Structure of the murine complement factor H gene.

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1988 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 263, No. 32, Issue of November 15. PP. 16720-16724,1988 Printed in U.S.A.

Structure of the Murine Complement FactorH Gene* (Received for publication, May 2,1988)

Dennis P. VikS, Jill B. Keeneysv, Pura Muiioz-CanovesS, David D. Chapline, and Brian TackSII F. From the $Department of Immunology, Research Institute of Scripps Clinic, La Jolh, California 92037 and the §Department of Internal Medicine and the Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis,Missouri 63110

Factor H is a regulatory protein of the alternative ing factor (16), &glycoprotein I (17), haptoglobin (18),the pathway of complement activation comprised of 20 interleukin-2 receptor (19), clotting factor XIIIb (20), andthe tandem repeating units 60 ofamino acids each. A factor related cDNA clonetermed “X/Y” (21). In addition to sharing H cDNA clone was used to identify 17 genomic clones homologous repeating units, factor H is also part of a linkage from a cosmid library. Four clones were selected for group found on chromosome 1termed the regulation of comanalysis of intronlexon junctions and 5’ and 3’ regions plement activation cluster (22, 23). This group also includes of the gene and for mapping ofexons. the The factorH CR1 and CR2 (24), C4bp (25), decay-accelerating factor (26), gene was foundtobecomprisedof 22 exons. Each and possibly the Y gene (21). repeating unitis encoded by one exon, except thesecThe functional significance of this 60-amino acid repeating ond repeat, which is coded by two exons; the leader unit is not known. Many of the complement proteins containsequence is encodedby a separate exon. The exons ing this repeating unit interact in some way with either C3b range insize from 77 to 210 base pairs (bp) andaverage 178 bp. They span a region of approximately 100 or C4b. However, the presence of the consensus repeat in kilobases (kb) on chromosome 1. The leader sequence noncomplement proteins indicates that it must function in exon is 26 kb upstream of the first repeat exon, rep- ways other than binding of complement and possibly serves resenting the largest intron. The other introns range in a general structural framework capacity. This study was in size from 86 bp to 12.9 kb, and the average intron undertaken to examine the structural organization of the factor H gene, to gain insight into how the arrangement of size is 4.7 kb. Analysis of the genomic organization of the exons might affect the structureand function of the the factorH gene has provided insight into the protein structure and will enable the construction of deletion protein, andto enable the furtherstudy of the function of the mutants for functional studies. protein through deletion and expression experiments. EXPERIMENTALPROCEDURES

Enzymes and Reagents-Restriction endonucleases were purchased from Promega Biotec and Boehringer Mannheim; a nick translation Factor H is a 150-kDa plasma protein involved in the kit was purchased from Bethesda Research Laboratories; and radioregulation of complement activation, an early phase of the labeled nucleotides were purchased from Amersham Corp. immune response system. It down-regulates the alternative Construction and Screening of Cosmid Library” cosmid library pathway C3 convertase C3b,Bb by binding to the C3b frag- was constructed in the pTCF vector (27) as previously described (28) ment, thereby displacing Bb and serving as a cofactor for using genomic DNAfrom a BALB/c liver. Filters were prehybridized proteolytic cleavage of C3b by complement factor I. Factor H and hybridized a t 42 “C in50% formamide buffer. The cosmid library serves to prevent spontaneous activation in the absence of was probed with three different 32P-labeledfactor H cDNA fragments representing positions 1-554, 1041-2488, and 3262-4254 of the fullantigen and tolimit the extent of complement activation by length cDNA (1).Positive clones were colony-purified, and cosmid a foreign invader. The full-length cDNA sequence for murine DNA was isolated (29). factor H has been determined, and the protein is comprised Sequencing of Intron/Exon Junctions-Cosmid DNA was seentirely of20 60-amino acid consensus repeating units (1). quenced using the “shotgun” method (30). Fragments of 300-600 bp This repeating unit structure isfound in anumber of comple- in length, randomly generated by sonication, were ligated into the ment and noncomplement proteins including Clr (2, 3), Cls SmaI site of M13mp8. Exon-containing phage were identified by transferring a portion of the phage to Genescreen filters (Du Pont(4), C2b (5), Ba (6, 7), C4b-binding protein (C4bp)’ (8, 9), New England Nuclear) in duplicate and probing the filters with the factor I (10, l l ) , complement receptor type 1 (CR1) (12), appropriate 32P-labeledfactor H cDNA fragments. These phage were complement receptor type 2 (CR2) (13-15), decay-accelerat- then sequenced by the dideoxy chain termination method (31) using [a - 32S]thio-labeleddeoxyadenosine 5’-(thio)triphosphate (32). The * This work wassupported by United States Public Health Service sequences were compiled and aligned using the DBAUTO and DBUAward A117354 and Training Grants HL07195 and A107163 and the TIL programs (33, 34) on a V A X VMS computer. The compiled sequences were compared to thesequence of a factor H cDNA cloned Howard Hughes Medical Institute. This is Publication 5304-1“ from the Research Institute of Scripps Clinic. The costs of publication from B1O.WR liver mRNA, and the intron/exonjunctions were of this article were defrayed in part by the payment of page charges. determined. Southern Blot Analysis of Intron Size-One pg of cosmid DNA was This article must therefore be hereby marked “advertisement” in digested to completion with the appropriate restriction endonucleases accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. 11 Present address: Dept. of Genetics, Washington University and electrophoresed in a 0.8% agarose gel. The DNA wastransferred to Genescreen, and the filters were hybridized at 42 “C in 50% School of Medicine, St. Louis, MO 63110. 11 To whom correspondence should be addressed Dept. of Immu- formamide buffer using a 32P-labeledM13 subclone. The phage was nology, Research Inst. of Scripps Clinic, IMM-11, 10666 N. Torrey labeled using a reaction mixture identical to thatused in sequencing except that [ a - 32P]dCTPwas used as thelabeled nucleotide and no Pines Rd., La Jolla, CA 92037. The abbreviations used are: Clbp, C4b-binding protein; CR1 and dideoxynucleotides were present in the reaction mixture. After hyCR2, complement receptor types 1 and 2, respectively; bp, base bridizing overnight, the filters were washed in 0.2 X SSC (1 X = 0.15 M NaCl, 0.015 M trisodium citrate, pH 7) and 0.1% sodium dodecyl pair(s); kb, kilobase(s).

16720

Complement Factor H Gene sulfate at 65 "Cand exposed to Kodak XAR film with an intensifying screen for several hours at -70 "C. Fifteen of the 21 introns were found to be completely contained on a single restriction fragment of 12 kb or less. To delineate further the boundaries of these introns, the intron/exon junction sequences were examined for sites recognizedby restriction endonucleases, and these enzymes were used in double digestion experiments to locate more precisely the distance between exons. The other six introns not contained on a single restriction fragment of appropriate size were mapped by other means. Cosmid DNA was digested with various restriction enzymes, and the resulting fragments were orderedbased on their hybridization patterns with exon probes. Fragments containing only intron sequence were placed based on their commonality between two overlapping cosmid clones or based on the approximate size of the intron when compared to other restriction enzyme digestion patterns. RESULTS

Factor H cDNA was used as a probe to screen a BALB/c genomic cosmid library. Seventeen factor H-specific clones were identified, spanning a region of approximately 125 kb (Fig. 1). Four clones, A-18, BB-36, Q-40, and X-42, were selected for analysis of intron/exon junctions and for mapping of distances between the exons. The factor H gene wasfound to be composed of 22 exons. The firstexon represents the 5'untranslated region and theleader sequence and includes the first 4 base pairs coding for the mature secreted protein. The second exon codes for the first repeating unit of factor H; however, the second repeating unit is encoded by two exons of 106 and 77 bp, respectively. Each of the other18 repeating units of factor H is encoded by one exon. The size of each exon ranged from 77 to 210 bp and averaged 178 bp (Table I). Excluding the firstexon, each exon begins with the second base pair of a codon, except for the fourth exon, which begins with the third base pair of a codon (Table 11). The exon sequences differed from the previously published sequence for murine factor H cDNA at three positions. The C in position 499 of the cDNA was read as a G in exon 4, but this change does not alter the derived amino acid sequence, as both codons specify glycine.Position 3573 in the 19threpeat of the cDNA is a C, but in exon 21 is a G, leading to an apparent change in aminoacid from threonine to arginine. The thirddifference occurs in the 3"untranslated region of factor H, where the C a t position 3945 of the cDNA was found to be a T in the genomic sequence. The DIAGON program was used to analyze the relationship between the exons at thenucleotide level (Fig. 2). The exons clustered into two major homology groups and one minor one. The first group is comprised of exons 5 and 13-21, the second group of exons 6-11 and 22, and the minor group of exons 2 and 12. Under these conditions, matching 44 of 91 bp, neither

16721

exon 3 nor 4, which together comprise the second repeat unit, showed homology with any of the otherexons. Approximately 7.3 kb of intron was sequenced, averaging 174 bp on either side of each exon. The introns began with the consensus sequence GTAAGT, where the first GT was invariant and the A, A, G, and T occurred in 71, 71, 76 and 62% of the sequences, respectively (Table 11). The 3' intron consensus sequence was YTTYAG (Y represents apyrimidine nucleoside), where the AG was invariant and the Y, T, T, and Y occurred in 80, 75, 60, and 80% of the sequences, respectively. The AT content of the 5' and 3' ends of the introns was high, comprising 69.7% of the totalbases. The 5' and 3' regions of the gene were examined in more detail. Based on the size of the factor H mRNA (-4.4 kb), the published cDNA sequence must be nearly full-length. NO conventional TATA boxwas seen up to 270 bp 5' of the cDNA sequence (Fig. 3A). However, two potential sites were identified. In the 3' region of the gene, three potential polyadenylation signals were identified, all within 100 bp of each other (Fig. 3B). The sizes of the introns were determined by Southern blot analysis of cosmid clones digested with various restriction enzymes and probed with exon-specific probes. The largest intron occurs first, between the leader sequence exon and the exon for the first repeating unit, and is approximately 26 kb (Fig. 1 and Table I). Four introns were short enough to be sequenced completely and have lengths of 296, 372, 86, and 161 bp, respectively. The other introns range in size from 0.65 to 12.9 kb, and the average intron size is 4.7 kb. DISCUSSION

The 60-amino acid consensus sequence which provides the framework for the entire factor H protein is emerging as a common component of a large number of proteins, bothwithin and outside the complement family. These consensus repeating units have been found in the complement proteins Clr, Cls, C2b, Ba, C4bp, factor I, decay-accelerating factor, CR1, and CR2 and in the noncomplement proteins &-glycoprotein I, the interleukin-2 receptor, haptoglobin, and factor XIIIb of the clotting pathway. Although many of the complement proteins have in common their interaction with C3b or C4b, they can be further subcategorized based on the percentage of the protein comprised of the repeating unit. Factor H, C4bp, CR1, CR2,and decay-accelerating factor are composed almost entirely of this repeat, whereas Clr, Cls,C2b, Ba, and factor I contain only 1-3 repeating units. A similar situation is seen in the noncomplement proteins, where factor XIIIb is composed entirely of repeating units, whereas the other three 13 14

16 17 18

\\ \ I /

1

23

I

I 10

FIG. 1. Map of murine factor H gene. The positions of the 22 exons are indicated above the line. The approximate positions of the 17 factor H genomic cosmid clones are indicated below the line.

P

5

6 7

89

I I

I I

II

4

la11

XJ

50

40

12\\

II I

60

15\

I/

19 20

1 II 1 1 1 1 1

m

m

90

L-22

8-3 0-2 x42 F-l V-31 "

21 22

I I 103

110

120th

16722

Complement Factor H Gene TABLE I Sizes of, .factor H exons and introns Repeat Length Intron

Exon

5' Unt."

2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 a

unt.,

+ leader

bp

14

-240 186 106 77 192 171 174 195 177 183 177 174 183 0.086 180 177 177 0.161

16 17 18 19 20

174 177 8.9 177 183 644

1

1 2a

2b 4 5 6

8 9 10 11

+ 3' unt.

Length kb -26 0.296 5.5 2.6 7.6 1.9 7.5 0.372 9.7 1.2 12.9 3.7

1 2 3 4 5 6 7

8 9 10 11 12 13 14 15 16 17 18 19 20 21

1.2 2.2 0.65 1.6 1.6

2 3 4

5 6

7 8 9

10 11 12 13 14 15 16

17 18 19

20 21 22 a

Exon"

. . . ttgtagAT

. . . ttttagAA . . . ttttagG

. . . GAA TGT . . . CGG AAG . . . GAT TAT. . . GAA GTG . . . GTG

. . . tttcagTT . . . atttagAA ATT . . . GAA . . . tttcagAA AAG . . . ACC . . . ttcaagTG AAA . . . GTC . . . tcttagGG AAA. . . ATC . . . tttaagAG ACA. . . ATT . . . catcagAG TCT . . . TAT . . . ttcaagAA AGA. . . AAA . . . cagcagGT CAA . . . ATT . . . ctacagAG G A G , . . GTT . . . atatagCA ACA . . . ACA . . . gaaaagGC AAA . . . ATT . . . atgtagAA AAA . . . GTT . . . tttcagGA CTT . . . ATA . . . tttcagAA ACG . . . AAA . . . ctttagAT AAT . . . CGA . . . ccttagAC TCA. . . TTA . . . cttcagAT GCA. . .

Exon base

pairs

are

4000

H nucleotide sequence versus itself. Segments of the factor H nucleotide seH quence 91 bp in length were compared sequentially to factor segments along the entire length of the sequence, a dot wasand bp. The solid diagonal line represents plotted for a match of at 44 least identity with itself.

TABLE I1 Intron

3000

FIG.2. DIAGON analysis ofmurinefactor

Intronlexon junctionsequences 1

2000 Base Number

2.2

untranslated.

Exon

1000

Intron

Ggtaagc . Agtaagt . GGgtatgt . Ggtaaat . Ggtaaga Ggtgaca Tgtaagc Agtaagc . Agtaagt . Agtgagt . Ggtgagt Ggtatgt Ggtaagt . Ggtaagt . Agtgctt Ggtcagt . Ggtgaga . Agtatag Ggtattt Ggtaggg . Cgtaagt .

capitalized and grouped

.. .. .. ..

A.

... ... ... .. .. .. ... ... .. .. ... .. ..

... ...

in

.. ..

codons.

gttctgtggtttgtccacagtagaacacaatttaaaggattatgaaatccagcccttgct cacatttccagaatgtgaacttgtttccaagcaaaacaagctgtqatttacaagaacaat

ttcctaaactgactttcaacttccctttgaagcAAGTCTTTCCCTGCTGTGACCACAGTT 28 CATAGCAGAGAGGAACTGGATGGTACAGCACAGATTTCTCTTGGAGTCAGTTGGTCCCAG MetArgLeuSerAlaArgIleIleTrpLeuIleLeuTrpThrValCy 88 AAAGATCCAAATTATGAGACTGTCAGCAAGAATTATTATTTGGCTTATATTATGGACTGTTTG SAlaAlaGlu

148 TGCAGCAGAAGgtaagctggaaacattcttttctccttcttgctgagccaaattataaaa

B. 3803

TAARATCATAATACATTTATTAGTTGATTTTATTGTTTAGAAAGGCACATGCATGTGA

3861 CTAATATACTTTCAATTTGCATTGAAGTATTGTTTAACTCATGTCTTCTCATAWTATAA 3921 A C A T T T T T G T T A T A T G G T G A T T A A C T T G T A A C T T T A A A A A G

3981 CAGTAATTCAARACTCCTAATCTAARATATGATATGTCCAAGGACAWCTATTTCAATCA proteins contain only 1-4 units. Those complement proteins composed almost entirely of consensus repeats have in com- 4041 AGAAAGTAGATGTAAGTTCTTCAACATCTGTTTCTGTTTCTATTCAGAACTTTCTCAGATTTTCCT mon their ability to bind to C3b or C4b in a receptor-ligand 4101 GGATACCTTTTGATGTAAGGTCCTGATTTACAGTGGATAAAGGATATATTGACTGATTCT fashion and are also all involved in the down-regulation of 4161 TC-TATGATTTCCCAAAGCATGTAACAACCAAACTATCATATATTATATGACTA the complement cascade. The other complement proteins 4221 ATGCATACBBTTBBTTACTATATAATACTTTCa~agaatctaagaaacttcttgc containing this repeat are all enzymes which interact with ctatgtacgtctaatatttggtacattgaaataagaaaagattcaaacaattttacaaaq C3b or C4b in a more short-lived manner. Thus, the number of consensus repeats in a protein may reflect the strength and ggattaagatttcacaaggtgtatgatcctatcactgtaataatattgacattaaaaacc purpose of its interaction with C3b or C4b. tataaatatatggtatcacttataaacaggcatgatcattggttaagcaggacttattgc Using three different factor H probes, 17 different genomic FIG.3. Sequence of the 6' (A) and 3' (B) regions of factor cosmid clones were isolated. The four clones studied in more depth almost certainly contain factor H genomic sequence H gene. c D N A sequence is in upper-case letters, and genomic selower-case letters. The numbers correspond to the positions in because they are 99.93% homologous to the previously pub- quence , two possible TATA boxes are in the published c D N A sequence. AIn lished sequence for factor H cDNA (1).The 3-bp differences underlined. In B , three possible polyadenylation signals are undernoted are possibly allelic in nature inasmuch as two different lined. The C marked by asterisk the was read as a T in the genomic strains of mice wereused for the cDNA and genomic libraries, sequence.

Complement Factor H Gene

16723

respectively. However, when aportion of the cDNA was protein are necessary for binding to C3b and for serving as a resequenced, the C at position 3573 in thecDNA was read as cofactor in its factor I-mediated cleavage. a G , identical to thegenomic sequence; and thus, theoriginal Acknowledgment-We thank Bonnie Towle for preparation of the cDNA clone sequenced may indicate aprior sequencing error manuscript. or may represent a point mutationat thatposition. The fact that therepeating units of factor H were encoded REFERENCES by separate exons was not unexpected, as the data from Kristensen, T., and Tack, B. F. (1986)Proc. Natl. Acad. Sci. u. 1. genomic sequences of several other of these proteins had S. A. 83,3963-3967 suggested this would be the case (12, 35). Comparison of the 2. Journet, A., and Tosi, M. (1986)Biochem. J. 240,783-787 exons with each other on the nucleotide level failed to show 3. Leytus, S. P., Kurachi, K., Sakariassen, K. S., and Davie, E. W. a pattern of long homologous repeats, as has been reported (1986)Biochemistry 25,4855-4863 for CR1 and CR2 (12, 14, 15). However, a certain pattern of 4. Tosi, M., Duponchel, C., Meo, T., and Julier, C. (1987)Biochemrelatedness was evident in that most exons fell into one of istry 26,8516-8524 5. Bentley, D. R. (1986)Biochem. J. 239, 339-345 three homology groups. This may indicate that thegene arose 6. Morley, B. J., and Campbell, R. D. (1984)EMBO J. 3,153-157 from duplication of individual exons rather than duplicating 7. Mole, J. E., Anderson, J. K., Davison, E. A., and Woods, D. E. segments of DNA containing several exons. (1984)J.Biol. Chem. 259,3407-3412 One surprising finding was that the second repeating unit 8. Chung, L. P., Bentley, D. R., and Reid, K. B. M. (1985)Biochem. of factor H, whose nucleotide sequence showed the least J. 230,133-141 homology with any other exon, was encoded by two exons. A 9. Kristensen, T., Ogata, R. T., Chung, L. P., Reid, K. B. M., and preliminary report (36) has suggested that this will be true Tack, B. F. (1987)Biochemistry 26,4668-4674 for C4bp also. The repeating unit found in the a chain of 10. Goldberger, G., Bruns, G.A. P., Rits, M., Edge, M.D., and Kwaitkowski, D. J. (1987)J. Biol. Chem. 262,10065-10071 haptoglobin is also encoded by two exons (37). However, this consensus repeat is the most different from any of the others, 11. Catterall, C. F., Lyons, A., Sim, R. B., Day, A. J., and Harris, T. J. R. (1987)Biochem. J. 242,849-856 in that it has approximately a 10-amino acid deletion between 12. Klickstein, L. B.,Wong, W. W., Smith, J. A., Weis, J. H., Wilson, the first and second cysteine, and the thirdcysteine, which is J. G., and Fearon, D. T. (1987)J.Exp. Med. 165, 1095-1112 invariant in all of the other consensus sequences, is absent. 13. Weis, J. J., Fearon, D. T., Klickstein, L. B., Wong, W.W., The significance of this two-exon repeating unit is not known. Richards, S. A., de Bruyn Kops, A., Smith, J. A., and Weis, J. H. (1986)Proc. Natl. Acad. Sci. U. S. A. 83,5639-5643 It may represent amore primordial form of the repeating unit or perhaps has a role in the function of the protein, repre- 14. Moore, M. D., Cooper, N. R., Tack, B. F., and Nemerow, G. R. (1987)Proc. Natl. Acad. Sci. U. S. A. 84,9194-9198 senting the binding domain for C3b or C4b. More studies on 15. Weis, J. J., Toothaker, L. E., Smith, J. A., Weis, J. H., and the genomic structure of other proteins from this family will Fearon, D. T. (1988)J.Exp. Med. 167,1047-1066 need to be done before this canbe determined. 16. Caras, I. W., Davitz, M. A., Rhee, L., Weddell, G., Martin, D. W., Another unusual feature of the factor H gene is its large Jr., and Nussenzweig, V. (1987)Nature 325,545-549 size, over 100 kb. This is in contrast to the genes for comple- 17. Lozier, J., Takahashi, N., and Putnam, F. W. (1984)Proc. Natl. Acad. Sci. U. S. A. 81, 3640-3644 ment components C4, Slp, and factor B, which span approx18. Kurosky, A., Barnett, D. R., Lee, T. H., Touchstone, B., Hay, R. imately 15-20 kb each on chromosome 17(28). The total E., Arnott, M. S., Bowman, B. H., and Fitch, W.M. (1980) length of the factor H gene is nearly 24 times the length of Proc. Natl. Acad. Sci. U. S. A. 77,3388-3392 its mRNA. Approximately one quarter of this length is rep- 19. Shimuzu, A., Kondo, S., Takeda, S., Yodoi, J., Ishida, N., Sabe, resented by the leader sequence exon and the first intron. H., Osawa, H., Diamantstein, T., Nikaido, T., and Honjo, T. Exons 2-11 tend to be grouped in pairs, and exons 12-20 are (1985)Nucleic Acids Res. 13, 1505-1516 in a cluster spanning 13 kb. This arrangement may be the 20. Ichinose, A., McMullen, B. A., Fujikawa, K., and Davie, E. W. (1986)Biochemistry 25,4633-4638 result of the duplication process this gene has undergone to 21. Aegerter-Shaw, M., Cole, J. L., Klickstein, L. B., Wong, W. W., create these repeating units. Fearon, D. T., Lalley, P. A., and Weis, J. H. (1987)J.Zmmunol. There have been reports of truncated forms of factor H 138,3488-3494 mRNA and/or protein in humans (38-40) that end after the 22. Rodriguez de Cordoba, S., Lublin, D.M., Rubinstein, P., and seventh repeating unit. Analysis of the genomic sequence at Atkinson, J. P. (1985)J. Exp. Med. 161, 1189-1195 the end of exon 9 of murine factor H indicates that if the 23. Rey-Campos, J., Rubinstein, P., and Rodriguez de Cordoba, S. (1988)J. Exp. Med. 167,664-669 ninth intron remains unspliced, the reading frame continues 5 bp into the intron and then reaches a stop codon. These 24. Weis, J. H., Morton, C. C., Bruns, G. A. P., Weis, J. J., Klickstein, L. B., Wong, W.W., and Fearon, D. T. (1987)J. Zmmunol. data would be consistent with a model of alternative splicing 138,312-315 to explain the truncated form of human factor H. We have 25. Rodriguez de Cordoba, S., and Rubinstein, P. (1986)J.Exp. Med. been unable to identify any murine cDNA clones analogous 164,1274-1283 to thetruncated factor H clones in human. 26. Lublin, D.M., Lemons, R. S., LeBeau, M. M., Holers, V.M., Tykocinski, M. L., Medof, M. E., and Atkinson, J. P. (1987)J. The function of the 60-amino acid consensus repeating unit Exp. Med. 165,1731-1736 is unknown. It is tempting to speculate that it is involved in 27. Grosveld, F. G., Lund, T., Murray, E. J., Mellor, A. L., Pahl, H. some manner with the binding of C3b or C4b.However, M., and Flavell, R. A. (1982)Nucleic Acids Res. 10,6715-6732 because of its presence in noncomplement proteins such as 28. Chaplin, D. D., Woods, D. E., Whitehead, A. S., Goldberger, G., the interleukin-2 receptor and j32-glycoproteinI, this consenColten, H. R., and Seidman, J. G. (1983)Proc. Natl. Acad. Sci. susrepeatmust also function inother capacities. Indeed, U. S. A. 80,6947-6951 certain proteins such as factor H and CR1, despite being 29. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982)Molecular Cloning:A Laboratory Manual, Cold Spring HarborLaboratory, comprised of many of these repeating units, have only a Cold Spring Harbor, NY valence of 1 for binding ligand; and therefore, the consensus A. T., and Barrell, B. G. (1983)in Techniques in Nucleic repeating unit must have other functions. With the isolation 30. Bankier, Acid Biochemistry (Flavell, R.A., ed) Vol. 85-08, pp. 1-34, of factor H genomic clones and the determination of the Elsevier/North-Holland Scientific Publishers, Ltd., Limerick, intron/exon boundaries, it is now possible to construct careIreland fully defined deletion mutants to assess which portions of the 31. Sanger, F., Nicklen, S., and Coulson, A.R. (1977)Proc. Natl.

16724

Complement Factor H Gene

Acad. Sci. U.S. A. 74,5463-5467 32. Biggin, M. D., Gibson, T. J., and Hong, G. F. (1983)Proc. Natl. Acad. Sci. U.S. A. 80,3963-3965 33. Staden, R. (1980)Nucleic Acids Res. 8, 3673-3694 34. Staden, R. (1982)Nucleic Acids Res. 10,4731-4751 35. Leonard, W. J., Depper, J. M., Kanehisa, M., Kronke, M., Peffer, N. J., Svetlik, P. B., Sullivan, M., and Greene, W. C. (1985) Science 230,633-639 36. Bamum, S., Keeney, J., Kristensen, T., Noack, D., Seldin, M.,

D’Eustachio, P., Chaplin, D., and Tack, B. F. (1987)Complement 4, 131 37. Maeda, N., Yang, F., Barnett, D. R., Bowman, B. H., and Smithies, 0.(1984)Nature 309,131-135 38. Kristensen, T., Wetsel, R. A., and Tack, B. F. (1986)J. Immunol. 136,3407-3411. 39. Ripoche, J., Day, A. J., Moffatt, B., and Sim, R. B. (1987) Biochem. SOC. Trans. 15,651-652 40. Katz, Y., and Strunk, R. C. (1987)Complement 4, 176