Structure and function of the septal pore cap of Schizophyllum commune

Structure and function of the septal pore cap of Schizophyllum commune

Arend Frans van Peer

Structure and function of the septal pore cap of Schizophyllum commune

Structuur en functie van de septal pore cap van Schizophyllum commune (met een samenvatting in het Nederlands)

Proefschrift ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnificus, prof. dr. J.C. Stoof, ingevolge het besluit van het college voor promoties in het openbaar te verdedigen op woensdag 22 oktober 2008 des middags 2.30 uur

door

Arend Frans van Peer

geboren op 24 oktober 1977 te Groningen

Promotoren:

Prof.dr. H.A.B. Wösten Prof.dr. A.J. Verkleij

Co-promotoren:

Dr. W.H. Müller Dr. T. Boekhout

Voor de Biologie

ISBN: 978-90-71382-60-4

Cover: Orange summer (20071102), painting, Margot Brekelmans* Size 100x120 cm acryl op doek. Photo Aernout Steegstra. * www.margot-brekelmans.nl

Lay-out & printing: Gildeprint drukkerijen, Enschede, The Netherlands The studies described in this thesis were performed at: Department of Microbiology, Institute of Biomembranes, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands. Department of Cellular Architecture and Dynamics, Institute of Biomembranes, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands.

Contents Chapter 1

General Introduction

9

Chapter 2

Phleomycin increases transformation efficiency and promotes single integrations in Schizophyllum commune

31

Chapter 3

The septal pore cap of Schizophyllum commune consists of a proteinaceous matrix that defines the SPC ultrastructure

45

Chapter 4

Identification of the matrix proteins of the septal pore cap of Schizophyllum commune

57

Chapter 5

Septa of Schizophyllum commune close reversibly upon exposure to stress

79

Chapter 6

Summary and General Discussion

97

Samenvatting

109

Nawoord

115

List of publications

119

Curriculum vitae

120

Chapter 1 General Introduction Arend F. van Peer*, Kenneth G.A. van Driel*, Wally H. Müller, Teun Boekhout, Arie J. Verkleij and Han A.B. Wösten. *Both authors equally contributed to this work.

Chapter 1

regel 1

Filamentous Fungi

regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25

Filamentous fungi grow by means of hyphae that extend at their apices while branching subapically. This mode of growth together with hyphal fusion (anastomosis) results in an interconnected network of hyphae called a mycelium. Hyphae of the lower fungi, i.e. the Glomeromycota, Zygomycota, and Chytridiomycota (Schüßler et al., 2001; Bauer et al., 2006), are sparsely, if at all, septated (Barr, 2001; Benny et al., 2001). In contrast, the hyphae of the filamentous Ascomycota and Basidiomycota are regularly septated. Their septa contain pores of about 50 to 500 nm, which allow streaming of cytoplasm including large organelles like mitochondria (Bracker & Butler, 1963, 1964; Gull, 1978; van Driel et al., 2007). The continuity of the cytoplasm discriminates cells of filamentous fungi from those of plants and animals. In the latter two kingdoms there are also intercellular cytoplasmic connections but these are much smaller. Gap junctions in animals and plasmodesmata in plants have pores with a diameter of about 1.5 to 3.0 nm. These pores allow streaming of inorganic ions and small organic molecules (Veenstra, 1996; Perkins et al., 1997; Ghoshroy et al., 1997). It should be noted that the channels in plasmodesmata are dynamic; they can be closed or their width can be increased to 5 to 9 nm. In this chapter the ultrastructure, the composition and the function of fungal septa and their associated organelles (i.e. the Woronin bodies and the septal pore caps) are described. The mechanisms underlying the formation of septa and the associated organelles are also briefly discussed. This is followed by a description of Schizophyllum commune as a model system to study septal pore caps in Basidiomycota. At the end of this chapter the aim of this Thesis is described followed by a brief summary of each of the chapters.

regel 26 regel 27 regel 28 regel 29

Ultrastructure of the septum and Woronin Bodies in Ascomycota

regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37

The ascomycetous septum consists of a cross-wall with a central pore (Figure 1A). The septum is tapered towards the pore and is usually referred to as “simple” septum. The diameter of the septal pore varies between 50 to 500 nm allowing passage of mitochondria, nuclei and other organelles (Shatkin & Tatum, 1959; Moore & McAlear, 1962; Gull, 1978). Although the septa are extensions of the lateral cell wall, they differ in chemical composition (Gull, 1978). The septal plate is built from chitin microfibrils and β-glucans, but α-glucan, which is a component of the lateral wall,

regel 38 regel 39

10


regel 1

10 1


10 2

regel 6 regel 7 regel 8

10 1


10 4


10 1


Figure 1: Transmission electron micrographs of several septum types that are found in the fungal kingdom. A) Septal pore of Aspergillus nidulans (Ascomycota). The “simple”septum is tapered towards the pore and is associated with Woronin bodies indicated by arrows (image is adopted from Momany et al., 2002). B) The septum of the basidiomycete Sporidiobolus ruineniae (Pucciniomycotina) is tapered towards the pore, but Woronin bodies are absent (Boekhout et al., 1992). C) Dolipore septum of Itersonilia perplexans (Agaricomycotina) lacking septal pore caps (SPCs). Membrane bands (arrow) are located between the swollen pore that is covered by endoplasmic reticulum (T. Boekhout, 1991). D) Dolipore septum (DP) of Rhizoctonia solani (Agaricomycotina) associated with perforate SPCs (SPC). The SPC blocks a nucleus (Nu) from passing the septal pore (W.H. Müller, unpublished). Bars represent 250 nm in A, 500 nm in B and D, and 200 nm in C.

10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20

regel 22 regel 23 regel 24 regel 25 regel 26 regel 27

is not found (Griffin, 1994). Older septa may be covered with an amorphous protein layer (Gull, 1978). The ascomycetous septum is associated with Woronin bodies (Figure 1A) that are also found at the hyphal tip (Momany et al., 2002). Woronin first observed these organelles in 1864 by light microscopy (Woronin, 1864; Buller, 1933). They have a spherical or hexagonal shape with a diameter of 150 to 500 nm (Markham & Collinge, 1987). Woronin bodies rapidly plug septal pores when hyphae are damaged to prevent loss of cell content (Trinci & Collinge, 1974). The Woronin bodies of Neurospora crassa consist of a single membrane that covers a crystalline core of

10 1


10 1


10 1

regel 34 regel 35 regel 36 regel 37 regel 38

11

regel 39

Chapter 1


the HEX-1 protein (Jedd & Chua, 2000; Yuan et al., 2003; Markham & Collinge, 1987). Phosphorylation of HEX-1 is important for multimerization of the protein and proper formation of the Woronin bodies (Juvvadi et al., 2007). Moreover, HEX1 has a C-terminal peroxisome targeting signal (PTS1) and, therefore, Woronin bodies have been suggested to be peroxisomes (Jedd & Chua, 2000; Tenney et al., 2000). HEX-1 homologues have been found in several filamentous Ascomycota, like Aspergillus nidulans and Magnaporthe grisea (Jedd & Chua, 2000; Soundarajan et al., 2004) but not in ascomycetous yeasts nor in Basidiomycota.


Ultrastructure of the septum and the Septal Pore Cap in Basidiomycota

regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37

Within the Basidiomycota, three major groups Pucciniomycotina (Urediniomycetes), Ustilaginomycotina (Ustilaginomycetes), and Agaricomycotina (Hymenomycetes) are distinguished (Swann & Taylor, 1995; Bauer et al., 2006; James, et al., 2006; Hibbett et al., 2007). These groups are, amongst others, characterized by the ultrastructure of their septum. The Pucciniomycotina contain the rust fungi, which have septa as found in the filamentous Ascomycota (Oberwinkler & Bandoni, 1982; Swann et al., 2001; Bauer et al., 2006), though without Woronin bodies (Figure 1B). The Ustilaginomycotina that include the smut fungi possess a septum similar to that found in the Pucciniomycotina, but may have a slightly swollen rim around the pore. These septal pores may also be associated with membrane caps or membrane bands (Bauer et al., 1997, 2001). The Agaricomycotina (i.e. Tremellomycetes, Dacrymycetes, and Agaricomycetes) include jelly fungi and mushroom-forming fungi. They have a barrel-shaped swelling around the pore, the dolipore (Figure 1C, D), which generally is associated with a septal pore cap (SPC) (Figure 1D) (Bracker & Butler, 1963). The SPC is also known as Verschlußband (Girbardt, 1958) or parenthesome (Moore & McAlear, 1962). The dolipore channel measures 70 to 500 nm in diameter (Bracker & Butler, 1964; Setliff et al., 1972; Patton & Marchant, 1978). However, SPCs that cover the dolipore restrict the passage of large organelles, such as nuclei (Figure 1D). Like in the Ascomycota, the chemical composition of the basidiomycetous septum is different from that of the lateral cell wall. The lateral cell wall consists of chitin, β-1,3/β-1,6-glucan and α-1,3-glucan. The septal plate contains chitin and β-1,3/β1,6-glucan but no α-1,3-glucan. On the other hand, the septal swelling contains α1,3-glucan, β-1,3-glucan, and β-1,6-glucan (Janszen & Wessels, 1970; Müller et al., 1998a, 2000a). Moreover, the dolipore swelling contains more β-1,6-glucan than the

regel 38 regel 39

12

v


regel 1

10 1


10 2


10 1


10 4


10 1


Figure 2: Scanning electron micrographs of the main SPC-types found in the Agaricomycotina. A) The vesicular-tubular SPC in Trichosporon sporotrichoides (Tremellales). B) The imperforate SPC in Epulorhiza anaticula (Agaricomycetes). C) The perforate SPC with small perforations in Schizophyllum commune (Agaricomycetes). D) The perforate SPC with few large holes in Rhizoctonia solani (Agaricomycetes). Bars represent 250 nm in A and C, 500 nm in B, and 1000 nm in D. Images are adopted from Müller et al., 1998a (A and C) and Müller et al., 1998b (B and D).

septal plate (Müller et al., 1998a, 2000a). Staining of the polysaccharides according to Thiéry (1967) showed that filaments radiate from the inner electron dense septal layer into the swelling of the dolipore. They form a distinct rim visible in median and traverse sections. This rim intertwines as a loose network of stained fibrous material with the non-stained peripheral part of the septal swelling (Bracker & Butler, 1963; van der Valk & Wessels, 1976). At the dolipore septum, several SPC-types can be distinguished, which can be used as a phylogenetic marker (e.g. McLaughlin et al., 1995; Fell et al., 2001; Hibbett & Thorn, 2001; Wells & Bandoni, 2001; Lutzoni et al., 2004). The vesicular (tubular or saccular) SPC-type is found in members of the Tremellomycetes. This SPC-type consists of a group of vesicles or tubules arranged in a hemisphere surrounding the dolipore (Figure 2A). The imperforate SPC-type is found in the Dacrymycetes and Agaricomycetes (Wells & Bandoni, 2001) and consists of a slightly flattened

10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


13

regel 39

Chapter 1

regel 38

closed membranous structure (Figure 2B). This SPC-type may have an inward growth with reduced thickness or a minute pore in the centre of the membrane (Müller et al., 2000b). These imperforate SPCs are about 270 to 800 nm in width (Patton & Marchant, 1978; Müller et al., 1998b, 2000a). Next to imperforate SPCs, perforate SPCs are found in the Agaricomycetes (Hibbett & Thorn, 2001; Wells & Bandoni, 2001). The perforate SPC-type can have many small perforations like in Schizophyllum commune (Figure 2C) or a few large perforations like in Rhizoctonia solani (Figure 2D). The diameter of the SPC of S. commune is 450 to 600 nm with perforations of about 100 nm (Müller et al., 1994, 1998a). The SPCs of R. solani that have a diameter of 1600 to 2000 nm, contain only 3 to 5 perforations with a diameter of 800 nm (Müller et al., 2000a; van Driel et al., 2007a). In general, pores at the apex of the SPC are larger than those at the base (Müller et al., 1994, 1999). The SPC is a layered structure that has an inner and outer membrane confining a matrix (Girbardt, 1958, 1961; Moore & McAlear, 1962; Bracker & Butler, 1963; Marchant & Wessels, 1973; Müller et al., 1998a, 2000a). The different SPC-types are connected at their base to the endoplasmic reticulum (ER) (Girbardt, 1961; Moore, 1975; Müller et al., 1998a, 2000b). This is especially clear in young hyphae. In older cells, the ER has degenerated and the connection is lost. Next to this basal connection, ER is often observed overlaying imperforate SPCs (Müller et al., 2000b; Currah & Sherburne, 1992; Müller et al., 1998b; Wells, 1994; Langer, 1994). The outer cap observed in the case of perforate SPCs of agaricoid fungi like Agaricus bisporus (Thielke, 1972; Craig et al., 1977), Coprinus cinereus (van der Valk & Marchant, 1978), and Agrocybe praecox (Gull, 1976) may be similar to the ER plates that are associated with the imperforate SPCs. The presence of the outer cap in the perforate SPCs may depend on the developmental stage of the hyphae (Gull, 1976; Craig et al., 1977). As the base of SPCs is continuous with the ER, SPCs might be regarded as subdomains of this organelle (Wilsenach & Kessel, 1965; Müller et al., 1998a, 2000a). Indeed, fluorescent markers that stain ER, like ER-tracker, DIOC-6, and Brefeldin A conjugated to BODIPY highlight the SPC region (van Driel, 2007). However, differences are observed with a zinc-iodine osmium tetroxide (ZIO) staining that marks calcium-affinity sites (Gilloteaux & Naud, 1979; Müller et al., 1998a, 1999, 2000a). The SPCs of Trichosporon sporotrichoides were as densely stained as the ER. In contrast, perforate SPCs of S. commune and R. solani stained only the inner and outer membranes of the SPC (Müller et al., 1998a, 1999, 2000a). This suggests that there are no structural differences between ER and the vesicular-tubular SPC-type in T. sporotrichoides (Müller et al., 1998a), while this may be the case in perforate SPCs of S. commune and R. solani.

regel 39

14

regel 1 regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37


Formation of septa

regel 1

Formation of septa in filamentous fungi takes place in germinating spores (Jersild et al., 1967; Niederpruem & Jersild, 1972), within hyphal compartments (Niederpruem & Jersild, 1968; Volz & Niederpruem, 1968; Niederpruem, 1971), and after branching (Jersild et al., 1967), nuclear translocation (Giesy & Day, 1965), clamp formation (Jersild et al., 1967; Niederpruem, 1971) and during basidiospore formation (Wells, 1965). Formation of septa has been studied in quite some detail in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe (Forsburg & Nurse, 1991; Morris & Enos, 1992; Sipiczki, 2007). It should be noted that these yeasts display complete cytokinesis whereas filamentous fungi remain coenocytic (Harris et al., 1994). Yet, the yeast models, together with recent data on Aspergillus sp. provide a strong framework to describe septum formation in the Ascomycota (Doonan, 1992; Harris, 2001; Walther & Wendland, 2003). Little is known about the mechanisms in the Basidiomycota but it may be similar to that in the Ascomycota. Analysis of temperature sensitive A. nidulans mutants that are defective in septum synthesis showed that sites for septum formation are established during growth (Morris, 1975; Trinci & Morris, 1979). Harris and Momany (2004) proposed three models for septum localization in filamentous fungi. Firstly, by cortical landmarks that gather at specific sites of the cell cortex as occurs in yeast. Secondly, by activation of specific cortical receptors (located in the cell cortex) at the future septum site, and thirdly, by stochastic signal fluctuation. The strict organization and regular distribution of septa makes the third model the least probable. In fission yeast, cortical landmarks direct the formation of a medial ring. Early in mitosis the medial ring is placed overlying the nucleus, marking the start site for septum synthesis. It is still unclear whether the cortical landmarks that direct the site for septum synthesis are present at their site prior to mitosis or that they are formed during mitosis, e.g. by the mitotic machinery (reviewed by Chang et al., 1996; Chang & Nurse, 1996). The septum in filamentous fungi also develops at the site that has previously been occupied by the dividing nuclei (Jersild et al., 1967; Trinci, 1978), in particularly at the site occupied during the metaphase (Bourett & McLaughlin, 1986). This correlation between nuclear division and septum formation is also observed in the Basidiomycota (Bourett & McLaughlin, 1986). The yeast medial ring is a very complex protein structure including actin, type II myosin, and a formin (for references see Gould & Simanis, 1997). Synthesis of the septum is initiated at the end of the anaphase. It starts at the cortex and is directed inwards to the centre of the cell (Johnson et al., 1973). The medial ring constricts

10 1


10 2


10 1


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


15

regel 39

Chapter 1

regel 1 regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20

the cell membrane (Girbardt, 1979; Marks & Hyams, 1985; Jochová et al., 1991; Fankhauser et al., 1995; McCollum et al., 1995; Chang et al., 1997; Kitayama et al., 1997) and the developing septum is surrounded by F-actin patches (Marks & Hyams, 1985). The polarization of such patches adjacent to the ring is obligate for septum formation (Gould & Simanis, 1997). The leading edge of the developing septum also contains a ring of F-actin (Jochová et al., 1991). In filamentous fungi the plasma membrane is also furrowed at the site of the emerging septum (reviewed by Wendland & Walther, 2006). The septal belt (Patton & Marchant, 1978; Girbardt, 1979; Hoch & Howard, 1981; Roberson, 1992) pulls the plasmamembrane together with radial and parallel filaments (Orlovich & Ashford, 1994). This belt has been shown to contain actin microfilaments (Harris et al., 1994; and references herein) and might be functionally equivalent to the medial ring in yeast. This mechanical contraction is also observed in the contractile actin ring of animal cells (Jochová et al., 1991) suggesting a highly conserved mechanism. More detailed information on the septal band of filamentous fungi has been obtained in Aspergillus sp. After SepA (a formin) localizes to the septation site, it co-assembles with AspB (a septin) and actin to form the septal band. At this point the daughter nuclei have undergone mitotic exit. The AspB ring then splits into two rings, that flank the actin and SepA rings. Then the SepA ring and the actin ring constrict and septum deposition takes place (reviewed by Harris, 2001).


Formation of the dolipore septum and Septal Pore Caps

regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37

The dolipore is formed late during synthesis of the basidiomycetous septum. After the septum has been expanded to its near final size, lamellae of the septum branch off at the pore rim and extend into the matrix of the forming dolipore (Bracker & Butler, 1963). The swelling is then enlarged. Little is known about the formation of SPCs. Based on electron microscopy, a model was proposed for the synthesis of these structures (Moore, 1975). In this model, ER sheaths would align in a parallel orientation and aggregate into an irregularly shaped structure. This structure then develops into two SPCs that stay attached during their growth process. After separation, they would be positioned at the dolipore septum (Moore, 1975; Orlovich & Ashford, 1994). Positioning of the SPCs at the septum supposedly takes place at the final stage of the septum formation process. Alternatively, SPCs may originate from a microfilament-based matrix situated at the developing dolipore instead of ER

regel 38 regel 39

16

v


(Patton & Marchant, 1978). This matrix may contain phospholipids and proteins. Only at the completion of SPC formation, laying down of the ER along the septum takes place where after the ER is attached to the SPC (Patton & Marchant, 1978).

regel 1

10 1


Functions of the septum and septum-associated structures

10 2


The role of septa in the fungal mycelium seems diverse. These cross walls may mechanically strengthen hyphae, but this is probably of secondary importance (Gull, 1978). Another role of the septa is compartmentalization of the hyphae into cellular compartments. As in regular cell division, distribution of cell constituents upon septation is not random, at least in the Basidiomycota with complex septa. In the Ascomycota, the distribution of organelles over compartments seems not to be controlled. Nuclei, mitochondria and other particles often traverse the septum (Shatkin & Tatum, 1959; Moore & McAlear, 1962; Hunsley & Gooday, 1974). In contrast, in the higher Basidiomycota (i.e. Agaricomycotina) the dolipore septum with the SPC is thought to prevent migration of nuclei and other organelles, though mitochondria can be observed traversing the dolipore septum (Bracker & Butler, 1963, 1964; van Driel et al., 2007). In general, the dolipore septa have to be reorganized to simple septa to allow organelle redistribution (Bracker & Butler, 1964; Giesy & Day, 1965; Wessels & Marchant, 1974; Todd & Aylmore, 1985). This occurs for instance during the nuclear exchange that follows dikaryotization (Jersild et al., 1967; Koltin & Flexer, 1969; Niederpruem & Wessels, 1969). Degradation of the septum starts at the dolipore that initially loses its membrane integrity (Giesy & Day, 1965; Marchant & Wessels, 1973; Mayfield, 1973). The dolipore swelling is progressively degraded until it is completely removed. Septal degradation has been reported to be associated with an invasion of vesicles and multi-vesicular bodies into the septum region (Marchant & Wessels, 1973; Mayfield, 1973) that are thought to contain degrading enzymes (Marchant & Wessels, 1974). The degradation process is directed from the septal pore to the hyphal wall. Degradation continues until a septum-base is left. The fate of the SPC during this process is obscure. It is removed from the septum region but its place in the degradation sequence is not known. Some reports state that the SPC is degraded even before the initial breakdown of the dolipore (Giesy & Day, 1965). Others have shown that the SPC can be found floating freely in the cytoplasm (Jersild et al., 1967; Marchant & Wessels, 1974).

10 1


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


17

regel 39

Chapter 1


Apart from functioning as a sieve for organelles, septa can be completely closed, thus sealing the compartment. Closure of the septal pore is observed during heterokaryon incompatibility (HI) and during differentiation of mycelium (Morris, 1975; Gull, 1978; Glass & Kaneko, 2003). In the event of the incompatible fusion of two hyphae, the four bordering septa of the fusion cell are plugged. The fusion cell is then lysed by an apoptosis-like process whereas the adjacent compartments remain intact (Glass & Kaneko, 2003). The function of septal closure in developmental process is indicated from the fact that mutations in septum formation often hamper development of fungi (Morris, 1975; Gull, 1978). Another main function for closure of septal pores is to prevent lysis of the mycelium as a response to hyphal damage (Markham, 1994). Septal pores in ascomycetous hyphae are plugged by Woronin bodies (see above). Emergency plugging of the septal pores in hyphae of the Basidiomycota follows a different mechanism. Aylmore et al. (1984) suggested that septal sealing in the Basidiomycota is a two-stage process. First, an electron-dense pore plug is formed. This plug of unknown composition is formed in an instant and restricts the dolipore entrance from each side of the disrupted compartment (Moore & McAlear, 1962; Bracker & Butler, 1963; Koltin & Flexer, 1969; Casselton, 1971; Moore & Marchant, 1972; Setliff et al., 1972; Craig et al., 1977). In the second step, the plug is extended into the dolipore channel, further sealing the opening between two neighboring hyphal compartments (Aylmore et al., 1984; Müller et al., 2000a). The plug material can be degraded by trypsin and chymotrypsin, showing that it is composed, at least partially, of protein (Flegler et al., 1976). Polysaccharide staining of the plug material did not give consistent results. Staining according to Thiéry (1967) did not stain the plug material (Flegler et al., 1976), whereas alkaline bismuth polysaccharide staining did (Shinji et al., 1975, 1976; Müller et al., 1998a). In addition, β-1,6-glucan was not detected in the plug material of S. commune, but was shown to be present in plugs of T. sporotrichoides (Müller et al., 1998a). Initiation of the immediate response of plugging is also observed in adjacent septa of the damaged compartment, but plugging here is aborted and eventually reversed (Aylmore et al., 1984). In young hyphal cells plugging is also thought to be reversible, while in mature cells the plug is more permanent (Bracker, 1967). Both the dolipore and SPCs have been proposed to participate in the plugging process (van Driel et al., 2008). The dolipore could function as an acceptor for plugging material (Bracker & Butler, 1963; Setliff et al., 1972) whereas the SPC has been suggested to act as a repository for plugging material (Moore, 1985; Markham, 1994; Müller et al. 1998a, 2000a; van Driel et al., 2008). The localization of the SPC in close vicinity of the dolipore would support this view as it enables a quick delivery of plugging material to the pore.

regel 38 regel 39

18


regel 1

10 1


10 2


10 1


Figure 3: Schizophyllum commune on a fallen branch of hardwood. Vegetative mycelium (left upper corner), small fruiting bodies (left, middle) and mature fruiting bodies that expose split gills are shown.

Moreover, filamentous structures have been observed between the plug and the SPC in R. solani (Müller et al., 2000a; van Driel et al., 2007), Pisolithus arhizus (Orlovich & Ashford, 1994), and S. commune (Müller et al., 1998a). They could be involved in transport of the plugging material from the SPC to the pore, function as an anchor to keep the plug in its position, or function as a scaffold for plug formation. It should be noted, however, that Basidiomycota, which do not have SPCs at their dolipore (i.e. Pucciniomycotina, Ustilaginomycotina) also plug the septal pore (Aylmore et al., 1984).

Schizophyllum commune as a model for studies on Septal Pore Caps The SPCs of S. commune are among the most thoroughly studied, probably because this fungus serves as a model system for mushroom forming fungi. S. commune is one of the most widespread fungi known. It is found on all continents except for the arctic. This saprophytic fungus is predominantly found on fallen branches and logs of leaf-wood (Figure 3). Yet, it colonizes softwood and grass silage too (O’Brien et al., 2005). S. commune is also occasionally found on living trees and has been reported to be an opportunistic human pathogen (Kern & Ueker 1986). The main characteristics of S. commune are the split gills (Schizo-phyllum means split gills)

10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


19

regel 39

Chapter 1

regel 1 regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26

of its fruiting bodies. The capacity to close these gills during drought and reopen them for spore release under moist conditions facilitates successful colonisation of substrates in various climates. S. commune has a long history as a model organism for mushroom forming fungi due to its easy cultivation, short life cycle (1-2 weeks) and sexual propagation on defi ned minimal medium. Classical genetics of S. commune have been well established. Spores of different mating types (up to 28000 sexes world wide) are dispersed by the fan-shaped fruiting bodies. Their germination results in a monokaryotic mycelium (each compartment carrying a single nucleus). A dikaryon is formed upon mating of two compatible monokaryons. Each compartment now carries two nuclei, one from each parent. Dikaryotic colonies develop fruiting bodies under the appropriate environmental conditions. Within the fruiting bodies karyogamy occurs followed by meisosis, which results in haploid spores that will be dispersed to give rise to new monokaryotic mycelia. With the development of a transformation protocol S. commune became amenable to molecular genetics (Schuren & Wessels 1994). Access to the partial genome sequence (± 40 % of the single copy DNA) at the start of this PhD project and the prospect of the release of the whole genome sequence in 2007 by the Department of Energy of the United States of America (http://www.jgi.doe.gov) further made S. commune an attractive model system. Moreover, fluorescent proteins such as GFP (de Jong, 2006b), DS-RED (Vinck, 2007) and d-Tomato (this Thesis) can be used to study gene expression. Genes can be inactivated by homologous recombination (see e.g. Lugones et al. 2004; van Wetter et al., 1996, 2000) and by RNA interference (de Jong et al. 2006a). It should be noted that homologous recombination occurs with low frequency (i.e. up to maximally 5 % of the integration events) and that RNA interference has only been reported once.


Aim and Outline of this Thesis


In this Thesis the composition and function of the septal pore cap of S. commune was studied. Functional analysis of genes involved in the formation and function of the SPCs would strongly benefit from improved methods for transformation and gene inactivation. Therefore, this was also part of the project. Previously, S. commune was transformed to phleomycin resistance using a construct consisting of the ble gene of Streptoalloteychus hindustanus placed under control of the S. commune GPD regulatory sequences. In Chapter 2 a nourseothricin

regel 38 regel 39

20

v


resistance cassette was constructed using the nat1 gene of Streptomyces noursei and the S. commune GPD regulatory sequences. Surprisingly, transformation efficiency with this construct was ten-fold lower compared to transformation to phleomycin resistance. Transformation efficiency with the nourseothricin cassette was improved ten-fold by adding non-selective concentrations of phleomycin during regeneration. Addition of phleomycin was accompanied by a high incidence of single copy integrations. The nourseothricin and phleomycin resistance cassettes were used to construct a vector that allows rapid screening of homologous integration (i.e. screening for nourseothricin resistant and phleomycin sensitive colonies). This vector was used for deletion of the SPC14 and SPC33 genes (see below) (Chapter 5). However, out of 800 transformants none showed a homologous integration. It may thus be that these genes are essential. This is also indicated from the fact that RNA interference of the SPC14 gene was not stable. Reduced SPC14 mRNA levels in transformants were no longer observed after one or two transfers to fresh medium. Notably, the reduced SPC14 mRNA levels correlated with reduced growth in the monokaryon and abnormal fruiting in the dikaryon. In Chapter 5 it was assessed whether septa of hyphae within a mycelium are open or closed. Laser dissection showed that the apical septum is always open. However, the third septum is in most cases closed. Upon exposure to antibiotic, heat stress, or hypertonic conditions the first septum also closes. The plugging mechanism, as was observed upon exposure to stress, seems to be an emergency response since arrest of growth and vacuolization of the cytoplasm preceded septal closure. Heatinduced closure of the septum was reversible. This indicates that septa are dynamic structures that may function as a gate. The fact that the third septum in hyphae is mostly closed challenges the general accepted assumption that the cytoplasm within a mycelium is a continuous system. The intimate association of the SPC with the dolipore septum suggests a function for this structure in septal plugging. In Chapter 3 a purification protocol for SPCs of S. commune is described. In this procedure, homogenized mycelium containing 1 % Triton-X-100 is loaded on two discontinuous sucrose gradients followed by filtration over a membrane. It is shown that the SPC is made up of a proteinaceous core surrounded by membranous material. The core determines the shape of the SPC and consists of two abundant proteins called SPC14 and SPC33 (Chapter 3 and 4). The SPC14 and SPC33 genes are conserved in basidiomycetes with an SPC. The SPC14 gene encodes a protein of 86 amino acids without any conserved signal or signature sequence. Expressed sequence tag (EST) analysis indicates that SPC33 encodes a 239 and a 340 amino acid variant. Both forms contain a predicted signal anchor,

regel 1

10 1


10 2


10 1


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


21

regel 39

Chapter 1


a putative RXR ER localization signal, and a transmembrane region. Immunolocalization confirmed the presence of SPC14 and SPC33 in the SPC. The results are summarized and discussed in Chapter 6. A model of the molecular architecture of the SPC is presented.

regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37 regel 38 regel 39

22


References

regel 1

Aylmore, R.C., Wakley, G.E. & Todd, N.K. (1984) Septal sealing in the basidiomycete Coriolus versicolor. J. Gen. Microbiol. 130, 2975-2982. Barr, D.J.S. (2001) Chytridiomycota. Pp. 93-112. In The Mycota VII, Systematics and evolution, Part A. McLaughlin, D.J., McLaughlin, E.G. & Lemke, P.A. (eds), Springer-Verlag, Berlin, Germany. Bauer, R., Oberwinkler, F. & Vanky, K. (1997) Ultrastructural markers and systematics in smut fungi

10 1


10 2

and allied taxa. Can. J. Bot. 75, 1273-1314.


Bauer, R., Begerow, D., Oberwinkler, F., Piepenbring, M. & Berbee, M.L. (2001) Ustilaginomycetes. Pp. 57-83. In The Mycota VII, Systematics and evolution, Part B. McLaughlin, D.J., McLaughlin,

10 1

E.G. & Lemke, P.A. (eds). Springer-Verlag, Berlin, Germany.


Bauer, R., Begerow, D., Sampaio, J.P., Weiss, M. & Oberwinkler, F. (2006) The simple-septate basidiomycetes: a synopsis. Mycol. Prog. 5, 41-66.

10 4

Benny, G.L., Humber, R.A. & Morton, J.B. (2001) Zygomycota: Zygomycetes. Pp. 113-146. In The Mycota VII, Systematics and evolution, Part A. McLaughlin, D.J., McLaughlin, E.G. & Lemke, P.A. (eds), Springer-Verlag, Berlin, Germany. Boekhout, T. (1991) Systematics of Itersonilia: a comparative phenetic study. Mycol. Res. 95, 135-146. Boekhout, T., Yamada, Y., Weijman, A.C.M., Roeymans, H.J. & Batenburg-van der Vegte, W.H. (1992) The significance of coenzyme Q, carbohydrate composition and septal ultrastructure for the taxonomy of ballistoconidia-forming yeasts and fungi. Syst. Appl. Microbiol. 15, 1-10. Bourett, T.M. & McLaughlin, D.J. (1986) Mitosis and septum formation in the basidiomycete Helicobasidium mompa. Can. J. Bot. 64, 130-145. Bracker, C.E. (1967) Ultrastructure of Fungi. Annu. Rev. Phytopathol. 5, 343-374. Bracker, C.E. & Butler, E.E. (1963) The ultrastructure and development of septa in hyphae of Rhizoctonia solani. Mycologia 55, 35-58. Bracker, C.E. & Butler, E.E. (1964) Function of the septal pore apparatus in Rhizoctonia solani during


10 1


10 1

regel 18

10 1

regel 21

10 1

protoplasmic streaming. J. Cell Biol. 21, 152-157.

regel 19 regel 20


Buller, A.H.R. (1933) The translocation of protoplasm through the septate mycelium of certain Pyrenomycetes, Discomycetes and Hymenomycetes. Pp. 75-167. In Researches on fungi, vol. V.

10 1

Buller, A.H.R. (ed.), Longmans, Green & Co., London, UK.


Casselton, L.A. (1971) Septal structure and mating behaviour of common A diploid strains of Coprinus lagopus. J. Gen. Microbiol. 66, 273-278.

10 1

Chang, F. & Nurse, P. (1996) How fission yeast fission in the middle. Cell 84, 191-194.


Chang, F., Woollard, A. & Nurse, P. (1996) Isolation and characterization of fission yeast mutants defective in the assembly and placement of the contractile actin ring. J. Cell Sci. 109, 131-142. Chang, F., Drubin, D. & Nurse, P. (1997) cdc12p, a protein required for cytokinesis in fission yeast, is a component of the cell division ring and interacts with profi ling. J. Cell Biol. 137, 169-182.

10 1


23

regel 39

Chapter 1

regel 1

Craig, G.D., Newsam, R.J. & Gull, K. (1977) Subhymenial branching and dolipore septation in Agaricus bisporus. Trans. Br. Mycol. Soc. 69, 337-344.

regel 2 regel 3

Currah, R.S. & Sherburne, R. (1992) Septal ultrastructure of some fungal endophytes from boreal orchid mycorrhizas. Mycol. Res. 96, 583-587.

regel 4 regel 5

Doonan, J.H. (1992) Cell division in Aspergillus. J. Cell Sci. 103, 599-611.

regel 6

de Jong, J.F., Deelstra, H.J., Wösten, H.A.B. & Lugones, L.G. (2006a) RNA-mediated gene silencing

regel 7

in monokaryons and dikaryons of Schizophyllum commune. Appl. Environ. Microbiol. 72, 1267-

regel 8

1269.

regel 9

de Jong, J.F. (2006b) Aerial hyphae of Schizophyllum commune: their function and formation. Thesis, Utrecht University, The Netherlands.

regel 10 regel 11

Fankhauser, C., Reymond, A., Cerutti, L., Utzig, S., Hofmann, K. & Simanis, V. (1995) The S. pombe cdc15 gene is a key element in the reorganization of F-actin at mitosis. Cell 82, 435-444.

regel 12 regel 13

Fell, J.W., Boekhout, T., Fonseca, A. & Sampaio, J.P. (2001) Basidiomycetous yeasts. Pp. 3-35. In The

regel 14

Mycota VII, Systematics and evolution, Part B. McLaughlin, D.J., McLaughlin, E.G. & lemke,

regel 15

P.A. (eds.), Springer-Verlag, Berlin, Germany.

regel 16

Flegler, S.L., Hooper, G.R. & Fields, W.G. (1976) Ultrastructural and cytochemical changes in the basidiomycete dolipore septum associated with fruiting. Can. J. Bot. 54, 2243-2253.

regel 17 regel 18

Forsburg, S.L. & Nurse, P. (1991) Cell cycle regulation in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe. Annu. Rev. Cell Biol. 7, 227-256.

regel 19 regel 20

Ghoshroy, S., Lartey, R., Sheng, J. & Citovsky, V. (1997) Transport of proteins and nucleic acids through plasmodesmata. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 27-50.

regel 21 regel 22

Giesy, R.M. & Day, P.R. (1965) The septal pores of Coprinus lagopus in relation to nuclear migration. Am. J. Bot. 52, 287-293.

regel 23 regel 24

Gilloteaux, J. & Naud, J. (1979) The zinc iodine-osmium tetroxide staining of Maillet. Ca 2+ affinity subcellular sites in a tonic smootth muscle. Histochemistry 63, 227-243.

regel 25 regel 26

Girbardt, M. (1958) Über die Substruktur von Polystictus versicolor L. Arch. Mikrobiol. 28, 255-269.

regel 27

Girbardt, M. (1961) Licht- und Elektronenmikroskopische Untersuchungen an Polystictus versicolor. Arch. Mikrobiol. 39, 351-359.

regel 28 regel 29

Girbardt, M. (1979) A microfi lamentous septal belt (FSB) during induction of cytokinesis in Trametes versicolor (L. ex Fr.). Exp. Mycol. 3, 215-228.

regel 30 regel 31

Glass, N.L. & Kaneko, I. (2003) Fatal attraction: nonself recognition and heterokaryon incompatibility in fi lamentous fungi. Eukaryotic Cell 2, 1-8.

regel 32 regel 33

Gould, K.L. & Simanis, V. (1997) The control of septum formation in fission yeast. Genes Dev. 11, 2939-2951.

regel 34 regel 35

Griffin, D.H. (1994) Molecular architecture. Pp. 63-101. In Fungal physiology (2nd ed.). Griffin, D.H. (ed.), John Wiley, New York, USA.


24


Gull, K. (1976) Differentiation of septal ultrastructure according to cell type in the basidiomycete Agrocybe praecox. J. Ultrastruct. Res. 54, 89-94. Gull, K. (1978) Form and function of septa in fi lamentous fungi. Pp. 78-93. In The fi lamentous fungi: developmental mycology, Vol. 3. Smith, J.E. (ed.), Edward Arnold, London, UK. Harris, S.D., Morrell, J.L. & Hamer, J.E. (1994) Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 136, 517-532. Harris, S.D. (2001) Septum formation in Aspergillus nidulans. Curr. Opin. Microbiol. 4, 736-739.

regel 1

10 1

Hibbett, D.S. & Thorn, R.G. (2001) Basidiomycota: Homobasidiomycetes. Pp. 121-168. In The Mycota

10 2

Hibbett, D.S., Binder, M., Bischoff, J.F., Blackwell, M., Cannon, P.F., Eriksson, O.E., Huhndorf, S.,

10 1

Hoch, H.C. & Howard, R.J. (1981) Conventional chemical fi xations induce artifactual swelling of dolipore septa. Exp. Mycol. 5, 167-172.

regel 6 regel 7


10 4

James, T., Kirk, P.M., Lucking, R., et al. (2007). A higher-level phylogenetic classification of the Fungi. Mycol. Res. 111, 509-547.

regel 4

regel 8

VII, Systematics and evolution, Part B. McLaughlin, D.J., McLaughlin, E.G. & Lemke, P.A. (eds), Springer-Verlag, Berlin, Germany.

regel 3

regel 5

Harris, S.D. & Momany, M. (2004) Polarity in fi lamentous fungi: moving beyond the yeast paradigm. Fungal Genet. Biol. 41, 391-400.

regel 2


10 1


Hunsley, D. & Gooday, G.W. (1974) The structure and development of septa in Neurospora crassa. Protoplasma 82, 125-146. James, T.Y., Kauff, F., Schoch, C.L., Matheny, P.B., Hofstetter, V., Cox, C.J., Celio, G., Gueidan, C., Fraker, E., Miadlikowska, J., et al. (2006) Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature 443, 818-822. Janszen, F.H.A. & Wessels, J.G. (1970) Enzymic dissolution of hyphal septa in a Basidiomycete. Antonie van Leeuwenhoek 36, 255-257. Jedd, G. & Chua, N.-H. (2000) A new self-assembled peroxisomal vesicle required for efficient resealing of the plasma membrane. Nat. Cell Biol. 2, 226-231.

10 1

regel 18

10 1

regel 21

10 1

Jersild, R., Mishkin, S. & Niederpruem, D.J. (1967) Origin and ultrastructure of complex septa in Schizophyllum commune development. Arch. Mikrobiol. 57, 20-32. Jochova, J., Rupes, I. & Streiblova, E. (1991) F-actin contractile rings in protoplasts of the yeast

regel 19 regel 20


10 1

Schizosaccharomyces. Cell Biol. Int. Rep. 15, 607-610.


Johnson, B.F., Yoo, B.Y. & Calleja, G.B. (1973) Cell division in yeasts: Movement of organelles associated with cell plate growth of Schizosaccharomyces pombe. J. Bacteriol. 115, 358-366.

10 1

Juvvadi, P.R., Maruyama, J.I. & Kitamoto, K. (2007) Phosphorylation of the Aspergillus oryzae Woronin body protein, AoHex1, by protein kinase C: evidences for its role in the multimerization and proper localization of the Woronin body protein. Biochem. J. 405, 533 -540. Kern, M.E. & Uecker, F.A. (1986) Maxillary sinus infection caused by the homobasidiomycetous fungus Schizophyllum commune. J. Clin. Microbiol. 23, 1001-1005.


10 1


25

regel 39

Chapter 1

regel 1

Kitayama, C., Sugimoto, A. & Yamamoto, M. (1997) Type II myosin heavy chain encoded by the myo2

regel 2

gene composes the contractile ring during cytokinesis in Schizosaccharomyces pombe. J. Cell

regel 3

Biol. 137, 1309-1319.

regel 4

Koltin, Y. & Flexer, A.S. (1969) Alteration of nuclear distribution in B-mutant strains of Schizophyllum commune. J. Cell Sci. 4, 739-747.

regel 5 regel 6

Langer, G. (1994) Die Gattung Botryobasidium Donk (Corticiaceae, Basidiomycetes). Bibl. Mycol. 158, 1-459.

regel 7 regel 8

Lutzoni, F., Kauff, F., Cox, J.C., McLaughlin, D., Celio, G., Dentinger, B., Padamsee, M., Hibbett, D.,

regel 9

James, T.Y., Baloch, E., et al. (2004) Assembling the fungal tree of life: Progress, classification, and evolution of subcellular traits. Am. J. Bot. 91, 1446-1480.

regel 10 regel 11

Lugones, L. G., de Jong, J. F., de Vries, O. M. H., Jalving, R., Dijksterhuis, J. & Wösten, H. A. B.

regel 12

(2004) The SC15 protein of Schizophyllum commune mediates formation of aerial hyphae and attachment in the absence of the SC3 hydrophobin. Mol. Microbiol. 53, 707-716.

regel 13 regel 14

Marchant, R. & Wessels, J.G.H. (1973) Septal structure in normal and modified strains of Schizophyllum commune carrying mutations affecting septal dissolution. Arch. Microbiol. 90, 35-45.

regel 15 regel 16

Marchant, R. & Wessels, J.G.H. (1974) An ultrastructural study of septal dissolution in Schizophyllum commune. Arch. Microbiol. 96, 175-182.

regel 17 regel 18

Markham, P. (1994) Occlusions of septal pores in fi lamentous fungi. Mycol. Res. 98, 1089- 1106.

regel 19

Markham, P. & Collinge, A.J. (1987) Woronin bodies of fi lamentous fungi. FEMS Microbiol. Lett. 46, 1-11.

regel 20 regel 21

Marks, J. & Hyams, J.S. (1985) Localization of F-actin through the cell division cycle of Schizosaccharomyces pombe. Eur. J. Cell Biol. 39, 27-32.

regel 22 regel 23

Mayfield, J.E. (1973) Septal involvement in nuclear migration in Schizophyllum commune. Arch. Microbiol. 95, 115-124.

regel 24 regel 25

McCollum, D., Balasubramaniam, M.K., Pelcher, L.E., Hemminsen, S.M. & Gould, K.L. (1995)

regel 26

Schizosaccharomyces pombe cdc4+ gene encodes a novel EF-hand protein essential for cytokinesis.

regel 27

J. Cell Biol. 130, 651-660.

regel 28

McLaughlin, D.J., Frieders, E.M. & Lü, H. (1995) A microscopist’s view of heterobasidiomycete phylogeny. Stud. Mycol. 38, 91-109.

regel 29 regel 30

Momany, M., Richardson, E.A., van Sickle, C. & Jedd, G. (2002) Mapping Woronin body position in Aspergillus nidulans. Mycologia 94, 260-266.

regel 31 regel 32

Moore, R.T. (1975) Early ontogenetic stages in dolipore/parenthesome formation in Polyporus biennis. J. Gen. Microbiol. 87, 251-259.

regel 33 regel 34

Moore, R.T. (1985) The challenge of the dolipore/parenthesome septum. Pp. 175-212. In Developmental

regel 35

biology of higher fungi. Moore, D., Casselton, L.A., Wood, D.A. & Frankland, J.C. (eds.),

regel 36

Cambridge University Press, Cambridge, UK.


26


Moore, R.T. & Marchant, R. (1972) Ultrastructural characterization of the basidiomycete septum of Polyporus biennis. Can. J. Bot. 50, 2463-2469. Moore, R.T. & McAlear, J.H. (1962) Fine structures of mycota. Observations on septa of ascomycetes and basidiomycetes. Am. J. Bot. 49, 86-94. Morris, N.R. (1975) Mitotic mutants of Aspergillus nidulans. Genet. Res. 26, 237-254.

regel 1

10 1


Morris, N.R. & Enos, A.P. (1992) Mitotic gold in a mold: Aspergillus genetics and the biology of mitosis. Trends Genet. 8, 32-37.

10 2

Müller, W.H., van Aelst, A.C., van der Krift, T.P. & Boekhout, T. (1994) Scanning electron microscopy of the septal pore cap of the basidiomycete Schizophyllum commune. Can. J. Microbiol. 40, 879883.

Microbiology 144, 1721-1730.

10 1

complex. Mycologia 90, 170-179. Müller, W.H., Humbel, B.M., van Aelst, A.C., van der Krift, T.P. & Boekhout, T. (1999) The perforate septal pore cap of basidiomycetes. Pp. 120-127. In Plasmodesmata. Structure, function, role in cell communication. van Bel, A.J.E. & van Kesteren, W.J.P. (eds.), Springer-Verlag, Berlin, Germany. Müller, W.H., Koster, A.J., Humbel, B.M., Ziese, U., Verkleij, A.J., van Aelst, A.C., van der Krift , T.P., Montijn, R.C. & Boekhout, T. (2000a) Automated electron tomography of the septal pore cap in Rhizoctonia solani. J. Struct. Biol. 131, 10-18. Müller, W.H., Stalpers, J.A., van Aelst, A.C., de Jong, M.D.M., van der Krift, T.P. & Boekhout, T. (2000b) The taxonomic position of Asterodon, Asterostroma and Coltricia inferred from the septal pore cap ultrastructure. Mycol. Res. 104, 1485-1491. Niederpruem, D.J. (1971) Kinetic studies of septum synthesis, erosion and nuclear migration in a


10 4

Müller, W.H., Stalpers, J.A., van Aelst, A.C., van der Krift, T.P. & Boekhout, T. (1998b) Field emission gun-scanning electron microscopy of septal pore caps of selected species in the Rhizoctonia s.l.

regel 7 regel 8

Müller, W.H., Montijn, R.C., Humbel, B.M., van Aelst, A.C., Boon, E.J.M., van der Krift, T.P. & Boekhout, T. (1998a) Structural differences between two types of basidiomycete septal pore caps.

regel 6


10 1


10 1

regel 18

10 1

regel 21

10 1

growing B-mutant of Schizophyllum commune. Arch. Microbiol. 75, 189-196.

regel 19 regel 20


Niederpruem, D.J. & Jersild, R.A. (1968) Nuclear behavior in multinucleate Schizophyllum commune germlings. Arch. Mikrobiol. 61, 223-231.

10 1

Niederpruem, D.J. & Jersild, R.A. (1972) Cellular aspects of morphogenesis in the mushroom Schizophyllum commune. CRC Crit. Rev. Microbiol. 1, 545-576. Niederpruem, D.J. & Wessels, J.G. (1969) Cytodifferentiation and morphogenesis in Schizophyllum


10 1

commune. Bacteriol. Rev. 33, 505-535.


O’Brien, M., O’Kiely, P., Forristal, P.D. & Fuller, H.T. (2005) Fungi isolated from contaminated baled grass silage on farms in the Irish Midlands. FEMS Microbiology Letters 247, 131-135 Oberwinkler, F. & Bandoni, R.J. (1982) A taxonomic survey of the gasteroid, auricularioid Heterobasidiomycetes. Can. J. Bot. 60, 1726-1750.

10 1


27

regel 39

Chapter 1

regel 1

Orlovich, D.A. & Ashford, A.E. (1994) Structure and development of the dolipore septum in Pisolithus tinctorius. Protoplasma 178, 66-80.

regel 2 regel 3

Patton, A.M. & Marchant, R. (1978) A mathematical analysis of dolipore/parenthesome structure in basidiomycetes. J. Gen. Microbiol. 109, 335-349.

regel 4 regel 5

Perkins, G., Goodenough, D. & Sosinsky, G. (1997) Three-dimensional structure of the gap junction connexon. Biophys. J. 72, 533-544.

regel 6 regel 7

Roberson, R.W. (1992) The actin cytoskeleton in hyphal cells of Sclerotium rolfsii. Mycologia. 84, 4151.

regel 8 regel 9

Schuren, F.H.J. & Wessels, J.G.H. (1994) Highly-efficient transformation of the homobasidiomycete SchizophyUum commune to phleomycin resistance. Curr. Genet. 26, 179-183.

regel 10 regel 11

Schüßler, A., Schwarzott, D. & Walker, C. (2001) A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycol. Res. 105, 1413-1421.

regel 12 regel 13

Setliff, E.C., MacDonald, W.L. & Patton, R.F. (1972) Fine structure of the spetal pore apparatus in Polyporus tomentosus, Poria latemarginata, and Rhizoctonia solani. Can. J. Bot. 50, 2559-2563.

regel 14 regel 15

Biochem. Cytol. 6, 423-426.

regel 17

Shinji, E., Shinji, Y. & Mizuhira, V. (1976) Histochemical study of a dermatophyte under an electron

regel 18

microscope: Trichophyton mentagrophytes cell wall. Acta Histochem. Cytochem. 9, 292-305.

regel 19

Shinji, Y., Shinji, E. & Mizuhira, V. (1975) A new electron microscopic histo-chemical staining

v

v

method: demonstration of glycogen particles. Acta Histochem. Cytochem. 8, 139-149.

regel 20 regel 21

Sipiczki, M. (2007) Splitting of the fission yeast septum. FEMS Yeast Res. 7, 761-770.

regel 22

Soundararajan, S., Jedd, G., Li, X., Ramos-Pamplona, M., Chua, N-H. & Naqvi, N.I. (2004) Woronin

regel 23

body function in Magnaporthe grisea is essential for efficient pathogenesis and for survival

regel 24

during nitrogen starvation stress. Plant Cell 16, 1564-1574. Swann, E.C. & Taylor, J.W. (1995) Toward a phylogenetic systematics of the basidiomycota: Integrating

regel 26

yeasts and fi lamentous basidiomycetes using 18S rRNA gene sequences. Stud. Mycol. 38, 147-

regel 27

161.

regel 28

Swann, E.C., Frieders, E.M. & McLaughlin, D.J. (2001) Urediniomycetes. Pp. 37-56. In The Mycota

regel 29

VII, Systematics and evolution, Part B. McLaughlin, D.J., McLaughlin, E.G. & Lemke, P.A. (eds.),

regel 30

Springer-Verlag, Berlin, Germany.

regel 31

Tenney, F., Hunt, I., Sweigard, J., Pounder, J.I., McClain, C., Bowman, E.J. & Bowman, B.J. (2000)

regel 32

Hex-1, a gene unique to fi lamentous fungi, encodes the major protein of the Woronin body and

regel 33

functions as a plug for septal pores. Fungal Genet. Biol. 31, 205-217.

regel 34

Thielke, C. (1972) Die dolipore der Basidiomyceten. Arch. Mikrobiol. 82, 31-37.

regel 35

Thiéry, J-P. (1967) Mise en évidence des polysaccharides sur coupes fines en microscopie électronique. J. Microscopie 6, 987-1018.


v

Shatkin, A.J. & Tatum, E.L. (1959) Electron microsocpy of Neurospora crassa mycelia. J. Biophys.

regel 16

regel 25

v

28

v

v

v

v


Todd, N.K. & Aylmore, R.C. (1985) Cytology of hyphal interactions and reactions in Schizophyllum

regel 1

commune. Pp. 231-248. In Developmental biology of Higher Fungi. Moore, D., Casselton, L.A.,

regel 2

Wood, D.A. & Frankland, J.C. (eds.), Cambridge University Press, Cambridge, UK. Trinci, A.P.J. (1978) The duplication cycle and vegetative development in moulds. Pp. 132-163. In The fi lamentous fungi: Developmental mycology. Smith, J.E. & Berry, D.R. (eds.), Wiley, New York, USA. Trinci, A.P.J. & Collinge, A.J. (1974) Occlusion of the septal pores of damaged hyphae of Neurospora

10 1


10 2

crassa by hexagonal crystals. Protoplasma 80, 57-67.


Trinci, A.P.J. & Morris, N.R. (1979) Morphology and growth of a temperature-sensitive mutant of Aspergillus nidulans which forms aseptate mycelia at non-permissive temperatures. J. Gen.

10 1

Microbiol. 114, 53-59.


van der Valk, P. & Marchant, R. (1978) Hyphal ultrastructure in fruit-body primordia of the basidiomycetes Schizophylum commune and Coprinus cinereus. Protoplasma 95, 57-72.

10 4

van der Valk, P. & Wessels, J.G.H. (1976) Ultrastructure and localization of wall polymers during regeneration and reversion of protoplasts of Schizophyllum commune. Protoplasma 90, 65-87. van Driel, K.G.A. (2007) Septal pore caps in basidiomycetes. Ultrastructure and composition. PhD Thesis, University of Utrecht, The Netherlands


10 1


van Driel, K.G.A., van Peer, A.F., Wösten, H.A.B, Verkleij, A.J., Boekhout, T. & Müller, W.H. (2007a) Enrichment of perforate septal pore caps from the basidiomycetous fungus Rhizoctonia solani by combined use of French press, isopycnic centrifugation, and Triton X-100. J. Microbiol. Meth. 71, 298-304. van Driel, K.G.A., Boekhout, T., Wösten, H.A.B.,Verkleij, A.J. & Müller, W.H. (2007b) Laser microdissection of fungal septa as visualised by scanning electron microscopy. Fungal Genet. Biol. 44, 466-473. van Driel K.G.A., van Peer, A.F., Grijpstra J., Wösten H.A.B., Verkleij A.J., Müller W.H. & Boekhout T. (2008) The Septal Pore Cap Protein SPC18 Isolated from the Basidiomycetous Fungus

10 1

regel 18

10 1

regel 21

10 1

Rhizoctonia solani also Resides in Pore-plugs. Eukaryot. Cell doi: 10.1128/EC.00125-08

regel 19 regel 20


van Wetter, M.-A., Schuren, F.H.J., Schuurs, T.A. & Wessels, J.G.H. (1996) Targeted mutation of the SC3 hydrophobin gene of Schizophyllum commune affects formation of aerial hyphae. FEMS

10 1

Microbiol. Lett. 140, 265-269.


van Wetter, M.-A., Wösten, H.A.B. & Wessels, J.G.H. (2000) SC3 and SC4 hydrophobins have distinct roles in formation of aerial structures in dikaryons of Schizophyllum commune. Mol. Microbiol.

10 1

36, 201-210.


Veenstra, R.D. (1996) Size and selectivity of gap junction channels formed from different connexins. J. Bioenerg. Biomembr. 28, 327-337. Vinck, A. (2007) Hyphal differentiation in the fungal mycelium. Thesis, Utrecht University, The Netherlands.

10 1


29

regel 39

Chapter 1

regel 1

Volz, P. & Niederpruem, D.J. (1968) Growth, cell division and branching patterns of Schizophyllum commune Fr. single basidiospore germlings. Arch. Mikrobiol. 61, 232-245.

regel 2 regel 3

Walther, A. & Wendland, J. (2003) Septation and cytokinesis in fungi. Fungal Genet. Biol. 40, 187196.

regel 4 regel 5

Wells, K. (1965) Ultrastructural features of developing and mature basidia and basidiospores of Schizophyllum commune. Mycologia 57, 236-261.

regel 6 regel 7

Wells, K. (1994) Jelly fungi, then and now. Mycologia 86, 18-48.

regel 8

Wells, K. & Bandoni, R.J. (2001) Heterobasidiomycetes. Pp. 85-120. In The Mycota VII, Systematics

regel 9

and evolution, Part B. McLaughlin, D.J., McLaughlin, E.G. & Lemke, P.A. (eds.), Springer-Verlag, Berlin, Germany.

regel 10 regel 11

Wendland, J. & Walther, A. (2006) Septation and cytokinesis in fungi. Pp. 105-122. In The Mycota I,

regel 12

Growth, differentiation and sexuality (2nd ed.). Kües, U. & Fischer, R. (eds.), Springer-Verlag, Berlin, Germany.

regel 13 regel 14

Wessels, J.G.H. & Marchant, R. (1974) Enzymic degradation of septa in hyphal wall preparations from a monokaryon and a dikaryon of Schizophyllum commune. J. Gen. Microbiol. 83, 359-358.

regel 15 regel 16

Wilsenach, R. & Kessel, M. (1965) On the function and structure of the septal pore of Polyporus rugulosus. J. Gen. Microbiol. 40, 397-400.

regel 17 regel 18

Woronin, M. (1864) Zur Entwicklungsgeschichte des Ascobolus pulcherrimus Cr. und Pezizen. Abh. Senkenb. Naturforsch. 5, 333-344.

regel 19 regel 20

Yuan, P., Jedd, G., Kumaran, D., Swaminathan, S., Shio, H., Hewitt, D., Chua, N.-H. & Swaminathan,

regel 21

K. (2003) A HEX-1 crystal lattice required for Woronin body function in Neurospora crassa. Nat.

regel 22

Struct. Biol. 10, 264-270.

regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37 regel 38 regel 39

30


Chapter 2


Phleomycin increases transformation efficiency and promotes single integrations in Schizophyllum commune


Arend F. van Peer, Arman Vinck, Han A. B. Wösten and Luis G. Lugones.

regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36

(submitted to AEM)


Chapter 2

regel 1

Abstract

regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15

Phleomycin resistance is conferred by the ble gene of Streptoalloteychus hindustanus and is widely used as a selection marker for transformation. It introduces double strand breaks in the DNA and as such is toxic but mutagenic as well. Schizophyllum commune was able to grow on 25 μg ml-1 phleomycin after introduction of a resistance cassette based on the ble gene of S. hindustanus and the S. commune GPD regulatory sequences. But, aberrant colony morphology showed that phleomycin still introduced mutations when resistant strains were grown on the antibiotic. Therefore, a new selection system based on resistance to nourseothricin was developed. However, transformation efficiency was ten fold lower than that obtained with phleomycin as a selection marker. The transformation efficiency could be rescued by addition of a non-selective concentration of phleomycin during protoplast regeneration. This was shown to be accompanied by a decrease in the number of integration events per cell.


32

Phleomycin increases transformation efficiency and promotes single integrations

Introduction

regel 1

Phleomycin and other bleomycins are widely used as selection markers for transformation of algae (Chang et al., 2003; Falciatore et al., 1999), protista (Ulbert et al., 2002), animals (Bennett et al., 1998; Pfeifer et al., 1997) and fungi (Banuelos et al., 2003; Bartholomew et al., 2001; Gueldener et al., 2002; Hua et al., 2000; Teunissen et al., 2002). They introduce double strand breaks in the DNA when activated by metal ions (mainly iron) and oxygen (Suzuki et al., 1970). In addition, bleomycins damage RNA and attack cell walls (Burger, 1998). Resistance to phleomycin is conferred by the ble gene of Streptoalloteychus hindustanus. This gene encodes a 14 kDa protein that is capable of sequestering bleomycin-like molecules in a reversible way (Gatignol et al., 1988). The basidiomycete Schizophyllum commune can be efficiently transformed using a phleomycin resistance cassette, in which the ble gene of S. hindustanus is placed under control of the regulatory sequences of the S. commune glyceraldehyde3-phosphate dehydrogenase gene (GPD) (Schuren & Wessels. 1994). However, we here show that phleomycin resistant strains of S. commune are still mutated upon exposure to phleomycin. Therefore, a cassette was constructed that confers resistance to a new selection marker, nourseothricin. The lower number of transformants obtained with this cassette could be increased by adding non-selective concentrations of phleomycin to the regenerating protoplasts. This was accompanied with a lower copy number of the plasmid in the genome of the transformants.

Materials and methods Strains and growth conditions The co-isogenic S. commune strains 4-39 (CBS 341.81) and 4-40 (CBS 340.81) were used as well as the uracil auxotroph 12-42 and the 4-39 derivative 4-39P. The latter strain had been transformed to phleomycin resistance using plasmid pHYM1.2. This plasmid contains the S. hindustanus ble gene under control of the upstream and downstream regulatory sequences of the S. commune GPD gene (Scholtmeijer et al., 2001). Strains were grown in minimal medium (MM) (Dons et al., 1979) at 25 or 30˚C. Plasmids used in this study pGEMPhleo and pGEMNour are derivatives of pGEMTeasy (Promega) containing EcoR1 fragments encompassing a phleomycin (Schuren & Wessels, 1994) and a

10 1


10 2


10 1


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


33

regel 39

Chapter 2


nourseothricin resistance cassette, respectively. The latter cassette consists of the nat1 gene of Streptomyces noursei (accession number S60706) (Krugel et al., 1993) placed under control of a 230 bp S. commune GPD promoter and a 450 bp S. commune SC3 terminator. Plasmid pNOURAD consists of a pUC20 backbone containing both the phleomycin and the nourseothricin resistance cassettes. These cassettes can be excised from the plasmid using EcoR1. Plasmid pUBB20 consists of a pUC20 backbone with a 2.8 kb BamHI fragment containing the URA1 gene of S. commune (Froeliger et al., 1989).

regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36

Transformation of S. commune Monokaryotic mycelium was grown for three days in 100 ml MM in a 250 ml Erlenmeyer flask at 250 rpm at 25 ºC. The culture was homogenized for 15 seconds in a blender (Waring Products Inc., Waring Laboratory, Torrington, USA), diluted 2 x with MM (v/v) and grown for another 24 h in 100 ml MM in a 250 ml Erlenmeyer flask. Mycelium was pelleted in 50 ml Greiner tubes (Greiner Bio-One International AG, Kremsmuenster, Austria) at 4500 g for 5 min and washed with 1M MgSO4. Mycelium (3 g wet weight) was added to 10 ml filter sterilized protoplasting mixture (1 M MgSO4, 10 mM malate buffer pH 5.8, 1.5 mg ml-1 lysing enzymes [Plant Research International, Wageningen, The Netherlands]). The suspension was gently shaken (10 rpm) for 2.5 h at 30 ºC, diluted 2x with sterile water and incubated for an additional hour. Cell debris was removed by centrifugation for 2 min at 300 g. After addition of 1 volume 1 M sorbitol, the supernatant was incubated for 15 min at room temperature and sieved through glass wool to remove cell debris. Protoplasts were pelleted by centrifugation for 15 min at 2200 g and carefully resuspended in 25 ml 1 M sorbitol. After centrifugation for 10 min at 2200 g protoplasts were aliquoted in 100 μl portions in 1 M sorbitol with 50 mM CaCl2 to a final concentration of 108 protoplasts ml-1. For transformation, portions were thawed on ice and 5 μg DNA was added that was dissolved in 20 μl TE (10 mM Tris pH 8, 3 mM EDTA). After 15 min of incubation on ice, one volume PEG 4000, buffered with 10 mM Tris pH 7, was slowly mixed with the protoplasts at room temperature and incubated for 5 min. Regeneration medium (MM + 0.5 M MgSO4) was added to a total volume of 3 ml. After overnight regeneration at 25 ºC, 7 ml MM containing 1 % low melting point agarose was added. After mixing at 37 ºC, regenerated protoplasts were spread on square plates containing 40 ml solidified MM. Regeneration medium and selection plates contained 25 μg ml-1 phleomycin or 10 μg ml-1 nourseothricin. Plates were incubated at 30 ºC for 5 days.


34


Isolation of genomic DNA and RNA Strains were grown on a porous polycarbonate membrane (diameter 76 mm, pore size 0.1 μm; Osmonics, GE Water Technologies, Trevose, PA, USA) on MM with 1.5 % agar for 4 days at 25 ºC. Colonies were harvested and ground in liquid nitrogen. Homogenized mycelium was lyophilized for RNA extraction. 2 mg of mycelial powder was extracted with Trizol Reagent (Gibco BRL, Life Technologies) according to the instructions of the manufacturer. For DNA isolation, 200 mg homogenized mycelium was mixed with 0.9 ml extraction buffer (2 % SDS, 24 mg ml-1 PAS [4-aminosalycilic acid] and 20 % 5 x RNB [ 121.1 g l-1 Tris-HCl, 73.04 g l-1 NaCl, 95.1 g l-1 EGTA, pH 8.5]). After incubation at 65 ºC for 15 min, the mixture was extracted with 0.4 ml phenol/chloroform (1:1) and 0.5 ml chloroform. The phases were separated by centrifugation for 10 min at 14000 g. The DNA was precipitated with 0.8 volume of isopropanol and pelleted at 14000 g for 10 min. After washing overnight with 70 % ethanol, the DNA was dissolved in 300 μl TE containing 10 μg ml-1 RNAse.

regel 1

10 1


10 2


10 1


10 4


10 1

Southern blotting DNA hybridizations were performed according to Schuren et al. (1993).

regel 2


Results Phleomycin is mutagenic to resistant S. commune strains The mode of action of phleomycin together with the occurrence of morphologically aberrant colonies during selection on this antibiotic, indicated that this compound was still mutagenic to S. commune despite acquired resistance. To study this effect of phleomycin, a resistant strain (4-39P) was grown for 7 days at 30 ˚C on minimal medium (MM) plates with or without 25 μg ml-1 phleomycin. Mycelial plugs were taken from four different spots from the resulting colonies and were cultured on MM plates. Colonies derived from mycelium that had been grown in absence of phleomycin were morphologically indistinguishable from the wild-type (Figure 1). In contrast, inocula taken from 4-39P colonies that had been grown in the presence of phleomycin developed morphologically aberrant colonies in three independent experiments. In one case even three out of four colonies showed a characteristic thin phenotype and one showed the typical streak phenotype (Papazian, 1950). These phenotypes were stable and segregated 1:1 in a cross with a compatible wild type strain. Morphological aberrant colonies were not observed when these experiments were repeated with the wild-type strain 4-39 and the phleomycin resistant strain 4-39P

10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


35

regel 39

Chapter 2

regel 1 regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16

Figure 1: Colonies resulting from inocula taken from mycelium of the phleomycin resistant strain 439P that had been grown in the absence (C1-C4) or presence (C5-C8) of phleomycin.


using non selective concentrations (1-5 μg ml-1) of phleomycin. These experiments show that phleomycin is still mutagenic to resistant S. commune strains at selective concentrations of the antibiotic.


Phleomycin increases transformation efficiency independent of the selection marker used Nourseothricin resistance is mediated by the nat1 gene of S. noursei. It has been used as a selection marker in several fungi including the yeast Saccharomyces cerevisiae, the filamentous ascomycete Podospora anserina, and the basidiomycetous yeasts Cryptococcus neoformans and Ustilago maydis. (Goldstein and McCuster, 1999; ElKhoury et al., 2008; McDade et al., 2001; Gold et al., 2007). Regenerated protoplasts of S. commune were cultured in the presence of different concentrations of nourseothricin (Figure 2A). 3 μg ml-1of the antibiotic inhibited growth of S. commune. The coding sequence of nat1 was cloned between the S. commune GPD promoter and the SC3 terminator, resulting in plasmid pGEMNour. 107 protoplasts of S. commune strain 4-39 were transformed with 5 μg of this vector. This routinely resulted in 4 transformants, in absence of non-transformed 4-39 background. However, transformation of 4-39 with pGEMPhleo, in which the nat1 gene had been replaced by the ble gene of S. hindustanus, resulted in ten-fold more transformants.

regel 38 regel 39

36


regel 1

10 1


10 2


10 1


10 4


Figure 2: A) Growth of regenerated protoplasts of S. commune in the presence of 0, 1, 3, and 5 μg ml-1 nourseothricin. Selection of transformants on 25 μg ml-1 phleomycin (B) and 8 μg ml-1 nourseothricin (C) after introduction of pNOURAD in S. commune and regeneration in the presence of 25 μg ml-1 phleomycin.

Vector pNOURAD was constructed that contains both the nourseothricin and phleomycin resistance cassette to determine what caused this difference in transformation efficiency. Transformation of 4-39 with pNOURAD, using phleomycin during regeneration, yielded similar numbers of transformants as with pGEMPhleo. This was irrespective of the antibiotic that was present in the selection plate (Figure 2B, C). Construct pNOURAD was then introduced in strain 4-39 using 10 μg of DNA and 2x107 protoplasts. After addition of regeneration medium, the mixture was divided in four portions that were regenerated in presence of phleomycin (25 μg ml-1), nourseothricin (8 μg ml-1) or in the absence of antibiotic (two portions). Protoplasts that had been regenerated in the presence of phleomycin or nourseothricin were plated on MM containing the same antibiotic. Protoplasts that were regenerated in absence of antibiotic were plated on MM containing either phleomycin or nourseothricin. Protoplasts regenerated with phleomycin and nourseothricin yielded 64 and 7 resistant colonies, respectively. Regeneration without antibiotics resulted in 6 transformants on phleomycin and 4 on nourseothricin. These results indicate that the presence of phleomycin during regeneration affects transformation efficiency. To test if this effect depends on the presence of the phleomycin resistance cassette, strain 4-39 was transformed with pGEMNour.

10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


37

regel 39

Chapter 2

regel 1 regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19

Figure 3: Southern analysis of transformants regenerated in the absence (A) and presence (B) of 25 μg ml-1 phleomycin. Arrows indicate transformants with single integrations. Blots were hybridized with a fragment of the GPD promoter, which is present both in the genomic DNA and in pNOURAD. The endogenous GPD fragment is represented by the lowest band on the blots.


Regeneration in the absence of antibiotic followed by selection on nourseothricin (8 μg ml-1) resulted in three transformants. In contrast, 37 transformants were obtained when regeneration was performed in the presence of 25 μg ml-1 phleomycin. Similar results were obtained in the presence of non-selective concentrations of 1-5 μg ml-1 phleomycin during regeneration. The increased transformation efficiency was also obtained when protoplasts of an uracil auxotrophic strain were transformed with plasmid pUBB20 (containing the URA1 gene with its own regulatory sequences) and regenerated in the presence of 1-25 μg ml-1 phleomycin. Phleomycin was added at different time points during regeneration of pGEMPhleotransformed protoplasts to assess whether timing of addition of the antibiotic affected transformation efficiency. Addition of phleomycin at the start of regeneration or after 1 or 2 hours, yielded 42, 48, and 40 transformants, respectively. In contrast, 18, 12 and 6 transformants were obtained when the antibiotic was added 3, 4 and 8 h after the start of the regeneration. Apparently, phleomycin influences transformation efficiency especially during the first 3 hours of regeneration.


38


Phleomycin reduces the number of integration events The copy number of pNOURAD was analyzed in genomic DNA of transformants that had been regenerated in the absence or presence of 25 μg ml-1 phleomycin. In the absence of the antibiotic, only 1 out of 11 transformants had a single integration of the construct (Figure 3A). The incidence of single integrations was increased 6 fold when regeneration of protoplasts was performed in the presence of 25 μg ml-1 of phleomycin (Figure 3B). Reducing the amount of antibiotic to 15 or 3 μg ml-1 showed similar results as 25 μg ml-1of phleomycin (Data not shown).

regel 1

10 1


10 2


10 1 Discussion


Expression of the ble gene of S. hindustanus under control of the S. commune GPD promoter and terminator confers resistance to phleomycin (Schuren & Wesssels, 1994). Expression could not be detected when genes encoding hygromycin B phosphotransferase (hph) and aminoglycoside phosphotransferase (apt) were expressed in the same configuration (Schuren et al., 1998). This was also found for gentamicin acetyltransferase (acc1) (our results, unpublished). Introduction of introns and the increase of GC content in AT rich regions (Lugones et al., 1999; Scholtmeijer et al., 2001) resulted in detectable mRNA levels of hph in S. commune. Nonetheless, selection on hygromycin remained problematic due to high background of nontransformed colonies (our results, unpublished). At this point phleomycin was thus the only efficient dominant selection marker for S. commune. It is shown here that resistant colonies remain sensitive to mutagenesis by phleomycin. Inocula derived from a resistant strain developed aberrant morphologies when they were grown in the presence of a selective concentration of phleomycin. Mutants with a thin phenotype (Raper & Miles, 1958) predominated. They are characterized by a high, radial growth rate and their inability to produce normal aerial hyphae. In addition, fruiting body formation is abolished in dikaryons homozygous for the mutation (Schuren, 1999; Schwalb & Miles, 1967; Wessels et al., 1991). Transposition of the class II transposon Scooter2 into the thn1 gene, encoding a putative regulator of G protein signalling (RGS), was shown to be responsible for the thin phenotype (Fowler et al., 2000). It can thus be that phleomycin is mutagenic not only because of its ability to make double strands DNA breaks but also because it mobilizes transposons. The frequent occurrence of colonies with a thin phenotype could be due to a hot spot for integration of Scooter2 in the thn1 gene. Also, the high frequency may be explained by the fact that thin mutants overgrow the wild type (Schuren, 1999).

10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


39

regel 39

Chapter 2


Although the stoichiometry between bleomycins and the ble gene encoded protein is 1:1, six fold excess of the latter is needed for protection of DNA in vitro (Gatignol et al., 1988). Taking this into account, 27 mg l-1 of ble encoded product should be produced to fully protect the DNA of S. commune during phleomycin selection. This is unlikely considering the low expression levels of the ble gene in S. commune (L.G. Lugones, unpublished data). Therefore, it may well be that the genomic DNA of S. commune is not completely protected during selection allowing mutations to occur. Different candidates were considered in order to replace the phleomycin selection marker. One candidate, nourseothricin, is an aminoglycoside antibiotic produced by S. noursei that consists of a complex of the streptothricin sulphates C and D. This complex inhibits ribosomal protein synthesis (Goldstein & McCuster, 1999). Several genes confer resistance to nourseothricin through acetylation, including the nat1 gene from S. noursei (Krugel et al., 1993). The 573 bp nat1 gene lacks AT rich regions and contains an overall GC content of 70.7 %, which is similar to that of the ble gene of S. hindustanus (69.5 %) that was shown to be functional in S. commune. Indeed, nat1 could be used to confer resistance to nourseothricin when placed under control of the homologous GPD promoter and terminator of S. commune. Since nourseothricin is not mutagenic we prefer to use this selection marker from now on. It came to a surprise that the number of nourseothricin resistant transformants was ten fold lower than that obtained with phleomycin as a selection marker. This was due to the fact that phleomycin increases the number of transformants during regeneration, in particular in the first three hours of this process. Also non-selective concentrations of phleomycin (that were shown not to induce morphological mutants) had this effect and it was independent of the selection marker that was used (uracil prototrophy or nourseothricin resistance). Increase of transformants due to the presence of phleomycin during regeneration was accompanied by a reduced copy number of the construct that was used during transformation. The effect of phleomycin thus strongly resembles REMI (Restriction Enzyme Mediated Integration) (see Kahmann & Basse, 1999). REMI also initiates a higher percentage of single-copy integration events and, in some organisms, is accompanied by an increase in the transformation frequency. Why low concentrations of phleomycin are non-mutagenic but do affect transformation efficiency is not yet understood. It is tempting to speculate that it has an effect on the DNA repair systems. Homologous recombination (HR) and non homologous end joining (NHEJ) are used by the cell to repair double strand DNA breaks (see Sonoda et al., 2006). It has been proposed that the proteins Rad52 (HR) and KU70/80 (NHEJ) function as “gatekeepers” for these pathways (Haber, 1999;

regel 38 regel 39

40

v


van Dyck et al., 1999). Expression of mus11, which is the orthologue of Rad52 in Neurospora crassa, can be induced by mutagens (Sakuraba et al., 2000). Quantification of the changes in the concentration of both “gatekeepers” in the presence or absence of phleomycin could explain the results described in this study.

regel 1

10 1


10 2


10 1


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


41

regel 39

Chapter 2

regel 1

References

regel 2 regel 3

Banuelos, O., Naranjo, L., Casqueiro, J., Gutierrez, S. & Martin, J. F. (2003) Co-transformation with

regel 4

autonomous replicating and integrative plasmids in Penicillium chrysogenum is highly efficient and

regel 5

leads in some cases to rescue of the intact integrative plasmid. Fungal Genet. Biol. 40, 83-92.

regel 6

Bartholomew, K., Dos Santos, G., Dumonceaux, T., Charles, T. & Archibald, F. (2001) Genetic

regel 7

transformation of Trametes versicolor to phleomycin resistance with the dominant selectable

regel 8

marker shble. Appl. Microbiol. Biotechnol. 56, 201-204.

regel 9

Bennett, R. P., Cox, C. A. & Hoeffler, J. P. (1998) Fusion of green fluorescent protein with the Zeocin-

regel 10

resistance marker allows visual screening and drug selection of transfected eukaryotic cells.

regel 11

BioTechniques 24, 478-482.

regel 12

Burger, R. M. (1998) Cleavage of nucleic acids by bleomycin. Chemical Reviews 98, 153-1169.

regel 13

Chang, M., Li, F., Odom, O. W., Lee, J. & Herrin, D. L. (2003) A cosmid vector containing a dominant

regel 14

selectable marker for cloning Chlamydomonas genes by complementation. Plasmid 49, 75-78.

regel 15

Dons, J. J. M., de Vries, O. M. H. & Wessels, J. G. H. (1979) Characterization of the genome of the basidiomycete Schizophyllum commune. Biochim. Biophys. Acta 563, 100-112.

regel 16 regel 17

El-Khoury, R., Sellem, C.H., Coppin, E., Boivin, A., Maas, M.F., Debuchy, R. & Sainsard-Chanet, A.

regel 18

(2008) Gene deletion and allelic replacement in the filamentous fungus Podospora anserina. Curr.

regel 19

Genet. 53, 249-258.

regel 20

Falciatore, A., Casotti, R., Leblanc, C., Abrescia, C. & Bowler, C. (1999) Transformation of Nonselectable Reporter Genes in Marine Diatoms. Diatoms. Mar. Biotechnol. 1, 239-251.

regel 21 regel 22

Fowler, T. J. & Mitton, M. F. (2000) Scooter, a New Active Transposon in Schizophyllum commune, Has Disrupted Two Genes Regulating Signal Transduction. Genetics 156, 1585-1594.

regel 23 regel 24

Froeliger, E. H., Ullrich, R. C. & Novotny, C. P. (1989) Sequence analysis of the URA1 gene encoding orotidine-5’-monophosphate decarboxylase of Schizophyllum commune. Gene 83, 387-393.

regel 25 regel 26

Gatignol, A., Durand, H. & Tiraby, G. (1988) Bleomycin resistance conferred by a drug-binding protein. FEBS Lett. 230, 171-175.

regel 27 regel 28

Gold, S. E., Bakkeren, G., Davies, J. E. & Kronstad, J. W. (2007) Three selectable markers for transformation of Ustilago maydis. Gene 142, 225-230.

regel 29 regel 30

Goldstein, A. L. & McCusker, J. H. (1999) Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15, 1541-1553.

regel 31 regel 32

Gueldener, U., Heinisch, J., Koehler, G. J., Voss, D. & Hegemann, J. H. (2002) A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucl. Acids Res. 30, e23.

regel 33 regel 34

Haber, J. E. (1999) Gatekeepers of recombination. Nature. 398, 665-667.

regel 35

Hua, J., Meyer, J. D. & Lodge, J. K. (2000) Development of positive selectable markers for the fungal pathogen Cryptococcus neoformans. Clin. Diagn. Lab. Immunol. 7, 125-128.


42


Kahmann, R. & Basse, C. (1999) REMI (Restriction Enzyme Mediated Integration) and its impact on

regel 1

the isolation of pathogenicity genes in fungi attacking plants. European Journal of Plant Pathology

regel 2

105, 221-229. Krugel, H., Fielder, G., Smith, C. & Baumberg, S. (1993) Sequence and transcriptional analysis of the nourseothricin acetyltransferase encoding gene natl from Streptomyces noursei. Gene 127, 128131. Lugones, L. G., Scholtmeijer, K., Klootwijk, R. & Wessels, J. G. H. (1999) Introns are necessary for mRNA

10 1


10 2

accumulation in Schizophyllum commune. Mol. Microbiol. 32, 681-689.


McDade, H. C. & Cox, G. M. (2001) A new dominant selectable marker for use in Cryptococcus neoformans. Med. Mycol. 39, 151-154.

10 1

Papazian, H. P. (1950) Physiology of the incompatibility factors in Schizophyllum commune. Bot. Gaz. 112, 143-163. Pfeifer, T. A., Hegedus, D. D., Grigliatti, T. A. & Theilmann, D. A. (1997) Baculovirus immediate-early

Raper, J. R. & Miles, P. G. (1958) The genetics of Schizophyllum commune. Genetics 43, 530-546. Sakuraba, Y., Schroeder, A. L., Ishii, C. & Inoue, H. (2000) A Neurospora double strand-break repair gene, mus-11, encodes a RAD52 homologue and is inducible by mutagens. Mol. Gen. Genet. 264, 392-401. Scholtmeijer, K., Wösten, H. A. B., Springer, J. & Wessels, J. G. H. (2001) Effect of introns and ATrich sequences on expression of the bacterial hygromycin B resistance gene in the basidiomycete Schizophyllum commune. Appl. Environ. Microbiol. 67, 481-483. Schuren, F. H. J. (1999) Atypical interactions between thn and wild-type mycelia of Schizophyllum commune. Mycol. Res. 103, 1540-1544. Schuren, F. H. J. & Wessels, J. G. H. (1998) Expression of heterologous genes in Schizophyllum commune is often hampered by the formation of truncated transcripts. Curr. Genet. 33, 151-156.

10 4

Genet. 238, 91-96.

10 1

Schwalb, M. N. & Miles, P. G. (1967) Morphogenesis of Schizophyllum commune I. Morphological

regel 13


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1

Schuren, F. H. J. & Wessels, J. G. H. (1994) Highly-efficient transformation of the homobasidiomycete Schizophyllum commune to phleomycin resistance. Curr. Genet. 26, 179-183.

regel 12

regel 14

Schuren, F.H.J., Harmsen, M.C. & Wessels, J.G.H. (1993) A homologous gene reporter system for the basidiomycete Schizophyllum commune based on internally deleted homologous genes. Mol. Gen.

regel 10 regel 11

promoter-mediated expression of the Zeocin resistance gene for use as a dominant selectable marker in dipteran and lepidopteran insect cell lines. Gene 188, 183-190.

regel 9


10 1

variation and mating behaviour of the thin mutation. Am. J. Bot. 54, 440-446.


Sonoda, E., Hochegger, H., Saberi, A., Taniguchi, Y. & Takeda, S. (2006) Differential usage of nonhomologous end-joining and homologous recombination in double strand break repair. DNA Repair 5, 1021-1029.

10 1


43

regel 39

Chapter 2

regel 1

Suzuki, H., Nagai, K., Akutsu, E., Yamaki, H. & Tanaka, N. (1970) On the mechanism of action of

regel 2

bleomycin. Strand scission of DNA caused by bleomycin and its binding to DNA in vitro. J.

regel 3

Antibiotics 23, 473-480.

regel 4

Teunissen, H. A., Verkooijen, J., Cornelissen, B. J. & Haring, M. A. (2002) Genetic exchange of avirulence

regel 5

determinants and extensive karyotype rearrangements in parasexual recombinants of Fusarium

regel 6

oxysporum. Mol. Genet. Genomics 268, 298-310.

regel 7

Ulbert, S., Chaves, I. & Borst, P. (2002) Expression site activation in Trypanosoma brucei with three marked variant surface glycoprotein gene expression sites. Mol. Biochem. Parasitol. 120, 225-235.

regel 8 regel 9

van Dyck, E., Stasiak, A. Z., Staslak, A. & West, S. C. (1999) Binding of double strand breaks in DNA by human Rad52 protein. Nature 398, 728-731.

regel 10 regel 11

Wessels, J. G. H., de Vries, O. M. H., Ásgeirsdóttir, S. A. & Springer, J. (1991) The thn mutation of

regel 12

Schizophyllum commune, which suppresses formation of aerial hyphae, affects expression of the Sc3

regel 13

hydrophobin gene. J. Gen. Microbiol. 137, 2439-2445.

regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37 regel 38 regel 39

44


Chapter 3


The septal pore cap of Schizophyllum commune consists of a proteinaceous matrix that defines the SPC ultrastructure


Arend F. van Peer, Kenneth G.A. van Driel, Wally H. Müller, Jurian Bronkhof, Teun Boekhout, Arie J. Verkleij and Han A.B. Wösten


Chapter 3

regel 1

Abstract


Basidiomycete hyphae are compartmentalized by perforated septa. The complex septa of these fungi contain a characteristic rim around their central pore, the dolipore, which is covered on either side by a septal pore cap (SPC). Little is known about the SPC composition and function. Here, the SPCs of Schizophyllum commune were purified using a strain in which the SC3 and SC15 genes have been deleted. Purification was obtained using two discontinuous sucrose gradients followed by filtration over a 220 nm cut-off filter. Addition of Triton-X-100 prior to gradient centrifugation not only proved to be essential for the purification of the SPC, it also increased the buoyant density of the organelle (from 1.2295 to 1.2575 g cm-3) and altered the ultra-structure of its perforations. From these data it is concluded that SPCs of S. commune consist of a proteinaceous matrix, which is covered by a lipid membrane. The protein matrix defines the ultrastructure of the SPC and can be dissociated by SDS. SDS PAGE analysis revealed three protein bands with apparent molecular weights of 14, 33 and 60 kDa. Despite its complicated ultrastructure the SPC matrix thus seems to have a simple protein composition.

regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37 regel 38 regel 39

46

The septal pore cap of Schizophyllum commune consists of a proteinaceous matrix

Introduction

regel 1

Filamentous fungi grow by means of hyphae that extend at their apices while branching subapically. This mode of growth together with hyphal fusion (anastomosis) results in an interconnected network of hyphae that is called a mycelium. Hyphae of the lower fungi, i.e. the Glomeromycota, Zygomycota, and Chytridiomycota (Schüßler et al., 2001; Bauer et al., 2006), are sparsely, if at all, septated (Barr, 2001; Benny et al., 2001). Hyphae of the filamentous Ascomycota and Basidiomycota have septa that contain a pore. This central perforation allows streaming of cytoplasm and translocation of organelles between hyphal compartments (Gull, 1978; Bracker & Butler, 1963, 1964). Closure of the septal pore is crucial for differentiation processes such as sporulation, and for heterokaryon incompatibility (HI) and damage control. It may have other functions as well (see Chapter 1). Basidiomycota that are grouped in the Agaricomycotina and the Ustilagomycotina have septa that are characterized by a barrel-shaped swelling around the pore, which is known as the dolipore. The dolipore of the Agaricomycotina is generally associated with a septal pore cap (SPC) (Bracker & Butler, 1963). SPCs can be of the vesiculate type, the imperforate type or the perforate type (Mclaughlin et al. 1995). The SPC of Schizophyllum commune is of the perforate type. Its base, i.e. the part closest to the septum, has a diameter of 450 – 600 nm and the whole structure is regularly perforated by openings of approximately 100 nm (Müller et al., 1994, 1998, 1999). The SPC consists of a matrix that is surrounded by an inner and outer membrane (Girbardt, 1958, 1961; Moore & McAlear, 1962; Bracker & Butler, 1963; Marchant & Wessels, 1973; Müller et al., 1998, 2000). At its base the SPC is connected to the endoplasmic reticulum (ER) (Girbardt, 1961; Moore & Patton, 1975; Müller et al., 1998). This is especially clear in young hypha and it has therefore been suggested that the SPC is derived from this organelle. The finding that fluorescent ER markers like ER-tracker, DIOC-6, and Brefeldin A conjugated to BODIPY stain the septal pore cap region supports this hypothesis (van Driel, 2007) as well as the staining of this region by zinc-iodine osmium tetroxide (ZIO) (Müller et al., 1998, 1999, 2000), which marks calcium-affinity sites in the ER (Gilloteaux & Naud, 1979). Although the ultrastructure of the SPC of S. commune is one of the best studied (Jersild et al., 1967, Marchant & Wessels, 1973, 1974; Moore & Patton, 1975; Patton & Marchant, 1978; van der Valk & Marchant, 1978; Müller et al., 1994, 1998, 1999) its composition, dynamics and function are unknown. This chapter describes a purification method and the further characterization of this SPC. It is shown that the matrix of the SPC of S. commune defines the ultrastructure of this organelle and that it consists of proteins with apparent molecular weights of 14, 33, and 60 kDa. 47

10 1


10 2


10 3


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


Chapter 3

regel 1

Materials and methods

regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13

Strains and growth conditions S. commune strain 4-40 (MATA43, MATB43, CBS 340.81) was used as well as an isogenic derivative in which the SC3 and SC15 genes have been deleted (Lugones et al., 2004). Strains were grown in the light at 25 ºC on porous polycarbonate membranes (diameter 76 mm, pore size 0.1 μm; Osmonics, GE Water Technologies, Trevose, PA, USA) placed on minimal medium (MM; Dons et al, 1979) solidified with 1.5 % agar. A 5-days-old colony was homogenized in a blender (Waring Products Inc., Waring Laboratory, Torrington, USA) in 100 ml MM. The homogenate was grown for 24 h at 225 rpm. This culture was again homogenized and 1 volume of MM was added. After growing for 24 h this procedure was repeated, resulting in 400 ml of densely grown mycelium, which was used for purification of the SPCs of S. commune.

regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36

Purification of the septal pore cap Mycelium was separated from the culture medium by filtration over filter paper. 15 g aliquots of mycelium (wet weight) were mixed with 40 ml protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany) at 4 °C and homogenized in a French Pressure Cell Press (American Instrument Company, Silverspring, Maryland) in three cycles at 1000 Psi (16000 cell pressure, high ratio). Cold Triton-X-100 (Serva, electrophoresis GmbH, Heidelberg, Germany) was added to a final concentration of 1 %, after which the homogenate was incubated for 30 min on ice. 20 ml aliquots were loaded on a discontinuous sucrose gradient consisting of 5.5 ml 55 % w/w sucrose, and 5 ml 40 % w/w sucrose in Ultra-clearTM Centrifuges tubes (25 x 89 mm, Beckman Coulter Inc., Fullerton, USA). Fractions were collected with a needle connected to a peristaltic pump (LKB Bromma, Bromma, Sweden) after centrifugation for two hours at 100000 g in a SW28 swing out rotor (Beckman Coulter Inc., Fullerton, USA). The SPC containing fraction at the 40-55 % sucrose interface was diluted 4 times with 1 % Triton X-100 and was loaded on a three layered sucrose gradient that consisted of 3.5 ml 70 % w/w sucrose, 5 ml 52 % w/w sucrose, and 5 ml 47 % w/w sucrose. The 52-70 % interface was isolated after centrifugation for 2 hrs at 100000 g at 4 ºC. The fraction was diluted 5 times with cold distilled water and filtered over a 220 nm cut-off pore-size filter (Nitrocellulose filters, Millipore, Billerica, USA) mounted in a Swinnex membrane holder (Millipore, Billerica, USA). Filters were inverted in the membrane holder and SPCs were washed off with ultra pure water and collected by centrifugation at 10000 g for 60 min.


48

v

v


Protein analysis SDS-PAGE was performed on 3-18 % gradient gels (Bio-Rad Laboratories, Hercules, USA). Proteins were stained with colloidal coomassie brilliant blue (Neuhof et al., 1988) or blotted onto PVDF membranes for immunodetection of the SC3 and SC15 proteins (Wösten et al., 1994; Lugones et al., 2004). Transmission electron microscopy Samples were fi xed overnight at 4 oC in 1.5 % glutaraldehyde (Agar Scientific LTD., Essex, UK) buffered with 20 mM HEPES, pH 6.8. After post fi xation in 1 % (w/ v) aqueous osmium tetroxide (EMS, Hatfield, PA, USA) for 60 min, samples were washed with ultra pure water twice, and gradually dehydrated in 60 % (v/v), 70 % (v/ v), 80 % (v/v), 90 % (v/v), and 100 % (two times) acetone for 30 min each. After taking up the material in acetone containing 1 % (v/v) acidified 2,2-dimethoxypropane (DMP), samples were infiltrated stepwise (each step for 2 hrs) with 25 % (v/v), 50 % (v/v), 75 % (v/v) and 100 % (two times) Spurr’s resin (Spurr, 1969). After washing with freshly prepared Spurr’s resin, samples were embedded in the resin at 65 ºC for 48 h in BEEM capsules (EMS, Hatfield, PA, USA). Sections were cut with a diamond knife (Diatome, Hatfield, PA, USA) using a ULTRACUT E ultramicrotome (Leica Microsystems, Vienna, Austria). The sections were picked up with formvar-coated, carbon-stabilized copper grids (hexagonal 150 mesh Veco grids, EMS, Hatfield, PA, USA). Sections were contrasted with 4 % (w/v) aqueous uranyl acetate (Merck, Darmstadt, Germany) for 10 min and 0.4 % (w/v) aqueous lead citrate (Merck, Darmstadt, Germany) for 2 min (Venable & Coggeshall, 1965) and analyzed with a TECNAI 10 (FEI Company, Hillsboro, OR, USA) electron microscope at an acceleration voltage of 100 kV.

regel 1

10 1


10 2


10 3


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


Results

10 1

Homogenized mycelium of S. commune was loaded onto discontinuous sucrose gradients and centrifuged at 100000 g. Transmission electron microscopy (TEM) revealed that the SPCs of S. commune migrated through 45 % (w/w) sucrose but accumulated on top of a 50 % solution of the sugar. Cell wall fragments migrated through this concentration of sucrose and pelleted at the bottom of the centrifuge tube. However, vesicles and membrane remnants behaved like the SPCs in density flotation (Figure 1A). To remove the contaminating lipids, the homogenate was treated with 1 % SDS, 1 % Tween-20 or 1 % Triton-X-100 prior to centrifugation.


10 1


10 1


49

regel 39

Chapter 3


Figure 1: Transmission electron microscopy of fractions obtained during purification of the SPCs of S. commune. (A) 50 % and (B) 55 % sucrose interface of a sucrose gradient loaded with a mycelial homogenate that was either untreated or treated with Triton-X-100, respectively. A SPC in (A) (arrow) is surrounded by vesicles and membranous material. C) Top layer that was derived from a 220 nm fi lter showing purified SPCs (examples are indicated by arrows). Inserts in (A) and (B) show SPCs at higher magnification with round and hexagonal perforations, respectively. Bars represent 1 μm in A-C and 500 nm in the inserts.

regel 25 regel 26

regel 38

When treated with SDS the SPC ultrastructure was disrupted and could no longer be detected by TEM (not shown). The SPC ultrastructure was maintained in the presence of Tween-20 (not shown) or Triton-X-100 (Figure 1B). These detergents dissolved most of the vesicles, which thus no longer contaminated the SPC enriched fraction. This was especially the case in the Triton-X-100 treated samples. Interestingly, the buoyant density of the SPCs increased upon treatment with TritonX-100. The SPCs now accumulated at 55 % w/w (1.2575 g cm-3) sucrose as opposed to 50 % w/w (1.2295 g cm-3) before treatment with the detergent. TEM analysis revealed that the perforations of the SPC changed from round to hexagonal upon treatment with Triton-X-100 (inserts in Figure 1A and B). These data indicate that membranous material is removed from the outer surface of the SPC and that the remaining matrix consists of proteins.

regel 39

50



regel 1

10 1


10 2


10 3


10 4


10 1


Figure 2: Purification of SPCs of S. commune. A) Triton-X-100 treatment of a mycelial homogenate obtained by french-pressing and first fractionation over a 40-55 % sucrose gradient. B) Dilution of the 40-55 % interface with Triton-X-100 and second fractionation over a 47-52-70 % sucrose gradient. C) Dilution of the 52-70 % interface to a concentration lower than 10 % sucrose and filtration over a 220 nm cut-off fi lter.

To further purify the SPCs of S. commune, two discontinuous sucrose gradients were combined with a filtration step (Figure 2). Cell wall fragments of high buoyant density (> 1.2575 g cm-3; i.e. 55 % w/w sucrose) and low-density material (< 1.1764 g cm-3; i.e. 40 % w/w sucrose) were separated from the SPCs in the first fractionation of the mycelial homogenate over a 40-55 % discontinuous sucrose gradient (Figure 2A). The protein profile of the 40-55 % sucrose interface containing the SPCs was complex (Figure 3, lane 1). This interface fraction was diluted with 1 % Triton-X-100 to a final concentration of less than 10 % w/w sucrose and loaded on top of a second, three layered, 47-52-70 % w/w sucrose gradient (Figure 2B). The SPCs now accumulated on top of the 70 % sucrose layer. The protein pattern of this fraction was clearly different from that of the 47-52 % interface but was still complex (Figure 3, lanes 2 and 3). Therefore, the 52-70 % interface fraction was diluted to a final sucrose concentration of less than 10 % and passed through a 220 nm cut-off filter (Figure 2C). This resulted in a dense layer of SPCs on top of the filter. The SPC containing layer could be removed from the filter by forcing down distilled water through the inverted filter.

10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


51

regel 39

Chapter 3


Figure 3: SDS PAGE analysis of fractions obtained during purification of SPCs of the wild-type strain of S. commune. 1) 40-55 % sucrose interface of the first sucrose gradient. 2) 47-52 % interface of the second sucrose gradient. 3) 52-70 % interface of the second sucrose gradient. 4) 220 nm fi lter layer.


SPCs were collected as a pellet from this fraction by centrifugation at 10000 g. TEM analysis of this fraction showed a very high content of SPCs (Figure 1C) and SDS PAGE revealed four abundant protein bands (Figure 3, lane 4). These proteins had an apparent molecular weight of 10, 14, 33 and 60 kDa. N-terminal sequencing revealed that the 10 kDa protein was a truncated form of SC15. This highly secreted protein of S. commune is known to interact with the SC3 hydrophobin at the water-air interface (Wösten et al., 1993; Lugones et al., 2004). Western blot analysis of purified SPC fractions confirmed that SC15 as well as SC3 co-purified with the SPCs (not shown). The SC3 band became especially clear after treating the purified SPC samples with trifluoroacetic acid (TFA), which dissociates hydrophobin complexes, enabling the protein to enter the gel (Wösten et al., 1993). SPCs were purified from a S. commune ΔSC3ΔSC15 strain to exclude that these secreted proteins are components of the SPC. Neither the 10 kDa SC15 fragment nor the SC3 protein were detected anymore in the SPC fraction of this strain, while the SPC ultrastructure was not affected as was confirmed by TEM (not shown).


Discussion

regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37

SPCs of S. commune were purified from mycelial homogenate by combination of a treatment with 1 % Triton-X-100, two discontinuous sucrose gradients, and a filtration step over a 220 nm cut-off filter. The detergent dissociated membranous material that otherwise contaminated the SPC fraction. Addition of Triton-X-100 also increased the SPC buoyant density from 1.2295 to 1.2575 g cm-3. The latter buoyant density correlates with that of pure proteins or protein complexes. Concomitantly with this

regel 38 regel 39

52


shift in density, the shape of the pores in the SPC changed from round to hexagonal upon treatment with Triton-X-100. These findings are consistent with the idea that membranes represent the outer layers of the SPC (Girbardt, 1958, 1961; Moore & McAlear, 1962; Bracker & Butler, 1963; Marchant & Wessels, 1973; Müller et al., 1998, 2000). The data also strongly indicate that the inner part of the SPC consists of protein. The proteinaceous matrix still displays a characteristic SPC ultrastructure and thus defines the overall ultrastructure of the organelle. N-terminal sequencing and immuno-labelling revealed that the secreted SC3 and SC15 proteins (Wösten et al., 1993; Lugones et al., 2004) co-purified with the matrix of the SPCs. This came to a surprise since these proteins are secreted and known to be involved in formation of aerial hyphae and in hyphal attachment. This made us assume that the highly abundant SC3 and SC15 proteins contaminated the SPC fraction. Indeed, the ultrastructure of the SPCs was not affected in a ΔSC3ΔSC15 strain. SDS PAGE analysis of the SPCs purified from the ΔSC3ΔSC15 strain that had accumulated on top the 220 nm fi lters revealed three protein bands with apparent molecular weights of 14, 33 and 60 kDa. This shows that despite its complicated ultrastructure the SPC matrix has a low complexity protein composition.

regel 1

10 1


10 2


10 3


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


53

regel 39

Chapter 3

regel 1

References

regel 2 regel 3

Barr, D.J.S. (2001) Chytridiomycota. Pp 93-112. In The Mycota VII, Systematics and evolution, Part A.

regel 4

McLauglin, D.J., McLaughlin, E.G. & Lemke, P.A. (eds), Springer-Verlag, Berlin, Germany.

regel 5

Bauer, R., Begerow, D., Sampaio, J.P., Weiss, M. & Oberwinkler, F. (2006) The simple septate basidiomycetes: a synopsis. Mycol. Prog. 5, 41-66.

regel 6 regel 7

Benny, G.L., Humber, R.A. & Morton, J.B. (2001) Zygomycota: Zygomycetes. Pp 113-146. In The

regel 8

Mycota VII, Systematics and evolution, Part A. McLauglin, D.J., McLaughlin, E.G. & Lemke,

regel 9

P.A. (eds), Springer-Verlag, Berlin, Germany.

regel 10

Bracker, C.E. & Butler, E.E. (1963) The ultrastructure and development of septa in hyphae of Rhizoctonia solani. Mycologia 55, 35-58.

regel 11 regel 12

Bracker, C.E. & Butler, E.E. (1964) Function of the septal pore apparatus in Rhizoctonia solani during protoplasmic streaming. J. Cell. Biol. 21, 152-157.

regel 13 regel 14

Dons, J.J.M., de Vries, O.M.H. & Wessels, J.G.H. (1979) Characterization of the genome of the basidiomycete Schizophyllum commune. Biochim. Biophys. Acta 563, 100-112

regel 15 regel 16

Girbardt, M. (1958) Über die Substruktur von Polystictus versicolor L. Arch. Mikrobiol. 28, 255-269.

regel 17

Girbardt, M. (1961) Licht- und Elektronenmikroskopische Untersuchungen an Polystictus versicolor. Arch. Mikrobiol. 39, 351-359.

regel 18 regel 19

Gilloteaux, J. & Naud, J. (1979) The zinc iodine-osmium tetroxide staining of Maillet. Ca 2+-affinity subcellular sites in a tonic smooth muscle. Histochemistry 63, 227-243.

regel 20 regel 21

Gull, K. (1978) Form and function of septa in fi lamentous fungi. Pp. 78-93. In The fi lamentous fungi: developmental mycology, Vol. 3. Smith, J.E. (ed.), Edward Arnold, London, UK.

regel 22 regel 23

Jersild, R., Mishkin, S. & Niederpruem, D.J. (1967) Origin and ultrastructure of complex septa in Schizophyllum commune development. Arch. Mikrobiol. 57, 20-32.

regel 24 regel 25

Lugones, L.G., de Jong, J.F., de Vries, O.M.H., Jalving, R., Dijksterhuis J. & Wösten, H.A.B. (2004) The

regel 26

SC15 protein of Schizophyllum commune mediates formation of aerial hyphae and attachment in

regel 27

the absence of the SC3 hydrophobin. Mol. Microbiol. 53, 707-716.

regel 28


regel 29 regel 30

Marchant, R. & Wessels, J.G.H. (1974) An ultrastructural study of septal dissolution in Schizophyllum commune. Arch. Microbiol. 96, 175-182.

regel 31 regel 32

Mclaughlin, D.J., Frieders, E.M. & Lü, H. (1995) A microscopist’s view of hetero-basidiomycete phylogeny. Stud. Mycol. 38, 91-109.

regel 33 regel 34

Moore, R.T. & McAlear, J.H. (1962) Fine structures of mycota. Observations on septa of ascomycetes and basidiomycetes. Am. J. Bot. 49, 86-94.

regel 35 regel 36

Moore, R.T. & Patton, A.M. (1975) Parenthesome fine structure in Pleurotus cystidiosus and Schizophyllum commune. Mycologia 67, 1200-1205.


v

54

v


Müller, W.H., van Aelst, A.C., van der Krift, T.P. & Boekhout, T. (1994) Scanning electron microscopy

regel 1

of the septal pore cap of the basidiomycete Schizophyllum commune. Can. J. Microbiol. 40, 879-

regel 2

883. Müller, W.H., Montijn, R.C., Humbel, B.M., van Aelst, A.C., Boon, E.J., van der Krift, T.P. & Boekhout, T. (1998) Structural differences between two types of basidiomycete septal pore caps. Microbiology 144, 1721-1730. Müller, W.H., Humbel, B.M., van Aelst, A.C., van der Krift, T.P. & Boekhout, T. (1999) The perforate

10 1

Müller, W.H., Koster, A.J., Humbel, B.M., Ziese, U., Verkleij, A.J., van Aelst, A.C., van der Krift, T.P.,

10 2

Neuhof, V., Arold, N., Taube, D. & Erhardt, W. (1988) Improved staining of proteins in polyacrylamide

10 3

Patton, A.M. & Marchant, R. (1978) A mathematical analysis of dolipore /parenthesome structure in basidiomycetes. J. Gen. Microbiol. 109, 335-349.

regel 7


10 4

gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis 9, 255 − 262.

regel 6

regel 8

Montijn, R.C. & Boekhout, T. (2000) Automated electron tomography of the septal pore cap in Rhizoctonia solani. J. Struct. Biol. 131, 10-18.

regel 4 regel 5

septal pore cap of basidiomycetes. Pp. 120-127. In Plasmodesmata. Structure, function, role in cell communication. van Bel, A.J.E. & van Kesteren, W.J.P. (eds.), Springer-Verlag, Berlin, Germany.

regel 3


10 1


Schüβler, A., Schwarzott, D. & Walker, C. (2001) A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycol. Res. 105, 1413-1421. Spurr, A.R. (1969) A low-viscosity epoxy resin embedding medium for electron microscopy. J. Ultrastruct. Res. 26, 31-43. van der Valk, P. & Marchant, R. (1978) Hyphal ultrastructure in fruit-body primordia of the basidiomycetes Schizophylum commune and Coprinus cinereus. Protoplasma 95, 57-72. van Driel, K.G.A. (2007) Septal Pore Caps in Basidiomycetes; ultrastructure and composition. Thesis, Utrecht University, The Netherlands. Venable, J.H. & Coggeshall, R. (1965) A simplified lead citrate stain for use in electron microscopy. J.

10 1

regel 18

10 1

regel 21

10 1

Cell. Biol. 25, 407-408.

regel 19 regel 20


Wösten, H.A.B., de Vries, O.M.H. & Wessels, J.G.H. (1993) Interfacial self-assembly of a fungal hydrophobin into a rodlet layer. Plant Cell 5, 1567-1574

10 1

Wösten, H.A.B., Ásgeirsdóttir, S.A., Krook, J.H., Drenth, J.H.H. & Wessels, J.G.H. (1994) The fungal hydrophobin Sc3p self-assembles at the surface of aerial hyphae as a protein membrane constituting the hydrophobic rodlet layer. Eur. J. Cell Biol. 63,122-129.


10 1


10 1


55

regel 39

Chapter 4 Identification of the matrix proteins of the septal pore cap of Schizophyllum commune Arend F. van Peer, Jan Grijpstra, Wally H. Müller, Teun Boekhout, Luis G. Lugones and Han A.B. Wösten

Chapter 4

regel 1

Abstract


Hyphae of basidiomycetes are compartmentalized by perforated septa. The central pores in septa of the Agaricomycotina are generally associated with a septal pore cap (SPC). The SPC of Schizophyllum commune consists of a proteinaceous matrix that defines the SPC ultrastructure and is covered by a lipid membrane. SDS PAGE analysis of the matrix revealed three protein bands with apparent molecular weights of 14, 33 and 60 kDa. Here, it is shown that the genes encoding these proteins are unique for basidiomycetes that contain perforated SPCs. Gene SPC14 encodes the protein with the apparent molecular weight of 14 kDa. The deduced protein is 86 amino acids long and lacks known domain, signal, or localization sequences. MS-MS analysis and N-terminal sequencing showed that the 33 and 60 kDa bands are encoded by the same gene, dubbed SPC33. Expressed sequence tag (EST) analysis indicated that this gene encodes a 239 and a 340 amino acid variant. Both forms contain a predicted signal anchor, a putative RXR ER localization signal and a transmembrane region. Immuno-localization confirmed the presence of SPC14 and SPC33 in the SPC. Despite the ER localization signal, the latter protein was not localized in the ER. Over-expression of SPC14 with a C-terminal, 12-amino acid lumio tag resulted in aberrant SPC morphology. Based on these results it is concluded that SPC14 and SPC33 make up the protein matrix of the SPC of S. commune.


58


Introduction

regel 1

Hyphae of filamentous fungi grow at their apex and branch subapically. This mode of growth together with hyphal fusion (anastomosis) results in an interconnected network of hyphae that is called a mycelium. Hyphae of the lower fungi, i.e. the Glomeromycota, Zygomycota, and Chytridiomycota (Schüßler et al., 2001; Bauer et al., 2006), are sparsely, if at all, divided by septa (Barr, 2001; Benny et al., 2001). In contrast, hyphae of the Ascomycota and Basidiomycota are septated. Yet, the central pore in these septa allows streaming of cytoplasm and translocation of organelles between hyphal compartments (Gull, 1978; Bracker & Butler, 1963, 1964). During sporulation and heterokaryon incompatibility (HI) the septal pores are closed. Closing also occurs during mechanical damaging of hyphae. The septa of Basidiomycota that are grouped in the Agaricomycotina and the Ustilagomycotina have a barrel-shaped swelling around the pore, which is known as the dolipore. The dolipore of the Agaricomycotina is generally associated with a septal pore cap (SPC) (Bracker & Butler, 1963). This cap can be of the vesiculate type, the imperforate type or the perforate type (Mclaughlin et al., 1995). The SPC of Schizophyllum commune belongs to the latter type. Its perforations are approximately 100 nm in diameter and are regularly scattered over the cap (Müller et al., 1994, 1998, 1999). The SPC, which has a diameter of 450 – 600 nm, consists of a matrix that is surrounded by a membrane (Girbardt, 1958, 1961; Moore & McAlear, 1962; Bracker & Butler, 1963; Marchant & Wessels, 1973; Müller et al., 1998, 2000). At its base the SPC is connected to the endoplasmic reticulum (ER) (Girbardt, 1961; Moore & Patton, 1975; Müller et al., 1998). This and the fact that ER markers (van Driel, 2007) and zinc-iodine osmium tetroxide (Müller et al., 1998, 1999, 2000) stain the septal pore cap (region) suggest that the SPC is derived from this organelle. Recently, SPCs of S. commune were purified using 1 % Triton-X-100, two discontinuous sucrose gradients and a 220 nm cut-off filter (Chapter 3). It was shown that they consist of a proteinaceous matrix, which defines the SPC ultrastructure. SDS PAGE analysis of purified SPCs revealed three protein bands with apparent molecular weights of 14, 33 and 60 kDa. In this chapter it is shown that these proteins are indeed part of the SPC. The 14 kDa protein is encoded by the SPC14 gene, whereas the 33 and 60 kDa bands are encoded by the SPC33 gene. These genes are unique for basidiomycetes with SPCs. Over-expression of a tagged SPC14 resulted in aberrant SPC morphology, suggesting that this protein performs a structural role.

10 1


10 2


10 1


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


59

regel 39

Chapter 4

regel 1



Strains and growth conditions S. commune strains 4-40 (MATA43, MATB43, CBS 340.81) and 4-8 (FGSC # 9210 VT # H4-8) were used in this study. The latter strain was transformed with pAVP1B and pAVP4A (see below) because of the recent release of its genome sequence (4x coverage, Joint Genome Institute). An isogenic derivative of strain 4-40, in which the SC3 and SC15 genes have been deleted (Lugones et al., 2004) was used for purification of SPCs (Chapter 3). Strains were grown in the light at 25 ºC on minimal medium (MM; Dons et al., 1979) solidified with 1.5 % agar or as a liquid culture at 225 rpm. S. commune transformants were grown on MM containing 3 μg chloramphenicol and 25 μg phleomycin. Plates were inoculated with mycelial plugs, while liquid cultures were inoculated with mycelium of a 3-days-old colony that had been homogenized in 100 ml MM in a blender (Waring Products Inc., Waring Laboratory, Torrington, USA).


Transformation of S. commune Monokaryotic mycelium was grown for three days in 100 ml MM in a 250 ml Erlenmeyer flask at 250 rpm at 25 ºC. The culture was homogenized for 15 seconds in a blender (Waring Products Inc., Waring Laboratory, Torrington, USA), diluted 2x with MM (v/v) and grown for another 24 h in 100 ml MM in a 250 ml Erlenmeyer flask. Mycelium was pelleted in 50 ml Greiner tubes (Greiner Bio-One International AG, Kremsmuenster, Austria) at 4500 g for 5 min and washed with 1M MgSO4. Mycelium (3 g wet weight) was added to 10 ml filter sterilized protoplasting mixture (1 M MgSO4, 10 mM malate buffer pH 5.8, 1.5 mg ml-1 lysing enzymes [Plant Research International, Wageningen, The Netherlands]). The suspension was gently shaken (10 rpm) for 2.5 h at 30 ºC, diluted 2x with sterile water and incubated for an additional hour. Cell debris was removed by centrifugation for 2 min at 300 g. After addition of 1 volume 1 M sorbitol, the supernatant was incubated for 15 min at room temperature and sieved through glass wool to remove remnants of cell debris. Protoplasts were pelleted by centrifugation for 15 min at 2200 g and carefully resuspended in 25 ml 1 M sorbitol. After centrifugation for 10 min at 2200 g protoplasts were aliquoted in 100 μl portions in 1 M sorbitol with 50 mM CaCl2 to a final concentration of 108 protoplasts ml-1. For transformation, portions were thawed on ice and 5 μg DNA was added that was contained in 20μl TE (10 mM Tris pH 8, 3 mM EDTA). After 15 min of incubation on ice, one volume PEG 4000, buffered with 10 mM Tris pH 7, was slowly mixed with the protoplasts at room temperature and incubated for 5 min.

regel 38 regel 39

60

N


Regeneration medium (MM + 0.5 M MgSO4 + 25 μg ml-1 phleomycin) was added to a total volume of 3 ml. After overnight regeneration at 25 ºC, 7 ml MM containing 1 % low melting point agarose was added. After mixing at 37 ºC, regenerated protoplasts were spread on square plates containing 40 ml solidified MM and 25 μg ml-1 phleomycin. Plates were incubated at 30 ºC for 5 days. Isolation of genomic DNA and RNA Strains were grown on a porous polycarbonate membrane (diameter 76 mm, pore size 0.1 μm; Osmonics, GE Water Technologies, Trevose, PA, USA) on MM with 1.5 % agar for 4 days at 25 ºC. Colonies were harvested and ground in liquid nitrogen. Homogenized mycelium was lyophilized for RNA extraction. 2 mg of mycelial powder was extracted with Trizol Reagent (Gibco BRL, Life Technologies) according to the instructions of the manufacturer. For DNA isolation, 200 mg homogenized mycelium was mixed with 0.9 ml extraction buffer (2 % SDS, 24 mg ml-1 PAS [4aminosalycilic acid] and 20 % 5 x RNB [ 121.1 g l-1 Tris-HCl, 73.04 g l-1 NaCl, 95.1 g l-1 EGTA, pH 8.5]). After incubation at 65 ºC for 15 min, the mixture was subsequently extracted with 0.4 ml phenol : chloroform (1:1) and 0.5 ml chloroform. Phases were separated by centrifugation for 10 min at 14000 g. The DNA was precipitated with 0.8 volume of isopropanol and pelleted at 14000 g for 10 min. After washing overnight with 70 % ethanol, the DNA was dissolved in 300 μl TE containing 10 μg ml-1 RNAse. Northern and Southern analysis DNA and RNA hybridizations were performed according to Schuren et al. (1993). Cloning of SPC14, over-expression, lumio-tagging and d-Tomato fusion The coding sequence of SPC14 was amplified from S. commune chromosomal DNA with primers SPC14A and SPC14B (Table 1). The resulting 438 bp fragment was cloned in pGEMTeasy (Promega, Madison, Wisconsin, USA), resulting in construct pAVP1. Amplification of SPC14 cDNA was performed on a S. commune cDNA library (Lambda ZAP®-CMV XR Library, Stratagene, La Jolla, California, USA) with primers SPC14C (Table 1) and T7 (universal primer). The resulting 606 bp fragment was cloned in pGEMTeasy, resulting in construct pAVP2. For over-expression in Escherichia coli, SPC14 was amplified from cDNA with primers SPC14C and SPC14D (Table 1). The PCR product was introduced in pET11a (Novagen, Merck KgAa, Darmstadt, Germany) after cutting with NdeI and BamHI, which resulted in pAVP3.

regel 1

10 1


10 2


10 1


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


61

regel 39

Chapter 4

regel 1 regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18

The coding sequence of the enhanced lumio tag (FLNCCPGCCMEP) was designed as two compatible primers (LumioTagA and LumioTagB; Table 1) that were mixed and annealed (1 min 94 °C, 94-70 ºC, 2 ºC sec-1 and 70-20 ºC, 0.3 ºC sec-1). The double stranded tag was fused in frame at the 3’ end of the SPC14 genomic coding sequence in pAVP1 that had been cut with SacII and BamHI. This introduced a spacer of 6 AA (WRNIPA) in the resulting plasmid pAVP1A and removed the original SPC14 stop codon. The genomic coding sequence of SPC14 with the lumio tag was then introduced as an NcoI/BamHI fragment into the respective sites of the vector backbone of pGDSi3 (L.G. Lugones, unpublished results), which resulted in plasmid pAVP1B. This construct contains the fusion gene under control of the S. commune GPD promoter and the SC3 terminator and carries a phleomycin resistance gene. The SPC14 promoter was amplified by PCR using S. commune genomic DNA and primers pSPC14a and pSPC14b (Table 1). The 1918 bp fragment was ligated into pUC19 and then excised from the resulting construct pAVP4 using BsaI, generating NcoI and BamHI sticky ends. This fragment was introduced in the respective sites of vector pGDSi3-dTom (a pGDSi3 derivative with the DS-RED gene replaced by the d-Tomato gene; R.A. Ohm, unpublished). In the resulting plasmid pAVP4A the dTomato gene (Shaner et al., 2004) is placed under regulation of the SPC14 promoter.


N-terminal sequencing, MS-MS and LC-MS-MS Proteins were separated on 3-12 % gradient SDS PAA gels containing 40 mM thioglucanate (Bio-Rad Laboratories, Hercules, USA). For N-terminal sequencing (Dr J. Keen; University of Leeds), proteins were blotted onto a PVDF membrane, stained (Lugones et al., 2004), and excised. For MS-MS and LC-MS-MS (Service XS, Leiden, The Netherlands), protein bands were excised from gel after staining with Coomassie Brilliant Blue.

regel 27

regel 38

Preparation of antisera SPC14 antiserum was produced in rabbits using SPC14 protein that was expressed in E. coli. To this end, plasmid pAVP3 (see above) was introduced in E. coli BL21*. After IPTG induction, cells were sonified in cold buffer consisting of 10 mM Tris HCl pH 8.0, 3 mM EDTA, and Complete protease inhibitor (Roche, Basel, Switzerland). Inclusion bodies were pelleted by centrifugation at 4000 rpm (Optimatm TLX Ultracentrifuge, Beckman Coulter Inc., Fullerton, USA) for 10 min and dissolved in 20 mM Tris HCl pH 8.0, 100 mM glycine and 8 M urea. Proteins were separated by SDS PAGE after removing insolubles by centrifugation at 75000 rpm (TL-100, Beckman Coulter Inc., Fullerton, USA). The SPC14 band was excised from gel and injected into rabbits (Eurogentech, Seraing, Belgium).

regel 39

62

regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37

Complement of primer LumioTagA with BamHI sticky end

LumioTagB CGGATCCTCAAGGCTCCATGCAGCAGCCAGGGCAGCAGTTCAGGAAAGCCGC

Restriction with BsaI generates NcoI sticky end

Restriction with BsaI generates HindIII sticky end

Adds BamHI site at the 3’ end of SPC14

Introduces NdeI site at the start of the SPC14 coding sequence

Degenerate primer based on SPC14 sequences of C. cinereus and P. chrysosporium

Introduces an NcoI site. Changes second amino acid of SPC14 from Ser into Ala.

Complement of primer LumioTagB with SacII sticky end

GGTCTCCCATGGTTCCGTTGGATAGGT

GGTCTCAAGCTTCGAGCGAATAGAGGATG

TAGGATCCCATGCGCACCTACCAGTAGATG

AGTGATcatATGtCTGACGAAGAGATCTTG

YYACCARTADATNCKNCKYTCNAC

Primer sequence ccATGgCTGACGAAGAGATCTTG

LumioTagA AACTGCTGCCCTGGCTGCTGCATGGAGCCTTGAGGATCCGCATG

pSPC14b

pSPC14a

SPC14D

SPC14C

SPC14B

Primer SPC14A

Table 1: primers used in this study


regel 1

10 1

10 2

10 1

10 4

10 1

10 1

10 1

10 1

10 1

63 regel 2

regel 3

regel 4

regel 5

regel 6

regel 7

regel 8

regel 9

regel 10

regel 11

regel 12

regel 13

regel 14

regel 15

regel 16

regel 17

10 1 regel 18

10 1 regel 21

regel 19

regel 20

regel 22

regel 23

regel 24

regel 25

regel 26

regel 27

regel 28

regel 29

regel 30

regel 31

regel 32

regel 33

regel 34

regel 35

regel 36

regel 37

regel 38

regel 39

Chapter 4


SPC33 antiserum was produced in rabbits by Sigma Genosys (Sigma-Aldrich Co, St. Louis, MO, USA) by injecting the synthetic peptides EVVNRREHDASRRE and LKVAERERDISKRE (Figure 3B).


Immuno-blot analysis S. commune strain 4-40 was grown for 3 days in 100 ml minimal medium (MM) in a 250 ml Erlenmeyer flask. Mycelium was homogenized in a French Pressure Cell Press (American Instrument Company, Silverspring, Maryland) in three cycles at 1000 Psi (16000 cell pressure, high ratio). Proteins in the homogenate were taken up in 1/3 volume of 4 x SDS sample buffer, separated by SDS PAGE, and blotted onto a PVDF membrane. Blots were blocked for 1 h with TBS (18.5 mM Tris, 0.5 M NaCl, pH 7) containing 0.05 % Tween-20 and 5 % Protifar (Nutricia ltd, Trowbridge, UK). After washing with TBS-Tween, blots were incubated for one hour with 2000-fold diluted anti-SPC33 or 500-fold diluted anti-SPC14 serum in TBS-Tween containing 0.1 % Protifar. After washing with TBS, blots were incubated for 1 h with 10000-fold diluted goat-anti-rabbit peroxidase (Biosource, Camarillo, CA, USA) in TBS-Tween with 0.1 % protifar. Blots were stained with NBT (0.5 mg ml-1) and (BCIP 1.25 mg ml-1) (Sigma-Aldrich Co, St Louis, MO, USA) in 10 ml alkaline phosphatase buffer (0.1 M Tris, 0.1 M NaCl and 5 mM MgCL2, pH 9.5).


Chemical fixation and freeze substitution Mycelium was fi xed overnight at 4 oC in 1.5 % glutaraldehyde (Agar Scientific LTD, Essex, UK) buffered with 20 mM HEPES, pH 6.8. After post-fi xation in 1 % (w/ v) aqueous osmium tetroxide (EMS, Hatfield, PA, USA) for 60 min, samples were washed with ultra pure water twice, and gradually dehydrated in 60 % (v/v), 70 % (v/ v), 80 % (v/v), 90 % (v/v) and 100 % (two times) acetone for 30 min each. After taking up the material in acetone containing 1 % (v/v) acidified 2,2-dimethoxypropane (DMP), samples were infiltrated stepwise (each step for 2 hrs) with 25 % (v/v), 50 % (v/v), 75 % (v/v) and 100 % (two times) Spurr’s resin (Spurr, 1969). After washing with freshly prepared Spurr’s resin, samples were embedded in the resin at 65 ºC for 48 hrs in BEEM capsules (EMS, Hatfield, PA, USA). Sections were cut with a diamond knife (Diatome, Hatfield, PA, USA) using a ULTRACUT E ultramicrotome (Leica Microsystems, Vienna, Austria). Sections were picked up with formvar-coated, carbon-stabilized copper grids (hexagonal 150 mesh Veco grids, EMS, Hatfield, PA, USA). Sections were contrasted with 4 % (w/v) aqueous uranyl acetate (Merck, Darmstadt, Germany) for 10 min and 0.4 % (w/v) aqueous lead citrate (Merck, Darmstadt, Germany) for 2 min (Venable & Coggeshall, 1965).

regel 38 regel 39

64


For high pressure freezing and freeze-substitution, peripheral colony parts (2 mm diameter) were cut with an eye biopsy punch (Grieshaber, Switzerland) and put into 100 μm aluminum planchets. Planchets were closed with back-sides of 300 μm aluminum planchets and high-pressure frozen in a holder from Leica. Prior to use, plancets were coated with 10 % lecithin (Fluka, Sigma-Aldrich Co, St. Louis, MO, USA) in ethanol (w/v) to enable easy separation under liquid nitrogen. After high-pressure freezing, samples were opened under liquid nitrogen and colony parts (still attached to the 100 μm planchets) were transferred to a 2.0-ml Saf-T-seal free-standing tube (Biozyme) with substitution medium (0.3 % uranyl acetate and 0.01 % glutaraldehyde in anhydrous methanol). Tubes were placed into a CS-auto substitution apparatus (Sitte et al., 1985) at −90 °C for 48 h, after which the temperature was raised to −40 °C at a speed of 3 °C h-1. The freeze-substitution medium was exchanged for methanol and samples were infiltrated with increasing concentrations of Lowicryl mixture containing K11M : HM20 (3:1) and 0.05 % uranyl acetate (Carlemalm et al., 1982; Edelmann & Ruf, 1996). Samples were infiltrated with 25 % mixture for 2 h, 50 % for 2 h, 75 % for 15 h, 100 % for 1 h, 100 % for 72 h, 100 % for 48 h, and fresh made 100 % Lowicryl mixture for 48 h. Samples were embedded in 100 % Lowicryl mixture and polymerized with UV at −40 °C for 48 h (Carlemalm et al., 1982) and 1 day of curing under UV at room temperature. Ultrathin sections were blocked for 5 min in 5 % foetal calf serum (PAA laboratories GmbH, Pasching, Austria) in PBS, washed with 1 % BSA-C in PBS, and labeled with anti-SPC33 antibodies (1:250), anti-SPC14 antibodies (1:500) and protein A-10 nm gold (1:55) (Department of Cell Biology, UMC, Utrecht, The Netherlands) in PBS containing 1 % BSA-C. Samples were washed with PBS containing 0.1 % BSA-C in between the incubation steps. The gold-labeled sections were post-fi xed with 1 % glutaraldehyde in PBS for 3 min and post-stained for 5 min with aqueous 4 % uranyl acetate (Merck & Co., Inc., Whitehouse Station, NJ, USA) and 30 sec with 0.4 % lead citrate (Merck & Co., Inc.) (Venable & Coggeshall, 1965). Transmission electron microscopy Samples were analyzed with a Technai 10 (FEI Company, Hillsboro, OR, USA) electron microscope at an acceleration voltage of 100 kV.

regel 1

10 1


10 2


10 1


10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


65

regel 39

Chapter 4

regel 1

Results


Figure 1: Contig S5C1XXD06938 of the Utrecht University S. commune genomic database contains the coding sequence of the N-terminal part of SPC14. Amino acids retrieved from sequencing are boxed.


Identification of SPC14 and SPC33 SDS PAGE of purified SPCs of S. commune revealed three protein bands with apparent molecular weights of 14, 33 and 60 kDa (Chapter 3). The first two amino acids of the 14 kDa protein could not be identified by N-terminal sequencing. However, amino acids 3 to 15 revealed the sequence E/DEEILLGIIVSVNHG. Amino acids 8-15 matched with the 3’ end of the 705 bp contig S5C1XXD06938 (Figure 1) of the Utrecht University (UU) S. commune genomic database, which represents about 40 % of the genomic sequence of strain 4-40. The codons for amino acids 1-7 could also be identified on this contig assuming an intron preceding the 8th codon. Moreover, the contig contains the codons for amino acids 16-34, which are followed by a second putative intron. The partial deduced amino acid sequence of SPC14 was blasted against the genomes of Coprinopsis cinereus (NCBI fungal genomes) and Phanerochaete chrysosporium (JGI whiterot v1.0). The homologues found in these genomes were highly conserved, which enabled design of a degenerate, reverse primer to identify the 3’ end of the S. commune SPC14 coding sequence. A 438 bp fragment was amplified from genomic DNA of S. commune using this primer (SPC14B) and a primer annealing to the 5’ end of SPC14 (SPC14A). The sequence of this fragment complemented the SPC14 sequence of S5C1XXD06938 (Figure 2A). The open reading frame that encodes an 86 amino acid protein and the positions of 3 introns were confirmed by sequencing a 606 bp cDNA of S. commune (Figure 2A). The SPC14 genes of the three basidiomycetes share 65-72 % identity in coding sequence and consequently show high amino acid identity (Figure 2B). All three genes lack known

regel 38 regel 39

66


A 1 81 151 221 291 361

atgtctgacg aagagatctt ggtgcgtcgg M S D E E I L [-------tcgccgccag ctcggggaca tcgtctctgt ---------] L G D I V S V ggttcccaca tcgactacct cgtgagtggc G S H I D Y L [-------cagggtcgcc aaatcgtcga ggtccagctc --]G R Q I V E V Q L cgttgtcatg tacttctcac tgaccgcaac ---------- -INTRON 3- ---------cgccgtccag cgccccgcca tgctcccccc A V Q R P A M L P P

421 tag AYY

regel 1

ctgcgcaatt ttttcgcggg cgggagcgag gacgctgacc ---------- -INTRON 1- ---------- ---------caaccacggc ttctctggcc gcaaggaggg cctcgtcatc N H G F S G R K E G L V I ccgtgcgcgg cgacctcgtt ccctcgctta cctccctccc ---------- -INTRON 2- ---------- ---------gagcctggcg aagtgtacca cgcctggtgc gcagcctcgt E P G E V Y H A W [-------------cgaacaggta ccccaccgtg acgcgcgtca agcgcacgat ------] Y P T V T R V K R T I tgcccggagc caccgcacgg tagagcgccg catttactgg A R S H R T V E R R I Y W CANCTYKCNKCNTADATRACC SPC14B primer

10 1


10 2


10 1

B Sc Pc Pp Cc Lb

1 1 1 1 1

M-S------MSS------MSS------MSSITTTTYT MES-------

-DEEILLGD-DEAILPGD-DE-IIPGDTEEYIAPGD--STILDNDS

--IVSVNHGF --IVAVQHGH --IVAVQNGV --IVAVRHGL ITIVAVRHGL

SGRKEGLVIG YGRKEGLVVG SGRREGLVIG KGRQEGLVVG KGRQEGLVIG

Sc Pc Pp Cc Lb

46 47 47 56 48

VYHAWYPTVT IYHAWYPTVT IYNAWYPTVT IYNAWYPTVT VYHAWYPTVT

RVKRTIAVQR RVRRTTYYNRVKRTISYTR RVKRTI-YTR RVKRTV-YTR

PAMLPPARSH P----APHKV P-----QHKQ P----LETRR PGI---TSGR

RTVERRIYW* RTVERRIYW* RTVERFIYW* RTVERRIYW* RTIERRIYW*

SHIDYLGRQI SHVDYAGRQV SHVDYAGRQI SHYDYAGRQI SHIDYAGRQI

VEVQLEPGE-LEVQLEPGE-LEVQMEPGE-IEVQLD-GEPV IEVQLD-SE--


10 4


10 1


Figure 2: Coding sequence of SPC14 of S. commune (A) and deduced amino acid (B) sequences of SPC14 of S. commune (Sc), P. chrysosporium (Pc), P. placenta (Pp), C. cinereus (Cc) and L. bicolor (Lb) and the sequence of the SPC14B primer which was used to pick up the 3’end of S. commune SPC14. Underlined sequence in S. commune (A) represents contig S5C1XXD06938. Sequences are highly conserved as indicated by shaded areas (≥80 % identity).

domain, signal, or localization sequences. BLAST search identified homologues in Amanita bisporigera, Laccaria bicolor, Postia placenta, Paxillus involutus and Pisolithus tinctorius. These basidiomycetes belong to the Agaricomycotina and are known to possess a perforated SPC. The SPC14 gene was not found outside the Agaricomycotina. What is more, fungi within the Agaricomycotina that do not have a SPC (e.g. Cryptococcus neoformans) do not contain an SPC14 homologue. Northern analysis showed that SPC14 is expressed in all stages of monokaryotic and dikaryotic mycelium (data not shown). Massive parallel signature sequencing (MPSS) showed a distribution of 215 transcripts per million (tpm) in monokaryon, 850 tpm in stage I aggregates, 580 tpm in stage II aggregates and 312 tpm in mushrooms (J.F. de Jong and R.A. Ohm, unpublished data). Construct pAVP4A, which encompasses the d-Tomato reporter gene under regulation of the SPC14 promoter, was introduced in S. commune to assess the spatial expression of the gene. Fluorescence microscopy revealed that all hyphae were fluorescent, showing that the gene is expressed throughout the mycelium (data not shown).

10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


67

regel 39

Chapter 4


Table 2: LC-MS-MS peptide sequences obtained from mass-peaks identified in both the 33 and 60 kDa protein bands and the corresponding sequences deduced from the SPC33 gene. LC MS MS peptide sequences

SPC33 sequence

Peak 1

SWITEQLR

L/I D L/I TEQ L/I L/I

Peak2

TPPXXVSP

TPPGWHSP

Peak3

EY L/I HEYFYEESEQ

VEEEYFYEP

regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27

The N-terminal sequences from the 33 kDa (MHPSTSHHT) and 60 kDa (MGPST) protein bands from purified SPCs of S. commune were quite similar. However, the sequences were too short to identify the encoding genes in the UU S. commune genomic database. Therefore, MS-MS fingerprinting was performed after tryptic ingel digestion. Both bands generated a similar mass fingerprint (data not shown), indicating that these bands contain the same protein, that was called SPC33. Three major peaks that were common in both mass-fingerprints were selected for LCMS-MS analysis. The peptide sequences (Table 2) matched with a region on contig SC_1000006 (JGI genomic database based on a 4x coverage sequence). By aligning expressed sequence tags (ESTs) contained in the JGI database with this region we could identify the complete SPC33 gene. Interestingly, two transcripts of SPC33 were found. These forms encode a 239 and a 340 amino acid variant. MPSS analysis showed that both mRNAs are formed throughout the life cycle of S. commune; 14/10/18/1 and 35/52/24/41 tpm, respectively, in monokaryotic mycelium, stage I aggregates, stage II aggregates and mature mushrooms. The first 228 amino acids of the two SPC33 variants are identical. These parts contain a putative ER localization signal RXR (Gassman et al., 2005; Margeta-Mitrovic et al., 2000; Pagano et al., 2001) preceding the h-region of a predicted signal anchor (SignalP 3.0, Nielsen et al., 1997; Bendtsen et al., 2004) and an additional predicted transmembrane domain (Mobyle, TopPred program, von Heijne, 1992; Claros and von Heijne, 1994) (Figure 3B).


68

Identification of the matrix proteins of the septal pore cap of Schizophyllum commune A

regel 1

1 71 141 211 281 351 421 491 561

631 701

atggcccacc cttccacatc M A H P S T S accaccatcg caccatctcg H H R T I S catgctctct ttgccgggcg M L S L P G G accagcgtcc tgagctacct T S V L S Y L agcgtgaggc agaggttgcc R E A E V A ggcctgcgca ccttgcgtgc A C A P C V P gaggtcatca aagaggactc E V I K E D S gtgaactcaa ggtcgccgag E L K V A E cgatgcttcc cgtcgcgaga D A S R R E S

ccaccacagt H H S tcgacgactc S T T L gcagctcacc S S P caacccgaag N P K cgccgcgagg R R E A cgacgaccgt T T V gctcacccca L T P cgcgagaggg R E R D gctggatcac W I T

gaccgacacc ggtcgcgcga D R H R S R E tcctcctcgt cctctctctc L L V L S L actcactggt ggtggcgcta L T G G G A T cgtgctcagc agctcatcgc R A Q Q L I A cggagctcct cgtcggtgcc E L L V G A gtacgagacc gttcccctcc Y E T V P L P cctggctggc atagcccgcg P G W H S P R acatttccaa gcgtgaggag I S K R E E agagcaactc atgtacgtaa E Q L [-------

gcgctcctcg cactcccacc R S S H S H H atccttgcgg tcctggccgt I L A V L A V ccggcgaaga aaagcaaacg G E E K Q T ccgcgagcac actgtcgctc R E H T V A Q cccggtggtg ttgttcctca P G G V V P Q cggcgcagac cgtggtcaag A Q T V V K catcgacgac atcatcgacc I D D I I D R gttgtcaacc gtcgggaaca V V N R R E H gcttcccaca ctcatacttc ---------- INTRON 1---

cacgcgtctg atggtctttt cagtcgtctc gggaacgctg gcgagcccgc ggagaccgtc ---------- ---------- --] R L G N A G E P A E T V acttctatga gccgcagggc aagcggagac ccaaggtagc gccaccactc cagcgccgtt F Y E P Q G K R R P K [---- ---------- ---------V A P P L Q R R S

---------771 agacgagggg 841 gtccgggctt 911 ataccacgcg 981 taacgctgtc 1051 tttgaggagc

10 1

---------gtcaatgaac acggtgtctt gcgtgaccgc gtgatttgtg cttttctcct

-INTRON 2tccagtccgt tcgcttctat gttccgcgga accgacgcgt tcctccctcg

---------aaactcccat tgtccccctc agcattagat ctgcgactga tcatctttgc

---------tgcgttactc gtcccctcgc cgcggagtcc cggcccgtcg aacgttgtac

---------gcctccctca tcctctacag gatcgcgttg gcgcgtggtg tgactgcttc

1121 tccagattat ccagcagcag ----] I I Q Q Q 1191 gtatcagacc gtaaccgcca Y Q T V T A T 1261 gccttccccg cccccgaatc A F P A P E S 1331 tcatccacga ggagtacaca I H E E Y T 1401 cgttccccct acccgcggac V P P T R G R

gttcaacatg V Q H ccgccaccca A T Q accggtgcaa P V Q catcatcccg H H P E gcgcaccacc A P P

aacttccacc E L P P gaccgtcact T V T atgcagaccg M Q T G aggacgaagt D E V ctcgcgccct S R P

accagtcgtc P V V cttccgccgc L P P P gttctgcacc S A P catcgaggag I E E ccccagcgct P Q R W

gtatcggaga V S E T ccgctggcac A G T caagaccacc K T T gaggaggagt E E E Y ggtggggcga W G E

ccgagattca E I Q ccgcaaagtc R K V agtgtcgaca S V D I actatgctgc Y A A gtaa -


10 2


10 1

gaggaagagt E E E Y cagagctttg ---------E L -

---------ggtacgcgat gggggacttt tcgcgacagg ccgcctgctc tgccatattt

regel 2


10 4


10 1


f Figure 3: A) Coding sequence (shaded) and introns (light) of SPC33 of S. commune and deduced amino acids of the long and short SPC33 variants. Short SPC33 continues 12 amino acids in 2nd intron (underlined). Long variant stops at base pair 735 preceding the 2nd intron and continues after the 2nd intron.

10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


69

regel 39

Chapter 4 B


1

3

1

2

Sc Pc Pp Cc Lb

1 1 1 1 1

MA--HPSTSH MA--QPS-SS MA--QPS-SS MA--GQSSSH MAGGQPSSSH

HSDR----HR HRDR----DR HRER----ER HDERRHRSDR HGERHHRSD-

SRERS--SHS ERERSERSSR ERERS--SSS DRER---SSS -RER-----S

HHHHRTISST HHHHRTISST RRSRRTISST RHHSRTVSST HHHNRTISST

TLLLVLSLIL TLLLVLSLVL TLLLVLSLVL TLLLVLSLIL TLLLVLSLVL

AVLAVMLSLP AVLAVMLTLP AVLAVMLSLP AVLAVMLSLP AVLAVMLSLP

Sc Pc Pp Cc Lb

53 54 52 56 54

GGSSPLTGGG NSQAVTGTPA STQAGRNPAA SG--GGGGAS SNNSTSNSE-

ATGEEKQTTS ADGTQPQ--AIPSEPGANP AGAGSGGENA---------

-----VLSYL ----GVWGIL ADNGGLLGYL ---AGVLGYL -SSSGVLGYL

NPKRAQQLIA TPKRSQALVA SPKRTQALLA TPKRNQALIA TPKRTQALIA

REHTVAQREA RESDVAKREA RESNIAVREA RESAVAVREA RESAVAVREA

EVARREAELL EVARREAEIL EVARREAEIL EVARREAELL EVARREAELL

Sc Pc Pp Cc Lb

108 107 112 110 103

VGAPGGVV-ANAPGGIVQT AGAPGG-VIA IGAPGG-VIP AGAPGGVV--

---PQACAPC PQ----CPPC NQAPVVCPVC TPAPGSVAVC --PSSTPILC

VPTTVYETVP QPIIEKVTEA PTVVEKVTEPPCIQATTIE PPCAVTTTVE

L---PAQTVV LPPPPVQTVI -PPPPIQTVI TVTGPVQTVI TITGPIQTII

KEVIKEDSLT KEVIKEESLT KEVVKEESLT KEIVKEDSLT KEIVKEDSLA

PPGWHSP--PPGWWDQARI PPGWWDQARI PPGW--QAPPPGW---TGP

Sc Pc Pp Cc Lb

157 163 169 166 156

RIDDIIDREL RAEDILDREL RAEDILDREL RIEDIIEREL RAEEILEREL

KVAERERDIS KIAEREREIS KIAEREREIS KIAEREREIS KIVERERDIS

KREEVVNRRE RREEAVNRRE RREEQVNRRE KREEQVNRRE KREENVNRRE

HDASRRESWI HDASRRENWI HDASRRESWI HDASRRESWI HDASRRESWI

TEQLIRLGNA MEQLVAL-NA MEQLMAL-ND MEQLYALGNE MEQLIALGND

GEPAETVEEE DEPT--VEEE DQPA--LEEE V-PQS-VEEE S-PQT-VEEE

Sc Pc Pp Cc Lb

217 220 227 224 214

YFY---E--P EFTYDMPPPP YVY---EPAP YVY---EQQP YVY---EPAG

QGKRRPK--GHKRKPK--PPRRNPK--PVKRHVKAAK –TKRKSK---

i i i i i

Sc Pc Pp Cc Lb

228 236 240 240 227

IIQQQVQHEL --------VP ---VPLFDAL ---QMQYQEL ------YKEL

PPPVVVSETE PPTVTY---PPPLIVTETA PPHVI----PPIVV-----

IQYQTVTATA ----TEHHTE YEMATEVRTV EEMAYGGPPQ SE----YDTK

T--------Q TLPLKT---THTQRYTVPT PVQT----KV TVIQ----TQ

TVTLPPPAGT -VTVPAPANT EVIAPPPAST IVDGPAPAST TVTLVPPANT

Sc Pc Pp Cc Lb

271 266 287 279 258

RKVAFPAPES RMVASPAPEV RRAATPTPQM RPAPFPTPEA RLAAFPTPEA

PVQMQTGSAKRQSS-TPSI LSRSSSTTHI AS-HSATEAS AS-SSSTPAS

PKTTSVDIIH PRTTSVERVI PRTTAVEVIT PRTTAVEIVR PRTTAVEIYT

EEYTHHPEDE EEVVEAPAPV EE---PVIPEE---APP-EE---EDGR-

VIEEEEEYYA VEEVEEEEEQ ---EPEEETV ---KP----K ---KP----K

Sc Pc Pp Cc Lb

320 315 330 316 296

AVPPTRGRAP A--YVRVPRP A--IVRKPRP P--ILRGPPP T--VVRG-PR

PSRPPQRWWG RRT-PNSWFG RMPAPARWW* R--APMRPHG R--PPTRWFG

E*W*--GW* GW*

4


4


5


6

7


VAPPL----Q VPPPV----VPPPPPPYPQ VPPP----TP VPPP----SP

RRSEL* RRSEL* RRSEL* RRSEL* RRSEL*

C


regel 38

Figure 3: B) Amino acid sequence of the identical part of the SPC33 variants of S. commune (Sc), P. chrysosporium (Pc), P. placenta (Pp), C. cinereus (Cc) and L. bicolor (Lb). The S. commune variants contain a putative ER targeting signal (3) in the predicted signal anchor with an n-region (1, AA 1-31), and a transmembrane h-region (2, AA 32-51). A second predicted transmembrane region (4) resisdes at amino acids 106-128. Dark grey shaded sequences (5 and 6) represent the synthetic peptides that were used to raise SPC33 antiserum. 2nd intron containing alternatively spliced short SPC33 amino acid sequences is marked by box 7. C) Amino acid sequence of the large SPC33 variants of S. commune (Sc), P. chrysosporium (Pc), P. placenta (Pp), C. cinereus (Cc) and L. bicolor (Lb). Sequences directly continue after the identical SPC33 parts in B preceding the 2nd intron (box7) Light shaded amino acids indicate highly conserved residues (≥80 % identity).

regel 39

70


v


regel 1

10 1


10 2


10 1


10 4


Figure 4: Immuno-localization of SPC33 (A, B) and SPC14 (C, D) in hyphae of S. commune. Hyphae were incubated with immune-serum (A, C) or pre-immune serum (B, D). Bars represent 500nm.

Also many putative phosphorylation sites are predicted (NetPhos Server 2.0, Blom et al., 1999). These data suggest localization to the ER. The alternative splicing of the second intron (389bp) results in different C-terminal sequences. The RNA including the second intron is terminated within this sequence after 11 amino acids (Figure 3B). The RNA with exised intron is terminated in the 113th codon of the third exon. The peptides from the 33 and 60 kDa protein bands that were analysed by LC-MSMS were from the part of SPC33 that is shared by both variants. Therefore, we do not know yet which variant is produced. BLAST search identified SPC33 homologues only in fungi that possess an SPC (C. cinereus, P. chrysosporium, L. bicolor, P. placenta and Armillaria sp.). Both SPC33 variants can be found in those homologues and show an amino acid identity of ≥65 % (Figure 3C). Immuno-localization of SPC33 and SPC14 and EM analysis of hyphae expressing a SPC14-lumio tag fusion Anti-SPC33 serum reacted with 33 and 60 kDa protein bands in S. commune wt lysates (data not shown), showing its specificity for SPC33. Immuno-gold labeling showed the presence of SPC33 within the SPC (Figure 4A) but not in the ER, not even close to the SPC base.

10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


71

regel 39

Chapter 4


Figure 5: Part of the SPCs in transformants expressing the SPC14-lumio tag fusion protein have an aberrant morphology as observed by chemical fi xation (A, B) and freeze substitution (C, D). Chemically fi xed pSPC14-d-Tomato served as a control (E, F). Bars represent 500 nm.


The recombinant SPC14 protein produced in E. coli could be detected with the antiSPC14 serum by Western blotting. However, SPC14 from an S. commune lysate or from purified SPCs could not be detected (data not shown). The antiserum did react with SPCs after freeze substitution of mycelium and embedding in lowicryl HM20 (Figure 4C). Labeling of the cell walls and septa can be considered a-specific as indicated by the labeling of these organelles with the pre-immune serum (Figure 4D). S. commune strain 4-40 was transformed with construct pAVP4A and pAVP1B. These constructs encompass a fusion of the SPC14 promoter with d-Tomato and the SPC14 gene with a lumio-tag under regulation of the GPD promoter. Integration of the vectors in the genome was confirmed by Southern analysis (not shown). pSPC14d-Tomato was not expressed in specific parts of hyphae. Fluorescence was observed throughout the hyphae (data not shown). Fluorescent detection of the SPC14-lumio

regel 38 regel 39

72


protein with ReAsH was unsuccessful in hyphae of S. commune, irrespective of the concentration of the substrate or washing and incubation conditions. Interestingly, electron microscopy analyses of SPC14-lumio expressing strains showed an aberrant morphology of part of the SPCs (Figure 5). The aberrant forms did not show the typical regular and sharp boundaries of SPCs, as represented in pSPC14-d-Tomato expressing strains, and occasionally they were attached to patches of electron dense material. These results indicate that SPC14-lumio disturbs formation of the SPC ultrastructure.

regel 1

10 1


10 2


10 1 Discussion


SDS PAGE analysis of the purified SPC matrix revealed three protein bands with apparent molecular weights of 14, 33 and 60 kDa. In this chapter, the constitutively expressed SPC14 and SPC33 genes are described that encode the 14 and both the 33 and 60 kDa protein bands, respectively. The SPC33 protein is predicted to be localized to the ER, which supports previous studies that indicate that the SPC is part of the ER, or is derived from this organelle (Girbardt, 1958, 1961; Moore & McAlear, 1962; Bracker & Butler, 1963; Marchant & Wessels, 1973; Müller et al., 1998, 1999, 2000; Chapter 3; van Driel, 2007). SPC14 and SPC33 are unique for basidiomycetes that contain SPCs. It should be noted that only genomes have been sequenced from species with perforated SPCs. It would be very interesting to establish whether taxa with imperforate and vessiculate SPCs also contain SPC14 and SPC33 like genes. SPC14 encodes a protein of 86 amino acids, which does not have any known domain, signal, or localization sequence. From this we postulate that the protein is integrated in the SPC matrix from the cytosol. MPSS and EST analysis showed that SPC33 mRNA is alternatively spliced in S. commune. As a result, it encodes a 239 and a 340 amino acid variant which share 228 amino acids at their N-termini. Unfortunately, it was not revealed which of the forms is produced. SPC33 homologues in P. placenta, P. chrysosporium, L. bicolor and C. cinerea also encode the two protein variants resulting from alternative splicing. This and the high conservation of these forms between species, suggest production of both variants. The identical parts of the SPC33 variants are predicted to contain a signal anchor, that is, an N-terminal signal peptide without a cleavage site. A putative ER retention or localization signal (RER, amino acids 16-18) precedes the predicted membrane spanning h-region of the signal anchor. Functional RXR motives have been found at various, internal positions in proteins (Zerangue et al., 1999, Scott et

10 4


10 1


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


73

regel 39

Chapter 4


al., 2001). They seem to mediate complex regulatory processes that enable specific forward trafficking of proteins from ER to other places (Scott et al., 2003). It would be tempting to speculate that the RXR sequence enables translocation of SPC33 from “general” ER towards the specific SPC domain. A second transmembrane domain is predicted approximately 50 amino acids downstream of the signal anchor. This would imply that part of the SPC33 protein will be present in the cytoplasm whereas the other part is located in the ER lumen. Enhanced lumio tags have been used to localize proteins in mammalian cells. The advantage is that only 12 amino acids (and in our case an additional 6 amino acid spacer) are fused to the protein. This short peptide less likely interferes with protein function and localization compared to larger reporters like GFP and d-Tomato. At least localization was indicated from the fact that strains expressing the SPC14lumio-tag fusion protein showed aberrant SPCs. The aberrant forms lacked the regular, sharp boundaries of this organelle and were occasionally attached to patches of electron dense material. Possibly, the fusion protein interferes with the normal assembly of the SPC. Immuno-localization confirmed the presence of SPC14 and SPC33 in the SPC of S. commune. Notably, SPC33 was not localized in ER in general despite its ER retention signal (for an explanation, see above). Taken together, it is concluded that SPC33 and SPC14 form the matrix of the SPCs of S. commune and probably of other basidiomycetes as well. Future studies should reveal how the SPC is assembled and what its function is.


74


References

regel 1

Barr, D.J.S. (2001) Chytridiomycota. Pp 93-112. In The Mycota VII, Systematics and evolution, Part A. McLauglin, D.J., McLaughlin, E.G. & Lemke, P.A. (eds), Springer-Verlag, Berlin, Germany. Bauer, R., Begerow, D., Sampaio, J.P., Weiss, M. & Oberwinkler, F. (2006) The simple septate basidiomycetes: a synopsis. Mycol. Prog. 5, 41-66. Bendtsen, J.D., Nielsen, H., von Heijne, G. & Søren Brunak, S. (2004) Improved prediction of signal

10 1


10 2

peptides: SignalP 3.0. J. Mol. Biol. 340, 783-795.


Benny, G.L., Humber, R.A. & Morton, J.B. (2001) Zygomycota: Zygomycetes. Pp 113- 146. In The Mycota VII, Systematics and evolution, Part A. McLauglin, D.J., McLaughlin, E.G. & Lemke,

10 1



Blom, N., Gammeltoft , S. & Brunak, S. (1999) Sequence- and structure-based prediction of eukaryotic protein phosphorylation sites. J. Mol.Biol. 294, 1351-1362.

10 4

Bracker, C.E. & Butler, E.E. (1963) The ultrastructure and development of septa in hyphae of Rhizoctonia solani. Mycologia 55, 35-58. Bracker, C.E. & Butler, E.E. (1964) Function of the septal pore apparatus in Rhizoctonia solani during protoplasmic streaming. J. Cell. Biol. 21, 152-157.


10 1


Carlemalm, E., Garavito, R.M. & Villiger, W. (1982) Resin development for electron microscopy and an analysis of embedding at low temperature. J. Microsc. 126, 123-143. Claros, M.G. & von Heijne, G. (1994) TopPred II: An Improved Soft ware For Membrane Protein Structure Predictions. CABIOS 10, 685-686. Dons, J.J.M., de Vries, O.M.H. & Wessels, J.G.H. (1979) Characterization of the genome of the basidiomycete Schizophyllum commune. Biochim. Biophys. Acta 563, 100-112. Edelmann, L. & Ruf, K. (1996) Freeze-dried human leukocytes stabilized with uranyl acetate during low temperature embedding or with OsO4 vapor after embedding. Pp. 295-307. In Scanning Microscopy Supplement 10, Scanning Microscopy International, Chicago (AMF O’Hare), IL

10 1

regel 18

10 1

regel 21

10 1

60666 USA.

regel 19 regel 20


Gassmann, M., Haller, C., Stoll, Y., Aziz, S.A., Biermann, B., Mosbacher, J., Kaupmann, K. & Bettler, B. (2005) The RXR-Type Endoplasmic Reticulum-Retention/Retrieval Signal of GABAB1 Requires

10 1

Distant Spacing from the Membrane to Function. Mol. Pharmacol. 68, 137-144.


Girbardt, M. (1958) Über die Substruktur von Polystictus versicolor L. Arch. Mikrobiol. 28, 255-269. Girbardt, M. (1961) Licht- und Elektronenmikroskopische Untersuchungen an Polystictus versicolor.

10 1

Arch. Mikrobiol. 39, 351-359.



10 1


75

regel 39

Chapter 4

regel 1

Lugones, L.G., de Jong, J.F., de Vries, O.M.H., Jalving, R., Dijksterhuis J. & Wösten, H.A.B. (2004) The

regel 2


regel 3


regel 4


regel 5 regel 6

Margeta-Mitrovic, M., Jan, Y.N. & Jan, L.Y. (2000) A Trafficking Checkpoint Controls GABAB Receptor Heterodimerization. Neuron 27, 97-106.

regel 7 regel 8

Mclaughlin, D.J., Frieders, E.M. & Lü, H. (1995) A microscopist’s view of hetero-basidiomycete phylogeny. Stud. Mycol. 38, 91-109.

regel 9 regel 10


regel 11 regel 12

Moore, R.T. & Patton, A.M. (1975) Parenthesome fine structure in Pleurotus cystidiosus and Schizophyllum commune. Mycologia 67, 1200-1205.

regel 13 regel 14

Müller, W.H., van Aelst, A.C., van der Krift, T.P. & Boekhout, T. (1994) Scanning electron microscopy

regel 15

of the septal pore cap of the basidiomycete Schizophyllum commune. Can. J. Microbiol. 40, 879-

v

883.

regel 16 regel 17

Müller, W.H., Montijn, R.C., Humbel, B.M., van Aelst, A.C., Boon, E.J., van der Krift, T.P. &

regel 18

Boekhout, T. (1998) Structural differences between two types of basidiomycete septal pore caps.

regel 19


regel 20

Müller, W.H., Humbel, B.M., van Aelst, A.C., van der Krift, T.P. & Boekhout, T. (1999) The perforate

regel 21

septal pore cap of basidiomycetes. Pp. 120-127. In Plasmodesmata. Structure, function, role in cell

regel 22

communication. van Bel, A.J.E. & van Kesteren, W.J.P. (eds.), Springer-Verlag, Berlin, Germany.

regel 23


regel 24

Montijn, R.C. & Boekhout, T. (2000) Automated electron tomography of the septal pore cap in

regel 25

Rhizoctonia solani. J. Struct. Biol. 131, 10-18.

regel 26

Nielsen, H., Engelbrecht, J., Brunak, S. & von Heijne, G. (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering. 10, 1-6.

regel 27 regel 28

Pagano, A., Rovelli, G., Mosbacher, J., Lohmann, T., Duthey, B., Stauffer, D., Ristig, D., Schuler,

regel 29

V., Meigel, I., Lampert, C., et al. (2001) C-Terminal interaction is essential for surface trafficking

regel 30

but not for heteromeric assembly of GABAB receptors. J. Neurosci. 21, 1189-1202

regel 31

Schuren, F.H.J., Harmsen, M.C. & Wessels, J.G.H. (1993) A homologous gene-reporter system for

regel 32

the basidiomycete Schizophyllum commune based on internally deleted homologous genes. Mol.

regel 33

Gen. Genet. 238, 91-96.

regel 34

Schüβler, A., Schwarzott, D. & Walker, C. (2001) A new fungal phylum, the phylogeny and evolution. Mycol. Res. 105, 1413-1421.


76

Glomeromycota:

v


Scott, D.B., Blanpied, T.A., Swanson, G.T., Zhang, C. & Ehlers, M.D. (2001) An NMDA receptor ER

regel 1

retention signal regulated by phosphorylation and alternative splicing. J. Neuroscience 21, 3063-

regel 2

3072. Scott, D.B., Blanpied, T.A. & Ehlers, M.D. (2003) Coordinated PKA and PKC phosphorylation suppresses RXR-mediated ER retention and regulates the surface delivery of NMDA receptors. Neuropharmacology 45, 755-767. Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans, B.N.G., Palmer, A.E. & Tsien, R.Y. (2004)

10 1

Sitte, H., Neumann, K. & Edelmann, L. (1985) Cryofi xation and cryosubstitution for routine work in

10 2

Ill.

10 1

van Driel, K.G.A. (2007) Septal Pore Caps in Basidiomycetes; ultrastructure and composition. Thesis, Utrecht University, The Netherlands.

regel 7


10 4

Spurr, A.R. (1969) A low-viscosity epoxy resin embedding medium for electron microscopy. J. Ultrastruct. Res. 26, 31-43.

regel 6

regel 8

transmission electron microscopy. Pp. 103-108. In Science of biological specimen preparation. Müller, M., Becker, R.P., Boyde, A. &. Wolosewick, J. J. (eds.), SEM Inc., AMF O’Hare, Chicago,

regel 4 regel 5

Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol. 22, 1567-1572.

regel 3


10 1


Venable, J.H. & Coggeshall, R. (1965) A simplified lead citrate stain for use in electron microscopy. J. Cell Biol. 25, 407-408. von Heijne, G. (1992) Membrane Protein Structure Prediction: Hydrophobicity Analysis and the ‘Positive Inside’ Rule. J. Mol. Biol. 225, 487-494. Zerangue, N., Schwappach, B., Jan, Y.N. & Jan L.Y. (1999) A new ER trafficking signal regulates the subunit stoichiometry of plasma membrane K ATP channels. Neuron. 22, 537-548.

10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


77

regel 39

Chapter 5 Septa of Schizophyllum commune close reversibly upon exposure to stress Arend F. van Peer, Luis Lugones, Wally H. Müller, Han A.B. Wösten

Chapter 5

regel 1

Abstract


The complex septa of Agaricomycotina of the fungal phylum of the Basidiomycetes are characterized by a rim around their central pore. This so called dolipore, is covered by a septal pore cap (SPC) on both sides. This pore is closed, for instance upon hyphal damage to prevent leakage of cytoplasm, but it is assumed that it is normally open to allow cytoplasmic streaming. The cytoplasm within the mycelium is thus considered to be a continuous system. Here, it is shown by laser dissection that the majority of the septa are in fact closed in vegetative mycelium of Schizophyllum commune. It is also shown that septa that are open plug not only upon hyphal damage, but also when exposed to high temperature, osmotic stress and toxic agents. Plugging, which was shown to be a reversible process, was not induced by hypotonic conditions and cold. It has been suggested that SPCs function in plugging of septal pores. As we previously identified the SPC14 and SPC33 proteins that make up the matrix of this structure we tried to determine their function herein. However, the genes encoding these proteins could neither be inactivated by RNAi, nor be deleted through homologous recombination. This indicates that the SPC14 and SPC33 proteins are essential. Taken together, it is concluded that the septa of S. commune are dynamic structures that plug when exposed to stress. The role of the SPCs in plugging remains to be established.


80

v


Introduction

regel 1

A fungal mycelium is the result of fusing hyphae that grow at their apices and branch subapically. Depending on the fungal phylum, hyphae are compartmentalized by cross-walls known as septa. The hyphae of the lower fungi, i.e. the Glomeromycota, Zygomycota, and Chytridiomycota (Schüßler et al., 2001; Bauer et al., 2006), are sparsely septated (Barr, 2001; Benny et al., 2001). In contrast, those of the filamentous Ascomycota and Basidiomycota are regularly septated. Their septa contain central pores that allow streaming of cytoplasm (Bracker & Butler, 1963, 1964; Gull, 1978; van Driel et al., 2007). Therefore, the cytoplasm within mycelia is considered to be a continuous system. The septa of ascomycetes consist of cross-walls with a simple, central pore. These pores allow streaming of cytosol and of organelles such as mitochondria and nuclei (Shatkin & Tatum, 1959; Moore & McAlear, 1962; Gull, 1978). When hyphae are damaged they are rapidly plugged with peroxisome-like organelles called Woronin bodies to prevent loss of cell content (Trinci & Collinge, 1974). Septa of basidiomycetes belonging to the Agaricomycotina have a barrel-shaped swelling around their central pore, the dolipore, which is generally associated with a septal pore cap (SPC) (Bracker & Butler, 1963). The SPC can be of the vesiculate type, the perforate type or the imperforate type (Mclaughlin et al., 1995) and generally restricts organelle translocation. The perforate SPCs of Schizophyllum commune consist of a protein matrix, surrounded by a single membrane that is believed to be derived from the ER (Wilsenach & Kessel, 1965; Müller et al., 1998, 2000; Chapter 4). Its matrix is composed of the SPC14 and SPC33 proteins (Chapter 3, 4). Basidiomycetes lack Woronin bodies but their septa also rapidly close in response to hyphal damage (Aylmore et al., 1984; Markham, 1994). Plugging in basidiomycetes is also observed during heterokaryon incompatibility (HI) and differentiation processes (Morris, 1975; Gull, 1978; Glass & Kaneko, 2003). Here, it is shown by laser dissection that the majority of the septa in the vegetative mycelium of S. commune are already in a closed configuration. Those septa that are open can be induced to plug by hyphal damage and by exposure to high temperature, osmotic shock and toxic agents. This plugging is shown to be reversible. The role of the SPC14 and SPC33 genes in this process could not be determined because of the inability to inactivate these genes.

10 1


10 2


10 1


10 4


10 5


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


81

regel 39

Chapter 5

regel 1



Strains and growth conditions S. commune strain 4-8 (FGSC # 9210 VT # H4-8) and its derivatives were grown in the light at 25 ºC on minimal medium (MM; Dons et al., 1979) solidified with 1.5 % agar or as a liquid culture at 225 rpm. Plates were inoculated with mycelial plugs, while liquid cultures were inoculated with mycelium of a 3-days-old colony (5 cm in diameter) that had been homogenized in 100 ml MM in a blender (Waring Products Inc., Waring Laboratory, Torrington, USA). Plugging experiments were performed in glass bottom culture dishes (No. P35G-0-20-C, MatTek Corporation, Ashland, MA, USA). To this end, wells in the dishes (20 mm in diameter, 1 mm in height) were filled with 400 μl MM containing 1 % agarose. After inoculating the medium by embedding a plug of S. commune mycelium, dishes were filled with 2 ml liquid MM (Figure 1) and transferred to a water vapor saturated chamber at 25°C for 2-3 days.


Cloning of the SPC14 RNAi, SPC14 and SPC33 knock-out constructs Vector pAVP14RNAi was constructed to silence the SPC14 gene of S. commune. This construct contains the SPC14 coding sequence fused to a 27 bp loop and an inversed SPC14 cDNA (Figure 2B). The cDNA sequence of SPC14 was amplified from a cDNA library (Lambda ZAP®-CMV XR Library, Stratagene, La Jolla, CA, USA) with primers SPC14invA and SPC14invB (Table 1). The resulting 283 bp fragment was cloned into pGEMTeasy, resulting in pAVP2inv. The SPC14 cDNA was restricted from pAVP2inv with SacII and inserted in inverse orientation in the SacII site of pAVP1 that is located 27 bp downstream of the stop codon of the SPC14 coding sequence (Chapter 4). In this specific construct the SPC14 stop codon was changed in TGG (W). The SPC14 coding sequence and cDNA with the 27 bp loop were cut from the resulting plasmid pAVP5 with NcoI and BamHI and exchanged with the DSred gene in pGPDRED2MARTP (Vinck, 2007). This resulted in vector pAVP14RNAi that contains the 1 kb S. commune GPD promoter, the SPC14 RNAi hairpin construct, the SC3 terminator and a phleomycin resistance cassette. Vector pDELCAS was used to inactivate the SPC14 and SPC33 genes (L.G. Lugones, unpublished, Figure 2A). Flanking regions of these genes were cloned at either site of the nourseothricin resistance cassette making use of restriction sites for Van91I and SfiI. Restriction of pDELCAS with Van91I generates two different sticky ends that are compatible with sequences in the primers SPC14KO1, SPC14KO2, SPC33KO1 and SPC33KO2 (Table 1) thus allowing directional cloning of fragments amplified with these primers. Likewise, the SfiI sites generate two different overhangs upon

regel 38 regel 39

82


regel 1

10 1


10 2


10 1


10 4


Figure 1: A) Glass bottom culture dish used to assess plugging of septa in S. commune. B) Magnification of boxed area in (A) showing a hypha with the first and second septum as referred to in the text.

10 5


restriction that are compatible with sequences in the primers SPC14KO3, SPC14KO4, SPC33KO3 and SPC33KO4 (Table 1). Upstream and downstream flanks of the SPC14 and SPC33 coding sequences were amplified by PCR using S. commune chromosomal DNA as a target. The 1823 bp upstream flank of SPC14 was amplified with primers SPC14KO1 and SPC14KO2. The 1685 bp downstream flank was amplified with primers SPC14KO3 and SPC14KO4. Similarly, the SPC33 1434 bp upstream flank and the 1659 bp downstream flank were amplified using primer sets SPC33KO1 and SPC33KO2 and SPC33KO3 and SPC33KO4, respectively. SPC14 PCR fragments were ligated into pUC19 (Phusion polymerase amplified fragments) and SPC33 fragments were cloned into pGEMTeasy (TAQ polymerase amplified fragments). The resulting plasmids were named pAVP6 (SPC14 upstream flank), pAVP7 (SPC14 downstream flank), pAVP8 (SPC33 upstream flank) and pAVP9 (SPC33 downstream flank). Upstream flanks were excised with SfiI and introduced in the Van91I site of pDELCAS, resulting in pAVPKO14a and pAVPKO33a. The downstream flanks of SPC14 and SPC33 were excised from pAVP7 and pAVP9 with SfiI, and cloned into the SfiI site of pAVPKO14a and pAVPKO33a, respectively, resulting in constructs pAVPKO14b and pAVPKO33b.

10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


83

regel 39

Chapter 5

regel 1

Table 1: primers used in this study. Primer SPC14invA

Primer sequence CCgCggATCC-ATgtCTgACgAAgAgATCTTg

Notes Introduces SacII and BamHI site

SPC14invB

CCgCggCgTAACTACCAgTAgATgCggCgCTCgAC

Introduces SacII site and stop codon

SPC14KO1

GGCCTAATAGGCCGACGAACCCCTCCTAC

Introduces Van91I compatible site

SPC14KO2

GGCCTCGCAGGCCGACGCACCAAGATCTC


SPC14KO3

GGCCTGCGAGGCCGGGGCGACCGTCCAC

Introduces SfiI compatible site

SPC14KO4

GGCCTATTAGGCCTGAGCTGCACAGAATCG


SPC33KO1

GGCCTAATAGGCCTGGAAGCCGACCAAG


SPC33KO2

GGCCTCGCAGGCCATCCTGACGCTGCTGTAG


SPC33KO3

GGCCTGCGAGGCCTGTGGCTTGCCAATGTTATG


SPC33KO4

GGCCTATTAGGCCTCAGGATGGTTCCCGTCTTG


SPC33KO scrA

GAGGAGGAGGAGTACTATGC

SPC33KO scrB

CGCTCAAACGCATCTAGGAC

SPC14KOscrA

CGCGACTCTTCTACTATTCC

regel 24

SPC14KOscrB

TAACCCAGACCTGGGCGATGTG

regel 25

SC3scr

GGCTGAGTCGTGGACTAAAG



Transformation of S. commune Monokaryotic mycelium was grown for three days in 100 ml MM in a 250 ml Erlenmeyer flask at 250 rpm at 25 ºC. The culture was homogenized for 15 seconds in a blender (Waring Products Inc., Waring Laboratory, Torrington, USA), diluted 2 x with MM (v/v) and grown for another 24 h in 100 ml MM in a 250 ml Erlenmeyer flask. Mycelium was pelleted in 50 ml Greiner tubes (Greiner BioOne International AG, Kremsmuenster, Austria) at 4500 g for 5 min and washed with 1M MgSO4. Mycelium (3 g wet weight) was added to 10 ml filter sterilized protoplasting mixture (1 M MgSO4, 10 mM malate buffer pH 5.8, 1.5 mg ml-1 lysing enzymes [Plant Research International, Wageningen, The Netherlands]).

regel 38 regel 39

84


regel 1

10 1


10 2


10 1


10 4


10 5


10 1

regel 18

10 1

regel 21

10 1 Figure 2: A) pDELCAS was used to delete the SPC33 and SPC14 genes. Its main restriction sites (Van91I and SfiI) are shown as well as the ampicillin resistance gene for selection in Escherichia coli and the phleomycin and nourseothricin resistance cassettes for selection in S. commune. The latter cassettes are regulated by the GPD promoter and GPD and SC3 terminators. B) Schematic representation of the SPC14 RNAi hairpin as cloned in pAVP5 and pAVP14RNAi. The exons of the genomic SPC14 sequence are depicted in black and the inverted cDNA sequence is indicated in grey.

The suspension was gently shaken (10 rpm) for 2.5 h at 30 ºC, diluted 2x with sterile water and incubated for an additional hour. Cell debris was removed by centrifugation for 2 min at 300 g. After addition of 1 volume 1 M sorbitol, the supernatant was incubated for 15 min at room temperature and sieved through glass wool to remove remnants of cell debris. Protoplasts were pelleted by centrifugation for 15 min at

regel 19 regel 20


10 1


10 1


10 1


85

regel 39

Chapter 5


2200 g and carefully resuspended in 25 ml 1 M sorbitol. After centrifugation for 10 min at 2200 g protoplasts were aliquoted in 100 μl portions in 1 M sorbitol with 50 mM CaCl2 to a final concentration of 108 protoplasts ml-1. For transformation, portions were thawed on ice and 5 μg DNA was added that was contained in 20 μl TE (10 mM Tris pH 8, 3 mM EDTA). After 15 min of incubation on ice, one volume PEG 4000, buffered with 10 mM Tris pH 7, was slowly mixed with the protoplasts at room temperature and incubated for 5 min. Regeneration medium (MM + 0.5 M MgSO4) was added to a total volume of 3 ml. After overnight regeneration at 25 ºC, 7 ml MM containing 1 % low melting point agarose was added. After mixing at 37 ºC, regenerated protoplasts were spread on square plates containing 40 ml solidified MM. Regeneration medium and selection plates contained 25 μg ml-1 phleomycin or 10 μg ml-1 nourseothricin. Plates were incubated at 30 ºC for 5 days.

regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27

Screening for homologous integration in S. commune Strains in which the deletion constructs pAVPKO14b and pAVPKO33b were introduced were selected for nourseothricin resistance (first screen) and phleomycin sensitivity (second screen). Chromosomal DNA was isolated from knockout candidates and analyzed by PCR. Presence of an intact SPC14 or SPC33 gene was screened for with primer pairs SPC14KOscrA and SPC14KOscrB and SPC33KOscrA and SPC33KOscrB, respectively (Table 1). Both forward primers (scrA) target parts of SPC14 and SPC33 that are removed upon homologous recombination. The backward primers (scrB) are located just downstream of the 3’ flank of the deletion construct. Together with primer SC3scr (Table 1), located on the SC3 terminator directly downstream of the nourseothricin resistance (Figure 2B), these latter primers will only amplify fragments if the targeted gene is exchanged with the nourseothricin resistance cassette, thus providing a positive control for homologous recombination.


Isolation of genomic DNA and RNA Strains were grown on a porous polycarbonate membrane (diameter 76 mm, pore size 0.1 μm; Osmonics, GE Water Technologies, Trevose, PA, USA) on MM with 1.5 % agar for 4 days at 25 ºC. Colonies were harvested and ground in liquid nitrogen. Homogenized mycelium was lyophilized for RNA extraction. 2 mg of mycelial powder was extracted with Trizol Reagent (Gibco BRL, Life Technologies) according to the instructions of the manufacturer. For DNA isolation, 200 mg homogenized mycelium was mixed with 0.9 ml extraction buffer (2 % SDS, 24 mg ml-1 PAS [4aminosalycilic acid] and 20 % 5 x RNB [ 121.1 g l-1 Tris-HCl, 73.04 g l-1 NaCl, 95.1 g

regel 38 regel 39

86

N

A


l-1 EGTA, pH 8.5]). After incubation at 65 ºC for 15 min, the mixture was extracted with 0.4 ml phenol/chloroform (1:1) and 0.5 ml chloroform. Phases were separated by centrifugation for 10 min at 14000 g. The DNA was precipitated with 0.8 volume of isopropanol and pelleted at 14000 g for 10 min. After washing overnight with 70 % ethanol, the DNA was dissolved in 300 μl TE containing 10 μg ml-1 RNAse. Northern and Southern analysis DNA and RNA hybridizations were performed according to Schuren et al. (1993). Analysis of plugging Glass bottom culture dishes were mounted on a PALM CombiSystem (Carl Zeiss MicroImaging GmbH, Munich, Germany). Disruption of compartments was performed with laser pulses (laser setting “dots”, laser power 65 %). Osmotic stress was applied by addition of 1 M MgSO4 (final concentration) to the MM in the glass bottom culture dish or by replacing MM with deionized water. Heat stress was applied by floatation of the glass bottom culture dish in a water bath at 45, 50 or 60 ºC for 30 min. Cold stress was applied by mounting the culture dish on ice or placing it at -20 or -80 ºC for 15 min. Movies were captured for analysis of the responses of the septa upon disruption of the compartment by laser light. Movement of cytoplasm in compartments adjacent to the septum of the disrupted compartment was used as a measure for plugging.

Results Knockdown of SPC14 and knockout of SPC14 and SPC33 pAVPRNAi was designed for silencing of the SPC14 gene. This construct contains the SPC14 gene sequence followed by a 27 bp loop and a SPC14 cDNA in inverse orientation. Transcription results in a mRNA that forms a 547 bp hairpin, which should induce silencing of SPC14. Sequencing the construct resulted in two signals, one confirming the presence of the fused inverted repeat and a second that lacked the hairpin. The latter can be explained by replication slippage (Viguera et al, 2001), which occurs when hairpins are formed that are flanked by short direct repeats, as in pAVPRNAi. S. commune 4-8 was transformed with construct pAVP14RNAi. Accumulation of SPC14 mRNA in transformants was analyzed by Northern blotting. Several strains with reduced levels of SPC14 RNA were identified (see for instance transformant 3 in Figure 3). 87

regel 1

10 1


10 2


10 1


10 4


10 5


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


Chapter 5


Figure 3: Northern analysis of expression of SPC14 in wild-type dikaryon (4.8A x 4.8B), wild-type monokaryon 4-8, and in 6 strains that have been transformed with pAVP14RNAi. Hybridization of 28S rRNA served as a loading control.


Figure 4: Dikaryon resulting from a cross between a strain that has been transformed with the SPC14 silencing construct and a compatible wild-type strain. A) Colony shows irregular distribution of fruiting structures that are clumped in a coral like rim. B) Detail of the mutant fruiting bodies.


However, none of these strains exhibited stable silencing. RNA expression of SPC14 recovered after one or two transfers to non-selective medium (data not shown). This correlated with instability of abnormal phenotypes. Several monokaryotic transformants showed reduced growth compared to the wild-type. Moreover, a dikaryon resulting from a cross between a transformant and a compatible wildtype monokaryon displayed unusual, coral-like, fruiting structures (Figure 4). After one or two transfers the morphology reverted to that of a wild-type strain. Consequently, the relation between SPC14 silencing and these phenotypes could not be confirmed. Deletion of SPC14 and SPC33 was used as an alternative for RNAi-mediated gene silencing. S. commune 4-8 was transformed with deletion constructs pAVPKO14b and pAVPKO33b. Approximately 400 nourseothricin resistant colonies were obtained for each construct. 10-20 % of these colonies were phleomycin sensitive, indicating homologous integration. However, PCR analysis showed that all transformants still had intact SPC14 and SPC33 genes. Moreover, no product was obtained with

regel 38 regel 39

88

A


regel 1

10 1


10 2

f

f

regel 2


10 1


10 4


Figure 5: Laser disruption of a single hyphal compartment. A) Positioning of laser (L), B-C) laser pulse, and D) disrupted hypha after laser pulse. The septum (S) curves towards the disrupted compartment (A-D) and the cytoplasm of the 2nd compartment is moving before the septum is closed (arrows).

primers that anneal to the nouseotricin cassette and just outside the downstream flank that was used in the deletion constructs, indicating the absence of homologous integration. These results suggest that SPC14 and SPC33 are essential genes. Analysis of plugging in septa S. commune was grown in glass bottom culture dishes in a thin layer of solidified MM, which was overlayered with liquid MM. Single compartments of hyphae were disrupted with a laser within 30 μm from the septum. Cytoplasm of disrupted compartments spilled into the surrounding medium, which was accompanied by a decrease in hyphal diameter of 15-20 %. Adjacent compartments showed 1) considerable loss of cytoplasm (septum open and slowly closed); 2) a very short movement of cytoplasm (septum open but quickly closed) or 3) no response at all (septum already closed) (Figure 5). Using these criteria it was shown that 45 out of 45 apical septa were open (Figure 1). In contrast, 28 out of 53 of the second and 13 out of 14 of the third septa were closed. This was shown to occur throughout the mycelium. The open septa between the second and third compartment generally closed quickly. Growth of the apical compartment stopped immediately when the second compartment was disrupted.

10 5


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


89

regel 39

Chapter 5

regel 1 regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9

Figure 6: Morphology of hyphae before (A) and after (B) addition of 1 M MgSO4 to the culture medium. Vacuoles accumulate in hyphae when exposed to the hypertonic stress.

regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37

Yet, growth continued at the original tip and at normal speed within 30 minutes. This shows that a tip is able to re-establish growth after a short period of recovery. The effect of stress on plugging of the apical septum was assessed in peripheral hyphae of S. commune (Table 2). Addition of 1 M MgSO4 to the liquid medium in the culture dish resulted in accumulation of vacuoles in hyphae within 15 minutes. At this point most hyphae had stopped growing but the first septum was still open. Exposure for 30 more minutes resulted in severely vacuolized hyphae (Figure 6). Cytoplasm did not stream through the apical septum upon damaging the first or second compartment. This was irrespective of the fact whether vacuoles were near the septum. It is thus concluded that all septa had closed. Replacement of MM with deionized water did neither affect growth, nor did it induce accumulation of vacuoles or closure of the first septum. Exposure of S. commune to 20 μg ml-1 nourseothricin, which inhibits protein synthesis, showed a similar response as 1M MgSO4. Within 30 minutes hyphal tips stopped growing and mild vacuolization was observed, but septa were still open. After 60 minutes, hyphae were heavily vacuolized and all septa had closed. Also upon treatment with 50 % ethanol a stress response was observed. Hyphal growth ceased already after 10 minutes and septa became plugged within 20 minutes. The cytoplasm had been fixed after 25 minutes. Consequently, spilling of the cytoplasm of a damaged compartment could not be observed anymore. Exposure to 60 ºC for 30 minutes killed the colony. The cytoplasm was completely solidified and did not flow into the medium anymore. Exposure to 45 ºC and 50 ºC for 30 minutes stopped growth. Moreover hyphae were highly vacuolized and all septa had closed. The first septa opened again within 15 minutes after colonies were transferred from 45 to 25 ºC. Hyphae retained normal growth and vacuolization was reverted. Decrease of vacuolization was also observed within 15 minutes after the 50 ºC heat shock and septa were open 4 out of 5 times at this point. Nevertheless, hyphae

regel 38 regel 39

90


Table 2: overview of responses of septa on stress conditions

regel 1

Condition

Closed septa (%) Apical

Second

Third

Standard (MM; 25 °C)

0

53

93

Damage by laser

100

100

100

1M MgSO4

100

100

100

Water

0

-

-

20 μg ml-1 Nourseothricin

100

-

-

50% Ethanol

100

-

-

Heat: 45 °C 50 °C 60 °C Cold: 0 °C -20 °C -80 °C

100 100 0 0 100

100 100 -

100 100 -

10 1


10 2


10 1


10 4


were not yet growing. Exposure to cold (0 and -20 ºC) for 15 minutes did not cause plugging of septa. Hyphae were slowly growing as soon as the frozen MM turned liquid again. Exposure to -80 ºC caused severe stress. Many hyphae were damaged or killed as could be concluded from vacuolization, strongly reduced hyphal diameter and hyphal fragments. Septa were closed in all cases. Taken together, growth halts at mild stress and septa close upon severe stress. These processes are reversible, at least upon exposure to heat stress.

10 5

The role of the complex septa in the life cycle of basidiomycetes is not clear. It has been proposed that the SPC is involved in plugging of septa as a response to hyphal damage (Moore, 1985; Markham, 1994; Müller et al. 1998, 2000; van Driel, 2008). Whether septal pore caps have other functions as well, and if plugging may be used not only as damage control was the aim of this study. First, it was attempted to inactivate the SPC14 and SPC33 genes that encode proteins that make up the SPC matrix (Chapter 3, 4). Secondly, plugging was studied in the absence and presence of external stress. Targeted disruption of genes has been successful in S. commune with frequencies of 1-5 % (see van Wetter et al., 1996, 2000; Lugones et al., 2004). In this study we were unable to obtain strains in which the SPC14 or the SPC33 genes had been deleted,

regel 16 regel 17

10 1

regel 18

10 1

regel 21

10 1

Discussion

regel 15

regel 19 regel 20


10 1


10 1


10 1


91

regel 39

Chapter 5


despite the fact that 800 transformants have been screened. This suggests that these genes are essential. This was also indicated by the fact that it was not possible to obtain stable RNAi-mediated silencing of the SPC14 gene. Silencing genes by RNA interference has been shown to be possible in the basidiomycetes S. commune, Coprinopsis cinerea, and Ustilago maydis (de Jong et al., 2006, Wälti et al., 2006, Namekawa et al., 2005, Laurie et al., 2008). Using a hairpin construct the SC15 gene in S. commune could be silenced by RNAi in 80 % of the transformants (de Jong et al., 2006). Silencing was stable and was also observed in a dikaryon, which resulted from a cross with a compatible wild-type monokaryon. Reduced levels of SPC14 mRNA indicated that RNAi had occurred in several strains in which a SPC14 hairpin construct was introduced. However, the reduced mRNA levels were quickly lost when these strains were transferred to fresh medium for one or two times. Notably, this was accompanied by the loss of the aberrant phenotype of these transformants. The colonies initially grew slower or contained slow growing sectors, but reverted to the wild-type phenotype when transferred to fresh plates. A dikaryon resulting from a cross between an apparent silenced strain and a compatible wild-type strain displayed an abnormal fruiting pattern. However, also in this case the phenotype reverted to that of the wild-type within two transfers. This suggests that S. commune is capable of suppressing RNAi induced silencing. A similar phenomenon has been observed in Agaricus sp. for a resistance gene (M. Challen, personal communication) and may therefore be more general in basidiomycetes. Suppression of RNAi mediated silencing has not been reported in other fungi and its mechanism is therefore not known. In the future, SPC14 and SPC33 will be inactivated in a dikaryotic background. Spore analysis of strains in which one of the copies of the genes is deleted will show whether these genes are indeed essential. Laser dissection was used to study whether septal pores in the mycelium are open or closed and if this is influenced by external stress. The septum between the first and the second compartment of growing hyphae was always open. In contrast, up to 90 % of subapical septa were closed. It may be that young septa, as occur between the first and second compartment, mature and change from an open to a closed state at the time they have become a subapical septum. Alternatively, it may be that a dedicated mechanism keeps the first septum open. Perhaps that this is needed to maintain growth at the hyphal apex. The results suggest that the cytoplasm of a mycelium is not a continuous system per se, as is generally assumed. However, we can not exclude that the “closed” septa alter between an open and closed configuration. At least, septa are dynamic structures as indicated from the fact that septal closure by heat stress was reversible (see below).

regel 38 regel 39

92

v


The apical septum, which is normally open, closed upon exposure to hypertonic conditions, to elevated temperature, to an antibiotic and to ethanol. Cold and hypotonic conditions did not affect the state of the septum. The stress plugging mechanism seems to be an emergency response since arrest of growth and vacuolization of the cytoplasm preceded septal closure. Plugging induced by heat shock could be reversed within 15-30 minutes. Possibly, septa act as gates that can be opened and closed in response to internal and external signals. The apical hyphal compartment stopped growing when the second compartment was damaged but growth continued within 30 minutes. This is an interesting observation considering the “steady state growth“ theory (Wessels, 1984, 1988). This theory states that cell wall material is released at the hyphal apex and cross-links in time. The cell wall at the hyphal apex is plastic due to continuous apposition of noncrosslinked cell wall material at the tip. In contrast, the cell wall becomes increasingly rigid in the subapical direction. Apposition of new cell wall material is interrupted when growth stops. As a result, the apical cell wall also rigidifies and growth can not restart at this site. This study has shown that the cell wall is still plastic enough 30 minutes after growth has stopped to allow reinitiation of growth.

regel 1

10 1


10 2


10 1


10 4


10 5


10 1

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


93

regel 39

Chapter 5

regel 1

References

regel 2 regel 3

Aylmore, R.C., Wakley, G.E. & Todd, N.K. (1984) Septal sealing in the basidiomycete Coriolus versicolor. J. Gen. Microbiol. 130, 2975-2982.

regel 4 regel 5

Barr, D.J.S. (2001) Chytridiomycota. Pp. 93-112. In The Mycota VII, Systematics and evolution, Part A.

regel 6

McLaughlin, D.J., McLaughlin, E.G. & Lemke, P.A. (eds), Springer-Verlag, Berlin, Germany.

regel 7

Bauer, R., Begerow, D., Sampaio, J.P., Weiss, M. & Oberwinkler, F. (2006) The simple septate basidiomycetes: a synopsis. Mycol. Prog. 5, 41-66.

regel 8 regel 9

Benny, G.L., Humber, R.A. & Morton, J.B. (2001) Zygomycota: Zygomycetes. Pp. 113 -146. In The

regel 10

Mycota VII, Systematics and evolution, Part A. McLaughlin, D.J., McLaughlin, E.G. & Lemke,

regel 11


regel 12


regel 13 regel 14

Bracker, C.E. & Butler, E.E. (1964) Function of the septal pore apparatus in Rhizoctonia solani during protoplasmic streaming. J. Cell Biol. 21, 152-157.

regel 15 regel 16

de Jong, J.F., Deelstra, H.J., Wösten, H.A.B. & Lugones, L.G. (2006) RNA-mediated gene silencing in

regel 17

monokaryons and dikaryons of Schizophyllum commune. Appl. Environ. Microbiol. 72, 1267-

regel 18

1269.

regel 19

Dons, J.J.M., de Vries, O.M.H. & Wessels, J.G.H. (1979) Characterization of the genome of the basidiomycete Schizophyllum commune. Biochim. Biophys. Acta 563, 100-112

regel 20 regel 21

Glass, N.L. & Kaneko, I. (2003) Fatal attraction: nonself recognition and heterokaryon incompatibility in fi lamentous fungi. Eukaryotic Cell 2, 1-8.

regel 22 regel 23


regel 24 regel 25

v

Laurie, J.D., Linning, R. & Bakkeren, G. (2008) Hallmarks of RNA silencing are found in the smut

regel 26

fungus Ustilago hordei but not in its close relative Ustilago maydis. Curr. Genet. 53, 49-58.

regel 27

Lugones, L.G., de Jong, J.F., de Vries, O.H.M., Jalving, R., Dijksterhuis, J. & Wösten, H.A.B. (2004) The

regel 28


v


regel 29 regel 30

Markham, P. (1994) Occlusions of septal pores in fi lamentous fungi. Mycol. Res. 98, 1089-1106.

regel 31

McLaughlin, D.J., Frieders, E.M. & Lü, H. (1995) A microscopist’s view of hetero-basidiomycete phylogeny. Stud. Mycol. 38, 91-109.

regel 32 regel 33

Moore, R.T. (1985) The challenge of the dolipore/parenthesome septum. Pp. 175-212. In Developmental

regel 34

biology of higher fungi. Moore, D., Casselton, L.A., Wood, D.A. & Frankland, J.C. (eds.),

regel 35

Cambridge University Press, Cambridge, UK.


v

94

v


Moore, R.T. & McAlear, J.H. (1962) Fine structures of mycota. Observations on septa of ascomycetes and basidiomycetes. Am. J. Bot. 49, 86-94. Morris, N.R. (1975) Mitotic mutants of Aspergillus nidulans. Genet. Res. 26, 237-254. Müller, W.H., Montijn, R.C., Humbel, B.M., van Aelst, A.C., Boon, E.J.M., van der Krift, T.P. & Boekhout, T. (1998) Structural differences between two types of basidiomycete septal pore caps. Microbiology 144, 1721-1730. Müller, W.H., Koster, A.J., Humbel, B.M., Ziese, U., Verkleij, A.J., van Aelst, A.C., van der Krift, T.P.,

regel 1

10 1

Namekawa, S.H., Iwabata, K., Sugawara, H., Hamada, F.N., Koshiyama, A., Chiku, H.,

10 2

Schuren, F.H.J., Harmsen, M.C. & Wessels, J.G.H. (1993) A homologous gene-reporter system for

10 1

Schüßler, A., Schwarzott, D. & Walker, C. (2001) A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycol. Res. 105, 1413-1421.

regel 6 regel 7


10 4

the basidiomycete Schizophyllum commune based on internally deleted homologous genes. Mol. Gen. Genet. 238, 91-96.

regel 4

regel 8

Kamada, T. & Sakaguchi, K. (2005) Knockdown of LIM15/DMC1 in the mushroom Coprinus cinereus by double-stranded RNA-mediated gene silencing. Microbiology 151, 3669-3678.

regel 3

regel 5

Montijn, R.C. & Boekhout, T. (2000) Automated electron tomography of the septal pore cap in Rhizoctonia solani. J. Struct. Biol. 131, 10-18.

regel 2


10 5


Shatkin, A.J. & Tatum, E.L. (1959) Electron microsocpy of Neurospora crassa mycelia. J. Biophys. Biochem. Cytol. 6, 423-426. Trinci, A.P.J. & Collinge, A.J. (1974) Occlusion of the septal pores of damaged hyphae of Neurospora crassa by hexagonal crystals. Protoplasma 80, 57-67. van Driel, K.G.A. (2007) Septal pore caps in basidiomycetes; ultrastructure and composition. PhD Thesis, University of Utrecht, The Netherlands. van Driel, K.G.A., van Peer, A.F., Grijpstra, J., Wösten, H.A.B, Verkleij, A.J., Müller,W.H. & Boekhout, T. (2008) The Septal Pore Cap Protein SPC18 Isolated from the Basidiomycetous Fungus Rhizoctonia solani also Resides in Pore-plugs. Eukaryotic Cell doi:10.1128.

10 1

regel 18

10 1

regel 21

10 1

van Wetter, M-A., Schuren, F.H.J., Schuurs, T.A. & Wessels, J.G.H. (1996) Targeted mutation of the SC3 hydrophobin gene of Schizophyllum commune affects formation of aerial hyphae. FEMS Microbiol. Lett. 140, 265-269.

36, 201-210.

10 1

Vinck (2007) Hyphal differentiation in the fungal mycelium. Thesis, Utrecht University, The Netherlands.



10 1

Viguera, E., Hernández, P., Krimer, D.B.,Lurz, R. & Schvartzman, J.B. (2000) Visualisation of plasmid replication intermediates containing reversed forks. Nucl. Acid Res. 28, 498-503.

regel 20

regel 27

van Wetter, M-A., Wösten, H.A.B. & Wessels, J.G.H. (2000) SC3 and SC4 hydrophobins have distinct roles in formation of aerial structures in dikaryons of Schizophyllum commune. Mol. Microbiol.

regel 19


10 1


95

regel 39

Chapter 5

regel 1

Wälti, M.A., Villalba, C., Buser, R.M., Grünler, A., Aebi, M. & Künzler, M. (2006) Targeted Gene

regel 2

Silencing in the Model Mushroom Coprinopsis cinerea (Coprinus cinereus) by Expression of

regel 3

Homologous Hairpin RNAs. Eukaryot. Cell. 5, 732-744.

regel 4

Wessels, J.G.H. (1984) Apical hyphal wall extension. Do lytic enzymes play a role? Pp. 31-42. In

regel 5

Microbial Cell Wall Synthesis and Autolysis. Nombela, C. (ed), Elsevier Science Publishers,

regel 6

Amsterdam, The Netherlands.

regel 7

Wessels, J.G.H. (1988) A steady-state model for apical wall growth in fungi. Acta Botanica Neerl. 37, 3-16.

regel 8 regel 9


regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37 regel 38 regel 39

96


Chapter 6




Arend F. van Peer


Chapter 6


The fungal mycelium is an interconnected network of hyphae. Depending on the phylum, hyphae can be compartmentalized by cross-walls known as septa. The lower fungi (Glomeromycetes, Zygomycetes, and Chytridiomycetes) are sparsely septated, whereas hyphae of the Ascomycetes and the Basidiomycetes are regularly septated. The simple septa of Ascomycetes consist of cross-walls with a central pore. They allow passage of cytosol but also of organelles such as mitochondria and nuclei. Septa of Basidiomycetes are generally more complex in their architecture and more restrictive to organelle translocation, but they do allow exchange of cytosol. Therefore, the cytoplasm within a fungal mycelium is generally considered a continuous system. Continuity is interrupted when hyphae are damaged and septa close (plug) by Woronin bodies in Ascomycetes, or by plugging material in Basidiomycetes. Plugging in Basdidiomycetes also occurs during heterokaryon incompatibility (HI) and differentiation processes. Septa of Basidiomycetes belonging to the Agaricomycotina are characterized by a barrel-shaped swelling around their central pore. This dolipore is associated with septal pore caps (SPC). The intimate association of the SPC with the dolipore septum suggests a function for this structure in septal plugging. In this Thesis, the formation and function of SPCs was studied in the model basidiomycete Schizophyllum commune. Functional analysis of SPC-related genes would strongly benefit from improved methods for transformation and gene inactivation. This was also part of this Thesis.


Genetic tools in S. commune


S. commune is found all over the world. The haploid spores from this basidiomycete form monokaryotic, haploid hyphae (each compartment carrying a single nucleus) that generate dikaryons (each compartment carrying two nuclei; one from each parent) upon mating with a compatible partner. Dikaryotic mycelia with compatible mating types form fruiting bodies under the appropriate environmental conditions. In these fruiting bodies karyogamy takes place followed by meisosis. This results in a new generation of haploid spores. S. commune has a long history as a model organism for mushroom forming fungi due to its easy cultivation, short life cycle (1-2 weeks) and sexual propagation on defined minimal medium. Classical and molecular genetics of S. commune have been relatively well established. During this project 40 % of the genomic sequence of S. commune became available. The complete genomic sequence will be made publicly available in the near future.

regel 38 regel 39

98


S. commune became amenable to molecular genetics with the development of a transformation protocol based on tryptophan auxotrophy (Munoz-Rivas et al., 1986) and resistance to phleomycin (Schuren & Wessels, 1994). The latter system has the advantage that any strain can be transformed with a construct consisting of the ble gene of Streptoalloteychus hindustanus placed under control of the S. commune GPD regulatory sequences. In fact, strains can be transformed twice with the same resistance cassette by adding caffeine to the medium in the second transformation (van Wetter et al., 1996). Yet, multiple gene deletions require more than one dominant selection marker. Expression could not be detected when genes encoding hygromycin B phosphotransferase (hph), aminoglycoside phosphotransferase (apt) and gentamicin acetyltransferase (acc1) were tested (Schuren et al., 1998; unpublished data). Introduction of introns and the increase of GC content in AT rich regions (Lugones et al., 1999; Scholtmeijer et al., 2001) resulted in detectable mRNA levels of hph in S. commune. Nonetheless, selection on hygromycin remained problematic due to high background of non-transformed colonies (our results, unpublished). At the start of this Thesis, phleomycin was thus the only efficient dominant selection marker for S. commune. Phleomycin, as well as other bleomycins are widely used as selection markers for transformation of fungi (Banuelos, et al., 2003; Bartholomew, et al., 2001; Gueldener, et al., 2002; Hua, et al., 2000; Teunissen, et al., 2002). Bleomycins introduce double strand DNA breaks, next to damaging RNA and cell walls (Burger, 1998). As such, they are toxic as well as mutagenic. In Chapter 2 it is shown that strains of S. commune that are resistant to phleomycin are still mutagenized when grown on selective concentrations of phleomycin. The 14 kDa protein encoded by ble gene of S. hindustanus provides resistance by binding reversibly in a one to one ratio to bleomycin (Gatignol, et al., 1988). Apparently, the expression levels as well as the mode of action of the resistance protein do not provide full protection against phleomycin. As an alternative, nourseothricin was developed as a selectable dominant marker. Resistance to the antibiotic that targets ribosomes was obtained by expressing the nat1 gene of S. noursei under the control of the GPD regulatory sequences of S. commune. However, transformation efficiency was ten-fold lower compared to phleomycin-mediated transformation despite use of the same regulatory sequences for expression. Interestingly, the low transformation efficiency could be increased 10fold by adding phleomycin, even at non-selective and non-mutagenic concentrations, to the regenerating protoplasts. This effect of phleomycin was independent of the other selection marker that was used. A side effect of the addition of phleomycin was that the integration events per transformant were reduced. Future studies will focus

regel 1

10 1


10 2


10 1


10 4


10 5


10 6

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


99

regel 39

Chapter 6

regel 1 regel 2 regel 3 regel 4 regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36

on the role of DNA repair systems in the effects of phleomycin on transformation efficiency. Such studies are important to improve gene deletions in S. commune by homologous recombination. Targeted gene deletions using phleomycin as a selection marker have been established, albeit with low frequencies of 1-5 % of the integration events (Lugones et al., 2004; van Wetter et al., 1996, 2000). The availability of the nourseothricin resistance cassette enabled the construction of a dedicated deletion construct called pDELCAS (L.G. Lugones, unpublished results). Flanking sequences of the gene of interest are cloned at either side of the nourseothricin resistance cassette, whereas the phleomycin resistance cassette is being present elsewhere in the construct. Strains in which a gene has been deleted are expected to be nourseothricin resistant but phleomycin sensitive. Secondary screening of nourseothricin resistant colonies on phleomycin eliminates a large number of transformants that otherwise have to be screened by Southern analysis to confirm that the gene has been inactivated. The pDELCAS vector was successfully used in S. commune to identify two knock-out strains (J.F. de Jong and R.A. Ohm, unpublished data) Unfortunately, I was unable to isolate a strain in which either the SPC14 or SPC33 gene (see below) has been inactivated. The fact that in total 800 transformants were screened suggests that these genes are essential. Recently, RNA interference has been shown to be an alternative for gene inactivation in Basidiomycetes (de Jong et al., 2006; Wälti et al., 2006; Namekawa et al., 2005; Laurie et al., 2008). Using a hairpin construct, the SC15 gene in S. commune could be silenced by RNAi in 80 % of the transformants (de Jong et al., 2006). RNAi thus was demonstrated to be a good alternative for homologous integration. However, inactivation of the SPC14 gene by RNAi mediated silencing was unsuccessful (Chapter 5). In fact, it seems that RNAi of SPC14 is not stable. Several strains were shown to have reduced levels of SPC14 mRNA. However, silencing was lost after one or two transfers to fresh medium. This coincided with the loss of an aberrant phenotype. Monokaryons grew slower, whereas dikaryons initially formed unusual, coral-like, fruiting structures. Taken together, this suggests that S. commune is capable of suppressing RNAi induced silencing. A similar phenomenon has been observed in Agaricus sp. for a resistance gene (M. Challen, personal communication) and may therefore be more general in basidiomycetes. Suppression of RNAi mediated silencing has not been reported in other fungi but is known to occur in other organisms (see Nakayashiki, 2005). It might be that suppression of silencing occurs mainly with essential genes.


100


Function of septa in the mycelium of S. commune The function of septa in the fungal mycelium is not well understood but their role seems to be diverse. They mechanically strengthen hyphae, but this is probably of secondary importance (Gull, 1978). Moreover, they restrict migration of nuclei and other organelles. The restrictive nature of dolipore septa with SPCs is reflected by the need of septal degradation to allow organelle redistribution e.g. during dikaryotization (Bracker & Butler, 1964; Giesy & Day, 1965; Wessels & Marchant, 1974; Todd & Aylmore, 1985, Jersild et al., 1967; Koltin & Flexer, 1969; Niederpruem & Wessels, 1969). Septa in Basidiomycetes also plug to prevent loss of cytoplasm in response to hyphal damage (Aylmore et al., 1984; Markham, 1994) or to isolate compartments during heterokaryon incompatibility (HI) and differentiation processes (Morris, 1975; Gull, 1978; Glass & Kaneko, 2003). Laser dissection was used to get more insight in septal plugging in S. commune (Chapter 5). Hyphal compartments were cut with a laser within 30 μm from a septum. Streaming of cytoplasm through the septum from the neighboring compartment was used to assess whether septa were open or closed. It was found that almost all septa between the apical and second compartment were open. This was irrespective of the location in the colony. In contrast, only 50 and 10 % of the second and third septa were open, respectively. It may be that young septa, as occur between the first and second compartment, mature and thus change from an open to a closed state at the time they have become a subapical septum. Alternatively, it may be that a dedicated mechanism keeps the first septum open, for instance to support growth at the apex. My results challenge the assumption that the cytoplasm within a mycelium is a continuous system. Yet, I can not rule out that septa act as gates that are opened and closed in response to internal and external signals. In fact, heat stress indicated that the septa of S. commune are dynamic structures that can plug and open within a 30 minutes period (see below). Upon hyphal damage a plug is formed instantaneously and restricts the dolipore entrance from each side of the disrupted compartment (Aylmore et al., 1984; Moore & McAlear, 1962; Bracker & Butler, 1963; Koltin & Flexer, 1969; Casselton, 1971; Moore & Marchant, 1972; Setliff et al., 1972; Craig et al., 1977). This plug is extended into the dolipore channel further sealing the septum (Aylmore et al., 1984; Müller et al., 2000). The plugging material has been shown to contain protein as it can be degraded by trypsin and chymotrypsin (Flegler et al., 1976) but its origin is unknown. In Chapter 5 it was shown that the apical septum closed upon exposure to hypertonic conditions, to elevated temperature, to an antibiotic and to ethanol. Cold

regel 1

10 1


10 2


10 1


10 4


10 5


10 6

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


101

regel 39

Chapter 6


and hypotonic conditions did not affect the state of the septum. Plugging induced by heat shock could be reversed within a 15-30 minutes period. The plugging mechanism as was observed upon exposure to stress seems to be an emergency response since arrest of growth and vacuolization of the cytoplasm preceded septal closure.


The SPC of S. commune

regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37

The SPC of S. commune consists of a matrix that is surrounded by a single membrane. This membrane is believed to be (derived from) endoplasmic reticulum (ER) (Wilsenach & Kessel, 1965; Müller et al., 1998, 2000). Identification of other components that make up the SPC will help to unravel the role of this structure in the biology of the fungal cell. van Driel (2007, 2008) identified a protein in Rhizoctonia solani that was localized both in the membrane surrounding the SPC and in the plug. This suggests a role for this protein, called SPC18, and for SPCs in plugging of septa. SPC18 has a signal sequence for secretion and is thus predicted to be targeted to the ER. It was suggested that this protein is somehow retained in the ER and expelled from the SPC to form the plug when the hypha is damaged. However, this seems not to be a general mechanism for plugging in basidiomycetes since SPC18 was not found in genomic sequences of other fungi that are known to contain SPCs (S. commune, Coprinopsis cinereus, Phanerochaete chrysosporium). The SPC18 protein was identified on basis of its abundance in a SPC enriched fraction (van Driel, 2007, 2008). SPCs were enriched by fractionation of Triton-X-100 containing homogenized mycelium over a discontinuous sucrose gradient consisting of three layers of 30, 50 and 70 % sucrose. SPCs migrated to the 50-70 % sucrose interface. SPCs contained in this fraction were pelleted by centrifugation. The protein composition of the enriched fraction was still complex. In Chapter 3 SPCs of S. commune were purified rather than enriched. Purification was obtained using two discontinuous sucrose gradients followed by filtration over a 220 nm cut-off filter. The first sucrose gradient consisted of two layers of 40 and 55 % sucrose. After centrifugation, SPCs were found at the interface of these layers. The SPC containing fraction was loaded on a gradient consisting of three layers of 47, 52, and 70 % sucrose. SPCs migrated to the 52-70 % interface, after which they were concentrated on top of a 220 nm filter. Addition of Triton-X-100 prior to gradient centrifugation not only proved to be essential for the purification of the SPC, it also increased the buoyant density of the organelle (from 1.2295 to 1.2575 g cm-3). The latter buoyant density correlates with that of pure proteins or protein complexes. Concomitantly with this

regel 38 regel 39

102


shift in density, the shape of the pores in the SPC changed from round to hexagonal upon treatment with Triton-X-100. These findings are consistent with the idea that membranes represent the outer layers of the SPC (Girbardt, 1958, 1961; Moore & McAlear, 1962; Bracker & Butler, 1963; Marchant & Wessels, 1973; Müller et al., 1998, 2000). The data also strongly indicate that the inner part of the SPC consists of proteins and that these proteins determine the SPC ultrastructure. SDS PAGE analysis of purified SPCs from S. commune revealed three protein bands with apparent molecular weights of 14, 33 and 60 kDa. In Chapter 4 it is shown that the constitutively expressed SPC14 and SPC33 genes encode the 14 and the 33 and 60 kDa protein bands, respectively. These genes are unique for basidiomycetes that contain SPCs. Unfortunately, genomes have only been sequenced from species with perforated SPCs. It would be interesting to establish whether taxa with imperforate and vessiculate SPCs also contain SPC14 and SPC33 like genes. SPC14 encodes a protein of 86 amino acids, which does not have any known domain, signal, or localization sequence. MPSS and EST analysis showed that SPC33 mRNA is alternatively spliced. The mRNAs of this gene encode a 239 and a 340 amino acid SPC33 variant. It is not yet clear which of the forms that share 228 amino acids is produced. The identical part of the SPC33 variants is predicted to contain a signal anchor. This anchor is an N-terminal signal peptide without a cleavage site. In addition, the protein contains a putative ER retention signal (RER, amino acids 16-18). A second transmembrane domain is predicted approximately 50 amino acids downstream of the signal anchor. This would imply that part of the protein will be present in the cytosol, whereas the other part would be located in the ER lumen. Immuno-localization confirmed the presence of SPC14 and SPC33 in the SPC of S. commune. A role of SPC14 in the SPC ultrastructure was indicated by the observation of an aberrant SPC morphology after introducing a gene in S. commune, which encodes a fusion between the SPC14 protein and a lumio-tag. Taken together, I propose a model for the formation of the SPC (Figure 1). The SPC would originate from ER. This is based on the fact that the SPC is connected to the endoplasmic reticulum (ER) at its base (Girbardt, 1961; Moore & Patton, 1975; Müller et al., 1998) and the fact that ER markers (van Driel, 2007) and zinc-iodine osmium tetroxide (Müller et al., 1998, 1999, 2000) stain the septal pore cap region. In the model, SPC33 resides in the lumen of ER near the dolipore. Part of SPC33 is located in the cytosol and interacts with the cytosolic protein SPC14. Treatment with Triton-X100 would remove the ER membrane but would leave the SPC33/SPC14 interaction intact. These proteins are proposed to determine the ultrastructure of the SPC.

regel 1

10 1


10 2


10 1


10 4


10 5


10 6

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


103

regel 39

Chapter 6


Figure 1: Model of the SPC of S. commune. Part of SPC33 is located in the lumen of the ER that makes up the SPC and another part resides in the cytosol. Cytosolic SPC14 interacts with SPC33. ER is continuous with SPC.


Notably, SPC33 was not detected in ER in general, despite its ER retention signal. It may be that SPC33 is formed only near the dolipore and is locally transported into the ER, where it forms the SPC matrix. It may also be that SPC33 is transported from “general” to “dedicated” ER by an unknown mechanism. Perhaps, the RER sequence is involved in this process because RXR motives seem to mediate complex regulatory processes that enable specific forward trafficking of proteins from ER to other places (Scott et al., 2003).


104


References

regel 1

Aylmore, R.C., Wakley, G.E. & Todd, N.K. (1984) Septal sealing in the basidiomycete Coriolus versicolor. J. Gen. Microbiol. 130, 2975-2982. Banuelos, O., Naranjo, L., Casqueiro, J., Gutierrez, S. & Martin, J. F. (2003) Co-transformation with autonomous replicating and integrative plasmids in Penicillium chrysogenum is highly efficient and leads in some cases to rescue of the intact integrative plasmid. Fungal Genet. Biol. 40, 83-

10 1


10 2

92.


Bartholomew, K., Dos Santos, G., Dumonceaux, T., Charles, T. & Archibald, F. (2001) Genetic transformation of Trametes versicolor to phleomycin resistance with the dominant selectable

10 1

marker shble. Appl. Microbiol. Biotechnol. 56, 201-204.



10 4

Bracker, C.E. & Butler, E.E. (1964) Function of the septal pore apparatus in Rhizoctonia solani during protoplasmic streaming. J. Cell Biol. 21, 152-157. Burger, R. M. (1998) Cleavage of nucleic acids by bleomycin. Chem. Rev. 98,153-1169. Casselton, L.A. (1971) Septal structure and mating behaviour of common A diploid strains of Coprinus lagopus. J. Gen. Microbiol. 66, 273-278. de Jong, J.F., Deelstra, H.J., Wösten, H.A.B. & Lugones, L.G. (2006) RNA-mediated gene silencing in monokaryons and dikaryons of Schizophyllum commune. Appl. Environ. Microbiol. 72, 12671269. Craig, G.D., Newsam, R.J. & Gull, K. (1977) Subhymenial branching and dolipore septation in Agaricus bisporus. Trans. Br. Mycol. Soc. 69, 337-344. Flegler, S.L., Hooper, G.R. & Fields, W.G. (1976) Ultrastructural and cytochemical changes in the basidiomycete dolipore septum associated with fruiting. Can. J. Bot. 54, 2243-2253. Gatignol, A., Durand, H. & Tiraby, G. (1988) Bleomycin resistance conferred by a drug-binding


10 5


10 6

regel 18

10 1

regel 21

10 1

protein. FEBS Lett. 230, 171-175.

regel 19 regel 20


Giesy, R.M. & Day, P.R. (1965) The septal pores of Coprinus lagopus in relation to nuclear migration. Am. J. Bot. 52, 287-293.

10 1

Girbardt, M. (1958) Über die Substruktur von Polystictus versicolor L. Arch. Mikrobiol. 28, 255-269. Girbardt, M. (1961) Licht- und Elektronenmikroskopische Untersuchungen an Polystictus versicolor. Arch. Mikrobiol. 39, 351-359.

Craig, G.D., Newsam, R.J. & Gull, K. (1977) Subhymenial branching and dolipore septation in Agaricus bisporus. Trans. Br. Mycol. Soc. 69, 337-344.

regel 29 regel 30

10 1

Glass, N.L. & Kaneko, I. (2003) Fatal attraction: nonself recognition and heterokaryon incompatibility in fi lamentous fungi. Eukaryot. Cell 2, 1-8.

regel 28


10 1


105

regel 39

Chapter 6

regel 1

Gueldener, U., Heinisch, J., Koehler, G. J., Voss, D. & Hegemann, J. H. (2002) A second set of loxP

regel 2

marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucl. Acid Res.

regel 3

30, e23.

regel 4


regel 5 regel 6

Hua, J., Meyer, J. D. & Lodge, J. K. (2000) Development of positive selectable markers for the fungal pathogen Cryptococcus neoformans. Clin. Diagn. Lab. Immunol. 7, 125-128.

regel 7 regel 8

Jersild, R., Mishkin, S. & Niederpruem, D.J. (1967) Origin and ultrastructure of complex septa in Schizophyllum commune development. Arch. Mikrobiol. 57, 20-32.

regel 9 regel 10

Koltin, Y. & Flexer, A.S. (1969) Alteration of nuclear distribution in B-mutant strains of Schizophyllum commune. J. Cell Sci. 4, 739-747.

regel 11 regel 12

Laurie, J.D., Linning, R. & Bakkeren, G. (2008) Hallmarks of RNA silencing are found in the smut

regel 13

fungus Ustilago hordei but not in its close relative Ustilago maydis. Curr. Genet. 53, 49-58.

regel 14

Lugones, L. G., Scholtmeijer, K., Klootwijk, R. & Wessels, J. G. H. (1999) Introns are necessary for mRNA accumulation in Schizophyllum commune. Mol. Microbiol. 32, 681-689.

regel 15 regel 16

Lugones, L.G., de Jong, J.F., de Vries, O.H.M., Jalving, R., Dijksterhuis, J. & Wösten, H.A.B. (2004) The

regel 17


regel 18

the absence of the SC3 hydrophobin. Mol. Microbiology. 53, 707-716.

regel 19


regel 20 regel 21


regel 22 regel 23

Moore, R.T. & Marchant, R. (1972) Ultrastructural characterization of the basidiomycete septum of Polyporus biennis. Can. J. Bot. 50, 2463-2469.

regel 24 regel 25

Moore, R.T. & Patton, M.A. (1975) Parenthesome fine structure in Pleurotus cystidiosus and Schizophyllum commune. Mycologia. 67, 1200-1205.

regel 26 regel 27

Morris, N.R. (1975) Mitotic mutants of Aspergillus nidulans. Genet. Res. 26, 237-254.

regel 28

Markham, P. (1994) Occlusions of septal pores in fi lamentous fungi. Mycol. Res. 98, 1089- 1106.

regel 29

Müller, W.H., Montijn, R.C., Humbel, B.M., van Aelst, A.C., Boon, E.J.M., van der Krift, T.P. &

regel 30

Boekhout, T. (1998) Structural differences between two types of basidiomycete septal pore caps.

regel 31


regel 32

Müller, W.H., Humbel, B.M., van Aelst, A.C., van der Krift, T.P. & Boekhout, T. (1999) The perforate

regel 33

septal pore cap of basidiomycetes. Pp. 120-127. In Plasmodesmata. Structure, function, role in cell

regel 34

communication. van Bel, A.J.E. & van Kesteren, W.J.P. (eds.), Springer-Verlag, Berlin, Germany.

regel 35


regel 36

Montijn, R.C. & Boekhout, T. (2000) Automated electron tomography of the septal pore cap in

regel 37

Rhizoctonia solani. J. Struct. Biol. 131, 10-18.

regel 38 regel 39

106

v

v

v

v


Munoz-Rivas, A., Specht, C., Drummond, B., Froelinger, E., Novotony, C. & Ullrich, R. (1986) Transformation of the basidiomycete, Schizophyllum commune. Mol. Gen. Genet. 205, 103-106. Nakayashiki, H. (2005) RNA silencing in fungi: Mechanisms and applications. FEBS Lett. 579, 59505957. Namekawa, S.H., Iwabata, K., Sugawara, H., Hamada, F.N., Koshiyama, A., Chiku, H., Kamada, T. & Sakaguchi, K. (2005) Knockdown of LIM15/DMC1 in the mushroom Coprinus cinereus by double-stranded RNA-mediated gene silencing. Microbiology 151, 3669-3678.

regel 1

10 1

Scholtmeijer, K., Wösten, H. A. B., Springer, J. & Wessels, J. G. H. (2001) Effect of introns and AT-

10 2

Schuren, F. H. J. & Wessels, J. G. H. (1998) Expression of heterologous genes in Schizophyllum commune

regel 4


10 1

rich sequences on expression of the bacterial hygromycin B resistance gene in the basidiomycete Schizophyllum commune. Appl. Environ. Microbiol. 67, 481-483.

regel 3

regel 5

Niederpruem, D.J. & Wessels, J.G. (1969) Cytodifferentiation and morphogenesis in Schizophyllum commune. Bacteriol. Rev. 33, 505-535.

regel 2


10 4

is often hampered by the formation of truncated transcripts. Curr. Genet. 33, 151-156.


Schuren, F. H. J. & Wessels, J. G. H. (1994) Highly-efficient transformation of the homobasidiomycete Schizophyllum commune to phleomycin resistance. Curr. Genet. 26, 179-183. Scott, D.B., Blanpied, T.A. & Ehlers, M.D. (2003) Coordinated PKA and PKC phosphorylation suppresses RXR-mediated ER retention and regulates the surface delivery of NMDA receptors. Neuropharmacology. 45, 755-767. Setliff, E.C., MacDonald, W.L. & Patton, R.F. (1972) Fine structure of the spetal pore apparatus in Polyporus tomentosus, Poria latemarginata, and Rhizoctonia solani. Can. J. Bot. 50, 2559-2563. Teunissen, H. A., Verkooijen, J., Cornelissen, B. J. & Haring, M. A. (2002) Genetic exchange of avirulence determinants and extensive karyotype rearrangements in parasexual recombinants of Fusarium oxysporum. Mol. Genet. Genomics. 268, 298-310. Todd, N.K. & Aylmore, R.C. (1985) Cytology of hyphal interactions and reactions in Schizophyllum commune. Pp. 231-248. In Developmental biology of Higher Fungi. Moore, D., Casselton, L.A.,

10 5


10 6

regel 18

10 1

regel 21

10 1

Wood, D.A. & Frankland, J.C. (eds.), Cambridge University Press, Cambridge, UK.

regel 19 regel 20


van Driel, K.G.A. (2007) Septal pore caps in basidiomycetes; ultrastructure and composition. PhD Thesis, University of Utrecht, The Netherlands.

10 1

van Driel, K.G.A., van Peer, A.F., Grijpstra, J., Wösten, H.A.B, Verkleij, A.J., Müller,W.H. & Boekhout, T. (2008) The Septal Pore Cap Protein SPC18 Isolated from the Basidiomycetous Fungus Rhizoctonia solani also Resides in Pore-plugs. Eukaryotic Cell doi:10.1128.

Microbiol. Lett. 140, 265-269. van Wetter, M-A., Wösten, H.A.B. & Wessels, J.G.H. (2000) SC3 and SC4 hydrophobins have distinct

regel 29 regel 30

10 1

van Wetter, M-A., Schuren, F.H.J., Schuurs, T.A. & Wessels, J.G.H. (1996) Targeted mutation of the SC3 hydrophobin gene of Schizophyllum commune affects formation of aerial hyphae. FEMS

regel 28


10 1


roles in formation of aerial structures in dikaryons of Schizophyllum commune. Mol. Microbiol.

regel 37

36, 201-210.

regel 38

107

regel 39

Chapter 6

regel 1

Wälti, M.A., Villalba, C., Buser, R.M., Grünler, A., Aebi, M. & Künzler, M. (2006) Targeted Gene

regel 2

Silencing in the Model Mushroom Coprinopsis cinerea (Coprinus cinereus) by Expression of

regel 3

Homologous Hairpin RNAs. Eukaryot. Cell. 5, 732-744.

regel 4

Wessels, J.G.H. & Marchant, R. (1974) Enzymic degradation of septa in hyphal wall preparations from a monokaryon and a dikaryon of Schizophyllum commune. J. Gen. Microbiol. 83, 359-358.

regel 5 regel 6


regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37 regel 38 regel 39

108


Samenvatting

regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37 regel 38 regel 39

Samenvatting


Het mycelium van een schimmel bestaat uit een netwerk van draden die hyfen worden genoemd. Afhankelijk van de groep schimmels zijn hyfen al dan niet opgedeeld in compartimenten door middel van septa. Zo bevatten de hyfen van zakjeszwammen (Ascomyceten) eenvoudige septa die bestaan uit een dwarswand met een centrale opening. Deze septa laten de celvloeistof (het cytosol) alsmede organellen zoals mitochondriën en kernen passeren. Septa van steeltjeszwammen (Basidiomyceten, bekend van de paddenstoelvormende schimmels) zijn complexer van samenstelling en beperken stroming van organellen tussen compartimenten van hyfen hoewel het cytosol vrij kan passeren. Vanwege de vrije stroming van het cytosol wordt het cytoplasma in een mycelium over het algemeen beschouwd als een continu systeem. Deze continuïteit wordt onderbroken wanneer hyfen beschadigd raken en de septa worden afgesloten. Septa worden ook afgesloten wanneer compartimenten moeten worden geïsoleerd, zoals bij sporenvorming. In de Basidiomyceten vindt de afsluiting plaats door plugmateriaal van onbekende samenstelling. Septa van Basidiomyceten die behoren tot de Agaricomycotina worden gekenmerkt door een verdikking rond de centrale opening. Rond deze verdikking, die dolipore wordt genoemd, ligt aan beide kanten van het septum een soort deksel; de septal pore cap (SPC). De nabijheid van de SPC bij de opening van het septum suggereert een functie voor deze structuur bij het afsluiten van de septa. In dit proefschrift werd de vorming en de functie van de SPC bestudeerd in de paddenstoelvormende schimmel Schizophyllum commune. Een dergelijke studie is sterk gebaat bij verbeterde methoden voor transformatie en geninactivatie in S. commune. Dit was daarom eveneens onderdeel van dit proefschrift.

v

v v v

v


Genetische gereedschappen voor S. commune


S. commune heeft een lange geschiedenis als modelorganisme voor paddenstoelvormende schimmels door zijn eenvoudige cultivatie, korte levenscyclus (één tot twee weken) en de mogelijkheid tot seksuele voortplanting op gedefinieerde substraten. De klassieke en moleculaire genetica van S. commune zijn relatief sterk ontwikkeld. Verder kwam tijdens dit project de volledige genoomsequentie van deze schimmel beschikbaar (binnenkort publiekelijk toegankelijk). S. commune kon genetisch worden getransformeerd door de ontwikkeling van selectiesystemen gebaseerd op tryptofaan-auxotrofie en phleomycine resistentie. Deze laatste methode heeft als voordeel dat elke willekeurige stam kan worden getransformeerd. Echter, men heeft meerdere selectiesystemen nodig indien men

regel 38 regel 39

110

v

Samenvatting

verschillende genen wil uitschakelen of in de schimmel wil brengen. Daarnaast bleek phleomycine ongewilde mutaties in het genoom aan te brengen in transformanten die op dit antibioticum konden groeien (Hoofdstuk 2). Daarom werd als alternatief een selectiesysteem ontwikkeld op basis van het antibioticum nourceothricine. Hiertoe werd het nat1 gen van Streptomyces noursei voorzien van de regulatiesequenties van het GPD gen uit S. commune. Echter, ondanks identieke regulatiesequenties bleek de transformatie efficiëntie met nourceotricine een factor tien lager te zijn dan die van phleomycine. Opmerkelijk genoeg kon de transformatie efficiëntie worden verhoogd door phleomycine toe te voegen aan de protoplasten die weer een celwand vormen, zelfs met niet-selectieve (en dus niet mutagene) concentraties. Dit effect was onafhankelijk van de gebruikte selectiemerker. Een bijkomstigheid van toevoeging van phleomycine was dat het aantal integraties per transformant afnam. Gerichte gendeleties zijn mogelijk in S. commune maar dit gebeurt met lage frequentie (1-5%). Beschikbaarheid van het nourceothricine selectiesysteem maakte een nieuw deletieconstruct, pDELCAS, mogelijk. De flankerende sequenties van een gen dat men wil deleteren worden aan beide zijden van de nourceothricine resistentie cassette gekloneerd, terwijl de phleomycine resistentie cassette elders in deze vector is geplaatst. Stammen waarin een gen succesvol is gedeleteerd worden nourceothricine resistent maar blijven phleomycine gevoelig. Selectie van nourceothricine resistente kolonies op phleomycine vermindert het aantal transformanten dat men middels analyse van genomisch DNA moet testen op de aanwezigheid van een gendeletie sterk. De pDELCAS vector is met succes toegepast voor gendeleties in S. commune. Helaas konden de SPC14 en SPC33 genen (zie beneden) niet op deze wijze worden geïnactiveerd ondanks het screenen van 800 transformanten. Dit suggereert dat SPC14 en SPC33 essentiële genen zijn. Recent is gebleken dat RNA interferentie (RNAi) een goed alternatief is voor gendeletie in Basidiomyceten. Echter, inactivatie van SPC14 via RNAi bleek niet goed mogelijk. Verschillende stammen met verlaagde SPC14 mRNA niveaus werden geïdentificeerd, maar deze inactivatie verdween na één of twee keer doorzetten op vers substraat. Dit ging gepaard met het verlies van een afwijkend fenotype waarvan monokaryons trager groeiden en dikaryons ongebruikelijke, koraalachtige paddenstoelen vormden. Deze resultaten duiden op repressie van geninactivatie door S. commune. Dit is onlangs ook waargenomen in Agaricus sp. Hoewel repressie van RNAi geïnduceerde geninactivatie niet eerder is beschreven in schimmels is het fenomeen wel bekend in andere organismen. Mogelijk vindt het in schimmels met name plaats bij essentiële genen.

regel 1

10 1


10 2


10 1


10 4


10 5


10 6

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


111

regel 39

Samenvatting

regel 1

Functie van septa in het mycelium van S. commune


De rol van septa in het mycelium van de schimmels is onduidelijk. Het lijkt er echter op dat zij meerdere functies hebben. Zo versterken zij de celwand en verminderen zij de stroming van organellen (zoals kernen) tussen compartimenten. Daarnaast worden septa in Basidiomyceten gesloten wanneer hyfen beschadigen of wanneer een compartiment moet worden geïsoleerd zoals bij sporenvorming. Laser dissectie werd ingezet om het afsluiten van septa in S. commune nader te bestuderen (Hoofdstuk 5). Hyfe compartimenten werden zo’n 15 μm van een septum doorgesneden. Stroming van cytoplasma vanuit het naastgelegen compartiment werd gebruikt om te bepalen of een septum open dan wel gesloten was. Alle septa tussen het eerste en tweede compartiment waren open, onafhankelijk van de positie van de hyfe in het mycelium. Van het tweede en derde septum bleken er maar 50 en 10% geopend te zijn. De al oude aanname dat het cytoplasma in het mycelium een continu systeem is wordt dus niet door deze resultaten ondersteund. Het is echter niet uitgesloten dat septa afwisselend geopend en gesloten worden als reactie op interne en externe signalen. Dit idee wordt ondersteund door de observatie dat septa die door warmte stress worden gesloten (zie hieronder) binnen 30 minuten weer worden heropend. In Hoofdstuk 5 laat ik zien dat het eerste septum vanaf de top, dat normaal gesproken open is, sluit bij verhoogde temperaturen en na toevoeging van zout, antibioticum en alcohol. Kou en afwezigheid van zout of suiker hadden geen effect. Het plugmechanisme dat hier onder stress is waargenomen lijkt een noodoplossing daar het stoppen van groei en sterke vacuolisatie van het cytoplasma altijd vooraf ging aan het sluiten van septa.

v v


De SPC van S. commune

v


De SPC van S. commune bestaat uit een matrix die wordt omgeven door een enkel membraan. Dit membraan zou afkomstig zijn van het endoplasmatisch reticulum (ER). Identificatie van de overige componenten van de SPC zal leiden tot begrip van de vorming en de functie van deze structuur. In Hoofdstuk 3 heb ik SPCs gezuiverd uit gehomogeniseerd mycelium waaraan Triton-X-100 is toegevoegd. Het homogenaat werd gescheiden middels twee discontinue sucrose gradiënten en filtratie over een 220 nm filter. De eerste sucrose gradiënt bevatte twee lagen van 40 en 55 % sucrose. SPCs kwamen na centrifugatie terecht op het grensvlak van deze lagen en werden vervolgens gescheiden over een gradiënt bestaande uit lagen van

regel 38 regel 39

112

Samenvatting

47, 52 en 70 % sucrose. De SPCs, die zich nu op het grensvlak van 52 en 70% sucrose bevonden, werden geconcentreerd op een 220 nm filter. Toevoeging van Triton-X100 bleek niet alleen essentieel voor de zuivering van SPCs maar verhoogde ook de relatieve dichtheid van dit organel (van 1.2295 naar 1.2575 g cm-3). Deze laatste dichtheid, komt overeen met die van zuiver eiwit. De verschuiving van de dichtheid door behandeling met Triton-X-100 ging gepaard met een vormverandering van de openingen in de SPC ultrastructuur, namelijk van rond naar hexagonaal. Deze bevindingen stemmen overeen met het idee dat de buitenlaag van de SPC bestaat uit een membraan, terwijl de matrix zou bestaan uit eiwit. Deze matrix bepaalt de ultrastructuur van de SPC. Eiwitscheiding van gezuiverde SPCs van S. commune toonde drie eiwitbanden aan van 14, 33 en 60 kDa. In Hoofdstuk 4 laat ik zien dat de constitutief actieve genen SPC14 en SPC33 coderen voor respectievelijk de 14 kDa band en zowel de 33 als de 60 kDa banden. Deze genen zijn uniek voor Basidiomyceten die een SPC hebben. SPC14 codeert voor een eiwit van 86 aminozuren dat geen enkel bekend domein, signaalsequentie of lokalisatie signaal bevat. MPSS (massive parallel signature sequencing) en EST (expressed sequence tag) analyses toonden aan dat SPC33 mRNA alternatief wordt “gespliced”. De mRNAs van dit gen coderen voor varianten van 239 en 340 aminozuren. Het is op dit moment nog onduidelijk welke variant in de schimmel aanwezig is. Het identieke deel van de SPC33 varianten dat 228 aminozuren omvat bevat een voorspeld signaalanker bestaande uit een signaal peptide zonder afsplitsingcode. Verder bevat het eiwit een mogelijk ER retentie signaal (RER) en een tweede voorspeld transmembraan domein. Dit betekent dat een deel van het eiwit in het ER lumen zit en een deel in het cytosol. Immunolokalisatie bevestigde de aanwezigheid van SPC14 en SPC33 in de SPC van S. commune. Ook wijzen afwijkend gevormde SPCs na introductie van een SPC14-fusie eiwit (bevattende een lumio-tag) erop dat SPC14 betrokken is bij de ultrastructuur van de SPC. Samengevat presenteer ik het volgende model voor de vorming van de SPC in S. commune (Figuur 1 in H6). De SPC zou gevormd worden uit ER. In het model bevindt SPC33 zich grotendeels in het ER lumen in de buurt van de dolipore. Doordat SPC33 twee transmembraan sequenties bevat zal ook een deel van SPC33 in het cytosol aanwezig zijn. Dit deel zou een interactie kunnen aangaan met het cytosolische SPC14 eiwit. Triton-X-100 verwijdert wel de ER membraan maar laat de SPC33/SPC14 interactie intact, waardoor de SPC structuur niet uiteenvalt. Opvallend is dat SPC33 ondanks een ER retentie signaal niet elders wordt gevonden in het ER. Mogelijk wordt SPC33 slechts nabij de dolipore gevormd en lokaal in het ER gebracht waar

regel 1

10 1


10 2


10 1


10 4


10 5


10 6

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


113

regel 39

Samenvatting


het de SPC matrix vormt. Het zou ook kunnen dat SPC33 wordt verplaatst vanuit “algemeen” naar “aangewezen” ER door een onbekend mechanisme. Hierin zou het RER signaal een rol kunnen spelen aangezien deze signalen complexe regulatie processen sturen die het doorreizen van eiwitten vanuit het ER mogelijk maken.

regel 5 regel 6 regel 7 regel 8 regel 9 regel 10 regel 11 regel 12 regel 13 regel 14 regel 15 regel 16 regel 17 regel 18 regel 19 regel 20 regel 21 regel 22 regel 23 regel 24 regel 25 regel 26 regel 27 regel 28 regel 29 regel 30 regel 31 regel 32 regel 33 regel 34 regel 35 regel 36 regel 37 regel 38 regel 39

114


Nawoord


Nawoord


Op het moment dat je deze tekst in mijn proefschrift leest zal het promotietraject in praktische zin zijn afgerond en kan het doctoraat als behaald worden beschouwd. Maar wat is er eigenlijk afgerond? Het blijkt dat veel mensen niet goed weten wat promoveren inhoudt. Sommigen denken dat ik eindelijk afstudeer, anderen zien mij nu als dokter, arts of zelfs professor. Ook niet zelden wordt “boekje” vertaald naar “hij is schrijver”. Deze verwarringen zijn begrijpelijk, maar ik zou ze graag rechtzetten. Wat is promoveren? Wikipedia omschrijft het begrip promoveren wel mooi: “Promotie in academische zin is het behalen van de academische graad van doctor door het schrijven en publiekelijk verdedigen van een proefschrift, al dan niet met stellingen, aan een universiteit, of althans onder supervisie van een hoogleraar die als promotor optreedt. Degene die gaat promoveren wordt een promovendus genoemd”. Oftewel; Arend (de promovendus) heeft onderzoek uitgevoerd onder begeleiding van Han (hoogleraar). Het onderzoek en de resultaten zijn samengevat in dit boekje (het proefschrift). Het is beoordeeld door collega moleculaire wetenschappers (leescommissie) die hierover vragen zullen stellen (als opponenten) tijdens de publieke verdediging (de promotieplechtigheid). Wat was promoveren voor mij? Natuurlijk is het behalen van een academische titel leuk, maar de werkelijke waarde van een promotieonderzoek zit hem in de persoonlijke reis die je maakt tijdens het traject. Toen ik begon was promoveren voor mij: heel veel proefjes doen in het lab. Niet meer, en niet minder. Al heel snel bleek deze visie enigszins beperkt. Ik begon me soms zelfs af te vragen of ik nog wel aan proefjes toe zou komen, zoveel andere zaken moesten er geregeld worden. Samenvattingen schrijven, presentaties, literatuur- en werkbesprekingen, overleg, planning, sociale labactiviteiten en opruimen waren nog maar een aantal van de extra taken. Dat was mij niet verteld, en nu moest ik me daaraan gaan aanpassen. Dat deed ik dus, met frisse tegenzin. Verder gaat fundamenteel onderzoek, en zeker biologisch onderzoek, veelal gepaard met onverwachte problemen. Micro-organismen hebben een hele sterke eigen wil. Ze besluiten vaak zomaar om iets wat ze altijd deden niet meer te doen, of juist iets wat ze nooit deden wel. En dan uiteraard op dusdanig ongelukkige momenten dat alleen nachtwerk of een grondige herziening van je weekend de proef nog kan redden. Dit vraagt veel tijd en aandacht. Dus hoe plan je naast tegenstribbelende organismen en mislukte proeven, feestjes met labgenoten en congressen in het buitenland, al je eigen vrienden, hobby’s en activiteiten? Hoe ga je om met commentaar van collega’s of meningsverschillen met je baas? Wat vind je leuk, wat is het belangrijkst, wanneer kies je voor jezelf, en wanneer juist niet?

regel 38 regel 39

116

j

j

j

v

Nawoord

Al deze zaken dwingen tot het maken van keuzes, en dat is lastig. Hieraan ging ik me niet aanpassen! Mijn aanpak was, toegegeven, enigszins ongebruikelijk. Ik koos niets maar deed gewoon alles. Daartoe besloot “alles” te kiezen dat ik maar even niets meer kon doen. Dat viel even vies tegen. Het proces dat hierop volgde is ongetwijfeld het meest leerzame dat ik tot nu toe in mijn leven heb doorgemaakt. Het heeft tijd gekost, maar als je gewoon stapjes blijft zetten, hoe klein ze af en toe ook zijn, reis je vanzelf verder. Dit proefschrift is daarvan het onomstotelijke bewijs. Ik wil dan ook benadrukken dat ik, ondanks de nodige tegenslag, een fantastisch leuke tijd heb gehad en dat ik het zonder twijfel meteen weer zou doen. Ik heb ontzettend veel geleerd, over mezelf en over de moleculaire microbiologie. Ik wil hiervoor alle vrienden, Aikido en Tai Chi maatjes heel erg bedanken. Zij stonden garant voor steun tijdens moeilijke perioden, en heel veel plezier naast het werk. Zij vormen een belangrijke factor in mijn leven. Met betrekking tot dit proefschrift wil ik even stilstaan bij mijn collega’s en ex-collega’s van Microbiologie, zowel van de afdeling bacteriën als schimmels. Ik wil jullie heel erg bedanken voor alle hulp, tips, adviezen en de dagelijkse gesprekken. Dat meen ik oprecht. Twee bijzondere mensen van deze groep wil ik even apart noemen: Han, ik vind het heel bijzonder hoeveel geduld je weet op te brengen wanneer zaken niet lopen zoals je zou willen. Ondanks aanvankelijke, duidelijke ergernis, accepteer je snel wat nu eenmaal zo is en kijk je rustig naar wat je wel kan doen. Dit bleek onder andere uit je onvoorwaardelijke steun als experimenten niet liepen, toen ik ziek was of als ik gewoon niet wilde luisteren. Dit is voor mij heel belangrijk geweest en ik durf te betwijfelen of ik het zonder jou had gered. Ik hoop van harte dat de energie die je in me hebt geïnvesteerd voor jou de moeite waard is gebleken. Ontzettend bedankt voor alles wat je me hebt gegeven. En dan Luis. Ik heb zelden iemand ontmoet die zo creatief is als jij. Je onconventionele kijk op zaken en de korte maar heftige botsingen die we soms hadden hebben me enorm gestimuleerd. Jouw vindingrijkheid is onmisbaar geweest voor mijn onderzoek en ik ben je daarvoor erg dankbaar. Natuurlijk, ook de leden van de SPC-club verdienen de aandacht. Kenneth en Teun, heel erg bedankt voor de fijne samenwerking, jullie geloof in het project en het welkom dat er altijd op het CBS was. Arie, bedankt voor het mogen werken op je afdeling. Wally, ook jou wil ik even in het bijzonder noemen. Bedankt voor alle begeleiding, steun en overleg en de intensieve training van het EM-werk. Het was onmogelijk geweest de SPC te zuiveren zonder jouw hulp. Tot slot wil ik mijn vader, moeder en zusje bedanken. Dick, Janna en Jacobien, bedankt voor alle ruimte en oprechte aandacht die ik altijd van jullie heb gekregen. Jacobien,

regel 1

10 1


10 2


10 1


10 4


10 5


10 6

regel 18

10 1

regel 21

10 1

regel 19 regel 20


10 1


10 1


10 1


117

regel 39

Nawoord


je geeft mij altijd het gevoel dat ik bijzonder ben, iets wat ik zelf vaak niet zo snel heb. Dick, Janna, bedankt voor het stimuleren van alle geknutsel; lego bouwwerken door het hele huis, voorwerpen van hout, klei, metaal, papier, zand, modder en alle mogelijke permutaties, die weken bleven staan of liggen. Voor het toelaten van mijn verzamelwoede van levende en dode (soms in verre staat van ontbinding verkerende) dieren en stenen en planten die ik mooi vond. En voor de ruimte in keuze van studie en toekomst. Dit heeft in grote mate bijgedragen aan wie ik ben en mijn huidige fascinatie voor alles wat leeft, hoe alles in elkaar zit en uiteraard dit proefschrift.


118

List of publications

List of publications 2008

2008

regel 1

van Peer, A.F., de Bekker, C., Vinck, A., Wösten, H.A.B. and Lugones, L.G. Running title: Phleomycin increases transformation efficiency. Submitted to AEM van Driel KG, van Peer AF, Grijpstra J, Wösten HA, Verkleij AJ, Müller WH, Boekhout T. The Septal Pore Cap Protein SPC18 Isolated from the Basidiomycetous Fungus Rhizoctonia solani also Resides in Pore-plugs. Eukaryot. Cell 2008 doi:10.1128/EC.00125-08

10 1


10 2


10 1


2007

van Driel, K.G.A., van Peer, A.F., Wösten, H.A.B, Verkleij, A.J., Boekhout, T. & Müller, W.H. (2007) Enrichment of perforate septal pore caps from the basidiomycetous fungus Rhizoctonia solani by combined use of French press, isopycnic centrifugation, and Triton X-100. J. Microbiol. Meth. 71, 298-304.

10 4


10 5


-2007

-2003

van Driel, K.G.A. & van Peer, A.F., Müller, W.H. and Wösten, H.A.B. General introduction in van Driel, K.G.A. (2007) Septal pore caps in basidiomycetes. Ultrastructure and composition. PhD Thesis, University of Utrecht, The Netherlands. Koulman, A., van Peer, A.F., Ebbelaar, M., Bos, R. and Quax, J.W. Bioconversion of 2,7’-cyclolignans by heterologously expressed human cytochrome 450 3A4. in Koulman, A. Podophyllotoxin: a study of the biosynthesis, evolution, function and use of podophyllotoxin and related lignans. Thesis, Rijksuniversiteit Groningen, The Netherlands.

2007 2006 2004

10 1

regel 21

10 1

regel 19 regel 20


10 1

Abstracts and presentations 2008 2008 2008

10 6

regel 18


10 1

GCBB congress, Cape Girardeau, MO, USA (Oral presentation) ECFG-9, Edinburgh, UK (Poster) IB (institute of biomembranes), Utrecht, Netherlands (Oral presentation) NVvM, section Mycology, Utrecht, Netherlands (Oral presentation) ECFG-8, Vienna, Austria (Poster) ECFG-7 Copenhagen, Denmark, (Poster)


10 1


119

regel 39

Curriculum vitae

regel 1

Curriculum vitae


Arend van Peer was born on October 24, 1977 in Groningen, The Netherlands. He followed high school education at the Praedinius Gymnasium and the Maartenscollege in Groningen and Haren where he received his VWO diploma in 1997. He continued with a Master’s in Biology at the Rijksuniversiteit Groningen (RuG), Groningen, The Netherlands, where he specialized in molecular biology (microbial- and plant-), molecular genetics and biotechnology through two research projects. 1) “Sterol metabolism in the actinomycete Rhodococcus erythropolis” at the Department of Microbial Physiology under supervision of dr. van der Geize, R. and professor dr. Dijkhuizen, L. 2) “Lignan bioconversion in plants” at the Department of Pharmaceutical Biology under supervision of dr. Koulman, A. and professor Quax, W. He obtained his MSc degree in 2002. This same year he started as a PhD student at the department of Microbiology at Utrecht University, Utrecht, The Netherlands under supervision of prof. dr. H.A.B. Wösten. He finished his research that is described in this Thesis in 2008.


120