March 1996; revised 31 July 1996; accepted 9 August 1996.