Student Competition 1 PATHWAYS AND CELLULAR ...

CSIRO PUBLISHING

Reproduction, Fertility and Development, 2015, 27, 93–270 http://dx.doi.org/10.1071/RDv27n1abs

Student Competition 1 PATHWAYS AND CELLULAR FUNCTIONS INFLUENCED BY INSULIN TREATMENT DURING OOCYTE MATURATION ] A TRANSCRIPTOME STUDY OF IN VITRO-PRODUCED BOVINE DAY 8 BLASTOCYSTS D. LaskowskiA, Y. SjunnessonA, R. Ba˚geA, M. A. Sirard C, H. GustafssonA, G. AnderssonB, and P. HumblotA B

A Swedish University for Agricultural Sciences, Department of Clinical Sciences, Division of Reproduction, Uppsala, Sweden; Swedish University for Agricultural Sciences, Department of Animal Breeding and Genetics, Section of Molecular Genetics and Bioinformatics, Uppsala, Sweden; C Department des Sciences Animales, Centre de Recherche en Biologie de la Reproduction, Universite´ Laval, Que´bec, Canada

Insulin as a key metabolic hormone has crucial functions in metabolic regulation in all mammals. Deviation of its physiological concentration occurs in metabolic disorders as obesity and diabetes in humans or negative energy balance and overfeeding in the cow. As these metabolic disorders are strongly correlated with reproductive disturbances, we investigated the effect of insulin during oocyte maturation on gene expression of bovine Day 8 blastocysts (BC8) by transcriptome analysis. Abattoir-derived oocytes (n ¼ 882) were divided into 3 groups and in vitro matured for 22 h by adding insulin (H: High 10 mg mL1; L: Low 0.1 mg mL1 and Z: Zero, control). This was followed by standard in vitro production (IVP) and evaluation of developmental rates up to blastocyst stage. BC8 (n ¼ 120) were pooled in groups of 10 and total RNA was extracted by parallel gDNA and total RNAextraction (AllPrepDNA/RNA micro kit, cat no. 80284, QiagenÒ, Valencia, CA, USA) for analyses of the transcriptome. All samples (4 biological replicates/group) resulted in RIN-values .7.5. RNA amplification, cDNA synthesis, purification, and labelling were performed and 825 ng of Cy3and Cy5-labelled linearly amplified aRNA was hybridized on the Agilent-manufactured EmbryoGENE-slides in a 2-colour dye swap design. An empirical Bayes moderated t-test was applied to search for the differentially expressed transcripts (DET) between control and insulin-treated groups, using the ‘limma’ package in R (www.r-project.org). The DET were defined as having a 1.5-fold change difference between treatment and control and P , 0.05. Pathways and molecular functions influenced by insulin treatment were analysed by using Ingenuity Pathway Analysis (IPA; IngenuityÒ Systems, www.ingenuity.com). As a global pattern, insulin treatment induced an up-regulation of genes. In total, 202 DET in the H and 142 DET in the L group were found where 104 DET were common in both insulin groups. Fifteen selected candidate genes chosen for qPCR validation and 12 (80%) showed similar expression patterns as the microarray data. DET relevant for following cellular functions were found in H: Cell Cycle, Cellular Compromise, Lipid Metabolism, Molecular Transport, Small Molecule Biochemistry respective L: Cell Morphology, Cellular Growth and Proliferation, Cell Cycle, Carbohydrate Metabolism and Cellular Assembly and Organization. The top canonical pathways influenced were Epithelial Adherens Junction Signalling and Remodelling, Germ Cell Sertoli Cell Junction Signalling and NRF2-mediated Oxidative Stress Response. Correlatively, blastocyst rates on Day 8 were significantly lower in H and L v. Z (P , 0.05). The transcriptome data could explain the mechanisms behind the impaired development, as genes involved in cellular growth and energy metabolism in Day 8 blastocysts were affected. The fact that transcripts related to NRF2-mediated oxidative stress response and lipid metabolism are up-regulated suggests that insulin induces dysregulation of cellular functions and energy metabolism leading to impaired embryo developmental potential. Funded by FORMAS.

2

ELEVATED NONESTERIFIED FATTY ACID CONCENTRATIONS HAMPER IN VITRO BOVINE OVIDUCTAL EPITHELIAL CELL PHYSIOLOGY L. Jordaens, S. Valckx, P. E. J. Bols, and J. L. M. R. Leroy University of Antwerp, Universiteitsplein 1, Wilrijk, Belgium

Elevated nonesterified fatty acids (NEFA) have been recognised as an important link between lipolysis-based metabolic conditions and impaired fertility in high-yielding dairy cattle. However, NEFA effects on the oviductal micro-environment currently remain unknown. We hypothesise that elevated NEFAs may contribute to the complex pathology of subfertility and infertility by exerting a negative effect on bovine oviductal epithelial cell (BOEC) physiology. Therefore, the objectives of this study were to elucidate NEFA toxicity effects on BOEC, both qualitatively and morphologically, by assessing BOEC-sperm binding affinity, monolayer integrity, proliferation capacity and morphology. The BOEC of 4 bovine oviducts (4 replicates) at Day 3–5 of the oestrous cycle from a local slaughterhouse were mechanically isolated, pooled, and cultured in a polarized cell culture system (ThinCert, Greiner Bio-One, Frickenhausen, Germany) with DMEM/F12-based culture medium for 9 days until transepithelial electric resistance (TER) reached at least 700 O cm2 to prevent leakage between the 2 compartments. At Day 10, monolayers were exposed to a 720 mM NEFA mixture of OA, SA, and PA, for 24 h in 4 treatment groups according to exposure side: control, basal (B), apical (A), and AþB. The BOEC were washed and monolayer quality was assessed by means of a sperm binding assay (30 min co-culture of BOEC monolayer and 106 spermatozoa mL1), TER measurements (pre- and post-exposure) and a wound healing assay (8-h observation of BOEC proliferation capacity after over an artificial gap). Morphology of BOEC was assessed by scanning electron microscopy on cell polarity, presence of microvilli and cilia, and monolayer integrity. Data (mean s.d.) were analysed by mixed model ANOVA. In AþB, monolayers (31.28 6.16 sp/0.05 mm2) showed a significantly reduced sperm binding affinity compared to the control (97.90 10.76 sp/0.05 mm2; P , 0.05), and treatment A tended to be more affected (39.95 19.30 sp/0.05 mm2) than treatment B (68.55 15.38 sp/0.05 mm2; P ¼ 0.051). The absolute TER increase post-NEFA exposure in the control (110 11 O cm2) was significantly higher than in all the other treatments. Also, the TER increase differed significantly depending on the exposure side: in treatment A (3 6 O cm2), the TER increase was lower than in treatment B (29 8 O cm2), and monolayers in treatment AþB were even associated with a significant TER reduction (15 10 O cm2; P , 0.05). Cell proliferation capacity showed a significant closure of the gap in all treatments, but only the control group (41.64% closure) differed significantly (P , 0.05) from the other groups (B ¼ 28.3%, A ¼ 31.62%, Journal compilation Ó IETS 2015

www.publish.csiro.au/journals/rfd

94

Reproduction, Fertility and Development

Student Competition

AþB ¼ 30.9% closure) irrespective of the exposure side; BOEC morphology was not affected. Depending on the exposure side, elevated NEFA exert a negative effect on BOEC physiology but not morphology. Ultimately, these physiological alterations in its micro-environment may result in suboptimal development of the pre-implantation embryo and a reduced reproductive outcome.

3

SEX INFLUENCES REGULATION OF GENE EXPRESSION BY DICKKOPF 1 IN THE BOVINE MORULA A. C. DenicolA, K. B. DobbsA,B, and P. J. HansenA A

University of Florida, Gainesville, FL, USA; Northeastern University, Boston, MA, USA

B

Successful embryonic development depends upon molecules secreted by the reproductive tract. Among such molecules is the protein dickkopf 1 (DKK1), an antagonist of canonical WNT signalling that can also activate the noncanonical, planar cell polarity (PCP) pathway. DKK1 increases the proportion of cells that are trophectoderm and hypoblast in the blastocyst and increases competence of embryos to establish pregnancy after transfer to recipients. The objective was to determine whether DKK1 affects cell fate by regulating expression of genes that promote differentiation at the morula stage, possibly by activating the PCP pathway. A second objective was to determine if actions of DKK1 on the embryonic transcriptome were dependent on embryo sex. Bovine oocytes were fertilized in vitro with pools of 3 bulls for which X- and Y-sorted sperm was available. Embryos were treated with 100 ng mL1 DKK1 or vehicle at Day 5 of development and harvested 24 h later. Embryos were pooled in 5 replicates of 20 embryos each. Following RNA reverse-transcription and amplification, cDNA was used for microarray analysis of global gene expression using the AffymetrixÒ Bovine Gene 1.0 ST array (Affymetrix, Santa, Clara, CA, USA). Statistical analysis was performed by ANOVA using JMPÒ Genomics (SAS Institute, Cary, NC, USA). A total of 9931 transcripts were identified as being expressed. Differentially expressed genes (DEG) were considered as those associated with P , 0.05 and fold change $1.5 or ,0.66. There were 124 DEG between females and males (91 up-regulated in females and 33 upregulated in males). A total of 68% of the genes up-regulated in females were located in the X chromosome. Treatment with DKK1 resulted in 132 DEG in females (68 up-regulated and 64 down-regulated) and 136 DEG in males (90 up-regulated and 46 down-regulated). Of these, 34 genes were regulated by DKK1 in both sexes: 14 in the same direction and 20 in opposite directions. Analysis by IngenuityÒ Pathway software indicated that changes in gene expression caused by DKK1 would increase formation of actin fibers in females and inhibit formation in males. DKK1 inhibited expression of AMOT in male embryos, indicating that DKK1 may inhibit Hippo signalling at this stage of development. Evidence for regulation of the PCP pathway by DKK1 was the finding that DKK1 regulated expression of genes involved in cell polarization and differentiation in both females and males. In both sexes, DKK1 regulated expression of many genes associated with HNF4A, a marker of hypoblast cells that promotes formation of cell junctions. In conclusion, female and male embryos developing in vitro have different transcriptomic profiles at the morula stage. DKK1 regulates cell differentiation and embryonic development in a sex-dependent manner and effects may be mediated, at least in part, by activation of the PCP pathway. Supported by USDA AFRI 2011-67015-30688 and NIH R03 HD080855.

4

DEVELOPMENTAL OUTCOMES AND EFFICIENCY OF TWO CRISPR/CAS9 MICROINJECTION METHODS IN BOVINE ZYGOTES

Y. S. BogliottiA, M. VilarinõA, J. L. ChitwoodA, J. WuB, A. MuttoC, N. MucciD, J. C. BelmonteB, and P. J. RossA A

B

Department of Animal Science, University of California-Davis, CA, USA; Gene Expression Laboratory, Salk Institute for Biological Studies, La Jolla, CA, USA; C UNSAM, San Martin, Buenos Aires, Argentina; D INTA, Balcarce, Buenos Aires, Argentina

The CRISPR/Cas9 system is a fast, effective, and easy method for gene disruption, allowing generation of knockout animals by direct zygote injection. To date there is no report on the efficiency of this microinjection system in bovine zygotes and its effects on early development. The aim of this study was to compare 2 microinjection methods on developmental rates and efficiency to induce gene disruption. Microinjection effects on embryo development were evaluated by blastocyst (BL) formation rates at Day 8 of culture and by the proportion of lysed embryos (damaged during injection); while the efficiency of CRISPR/Cas9 RNA to create targeted mutations was studied by sequencing resulting blastocysts. Three groups were evaluated: (1) noninjected (control), (2) direct intracytoplasmic injection (direct-ICI), and (3) laser-assisted ICI (laser-ICI). Direct-ICI was performed with a beveled spiked glass needle (5 mm ID; Origio, Ma˚løv, Denmark) to pass the zona pellucida (ZP) and deliver CRISPR/Cas9 RNA as earlier described (Ross et al. 2008 BMC Dev. Biol. 8, 16). For laser-ICI, a Research Instruments (RI) Saturn 5 ActiveTM laser system (Research Instruments Ltd., Falmouth, United Kingdom) was used to perforate the ZP, and a blunt-end glass needle (5–6 mm ID) used to deliver CRISPR/Cas9 RNA. In both cases, cytoplasm was aspirated into the pipette to disrupt the plasma membrane and the aspirated cytoplasm and CRISPR/Cas9 injected back into the embryo. Embryos were obtained by IVF of in vitro-matured oocytes aspirated from abattoir ovaries. At 18 h post-IVF (hpf), zygotes were denuded from cumulus cells and cultured in groups of 25 in 50-mL drops of KSOM (Evolve, Zenith Biotech, Guilford, CT, USA) with 4 mg mL1 of BSA. Zygotes were injected at 20 to 22 hpf. Four biological replicates were assessed for BL rates (258 embryos total). A 2-tailed t-test was used to evaluate statistically significant differences (P # 0.05) between groups. Direct-ICI had a greater proportion of lysed embryos (29.5 10.6%) compared with laser-ICI (15.6 5%; P ¼ 0.056). BL development was significantly lower on direct-ICI (15.5 8%) compared with laser-ICI (31.4 5.9%; P ¼ 0.02) and control groups (32.8 6.6%; P ¼ 0.01). These results indicate that laser-ICI causes less damage and results in normal BL rates after microinjection (P ¼ 0.24). Because laser-ICI had normal BL rates and less embryo lysis, we used this method to evaluate efficiency of the CRISPR/Cas9 system to induce genomic mutations. Twelve BL were sequenced. Analysis of the CRISPR targeted region showed that 50% of the embryos had biallelic mutations, 33% monoallelic mutations, and 17% were wild type. These results show that laser-ICI method was very efficient for injecting CRISPR/Cas9 RNA into zygotes, resulting in normal developmental rates and a high amount of mutations in BL. The authors thank Research Instruments Ltd. for providing the laser used in this study.

Student Competition


95

5 PROPYLENE GLYCOL FEEDING SUPPLEMENTATION MODIFIES INSULIN-LIKE GROWTH FACTOR SYSTEM GENE EXPRESSION IN CUMULUS-OOCYTE COMPLEXES AND THE EXPRESSION OF SELECTED CANDIDATE GENES IN EMBRYOS PRODUCED IN VITRO IN FEED-RESTRICTED HEIFERS G. GamarraA,B, C. PonsartC, S. LacazeB, F. NuttinckD, P. MermillodE, B. Le GuienneA, D. MonniauxF, P. HumblotG, and A. A. PonterH,D A

UNCEIA De´partement Recherche et De´veloppement, Maisons Alfort, France; B MIDATEST, Denguin, France; C ANSES, Animal Health Laboratory, Maisons Alfort, France; D INRA, UMR 1198 Biologie du De´veloppement et Reproduction, Jouy-en-Josas, France; E INRA, UMR7247, Physiologie de la Reproduction et des Comportements, Nouzilly, France; F INRA, UMR85 Physiologie de la Reproduction et des Comportements, Nouzilly, France; G Division of Reproduction, Department of Clinical Sciences, Faculty of Veterinary Medicine and Agricultural Sciences, Uppsala, Sweden; H Universite´ Paris Est, Ecole Nationale Ve´te´rinaire d’Alfort, UMR 1198 Biologie du De´veloppement et Reproduction, Maisons Alfort Cedex, France Dietary supplementation with propylene glycol (PG) increases the rate of grade 1 embryos produced from feed restricted females (Gamarra et al. 2014 Reprod. Fertil. Dev.). The aim of this study was to evaluate if a PG feeding supplement could modify the expression profile of selected candidate genes that are important for in vitro embryo development and the gene expression patterns of the insulin-like growth factor (IGF) system in oocytes and cumulus cells in feed-restricted heifers. Feed-restricted heifers (n ¼ 16, growth rate of 600 g day1) received a single daily drench of 400 mL of water (group restricted, R) from Day 1 to Day 9 of a first synchronized oestrous cycle followed by 400 mL of PG from Day 1 to Day 9 of the second synchronized oestrous cycle (group restricted þ PG, RPG). Ovum pick-up (OPU) was performed following superovulation, on Day 5 of the oestrous cycle to produce embryos in vitro and on Day 9 without superovulation to obtain oocytes and cumulus cells. The same protocol was used in control animals (n ¼ 6, growth rate of 800 g day1). Real-time PCR was used to determine the relative abundance of genes involved in lipid metabolism and storage (PLIN2, SCD), energy metabolism (ATP5A1, GLUT1), membrane permeability (AQP3), epigenetic marks (DNMT3a), apoptosis (BAX, TP53), and protein processing (HSPA9B) in grade 1 blastocysts, IGF1, IGF1R, IGFBP2, IGFBP4 in cumulus cells, and IGF1R and IGFBP2 in oocytes. Mann-Whitney nonparametric tests were performed to analyse gene expression results. The expression of PLIN2, ATP5A1, GLUT1, AQP3, DNMT3a, BAX, and HSPA9B were decreased in embryos collected from restricted compared with control animals. The expression levels of these genes were restored when females were supplemented with PG. The expression of TP53 and SCD were not affected. In cumulus cells, the expression levels of IGF1, IGF1R, and IGFBP4 were decreased in restricted compared with control animals. The expression levels of IGF1 and IGF1R were restored with PG supplementation. No differences were observed for the IGFBP2 gene. In the oocytes, no differences were observed for the expression levels of IGF1R and IGFBP2 genes. In conclusion, this work shows for the first time that feed restriction and dietary supplementation by PG in heifers produced changes in gene expression in blastocysts and modified the pattern of the IGF system in cumulus cells. These results suggest the existence of an epigenetic regulation induced by PG during follicular growth, which can regulate the level of gene expression up to the blastocyst stage. In general, PG supplementation of feed-restricted donors restored gene expression at the levels observed after normal feeding.

6

EQUINE SPERM INDUCES PRONUCLEAR FORMATION BY INTRACYTOPLASMIC SPERM INJECTION IN BOVINE, SWINE, AND FELINE OOCYTES INDEPENDENTLY OF CHEMICAL ACTIVATION ASSISTANCE M. B. Rodrı´guezA, A. GambiniA,B, R. J. BevacquaA,B, and D. F. SalamoneA,B

A

Laboratorio de Biotecnologıá Animal, Facultad de Agronomıá, Universidad de Buenos Aires, Ciudad Autońoma de Buenos Aires, Argentina; B Consejo Nacional de Investigaciones Cientı´ficas y Tećnicas (CONICET), Argentina

Interspecific intracytoplasmic sperm injection (ICSI) is a valuable tool to study early events of fertilization in species for which oocyte availability is reduced. Equine in vitro fertilization remains unsuccessful and ICSI is the technique of choice for the in vitro production of high-value embryos. Therefore, the objective of this study was to evaluate the rate of pronuclear (PN) formation after ICSI with stallion sperm in bovine, swine and feline oocytes with or without chemical activation assistance. Ovaries from cows and pigs were collected at abattoirs whereas gonads from female domestic cats were obtained from ovariectomized animals at veterinary sterilization centers. Cumulus-oocyte complexes were matured in TCM-199 supplemented following standard protocols for each species. ICSI was performed in 100-mL drops of TALP-HEPES, using frozen-thawed semen from one stallion. Spermatozoa were held separate in 3-mL droplets of 7% (vol/vol) polyvinylpyrrolidone, where one of them was immobilized by swiping the injection pipette across its tail, and then injected into the matured oocyte. After ICSI, some oocytes were chemically activated with 5 mM ionomycin for 4 min (cow and cat) or with an electric pulse (sow) followed by 3 h in culture medium to allow extrusion of the second polar body and then exposure to 1.9 mM 6-DMAP solution for 3 h. Embryos were cultured in SOF medium. After 17 h of culture, embryos were stained with propidium iodide to identify the percentage of oocytes activated and with PN. Haploid and diploid parthenogenetic controls were included. Cleavage (48 h after activation) and blastocyst formation (7–8 days) of the partenogenetic control groups were assessed. There were no statistical differences (chi-squared analysis) in PN formation between the activated and nonactivated groups within species. When the activated group was compared between the different species, no differences were observed. However, for the nonactivated group, significant differences were observed between species. The feline oocyte showed the higher percentage of PN and activation, whereas the bovine oocyte exhibited the lower rate of PN formation (cat: 22/27, 81.48%; swine: 19/39, 71.64%; cow:18/63, 43.07%). Our results suggest that the feline oocyte can be used as model to study fertilization events associated with the stallion sperm due to the higher efficiency in supporting PN formation. Our results indicate that the equine sperm is capable of inducing PN formation in these 3 species without further chemical activation assistance.

96


Artificial Insemination

Artificial Insemination 7 PREGNANCY RATES IN BEEF HEIFERS SYNCHRONIZED WITH A SHORTENED OESTRADIOL-BASED TREATMENT THAT PROVIDES FOR A PROLONGED PROESTRUS A. MenchacaA, R. Nun˜ez-OliveraA, F. CuadroA, and G. BoB,C A

Instituto de Reproduccion Animal Uruguay, Fundacion IRAUy, Montevideo, Uruguay; B Instituto de Reproduccion Animal Cordoba (IRAC), Cordoba, Argentina; C Inst. A.P. de Ciencias Ba´sicas y Aplicadas, U. Nacional de Villa Maria, Cordoba, Argentina An oestradiol-based protocol (named J-Synch) has been developed recently with the aim of providing for a longer proestrus, enhancing the development of the dominant follicle before ovulation, and increasing pregnancy rates following fixed-time AI (FTAI) in heifers (de la Matta and Bo 2012 Taurus 55, 17–23). Two experiments were performed in Uruguay with 1953 Angus Hereford crossbred heifers to compare pregnancy rates obtained with the J-Synch protocol with the conventional 7-day oestradiol-based protocol. A secondary objective was to determine the effects of the time of FTAI and the addition of eCG at the time progestin device removal on pregnancy rates. In Experiment 1, 966 heifers received a DIB device (0.5 g of progesterone, Syntex, Buenos Aires, Argentina) plus 2 mg of oestradiol benzoate IM (Syntex) on Day 0. Heifers in the conventional treatment group (n ¼ 485) received cloprostenol (500 mg, Ciclase DL, Syntex) and oestradiol cypionate (0.5 mg, Cipiosyn, Syntex) IM and had their DIB removed on Day 7 a.m. Heifers in this group were then subdivided to be FTAI on Day 9 a.m. or p.m. (i.e. 48 or 56 h after DIB removal). Heifers in the J-Synch treatment group (n ¼ 481) received cloprostenol IM and DIB removal on Day 6 p.m. and received gonadotropin-releasing hormone (100 mg gonadorelin acetate, Gonasyn Gdr, Syntex) on Day 9 a.m.; heifers were then FTAI on Day 9 a.m. or p.m. (i.e. 60 or 72 h after DIB removal). All heifers in this experiment were also treated with 300 IU of eCG (Novormon, Syntex) at DIB removal. In Experiment 2, 987 heifers were treated with the J-Synch protocol as described in Experiment 1. At device removal (Day 6 p.m.), heifers were divided to receive (n ¼ 488) or not (n ¼ 499) 300 IU of eCG IM at that time and were further subdivided to receive gonadotropin-releasing hormone and FTAI on Day 9 a.m. or p.m. (i.e. 60 or 72 h after DIB removal). Pregnancy rates were determined by ultrasonography 30 days after FTAI. Data were analysed using logistic regression, and results are shown in Table 1. J-Synch-treated heifers tended (P , 0.1) to have higher pregnancy rates following FTAI, whereas time of FTAI only affected pregnancy rates following the conventional 7-day treatment (P , 0.05). However, removal of eCG from the J-Synch protocol in Experiment 2 resulted in reduced pregnancy rates when inseminations were done on Day 9 p.m. (P , 0.05). In summary, the addition of eCG to the J-Synch protocol provided for a wider window of insemination times facilitating FTAI in large groups of beef heifers. Table 1. Effect of length of progestin insertion, time of insemination and eCG treatment on pregnancy rates in beef heifers

Experiment 1 FTAI Day 9 a.m. FTAI Day 9 p.m. P-value Total (n ¼ 966) Experiment 2 FTAI Day 9 a.m. FTAI Day 9 p.m. P-value Total (n ¼ 987)

8

6-day treatment (J-Synch)

7-day treatment (conventional)

P-value

62.4% (156/250) 56.3% (130/231) 0.17 59.5% (286/481) J-Synch þ eCG 54.4% (131/241) 53.0% (131/247) 0.77 53.7% (262/488)

58.6% (139/237) 49.6% (123/248) 0.05 54.0% (262/485) J-Synch eCG 54.5% (140/257) 42.1% (102/242) 0.05 48.5% (242/499)

0.40 0.14 0.09 0.98 0.05 0.10

COMBINATION OF OESTRUS DETECTION AND FIXED-TIME ARTIFICIAL INSEMINATION IN BEEF HEIFERS FOLLOWING A SHORTENED OESTRADIOL-BASED PROTOCOL THAT PROVIDES FOR A LENGTHENED PROESTRUS J. J. de la MataA, M. ReÁ, and G. A. BoÁ,B A

B

Instituto de Reproduccion Animal Cordoba (IRAC), Cordoba, Argentina; Instituto A.P. de Ciencias Basicas y Aplicadas, Universidad Nacional de Villa Maria, Cordoba, Argentina

Studies have shown that gonadotropin-releasing hormone-based protocols that reduce the period of progestin insertion and prolong the period from progestin removal to gonadotropin-releasing hormone and fixed-time AI (FTAI; named 5-day Co-Synch) results in similar or higher pregnancy rates than the conventional 7-day Co-Synch protocol in beef cows and heifers (Bridges et al. 2008 Theriogenology 69, 843–851). Similar findings have been reported following the use of an oestradiol-based protocol that also provides for a longer period of proestrus (named J-Synch; de la Mata and Bo´ 2012 Taurus 55, 17–23). An experiment was designed to compare the J-Synch protocol for synchronization of ovulation that allows for a prolonged proestrus with a conventional 7-day oestradiol-based protocol for FTAI in heifers. Cycling 18-month old Angus and Hereford heifers (n ¼ 208) with a body condition score of 6 to 7 (scale of 1 to 9) were randomly allocated to 1 of 2 treatment groups. Heifers in the 7-day EB group (n ¼ 105) received a



97

progesterone (P4) device (DIB 0.5 g of P4, Syntex SA, Buenos Aires, Argentina) and 2 mg of oestradiol benzoate (EB, Syntex SA) on Day 0 and 500 mg of cloprostenol (PGF; Ciclase DL, Syntex SA) and 0.5 mg oestradiol cypionate (Cipiosyn, Syntex SA) on the day of DIB removal (Day 7). Heifers were also tail painted at the time of DIB removal and observed for signs of oestrus (i.e. tail paint rubbed off). Those with the tail paint rubbed off by 36 h after DIB removal were inseminated 12 h later, whereas those not showing oestrus by 36 h were FTAI at 54 h. Heifers in the J-Synch group (n ¼ 103) received DIB and 2 mg of EB on Day 0 and PGF on the day of DIB removal (Day 6). Heifers in this group were also tail painted at DIB removal, and those with their tail paint rubbed off by 48 h were inseminated 12 h later; those not showing oestrus by 60 h received 100 mg of gonadorelin acetate (gonadotropin-releasing hormone, Gonasyn gdr, Syntex SA) and were FTAI at 72 h after DIB removal. Pregnancy was diagnosed by ultrasonography at 55 days after FTAI (Honda 101V, 5.0-MHz transducer). Data were analysed by logistic regression. Oestrus detection rate and pregnancy rate to FTAI did not differ (P . 0.1) between groups (38.8%, 40/103 and 60.3%, 38/ 63 for heifers in the J-Synch group v. 28.5%, 30/105 and 45.3%, 34/75 for those in the 7-day EB group). However, pregnancy rates to observed oestrus tended (P , 0.09) to be higher and the overall pregnancy rate was significantly higher (P , 0.01) in heifers in the J-Synch group (80.0%, 32/40 and 67.9%, 70 /103) compared with those in 7-day EB group (50%, 15/30 and 46.6%, 49/105). Furthermore, heifers within the J-Synch group that had their tail paint rubbed off by 48 h after DIB removal and were AI 12 h later (i.e. 60 h) had higher (P , 0.05) pregnancy rate than those in the same group that were FTAI. In conclusion, reducing the time of progestin device insertion and lengthening the proestrus period, as in the J-Synch protocol, results in higher pregnancy rates than with the conventional oestradiol-based protocol. Furthermore, the combination of oestrus detection and FTAI would appear to improve the pregnancy outcome even more.

9

TIMED ARITIFICIAL INSEMINATION IN BLOCKS: A NEW ALTERNATIVE TO IMPROVE FERTILITY IN BEEF COWS

L. F. M. PfeiferA,F, N. A. CastroB,F, L. G. B. SiqueiraC, K. R. LagosD,F, A. BagonD,F, and J. SinghE A

Embrapa Rondonia, Porto Velho, RO, Brazil; University of Rondonia, Porto Velho, RO, Brazil; C Embrapa Dairy Science, Juiz de Fora, MG, Brazil; D FIMCA – Faculdade Aparıćio Carvalho, Porto Velho, RO, Brazil; E University of Saskatchewan, Saskatoon, SK, Canada; F OVARO – Research Group in Animal Reproduction of Rondonia, Porto Velho, RO, Brazil B

The objective of this study was to evaluate whether timed artificial insemination (TAI) according to the diameter of the dominant preovulatory follicle (POF) would improve pregnancy rates in beef cows. In Experiment 1, a retrospective meta-analysis of 5 oestradiol- or gonadotropin-releasing hormone-based TAI experiments from 2011 to 2014 was performed to evaluate the interval from luteolysis to ovulation. In these experiments, crossbred cows (Gyr Holstein; n ¼ 60) were examined by ultrasonography at 12-h intervals from progesterone-releasing device (CIDR) removal to ovulation. A linear regression model was used to predict the effect of POF diameter on the time of ovulation. Cows with a larger POF at the time of AI ovulated earlier than cows with smaller POF (y ¼ 8.25x þ 115.22; R2 ¼ 0.93; P , 0.0001). In Experiment 2, lactating Nelore cows (Bos indicus; n ¼ 59) on random days of the oestrous cycle were given 2 mg of oestradiol benzoate IM and a CIDR device (Day 0) to synchronize follicular waves. The CIDR were removed, and cows were given 500 mg of d-Cloprostenol (prostaglandin F2a) IM, 1 mg of oestradiol cypionate IM, and 300 IU of eCG IM on Day 8. On the morning of Day 10 (07:00 a.m.), the diameter of the POF was assessed by ultrasonography, and cows were randomised into Control (n ¼ 29) and Block (n ¼ 30) groups. 1) Control-group cows were TAI 48 h after CIDR removal (08:00 a.m. on Day 10), and Block-group cows were inseminated at 4 time points according to the diameter of the POF: B0 (POF $15 mm, TAI at 08:00 a.m. on Day 10, n ¼ 6), B1 (POF 13 to 14 mm, TAI at 02:00 p.m. on Day 10, n ¼ 8), B2 (POF 11 to 12 mm, TAI at 08:00 a.m. on Day 11, n ¼ 11), and B3 (POF # 10 mm, TAI at 02:00 p.m. on Day 11, n ¼ 5). Pregnancy status was assessed 30 days post-AI by ultrasonography. No differences were detected in the diameter of the POF 48 h after CIDR removal (P ¼ 0.77) or ovulation rate (P ¼ 0.65; combined ovulation rate 52/59, 88%) between Control and Block groups. Block group had a higher pregnancy rate than Control (22/30, 73% v. 13/29, 45%, respectively; P ¼ 0.02). In conclusion, our results document that interval from luteolysis to ovulation depends on the size of preovulatory follicle, timing of AI in relation to ovulation time is critical, and AI time according to the diameter of the POF can be an effective tool to improve fertility of cows in TAI protocols.

10

TIMED ARTIFICIAL INSEMINATION PROTOCOLS TO SYNCHRONIZATION OF OVULATION IN BOS TAURUS TAURUS SUCKLING BEEF COWS

G. A. PessoaA, A. P. MartiniB, J. M. TrentinA, D. R. DottoB, H. L. D. NeriC, D. T. SchreinerC, G. M. ZanattaB, M. F. Sa´ FilhoB, and M. I. B. RubinB A

Universidade Federal do Rio Grande do Sul, Av. Bento Gonçalves, 9090 – Agronomia Porto Alegre/RS, Brazil; B Universidade Federal de Santa Maria, Laborato´rio de Embriologia Animal – Embryolab Avenida Roraima, 1000, 97105-900 Santa Maria-RS, Brazil; C Hertape Calier do Brasil, Juatuba, MG, Brazil; D Universidade de Saõ Paulo, Saõ Paulo, Brazil

The aim of this study was to compare 3 methods for synchronization of ovulation in anestrous beef cows. The hypothesis of this study was to determine whether low doses of hCG has superior efficacy to cypionate to induce ovulation in anestrous cows and provide higher pregnancy rate in oestrus-synchronization programs. Synchronization of ovulation and conception rate to timed AI (TAI) were evaluated in anestrus Bos taurus taurus suckling beef cows 45 15 days postpartum and with body condition score of 2.9 (1 to 5) maintained in a native pastured system in the south of Brazil. Females were evaluated with ultrasound on the Day 0 (D0) of the protocol (Day 0), day 8 (D8), immediately before TAI (D10), and 7 days after TAI

98



(Day 17). All cows were synchronized with an intravaginal progesterone-releasing device (IPRD; 0.75 g of progesterone, ProciclarÒ, Hertape Calier Animal Health, Juatuba, Brazil) and 2 mg IM of oestradiol benzoate (EB; Benzoato HCÒ) on D0. On Day 8, the IPRD was removed and 150 mg of D (þ) cloprostenol (Veteglan LuteolyticÒ), and 25 IU IM FSH/LH (PlusetÒ) were administered. Females of the EC (n ¼ 84) group received 1 mg IM of oestradiol cypionate (EC; Cipionato HCÒ). Females on D8 of the hCG (n ¼ 81) group received 500 IU IM of hCG (VetecorÒ, Hertape Calier) at the time of TAI. The females of the EC þ hCG group (n ¼ 83) received both treatments. All cows were submitted to TAI 54 h after withdrawal of IPRD. A part of the cows (n ¼ 102) had the ovulation evaluated every 12 h from the withdrawal of IPRD [EC (n ¼ 34), hCG (n ¼ 34), and hCG þ EC (n ¼ 33)]. Statistical analysis was performed using SAS PROC GLIMMIX. The dominant follicle diameter (FD) on Day 8 (8.7 0.2, 8.8 0.2, 8.6 0.2) did not differ between treatments EC, EC þ hCG, or hCG (P ¼ 0.79). However, the FD on D10 was higher (P ¼ 0.001) for cows treated with hCG (12.9 0.3) compared with cows from the EC (11.3 0.2) or EC þ hCG group (11.8 0.2). The interval (h) between the withdrawal of IPRD and ovulation was lower (P ¼ 0.01) for the hCG group, (71.2 1.7) compared with the groups treated with EC or EC þ hCG (76.6 2.18 and 74.2 1.65), respectively. The ovulation rate did not differ (P ¼ 0.61) among the EC (85.2%, 29/34), hCG (91.1%, 31/34), or EC þ hCG groups (90.9%, 30/33). Corpus luteum diameter (mm) was higher (P ¼ 0.04) on D17 for the hCG-treated group (21.4 0.3) compared with others treatments (EC ¼ 19.1 0.8 or EC þ hCG ¼ 20.4 0.8). However, the plasma progesterone levels on D17 were EC ¼ 2.0 0.1, hCG ¼ 2.4 0.1, and EC þ hCG ¼ 2.3 0.1 ng mL1 (P ¼ 0.19), and the conception rate on the 28th day after TAI (EC ¼ 43.0%; hCG ¼ 47.0%, and EC þ hCG ¼ 48.8%; P ¼ 0.76) was also similar. The hCG determined smallest ovulation interval, but similar rates of pregnancy were observed with both treatments.

11

FERTILITY RESPONSE IN SUCKLED BEEF COWS SUPPLEMENTED WITH LONG-ACTING PROGESTERONE AFTER TIMED ARTIFICIAL INSEMINATION G. PugliesiA, F. B. SantosA, E. LopesA, E´. NogueiraB, J. R. G. MaioC, and M. BinelliA A

Department of Animal Reproduction, University of Saõ Paulo, Pirassununga, SP, Brazil; B Embrapa Pantanal, Corumba´, MS, Brazil; C Ouro Fino Saude Animal, Cravinhos, SP, Brazil

Corpus luteum (CL) and progesterone (P4) secretion are affected by preovulatory follicle (POF) size. Increased circulating P4 during early diestrus has a positive effect on embryo development in beef cattle. However, the combined effects of the POF size and P4 supplementation during early diestrus on fertility of beef cows are not known. The objective was to evaluate the effects of POF size and supplementation of long-acting P4 after timed-AI on pregnancy rates (P/AI). Suckled Nelore cows (n ¼ 596) were evaluated twice by transrectal Doppler ultrasonography (US) 10 days apart to detect the cyclic status. In Study 1, anestrous cows (absence of CL on both exams) received an intravaginal P4 device and an oestradiol benzoate (EB) injection on Day 10 (day of the second US). Devices were removed and sodium cloprostenol [prostaglandin F2a (PGF2a)], oestradiol cypionate, and eCG were given on Day 2. Cows were timed-AI on Day 0 and assigned to receive placebo (control group, n ¼ 187) or 150 mg of longacting P4 on Day 4 (P4 group, n ¼ 189). In Study 2, cyclic cows (presence of CL) received a PGF2a injection on Day 20 (first US). Cows with a new CL on Day 10 received an intravaginal P4 device and an injection of EB and were split to receive an injection of PGF2a [large follicle (LF); n ¼ 109] or not [small follicle (SF); n ¼ 111]. Devices were removed and PGF2a was injected on Day 2. Ovulation was induced with buserelin acetate, and cows were timed-AI on Day 0 and split to receive placebo (LF/control group, n ¼ 55, and SF/control group, n ¼ 55) or 150 mg of long-acting P4 on Day 4 (LF/P4 group, n ¼ 56, and SF/P4 group, n ¼ 54). Ultrasonographic scanning was done on Days 0, 4, and between 35 and 40 to detect the POF and CL sizes and P/AI, respectively. Data were analysed using PROC GLIMMIX (SAS Institute Inc., Cary, NC). In anestrous cows, P/AI was reduced in POF with ,11 mm. The P/AI was greater in the P4-treated group than in the control group for all cows (55.6% v. 46.0%; P ¼ 0.05) and for ovulated cows (59%, 105/178 v. 49%, 86/173; P ¼ 0.08). For cyclic cows, POF size (mm) on Day 0 (13.5 0.3 v. 11.2 0.2), ovulation rate (90% v. 77%), and CL area (cm2) on Day 4 (1.46 0.05 v. 1.25 0.05) were greater (P , 0.007) in the LF group than in the SF group. There was a main effect of follicle group on P/AI (54%, LF group v. 38%, SF group; P , 0.01). Moreover, P/AI were greater (P , 0.05) in the LF/control (56%) and LF/P4 (52%) groups than in the SF/control group (31%), whereas no difference was detected between the SF/P4 group (45%) and the other groups. Among cows that ovulated, P/AI was lower (P ¼ 0.05) in the SF/control group (41%, 17/41) compared with the LF/control group (62%, 31/50) and were similar for the SF/P4 group (56%, 25/45) and LF/P4 group (57%, 28/49) compared with others. We suggest that P4-stimulated embryotrophic effects improved fertility in anestrous beef cows supplemented with long-acting P4 on Day 4 after timed-AI. Also, the presence of a functional CL during follicle growth results in smaller POF and CL and reduces the ovulatory and P/AI rates in cyclic cows. Post-AI P4 supplementation may attenuate the negative effects of small POF/CL. Research was supported by CNPq, FAPESP, Ouro Fino Agronegoćio, and Innovare.

12

EFFECT OF HUMAN CHORIONIC GONADOTROPIN (HCG) ADMINISTRATION ON DAY 2 OR DAY 5 AFTER OESTRUS ON PREGNANCY RATE IN HIGH-YIELDING DAIRY COWS J. M. SanchezA, V. MailloB, L. MolinaA, C. C. Perez-MarinA, P. LonerganC, and D. RizosB A

Department of Animal Medicine and Surgery, University of Cordoba, Cordoba, Spain; B Department of Animal Reproduction, INIA, Madrid, Spain; C School of Agriculture and Food Science, University College Dublin, Dublin, Ireland

In cattle, ,40% of embryonic loss occurs in the period from Day 8 to Day 16 of pregnancy. A significant proportion of embryo loss may be due to inadequate circulating progesterone (P4) concentrations. Low P4 concentrations have also been implicated as a causative factor in the low pregnancy rates (PR) observed in high-yielding dairy cows. Administration of hCG during the early luteal phase stimulates hypertrophy of the original corpus



99

luteum (CL) and, depending on the day of administration, induces ovulation of the first-wave dominant follicle and formation of a functional accessory CL, which increases circulating P4 concentrations. The aim of this study was to examine whether administration of hCG on Day 2 or Day 5 after oestrus after timed AI (TAI) would lead to an increase in pregnancy rates in dairy cattle. Lactating Holstein cows (n ¼ 194) from 12 commercial dairy herds in Southern Spain (37.88338 N, 4.76678 W) with an average milk production at 37.8 L/cow per day and typically with a PR to first AI of ,30% were randomly assigned based on their body condition score (2.65 0.05; mean SEM), parity (2.60 0.09), and days in milk (75.06 0.63) to 1 of 3 treatments and administered a single intramuscular injection of 3000 IU of hCG (4 mL of Veterin Corion) either (1) on Day 2 ¼ 36 h after TAI (n ¼ 65; hCG2 group), (2) Day 5 ¼ 108 h after TAI (n ¼ 64; hCG5 group), or (3) 4 mL of saline on Day 2 ¼ 36 h after TAI (n ¼ 65; control group). Cows were synchronized using a 7-day Ovsynch TAI protocol that included a P4-releasing intravaginal device (PRID DELTA 1.55 g). First, gonadotropin-releasing hormone (Cystorelin 100 mg) treatment was administered at PRID insertion (Day 0) followed by 25 mg Dinoprost (prostaglandin F2a: Enzaprost T) on Day 7 at PRID withdrawal. Then, 56 h later, the second gonadotropin-releasing hormone (100 mg) treatment was administered and all cows were inseminated 16 h later. Pregnancy was diagnosed by ultrasonography 28 to 32 days after TAI. Logistic regression model and chi-squared test were used to analyse data. Pregnancy rate to AI was significantly higher in the hCG2 and hCG5 groups than in the control group (43.1 and 45.3%, v. 27.7%; P , 0.05). A treatment-by-parity interaction was observed; while pregnancy rate for primiparous cows was not affected by treatment, multiparous cows from the hCG2 group had greater pregnancies per AI than those in the control group (47.2% v. 21.1%, respectively; P , 0.05). In conclusion, these preliminary results suggest that hCG administration on Day 2 and 5 after oestrus increases PR at first postpartum AI in Holstein cows. In addition, hCG on Day 2 increases the fertility in multiparous cows. This study was funded by the Spanish Ministry of Science and Innovation (AGL2012–37510) and partially supported by Ceva Salud Animal S.A., Spain – synchronization protocol and DFV, Spain – hCG treatments.

13 USE OF EQUINE CHORIONIC GONADOTROPIN OR FOLLICLE-STIMULATING HORMONELUTEINIZING HORMONE AT IMPLANT REMOVAL OR AT FIXED-TIME ARTIFICIAL INSEMINATION TIME IN PREGNANCY RATE OF SUCKLED NELLORE COWS E. Nogueira, U. Abreu, L. Oliveira, J. Borges, and W. Rodrigues Embrapa Pantanal, Corumba´, MS, Brazil Use of eCG as an inducer of follicular growth has improved the efficacy of fixed-time artificial insemination (FTAI) protocols and increased the ovulatory responses and pregnancy rates in beef cattle with low body condition scores (BCS) or are recently postpartum and anestrous. However, there are other gonadotropins such as FSH in different commercial applications (PlusetÒ – FSH : LH proportion ,50.0%) that could be potentially used to increase follicular growth but with controversial results. The goal of this trial was to evaluate the effects of replacing eCG with FSH/LH in two moments on the pregnancy rates (PR) of lactating Bos indicus cows raised in native grassland at Pantanal. The cows were subjected to a synchronization-of-ovulation protocol and FTAI based on progesterone, oestradiol benzoate (EB), and prostaglandin F2a. On Day 0, Nellore multiparous cows (n ¼ 352) at 42 days postpartum with BCS ¼ 4.9 (1–9) were evaluated by transrectal ultrasonography and received progesterone implant (DIB 1.0 g of progesterone) plus 2 mg of EB IM. Devices were removed and prostaglandin F2a was injected on Day 8 with 1 mg of EB. At the time of implant removal, the animals received T1 – 1 mL of saline solution IM (control; n ¼ 80); T2 – 300 IU IM of eCG (NovormonÒ; ECG; n ¼ 92); T3 – 40 IU IM of FSH/LH (PlusetÒ; Pluset; n ¼ 98). The T4-group cows received 40 IU IM of FSH/LH (PlusetÒ) at FTAI time (Pluset-FTAI; n ¼ 82); cows were timed-AI on Day 10 (44–48 h after implant removal) and evaluated by transrectal ultrasonography to measure the preovulatory follicle (POF) at FTAI and to estimate the pregnancy rate on Day 45. The effects of the treatment, sire, and BCS on pregnancy rate were evaluated using PROC GLIMMIX (SAS Institute Inc., Cary, NC). Because there was no difference between BCS, sire, and PR, they were removed from model. Pregnancy rate was not different between the treatment groups (control: 38.70%; ECG: 51.08%; Pluset: 45.91%, and Pluset-FTAI: 39.02%; P . 0.05), but the difference was found in POF, higher in ECG group – 13.53 mm compared with others (Pluset: 12.79 mm; control: 11.73 mm, and Pluset-FTAI: 12.01 mm; P , 0.05). Although PR was not different between treatments, the data are in agreement with the size of POF, where the largest POF are associated with tendency of higher pregnancy rates in ECG group. In conclusion, commercial FSH solution does not provide increases in PR, and eCG increases the preovulatory follicles in Nellore cows with a low-moderate BCS submitted to a progesterone-based FTAI protocol with EB at implant removal.

14

IS THE LOW NUMBER OF OVARIAN ANTRAL FOLLICLES $3 MM IN DIAMETER ASSOCIATED WITH LOW FERTILITY IN LACTATING NELORE COWS? V. G. PinheiroA, R. L. ErenoA, E. M. RazzaA,B, C. M. BarrosA, and M. F. G. NogueiraB A

Department of Pharmacology, IBB, Saõ Paulo State University (UNESP), Botucatu, Saõ Paulo, Brazil; B Department of Biological Sciences, FCL, UNESP, Assis, Saõ Paulo, Brazil

The follicular growth in cattle occurs in a wave pattern of 2 to 3 waves per oestrous cycle and is characterised by synchronous growth of a cohort of antral follicles, where usually only one of these will become dominant. The amount of recruited follicles per wave is variable between animals and breeds but is highly repeatable among individuals. Some studies report that in Bos indicus the amount of follicles recruited by wave is higher when compared with Bos taurus. The variation in the size of the ovarian follicular population can affect fertility by influencing oocyte competence (Ireland et al. 2007). We aimed to identify Nelore (Bos indicus) cows with high and low numbers of antral follicles recruited by follicular wave and to compare their pregnancy rates. We used 268 multiparous Nelore cows between 40 and 70 days postpartum and body condition score between 3.5 to 4.5 (5-point scale). The cows were sorted in ascending order according to the average number of follicles at all examinations ($3 mm in diameter). Hence, 33% of

100



animals with the greater follicular population were enrolled in the high population group (HG, n ¼ 89, $38 follicles), whereas the intermediate animals (33%) were placed in the intermediate group (IG, n ¼ 88, between 28 and 38 follicles), and animals (33%) with lower follicular population were included in the low population group (LG, n ¼ 91, #28 follicles). The animals underwent 3 ultrasound examinations (days D10, D0, and D28). In D0, at random day of the oestrous cycle, all cows received an intravaginal device containing progesterone (1.0 g, DIBÒ) and oestradiol benzoate (EB, 2.0 mg, IM, EstroginÒ). Eight days later (D8) we administered 75 mg of D-cloprostenol (CronibenÒ), and the intravaginal device was removed. Twenty-four hours after DIB removal, the cows were treated with EB (1.0 mg, IM), and after 30 to 36 h animals were AI at a fixed time. Data were analysed using PROC GENMOD SAS System 9.1 for Windows (2002–2003). The mean (SD) of antral follicles in both ovaries was 32.7 17.8. There was no difference (P ¼ 0.144) in pregnancy rates between the HG, LG, and IG animals (32.6, 46.6, and 42.9%, respectively). Thus, we conclude that there was no difference in pregnancy rates between Nelore cows either with high or low population of ovarian antral follicles after AI at a fixed time. Research was supported by grants #2013/02201-3 (VGP), #2011/50259-5 (RLE), #2012/23409-9 (EMR), #2012/50533-2 (MFGN), Saõ Paulo Research Foundation (FAPESP).

15

SPERM STORAGE IN FEMALE REPRODUCTIVE TRACT: STUDY OF MOLECULES INVOLVED C. RiouA,B, A. GargarosC, G. HarichauxC, A. BrionneD, J. GautronD, X. DruartB, V. LabasC, and N. GerardB A U.N.C.E.I.A., Nouzilly, France; UMR PRC INRA, Nouzilly, France; C INRA, Plateforme d’Analyse Inte´grative des Biomolećules, Nouzilly, France; D INRA, URA, Nouzilly, France B

Because of prolonged sperm storage in their oviduct, domestic hens can produce fertile eggs for up to 3 weeks following a single AI. The oviduct secretions may have an effect on sperm survival, but its composition during fertilization is unknown. In the present study, we compared the proteomic content of uterine fluid collected from two lines of hens divergent by their duration of fertility period (DFP), which defined sperm-storage duration. The first line displays a shorter period of sperm storage (10 days, line DFP), whereas the second displays a longer period of sperm storage (21 days, DFPþ). The aim was to identify proteins or peptides that may be involved in spermatozoa survival. Uterine fluid was collected 10 h after oviposition either before (n ¼ 5/line) or 24 h after (n ¼ 5/line) AI. Samples were pooled by condition: DFPþ before AI, DFPþ after AI, DFP before AI, and DFP after AI. Bottom-up approach using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and nano LC-MS/MS was performed (3 replicates). Data were matched against the NCBInr database (2014) using Mascot, and identifications were validated by the peptide and protein Prophet algorithm using Scaffold software. To determine the differences in protein expression, spectral counting and XIC quantitative methods were employed using Scaffold Qþ (P , 0.05, ratio . 2). Two proteins were up-regulated and one was down-regulated in oviductal secretion of both lines in response to AI. However, AI induced a significantly different abundance between protein content of DFP and DFPþ fluids. A panel of 8 proteins, included one DFPþ-specific protein, was more abundant in DFPþ line than in DFP. Only one protein was less abundant in DFPþ line than in DFP. In conclusion, the presence of sperm in the genital tract induced quantitative differences of the protein content of the uterine fluid in DFP and DFPþ hen lines. These differences imply proteins that are known as male proteins (sperm, seminal plasma, testis). Analysis of sperm protein modifications after storage will help us to understand the functional implication of these candidates.

16

BIOCHEMICAL ANALYSIS OF COMPONENT IN SEMINAL GEL SECRETED WITH BOAR SEMEN G. TakahashiA, M. MaedaB, Y. KimuraB, and H. FunahashiA A Department of Animal Science, Okayama University, Okayama, Japan; Department of Biofunctional Chemistry, Okayama University, Okayama, Japan

B

Seminal gel (SG), a part of semen, of the boar originates from secretions from the Cowper’s gland and has a high viscosity and water-holding capacity, preventing backflow of semen at natural mating. However, there are is little information available about biochemical and functional characteristics of boar SG. In this study, as a first step to elucidate the chemical features of the SG, we examined the structure of O-glycans and the primary structure of protein from the boar SG. Seminal gel was collected from ejaculated semen of a Berkshire boar with high fertility and freeze-dried. Samples were preserved in a refrigerator until experiments were conducted. For Exp. 1 the presence of O-glycans in SG was confirmed by detection of the amino sugar, galactosamine (GalNH2), from acid hydrolysis of GalNAc. The freeze-dried SG (1 mg) was hydrolyzed with 4N trifluoroacetic acid at 1108C for 2 h. The resulting amino sugar was labelled with phenyl isothiocyanate (PITC) and then analysed by RP-HPLC. The GalNAc was detected as a main amino sugar, suggesting that the SG contains O-glycosylated glycoprotein. For Exp. 2 the O-glycans were prepared from the freeze-dried SG (5 mg) by hydrazinolysis at 1008C for 2 h. After N-acetylation, the O-glycans were pyridylaminated. The structures were identified by anion-exchange HPLC, size-fractionation HPLC, glycosidase digestion, and ESI-MS and MS/MS analysis. Almost all glycans were digested by a2–3,6-sialidasae, indicating that these O-glycans are sialylated and give the glycoproteins viscosity. Furthermore, the MS analysis showed that the de-sialylated O-glycans consist of HexNAc-PA (m/z 300.0) and Hex-HexNAc-PA (m/z 462.0) and major glycans are di- or tri-saccharides. For Exp. 3 proteins in the SG were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing condition with 5% 2-mercaptoethanol. Proteins were stained with Coomassie Brilliant Blue R-250. Three bands (,160, 140, and 70 kDa) were found on 7.5% polyacrylamide gel, but two bands (160, 140 kDa) were converted to ,130 kDa after the sialidase digestion, indicating that native two proteins (160 and 140 kDa) may be highly sialylated. For Exp. 4 internal amino acid sequence was analysed using one of the peptic peptides. The freeze-dried SG (5 mg) was digested with porcine pepsin in 5% formic acid at 378C for 3 h. The resulting peptides were separated by RP-HPLC. N-terminal



101

sequence of one of the peptic peptides was WSEKYGIPGGKAH. The amino acid sequence showed a high homology with tyrosine-protein kinase ZAP-70. These results suggest that boar SG contains mucin-like glycoproteins carrying heavily sialylated O-glycans. Additionally, the current study suggests a possibility that some protein components of the boar SG derive from high concentration of the kinase in (dead) sperms.

17

EFFECT OF LOCAL TREATMENT OF SEMINAL VESICULITIS ON THE QUALITY OF EQUINE FRESH SEMEN

Y. F. R. Sancler-Silva, G. A. Monteiro, C. Ramires-Neto, C. P. Freitas-Dell’Aqua, A. M. Crespilho, and F. O. Papa Sao Paulo State University, Botucatu, SP, Brazil Stallions affected by seminal vesiculitis present history of infertility or subfertility, ejaculatory disturbance, spread of sexually transmitted pathogens, and changes in semen characteristics, leading to reduced semen quality and longevity. The aim of this study was to evaluate the semen quality of stallions with seminal vesiculitis before and after local treatment. Five stallions with a mean age of 12.4 years diagnosed with seminal vesiculitis were used. The identification of the microorganism involved in the pathogenesis of seminal vesiculitis of each animal was performed by bacterial culture of the seminal vesicles flush with Ringer Lactate solution, performed in duplicate at 1-week intervals. After identification of bacteria was performed, there was susceptibility testing to antibiotic (antibiogram) and the appropriate antibiotic was chosen. The local treatment was performed by endoscopy for 10 consecutive days, and this consisted of flushing with Ringer Lactate solution, followed by infusion of the antibiotic selected. The semen analyses were performed before starting the local treatment for seminal vesiculitis (M0), after a week (M1), and after a month (M2) of therapy. Sperm kinetics were performed by computerized method – CASA for the following parameters: percentage of sperm with total motility, progressive motility, and rapid sperm. Analysis of plasma membrane integrity was performed by epi-fluorescence microscopy, using the combination of fluorescent probes carboxyfluorescein diacetate and propidium iodide. Percentage of leukocytes was assessed through evaluation in light optical microscopy of semen smears stained with DiffQuick. The content of nitric oxide (NO) was determined by colourimetric Griess reaction by a spectrophotometer through the concentrations of nitrate (NO 3 ) and nitrite (NO2 ). To perform the count of colony forming units per millilitre 1 (CFU mL ), an aliquot of 0.1 mL of semen was diluted in 9.9 mL of saline. A 0.1-mL aliquot of this sample was plated on Mueller-Hinton agar. The seeded plates were incubated, and the bacterial colonies were counted after 24 h. According to the performed dilution, total colonies identified corresponds to 10 000 CFU mL1. The data were analysed by two-way ANOVA followed by Tukey’s test (P , 0.05). The values (mean standard error) of seminal parameters on M0, M1, and M2 were the following, respectively: sperm kinetics (total motility: 46.5 5.13a; 75.1 3.42b; 42.8 5.28a; progressive motility: 19.3 3.86a; 33.4 2.39b; 16.5 2.40a; rapid sperm: 22.2 1.82a; 52.2 5.65b; 22.1 2.62a); plasma membrane integrity (47.5 4.65a; 62.9 5.41b; 39.1 4.32a); percentage of leukocytes (35.2 2.36a; 15.1 2.55b; 36.1 4.04a); CFU (119 980 103 19 528.0 103a; 5375 103 2453.7 103b; 65 850 103 19 701.0 103ab) on fresh semen; and NO content (0.645 0.172a, 0.117 0.023b, 0.364 0.110ab) on seminal plasma. The results demonstrate that local treatment after a week leads to an improvement in sperm quality; however, this was not maintained after 1 month of therapy, since the seminal parameters at this time are similar to pretreatment, which can be justified by recurrent disease.

18 COMPARISON BETWEEN THE EFFICIENCY OF 30-MG FLUROGESTONE ACETATE INTRAVAGINAL SPONGE (FGA-30) AND CONTROLLED INTERNAL DRUG RELEASE (CIDR) TO SYNCHRONIZE OESTRUS IN EWES A. Swelum, A. Al-Owaimer, and M. Abouheif College of Food and Agricultural Sciences, King Saud University, Department of Animal Production, College of Food and Agricultural Sciences, King Saud University, Riyadh, KSA The aim of the present study was comparing between the efficiency of FGA-30 (intravaginal polyurethane sponges impregnated with 30 mg of flurogestone acetate; SynchropartÒ, Ceva Sante, Animale, France) and EAZI-BreedTM CIDRÒ (an inert silicone elastomer impregnated with 0.3 g of natural progesterone; Pfizer Animal Health, Hamilton, New Zealand) to synchronize oestrus in ewes. Three hundred twenty multiparous ewes of 2 native breeds (Naimi and Najdi) were equally and randomly allotted into 2 groups: Group A (FGA-30, n ¼ 160) and Group B (CIDRÒ, n ¼ 160). Both methods were inserted intravaginally for 14 days with intramuscular administration of 600 IU of eCG (SynchropartÒ Ceva Sante, Animale, France) at withdrawal time. Retention, vaginal discharge, and drawstring breakage rates were calculated at withdrawal time. The standing oestrous was detected using a vasectomized ram starting 24 h after progestagen withdrawal and repeated every 12 h (24 h, 36 h, 48 h, 60 h, and 72 h). The blood samples were collected at the time of progestagen withdrawal, after 24 h, and after 48 h (at time of AI). Follicular stimulating hormone, LH, oestradiol (E2), and progesterone (P4) serum concentrations were measured using commercial ELISA kits and micro-titrimetric plates. Laparoscopic insemination was performed 48 h after progestagen withdrawal. Pregnancy was diagnosed by ultrasonography at day 23 after insemination and confirmed at Day 35 and 60. Number of fetuses was recorded and confirmed at lambing. Pregnancy rate, fecundity percentage (litter size percentage), and prolificacy percentage (lambing rate) were calculated. The SAS programme was used for all analyses. Data were expressed in percentages except hormone levels, which were expressed as the mean standard error. Comparisons among groups were evaluated using Key Square in all measured parameters except hormone levels, which were evaluated using an analysis of variance (ANOVA) test. A difference was considered significant at P , 0.05. The results revealed that retention rate was insignificantly different between the two groups. Drawstring breakage was observed only in FGA-30 and was absent in CIDR (9.33% v. 0). Moreover, vaginal discharge rate was significantly higher in FGA-30. Oestrus response was significantly higher in CIDR at 24 h and 48 h after progestagen withdrawal. Oestradiol and progesterone serum levels were significantly higher in CIDR, whereas LH and FSH serum levels showed insignificant differences. Pregnancy rate, twining rate, prolificacy, and fecundity were

102


Cloning/Nuclear Transfer

significantly higher in CIDR (75.71%, 33.96%, 1.34 and 1.01, respectively). These results show that although FGA and CIDR devices are efficient in synchronizing oestrus in ewes, CIDR provides higher oestrus response rate, pregnancy rate, twining rate, prolificacy, and fecundity. Consequently, the use of CIDR is recommended.

Cloning/Nuclear Transfer 19

GENOME-WIDE ANALYSIS OF DNA METHYLATION IN CLONES AND NONCLONES OF TWO DIFFERENT BREEDS: HOLSTEIN AND JAPANESE BLACK H. KieferA, M. KanedaB, L. JouneauA, E. CampionA, S. BalzergueC, M.-L. Martin-MagnietteD, J.-P. RenardA, T. NagaiE,F, and H. JammesA A

Institut National de la Recherche Agronomique, Jouy-en-Josas, France; B Tokyo University of Agriculture and Technology, Tokyo, Japan; C Institut National de la Recherche Agronomique, Evry, France; D Institut National de la Recherche Agronomique, Paris, France; E Food and Fertilizer Technology Center, Taiwan; F Seoul National University, Seoul, Korea

Epigenetic marks, and especially DNA methylation, are at the interplay of both environmental and genetic factors. By facilitating the metabolic adaptation of highly selected rent animals to their environment, DNA methylation could contribute to the phenotypic differences observed between breeds. The aim of this study was to assess to which extent the methylome of 2 specialised cattle breeds – the dairy breed Holstein and the beef breed Japanese Black – could show some variability. We focused on the liver, which has a central role in metabolism and is therefore most susceptible to be affected by genetic and environmental variations. For each breed, both cloned and noncloned animals were included in the study. We used 9 adult Holstein cows aged from 5 to 15 years (5 healthy clones generated from ear skin fibroblasts of 4 genotypes, 2 cell donors obtained by AI and 2 other AI controls of unrelated genotypes, and 11 Japanese Black cows aged from 4 to 10 years (5 healthy clones generated from cumulus cells of one genotype and 6 AI controls of unrelated genotypes). The Holstein breed and Japanese Black breed were therefore represented by 6 and 7 genotypes, respectively. Liver samples were snap-frozen after slaughtering, and genomic DNA was extracted. To identify methylated regions, we used immunoprecipitation of methylated DNA followed by hybridization on a bovine promoter microarray (MeDIP-chip). The microarray targets the upstream region (2000 to þ1360 bp) of 21 416 genes (UMD3.1 assembly). After normalization of the data, enriched probes were identified using ChIPmix (Martin-Magniette et al. 2008). Results of exploratory analysis, including correlation clustering and principal component analysis, show a clear separation between the two breeds. A statistical test based on differences in the proportion of the enriched probes was used to identify differentially methylated regions (DMR) related to cloning and breed (Spatstat R package; http://www.spatstat.org/spatstat/). Only a restricted number of cloning-related DMR could be found (240). Interestingly, most of these DMR showed no overlap between Holstein and Japanese Black animals, maybe reflecting the different origin of the somatic cells used for cloning (fibroblasts v. cumulus cells). In contrast, we identified an important number of breed-related DMR (3642). These DMR were significantly enriched in genes involved in placental development and lactation, suggesting an adaptation of the two breeds to the different metabolic demand during gestation. Whether these epigenetic differences rely on environmental variations or genetic polymorphism remains to be elucidated. Research was supported by grants ANR-09-GENM-012-01 and Egide-JSPS Sakura 2012.

20

NUCLEAR TRANSFER ALTERS EXPRESSION AND HISTONE MODIFICATIONS OF THE IMPRINTED GENE PHLDA2 IN THE BOVINE PLACENTA

J. C. T. PenteadoA, D. R. ArnoldA, R. C. GasparA, C. V. da Rocha Jr.A, J. R. SangalliB, T. H. C. de BemB, C. A. P. CorreâA, F. V. MeirellesB, and F. L. LopesA A

Departamento de Apoio, Produçaõ e Sau´de Animal, Faculdade de Medicina Veterina´ria, Universidade Estadual Paulista ‘‘Ju´lio de Mesquita Filho’’ (FMVA/UNESP), Araçatuba, Saõ Paulo, Brazil; B Departamento de Medicina Veterina´ria, Faculdade de Zootecnia e Engenharia de Alimentos, Universidade de Saõ Paulo, FZEA-USP, Pirassununga, Saõ Paulo, Brazil Proper implantation and placental formation are crucial for the continuity of mammalian species. Embryonic and placental developments are under intense genetic and epigenetic control, such as the regulation of differentiation of pluripotent cells into highly specialised fetal and placental cells. In the present study the objectives were to evaluate expression and epigenetic control of the imprinted gene PHLDA2, a maternally expressed gene that appears to be a regulator of placental growth, in cotyledonary and inter-cotyledonary tissues of bovine placentas on Day 60 of pregnancies produced by embryo transfer (ET; n ¼ 3), in vitro fertilization (IVF; n ¼ 5), and nuclear transfer (NT; n ¼ 6), by real time PCR (qPCR). In vitro culture of IVF and NT embryos was performed in SOF medium supplemented with 2.5% fetal bovine serum, at 398C in a humidified atmosphere of 5% CO2 and 5% O2 for 7 days. For evaluation of gene expression, gene-specific standard curves were used, and results were analysed as a ratio to 2 separate housekeeping controls (GAPDH and b-actin). Chromatin immunoprecipitation followed by qPCR (ChIP-qPCR; precipitated/total input DNA) was also performed on the proximal promoter region of PHLDA2, with antibodies against H3K4me2 (permissive histone modification) and H3K9me2 (inhibitory histone modification) in these samples. Products of the ChIP-qPCR for PHLDA2 were digested with a restriction enzyme (AciI) that recognises a specific sequence of the maternal allele (Bos indicus), separating it visually on a gel, from the paternal allele (Bos taurus). Digestion



103

products were separated on a 3% agarose gel, and ethidium bromide was used for visualisation. ImageJ (NIH, Bethesda, MD, USA) was used to analyse band intensity. Gene expression, ChIP, and digestion data were analysed using the least-squares ANOVA and the general linear model procedures (SAS Institute Inc., Cary, NC, USA). Further comparison of means was performed using Duncan’s multiple range test (P , 0.05 was considered significant). Expression of the imprinted gene PHLDA2 was 11 times higher in samples produced by NT and, interestingly, also in samples produced by IVF (P , 0.05) compared with the samples produced by ET. ChIP-qPCR for the histone marks, followed by allelic analysis, showed a significant increase of the permissive mark H3K4me2, especially in the silenced paternal allele (P , 0.05), and a reduction of the inhibitory H3K9me2 mark, in the promoter region of the PHLDA2 gene, in clones. The differences observed for these 2 histone marks corroborated with the pattern of gene expression for these samples (elevated in TN placentas). In conclusion, the reproductive biotechnologies of nuclear transfer and in vitro fertilization induce changes in placental expression of the imprinted gene PHLDA2, and nuclear transfer also affects the pattern of histone marks on the proximal promoter region of the imprinted gene PHLDA2.

21

CHARACTERIZATION OF THE MICRO-RNA TRANSCRIPTOME IN LUNG TISSUES OF CLONED CALVES SUFFERING FROM RESPIRATORY DISTRESS SYNDROME Y. LiuA, Y. ZhangB, H.-S. HaoA, W.-H. DuA, H.-B. ZhuA, and Y.-H. ZhangB A

B

Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing, China; College of Animal Science and Technology, Anhui Agricultural University, Hefei, Anhui, China

Developmental deficiency leads to low survival rates of newborns, especially in cloned animals. Alveoli collapse leading to respiratory failure is one of the major causes of death in newborn cloned calves. The present study provides an insight into the expression pattern of micro-RNAs (miRNAs) in lung tissues and their role in the respiratory distress syndrome (RDS) in the cloned calves. Short RNA high-throughput sequencing and bioinformatic analysis from small RNA libraries created from collapsed lung tissues from 4 newborn cloned calves with RDS and normal lung tissues from 4 agematched healthy individuals were implemented. Lung tissues were collected by dissection from newborns that died due to RDS and from healthy individuals on the first day after birth. RNA samples from the lung tissues were processed to generate small RNA libraries that were further used for deep sequencing. Expression profiles of surfactant-associated protein B (SPB), surfactant-associate protein C (SPC), and their key transcription regulator thyroid transcription factor-1 (TTF-1), which are responsible for stabilising alveolar surface, reducing surface tension, and thus preventing alveoli collapse, were verified through real-time RT-PCR, Western blot, and immunohistochemistry (IHC). Differentially expressed (DE) miRNAs were quantified by edgeR (empirical analysis of digital gene expression data in R), and their target genes were predicted by both TargetScan and miRanda software. Only miRNAs with P values ,0.05 were considered statistically significant (Fisher exact test). Sequence analysis revealed the presence of 1592 and 1777 miRNAs in the RDS and healthy groups, respectively. A total of 326 miRNAs were DE between the two groups according to our criteria, of which 179 miRNAs were up-regulated and 147 were down-regulated in the RDS group. Gene ontological analysis showed that the DE miRNAs had a primary role in DNA-dependent regulation of transcription, cytoplasm biosynthesis, and nucleotide binding. Eleven miRNAs (bta-miR-186, bta-miR-2284x_Rþ1, bta-miR-24–3p_R-2, bta-miR-424–3p, bta-miR-592_L-1, bta-miR-660, bta-miR-150_R-1, bta-miR-2478_L2, bta-miR-450b_R-1, bta-miR-134_Lþ2R-2 and bta-miR-326_Rþ1) were DE between the 2 groups and were predicted to target SPB, SPC, and TTF-1, respectively. Among these DE miRNAs, 5 miRNAs (bta-miR-134_Lþ2R-2, bta-miR-424–3p, bta-miR-660, bta-miR-2478_L-2, bta-miR-450b_R-1) were up-regulated in the RDS group. Western blot and IHC confirmed the down-regulation of SPB, SPC, and TTF-1 at the protein level in RDS group. This increase in abundance of miRNAs targeting key regulatory genes in lung of newborn cloned calves may take part in the dysregulation of alveolus development leading to alveoli collapse and RDS. The assay for target gene verification and analysis of gene transcription profile are under study. Y. Liu and Y. Zhang contributed equally to this work. This project was supported by the National Natural Science Foundation of China (No. 31301977) and the National Nonprofit Institute Research Grant (No. 2011cj-11).

22

SEMEN AND REPRODUCTIVE PROFILES OF CLONED ANATOLIAN GREY CATTLE

S. AratA, S. PabuccuogluB, H. SagirkayaD, K. DemirB, R. AriciB, B. UstunerD, S. AlcayD, B. TokerD, S. AlkanB, Y. NakE, D. NakE, and R. KilicaslanC B

A Namik Kemal University, Faculty of Agriculture, Agricultural Biotechnology Department, Tekirdag, Turkey; Istanbul University, Faculty of Veterinary Medicine, Department of Reproduction and Artificial Insemination, Istanbul, Turkey; C Istanbul University, Faculty of Veterinary Medicine, Department of Obstetrics and Gynecology, Istanbul, Turkey; D Uludag University, Faculty of Veterinary Medicine, Department of Reproduction and Artificial Insemination, Bursa,Turkey; E Uludag University, Faculty of Veterinary Medicine, Department of Obstetrics and Gynecology, Bursa,Turkey

Anatolian grey cattle (endangered native Anatolian cattle) as 1 male (clone 1) and 4 females (clones 2–5) were produced from cells of 1 male and 1 female cattle by somatic cell nuclear transfer (SCNT) in a previous study. In this study, we examined the reproductive potential of these cloned animals, which are now 4 and 5 years old. The parameters evaluated by phase contrast microscopy for motility, TUNEL for DNA fragmentation, eosin staining for viability, Hoechst 33258 staining and hypo-osmotic swelling test (HOST) for membrane integrity, and fluorescein isothiocyanate-Pisum sativum agglutinin (FITC-PSA) for acrosome integrity of frozen-thawed spermatozoa, as well as birth and survival of calves following insemination with frozen-thawed semen of cloned and nuclear donor bull and normal bull. Six ejaculates and 3 samples per ejaculate from each bull were tested, and the Mann-Whitney U test was used to analyse the data. The spermatological parameters of cloned bull semen – volume, concentration, and motility of fresh – were within accepted limits for artificial insemination (4.60 0.47 mL, 1.55 0.21 109 spermatozoa mL1, 80.00 1.07%,

104



respectively). Frozen-thawed sperm motility and viability rate were higher in the cloned bull (56.6%, 56.7%) than in its nuclear donor (47%, 43%; P , 0.05). Intact membrane and DNA fragmentation rate of cloned bull and its nuclear donor bull sperm were similar (P . 0.05) but the intact acrosome rate of cloned bull was higher than that of its nuclear donor (P , 0.05). Low rates in frozen-thawed sperm of nuclear donor can be related to storage time of sperm which were frozen 5 years before. One (clone 4) of the cloned grey heifers was artificially inseminated with frozen semen from nuclear donor bull and the other (clone 5) was naturally mated with a Holstein bull. Two healthy calves were delivered naturally. When same cloned cows (clones 4–5) and 2 other cloned heifers (clones 2–3) were artificially inseminated with frozen semen of the cloned grey bull, clones 2 and 4 gave birth to 2 healthy female calves. One cloned cow (clone 3) aborted in the third month of gestation and other one (clone 5) is currently 8 months pregnant. Two calves of clone 4 and 5 are 17 months old and 2 other calves of clone 2 and 4 are now 6 and 1 months old. Except for clone 3, our results show that cloned Anatolian grey bull and cows produced from frozen cells in gene bank have normal fertility.

23

NEONATAL SUPPORT THERAPY AND BLOOD GAS EVALUATION IN CLONED AND ARTIFICIAL INSEMINATION-DERIVED NEWBORN CALVES

P. Fantinato-NetoA,B, A. T. ZanluchiA, M. M. YasuokaA, F. J. M. MarcheseA, J. R. V. PimentelB, R. V. SampaioA, M. A. BerlingieriA, R. ZaninA, E. S. SantosA, P. R. AdonaB, M. S. MirandaC, M. A. MiglinoA, O. M. OhashiC, F. V. MeirellesA,B, and E. H. Birgel JuniorA,B A B

School of Medicine Veterinary and Animal Husbandry, University of Saõ Paulo, Saõ Paulo, SP, Brazil; School of Animal Husbandry and Food Engineering, University of Saõ Paulo, Pirassununga, SP, Brazil; C Institute of Biological Sciences, Federal University of Para´, Bele´m, PA, Brazil

Offspring derived from artificial reproductive techniques are already known to present several postnatal undesirable phenotypes and clinical disorders. Despite its benefits, cloning by somatic cell nuclear transfer (SCNT) is extremely inefficient. The birth rate in cattle is around 5% of the transferred blastocysts, and ,50% of delivered calves die in the first 48 h. Neonatal respiratory distress is reported to be one of the main causes of such deaths. Veterinary intervention is often needed to promote or improve blood oxygenation, avoiding respiratory acidosis and improving carbon dioxide delivery from blood/lungs to the environment. This study aimed to evaluate a neonatal support therapy over the blood gas and acid-base balance on newborn calves derived from SCNT or AI. Four cloned and 3 AI-derived calves delivered by Caesarean section were used for the experiment. Postnatal therapeutic procedures were comprised 4 doses of 400 mg of intratracheal surfactant every 15 min, 25 mg of oral sildenafil every 8 h for 3 days, and 5 L min1 intranasal oxygen. Blood collections were performed within 30 min (T0), at 12 (T12), 24 (T24) and 48 (T48) hours after delivery. Blood samples were collected from the caudal auricular artery with a butterfly and a blood gas syringe. Oxygen saturation (sO2), arterial pressure of oxygen (PaO2) and carbon dioxide (PaCO2), pH, and bicarbonate (HCO 3 ) were evaluated with a portable blood gas analyzer (i-STAT, Abbott Point of Care Inc., Princeton, NJ, USA). Data obtained were submitted to ANOVA (Proc MIXED; SAS/STAT, version 9; SAS Institute Inc., Cary, NC, USA). There were significant differences between groups in blood pH (P ¼ 0.0182) and between groups (P ¼ 0.0281) and time of collection (P ¼ 0.0303) in blood bicarbonate (HCO 3 ). The AI calves were born with normal pH (7.468 0.033) and the cloned calves were born in acidosis (7.216 0.166). These calves were stabilised in T48 (7.427 0.017) using their own HCO 3 that increased over time. Although there were no differences in sO2 (P ¼ 0.4525), PaO2 (P ¼ 0.3086), or PaCO2 (P ¼ 0.2514), sO2 and PaO2 were numerically increased at the same time that PaCO2 decreased in both groups. In the cloned calves, the sO2, PaO2, and PaCO2 at T0 were 61.3 28.6%, 39.8 18.5 mmHg, and 65.8 29.3 mmHg, respectively and reached 90.0 3.4%, 57.7 15.8 mmHg, and 42.0 3.7 mmHg. In the AI calves, T0 blood gas analysis were 79.8 19.4%, 56.1 42.1 mmHg, and 39.1 4.8 mmHg, and at T48 were 89.0 2.6%, 82.3 43.5 mmHg, and 43.0 4.9 mmHg for sO2, PaO2, and PaCO2 respectively. The neonate support therapy improved calves’ oxygenation and helped to eliminate the carbon dioxide from the blood. In our experience, the neonatal treatment was essential in supporting the lives of the cloned calves. Funding support was received from FAPESP 2011/19543–9.

24 BUFFALO (BUBALUS BUBALIS) SOMATIC CELL NUCLEAR TRANSFER EMBRYOS PRODUCED FROM FROZEN-THAWED SEMEN-DERIVED SOMATIC CELLS: EFFECT OF TRICHOSTATIN A ON THE IN VITRO AND IN VIVO DEVELOPMENTAL POTENTIAL, QUALITY, AND EPIGENETIC STATUS N. L. SelokarA,B, M. SainiA, H. AgrawalA, P. PaltaA, M. S. ChauhanA, R. S. ManikA, and S. K. SinglaA A Animal Biotechnology Centre, National Dairy Research Institute, Karnal, Haryana, India; Division of Animal Physiology and Reproduction, Central Institute for Research on Buffaloes, Hisar, Haryana, India

B

Cryopreservation of semen allows preservation of somatic cells, which can be used for the production of progeny through somatic cell nuclear transfer (SCNT). This approach could enable restoration of valuable high-genetic-merit progeny-tested bulls, which may be dead but the cryopreserved semen is available. We have successfully produced a live buffalo calf by SCNT using somatic cells isolated from .10 year old frozen semen (Selokar et al. 2014 PLoS One 9, e90755). However, the calf survived only for 12 h, which indicates faulty reprogramming of these cells. The present study was, therefore, carried out to study the effect of treatment with trichostatin A (TSA), an epigenetic modifier, on reprogramming of these cells. Production of cloned embryos and determination of quality and level of epigenetic markers in blastocysts were performed according to the methods described previously (Selokar et al. 2014 PLoS One 9, e90755). To examine the effects of TSA (0, 50, and 75 nM), 10 separate experiments were performed on 125, 175, and 207 reconstructed embryos, respectively. The percentage data were analysed using SYSTAT 12.0 (SPSS Inc., Chicago, IL, USA) after arcsine transformation. Differences between means were analysed by one-way ANOVA followed by Fisher’s least significant



105

difference test for significance at P , 0.05. When the reconstructed buffalo embryos produced by hand-made clones were treated with 0, 50, or 75 nM TSA post-electrofusion for 10 h, the cleavage percentage (100.0 0, 94.5 2.3, and 96.1 1.2, respectively) and blastocyst percentage (50.6 2.3, 48.4 2.7, and 48.1 2.6, respectively), total cell number (274.9 17.4, 289.1 30.1, and 317.0 24.2, respectively), and apoptotic index (3.4 0.9, 4.5 1.4, and 5.6 0.7, respectively) in Day 8 blastocysts were not significantly different among different groups. The TSA treatment increased (P , 0.05) the global level of H4K5ac but not that of H3K18a in embryos treated with 50 or 75 nM TSA compared with that in controls. In contrast, the level of H3K27me3 was significantly lower (P , 0.05) in cloned embryos treated with 75 nM TSA than in embryos treated with 50 nM TSA or controls. The ultimate test of the reprogramming potential of any donor cell type is its ability to produce live offspring. To examine the in vivo developmental potential of the 0, 50, or 75 nM TSA treated embryos, we transferred Day 8 blastocysts, 2 each to 5, 6, and 5 recipients, respectively, which resulted in 2 pregnancies from 75 nM TSA treated embryos. However, one pregnancy was aborted in the first trimester and the other in the third trimester. In conclusion, TSA treatment of reconstructed embryos produced from semen-derived somatic cells alters their epigenetic status but does not improve the live birth rate. We are currently optimizing an effective strategy to improve the cloning efficiency of semen-derived somatic cells.

25

DEVELOPMENTAL COMPETENCE OF CLONED BUFFALO (BUBALUS BUBALIS ) EMBRYOS PRODUCED BY TRANSFECTED OR NONTRANSFECTED FIBROBLASTS TRANSFER TO ENUCLEATED OOCYTES DERIVED FROM OVUM PICK-UP AND ABATTOIR OVARIES C. Yang, J. Shang, H. Zheng, M. Chen, F. Huang, C. Li, B. Yang, and X. Liang

Guangxi Key Laboratory of Buffalo Genetics, Reproduction and Breeding, Guangxi Buffalo Research Institute, Chinese Academy of Agricultural Sciences, Nanning, P. R. China The objective of this study was to explore whether fibroblasts transfection and the source of oocytes – ovum pick-up (OPU) versus abattoir ovaries – affected the in vitro and in vivo developmental competence of somatic cell nuclear transferred (SCNT) embryos in buffalo. To this aim, the serumstarved ear fibroblasts were fused into enucleated oocytes derived from abattoir ovaries (Group 1) and OPU (Group 2). Furthermore, the enucleated buffalo oocytes derived from abattoir ovaries were also fused with pEGFP-N1 transfected ear fibroblasts, and the cloned embryos were enhanced green fluorescent protein (EGFP)-positive confirmed by fluorescence microscopy (Group 3). The reconstructed embryos cultured in Groups 1 to 3 were 262, 83, 120, respectively (5 replicates); and the data were analysed by one-way ANOVA (SPSS Inc., Chicago, IL, USA). As a result, the cleavage rate in Group 3 was significantly higher than that in Group 1 (75.0% v. 54.3%; P , 0.01), and the total blastocyst rate of reconstructed embryos in Group 3 (27.3%) was significantly higher than that in Group 1 (17.4%; P , 0.01) and Group 2 (24.4%; P , 0.05). The SCNT blastocysts were vitrified with 20% ethylene glycol þ 20% dimethylsulfoxide þ 0.5 M sucrose; the cryosurvival rates of SCNT blastocysts in the 3 groups were not different from each other (90.0%, 94.7%, 92.3%). Following culture, the cryosurvived blastocysts were transferred into synchronized local and crossbred buffaloes, with each recipient receiving 1 or 2 embryos. The pregnancy rates after transferring embryos derived from Groups 1 to 3 were not different from each other, and were 18.75% (3/16), 33.33% (4/12), and 26.67% (4/15), respectively. These results indicate that the oocytes derived from OPU can be enucleated as recipient cytoplasm and transfected fibroblast can be adopted as nuclei donor without decreasing the SCNT efficiency in buffalo. This research was supported by grants from the National Natural Science Foundation of China (31160456) and the Natural Science Foundations of China under Grant No. 0991011, No. 2011GXSFB018045).

26

HISTONE DEACETYLASE INHIBITOR SCRIPTAID IMPROVES EPIGENETIC REPROGRAMMING AND CLONING EFFICIENCY IN THE PIG S. LiangA, T. KimB, N.-H. KimA, and X.-S. CuiA A

Department of Animal Science, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea; B School of Medicine, Catholic University of Daegu, Daegu, Republic of Korea

After somatic cell nuclear transfer (SCNT), the epigenetic state of a differentiated donor cell nucleus must be reversed to the embryonic state. Incomplete epigenetic reprogramming and abnormal gene activation of the donor cell nuclei is thought to be the cause of low cloning efficiency. To improve cloning efficiency, we investigated the effect of scriptaid, a novel histone deacetylase inhibitor, on the in vitro development of porcine SCNT embryos were investigated. Cumulus cells collected from cumulus-oocyte complexes (COC) after 44 h of maturation were used for donor cell, and embryos were cultured in porcine zygote medium (PZM)-5 medium for 7 days. We found that treating SCNT embryos with 300 or 500 nM scriptaid for 20 h after activation increased developmental rate to the blastocyst stage (300 nM, 26.2%; 500 nM, 24.6% v. 100 nM, 18.3%; Ctrl, 15.7%; P , 0.05) and total cell numbers (300 nM, 43.5; 500 nM, 40.8 v. 100 nM, 33.8; Ctrl, 32.3; P , 0.05). Additionally, results of the TUNEL assay indicated that scriptaid decreased apoptosis (300 nM, 6.8% v. Ctrl, 11.4%; P , 0.05) in SCNT blastocysts. After the 300 nM scriptaid treatment, the levels of acetylated histone H3 lysine 9 and 5-hydroxymethylcytosines were increased (P , 0.05), and histone H3 lysine 9 trimethylation and 5-methylcytosine were decreased at the 1-cell stage, which might explain the enhanced (P , 0.05) transcript levels of mir-152, Oct4, Cdx2, and Bcl-xL and reduced (P , 0.05) transcription of Dnmt1, Casp3, and Bax in blastocysts. In conclusion, scriptaid enhances the developmental capacity by preventing apoptosis, and improves nuclear reprogramming in porcine SCNT embryos. This work was supported by the Bio-industry Technology Development Program, Ministry of Agriculture, Food and Rural Affairs, Republic of Korea, and by a grant from the Next-Generation BioGreen 21 Program (No. PJ009601 and PJ009098), Rural Development Administration, Republic of Korea.

106


27


EFFECT OF A SPECIFIC INHIBITOR OF DOT1L ON PREIMPLANTATION DEVELOPMENT OF PORCINE SOMATIC CLONED EMBRYOS J. Tao, Y. Zhang, D. Song, Y. Li, and Y. Zhang

College of Animal Science and Technology, Anhui Agricultural University, Hefei, Anhui Province, China EPZ004777 (EPZ), a specific inhibitor of DOT1L (a methyltransferase of H3K79), can significantly improve the generation and quality of mouse induced pluripotent stem cells [Onder et al. 2012 Nature 483(7391), 598–602), suggesting that H3K79 dimethylation (H3K79me2) is involved in controlling cell pluripotency. To date, however, it is unclear whether H3K79me2 regulates development competency of animal cloned embryos. Thus, we aimed to examine the dynamic changes of H3K79me2 in pre-implantation cloned embryos of pigs, and to explore effect of EPZ treatment of embryos on in vitro development fate in order to lay the foundation for revealing the role of H3K79me2 and mechanisms in controlling cell pluripotency. Porcine cloned embryos were treated immediately when fusion and activation stimuli were conducted, in vitro with porcine zygote medium (PZM)-3, including 0.5, 5, or 50 nM EPZ (S7353, Selleck Chemicals, Houston, TX, USA) and 1% DMSO (vol/vol, control group) for 24 h, respectively. Then, they were transferred into fresh PZM-3 without EPZ. We found that there was no significant difference in cleavage rate among groups, whereas the blastocyst rate of 0.5 nM EPZ group was higher than that of control group [28.97 2.65% (28/96) v. 17.13 2.69% (17/96)]. No obvious difference was observed for the total cell number of blastocyst among groups. We further treated the SCNT embryos with 0.5 nM EPZ for 0 (control group), 12, 24, and 36 h, respectively. No significant differences were found for cleavage rate among groups, whereas the blastocyst rates of the 12- and 24-h groups were significantly higher than that of control and 36-h groups [28.56 3.51% (27/97), 28.34 3.00% (25/88) v. 16.32 1.93% (16/97), 17.93 0.64% (18/100)]. Except for the remarkable decrease in the 36-h treatment group, no obvious difference was observed for the total cell number of blastocyst among the other 3 groups. All the above experiments were repeated at least 3 times. These results suggested that treatment of porcine SCNT embryos with 0.5 nM EPZ for 12 to 24 h could improve their development during the early stage. Then, we tested whether the EPZ favoured the in vitro development of porcine SCNT embryos by regulating H3K79me2 reprogramming. Porcine SCNT embryos were treated with 0.5 nM EPZ from the onset of electric activation and fusion stimuli was performed, and then the H3K79me2 signal (by immune-fluorescent staining) and expression of DOT1L (by RT-qPCR) at different development stages was analysed. We found that the H3K79me2 signal in control group (without EPZ treatment) decreased slowly from the time of electric stimulation to 4 hpa, and it disappeared in 8 hpa stage. In the EPZ treatment group, H3K79me2 signal started decreasing from 2 hpa, and disappeared in 8 hpa stage. The mRNA level of DOT1L in EPZ treatment group was lower than that in control group, although the difference was not significant. Taken together, treatment with EPZ at the appropriate concentration and for an appropriate time can improve the early in vitro development of pig SCNT embryos, probably by inhibiting expression of DOT1L and facilitating reprogramming of H3K79me2. Research was supported by NSFC No. 31272442.

28

EFFECTS OF RECLONING ON THE PRODUCTION OF PIGS OVEREXPRESSING 11 b-HYDROXYSTEROID DEHYDROGENASE TYPE 1 (11b-HSD1)

Y. I. JeongA, Y. JeonA, C. H. ParkA, K. H. KoA, Y. W. JeongA, Y. W. KimA, S. H. HyunB, I. S. YangA, and W. S. HwangA A Sooam Biotech Research Foundation, Seoul, Republic of Korea; Laboratory of Veterinary Embryology and Biotechnology (VETEMBIO), College of Veterinary Medicine, Chungbuk National University, Cheongju, Republic of Korea

B

The incidence of metabolic syndrome is increasing globally, as the prevalence of obesity continues to rise. However, the basic mechanisms of metabolic syndrome are not completely known yet. Therefore, animal disease models are required for the study of metabolic syndrome. The overexpression of 11 b-hydroxysteroid dehydrogenase type 1 (11b-HSD1) in mice leads to metabolic syndrome; thus, we attempted to produce pigs with overexpression of 11b-HSD1 gene by somatic cell nuclear transfer (SCNT). However, low transgenic (TG) efficiency has been an obstacle to the production of TG pigs. A SCNT method in which somatic cells derived from TG pig are used as the nuclear donor (re-cloning method) is an effective technique for TG pig production. In this study, we attempted to increase TG efficiency by the re-cloning method. Pregnancy efficiency, production efficiency, and TG efficiency were compared with sources of donor cells (transfected TG fetal fibroblast v. TG fibroblast derived from newborn TG cloned pig). A total of 1382 and 881 TG SCNT embryos were produced from fetal fibroblast v. cloned fibroblast, and then transferred to 13 and 10 recipients. The pregnancy rate was not significantly different (30.8% v. 20.0%). Seventeen live piglets and 5 stillborn piglets were born from 4 recipients in the fetal fibroblast group, and 8 live piglets, 2 stillborn piglets, and 3 mummies were born from 2 recipients in the cloned fibroblast group. There were no significant differences in the production efficiency (3.7% v. 5.0%). All of the 13 re-cloned piglets showed reporter and target gene integration. But, of 22 fetal fibroblast-cloned piglets, reporter gene integration was confirmed in 9, but only 3 clone piglets showed reporter gene integration. Efficiency of TG was significantly increased in re-cloning group (13.6% v. 100.0%). In this study, TG efficiency of 11b-HSD1 overexpressed pigs was improved by re-cloning method. These results indicate that re-cloning is an efficient method for production of TG cloned pigs. This work was supported by a grant from the Next-Generation Bio Green 21 Program (No. PJ009563032014), Rural Development Administration, Republic of Korea.



107

29 SCRIPTAID IMPROVES SOMATIC NUCLEAR TRANSFER EFFICIENCY DURING IN VITRO CULTURE OF PORCINE EMBRYOS DERIVED FROM INBRED MINIATURE PIG FETAL FIBROBLASTS R. Koppang, N. R. Mtango, M. Barcelo-Fimbres, and J. P. Verstegen MOFA Global LLC, Verona, Wisconsin, USA Porcine somatic cell nuclear transfer (SCNT) is limited to the same or next day surgical embryo transfer due to poor culture conditions in vitro. In this study, we aimed to overcome this problem by treating SCNT embryos with scriptaid, an inhibitor of histone deacetylase (HDACi) that helps with epigenetic reprogramming of the somatic nuclei. Scriptaid was chosen over other HDACi because it has been shown to improve histone acetylation in the same pattern as that of IVF embryos as well as its low toxicity characteristic (Zhao et al. 2009 Biol. Reprod. 81, 525–530; Zhao et al. 2010 Cell Reprogram. 12, 75–78). An inbred miniature pig fetal fibroblast cell line that is known to give low blastocyst rate in culture was used as a source of donor cells transferred into enucleated oocytes. Traditional SCNT was performed; embryos were fused and chemically activated in 10 mM ionomycin for 5 min and 2 mM DMAP for 3 to 4 h before being transferred into scriptaid. Embryos were treated with 500 nM scriptaid (Zhao et al. 2010) for 18 h and the untreated group was used as control. A total of 806 oocytes were used in 8 replicates. The constructed embryos were cultured in modified porcine zygote medium 5 (mPZM-5) for 7 days at 398C in 5% O2, 5% CO2, 90% N2 atmosphere. Cleavage rates were assessed at 2.5 days and blastocyst rates at Day 7 after activation. Data were analysed by ANOVA using GLM, and percentages were transformed using arcsin square root using Statistix 10 software (Tallahassee, FL, USA). There were no differences in cleavage rates for control group v. scriptaid (55.3 v. 49.9%; P . 0.1; Table 1). The blastocyst rate per construct showed remarkable increase in the scriptaid treated group compared with the control group (12.8 v. 2.2%; P , 0.01; Table 1). Similarly, a significant effect was observed for blastocyst per embryos cleaved where scriptaid had higher rates compared with control (25.8 v. 5.8%; P , 0.01). These results indicated that improving nuclear reprogramming of miniature porcine SCNT clones by scriptaid treatment enhanced blastocyst production during the in vitro culture of porcine embryos. Table 1. Mean (6 s.e.m.) measures of embryonic development of SCNT embryos Treatment Control Scriptaid

No. of oocytes

% Cleaved

% Blastocyst per construct

% Blastocysts per cleaved

150 656

55.3 3.9 49.9 2.9a

2.2 3.7 12.8 2.7b

5.8 5.8a 25.8 4.4b

a

a

Values without common superscripts in the same column differ (P , 0.01).

a,b

30

POSTMORTEM FINDINGS IN CLONED AND TRANSGENIC PIGLETS DEAD BEFORE WEANING M. SchmidtA, K. D. WintherB, and H. CallesenC A

Reproduction, University of Copenhagen, Frederiksberg, Denmark; B Danish Agriculture & Food Council, Kjellerup, Denmark; C Department of Animal Science, Aarhus University, Tjele, Denmark Around 50% of cloned and transgenic piglets are lost during the first month after birth (Reprod. Fertil. Develop. 26, 124), and one reason is malformations of vital organs. The aim of the present study was to describe the distribution of malformations in piglets (until weaning, i.e. age ,Day 28) born after transfer to Large White (LW) recipients of cloned embryos. Donor cells were fibroblasts either from LW (non-transgenic) or from Yucatan or Go¨ttingen (made transgenic with 1 of 7 genes related to different human diseases). Handmade cloning was used to produce embryos that, after 5–6 days in vitro culture, were transferred to 202 LW sows 4 days after natural heat. Abortion occurred in 29 sows, and 6.5 0.4 piglets per litter (from 1 to 22) were delivered from 116 sows (46 litters with LW piglets, 40 with Go¨ttingen, 30 with Yucatan). In 78 of these litters (67%), autopsies were performed on 55 4% of piglets stillborn or dead before weaning. Data were analysed by Fisher’s Exact test with P , 0.05 as significance level. Malformations were found in 1 to 12 piglets per litter, with a higher malformation rate in transgenic Go¨ttingen and Yucatan piglets (35% and 46% of all born, respectively) than in non-transgenic LW (17%). Many piglets showed 2 (24%) or more (6%) malformations. Some malformations seemed to be related to breed and/or transgene (see Table 1 for most frequent malformations); for example, heart malformations were most frequent in Yucatan litters independent of the transgene, whereas gall bladder and limb malformations were more frequent in Go¨ttingen and in various litters with the same transgene. These results show that pig cloning results in a considerable loss of piglets, and that a majority of these can be related to various malformations. Use of transgenic cells for cloning only adds to this problem. Some malformations are related to the specific breed in use, but the general finding is that the problem is related to the cloning technique as such. However, because approximately half of the cloned piglets still survive, perhaps with unknown minor malformations, use of pigs as a model for human diseases is still realistic. But choice of breed and possible improvements of the transgenic technologies for this kind of work should be considered carefully.

108



Table 1. Malformations in transgenic and nontransgenic cloned piglets dead before weaning Piglet breed: n ¼ number born All n ¼ 769 LW n ¼ 323 Go¨ttingen n ¼ 249 Yucatan n ¼ 197

No. (%) of piglets stillborn and dead before weaning

No. (%) of autopsied piglets

424 (55%) 155 (48%) 125 (50%) 144*** (73%)

291 (69%) 79 (51%) 104 (83%) 108 (75%)

Most frequent malformations (% of autopsied piglets) Skeletal and limbs

Tongue

19% 19% 29%*** 8%*

12% 9% 12% 16%

Heart 25% 9% 14% 48%***

Gonads

Liver/gall bladder

30% 38% 31% 22%*

17% 14% 24%* 12%

Piglets with at least 2 malformations

30% 28% 34% 29%

*P , 0.05, ***P , 0.001: significant difference within column.

31

PRODUCTION EFFICIENCY OF GENE KNOCKOUT PIGS USING GENOME EDITING AND SOMATIC CELL CLONING

H. MatsunariA,B, M. WatanabeA,B, K. NakanoB,C, A. UchikuraB, Y. AsanoB, S. HataeB, T. TakeishiB, K. UmeyamaA,B, M. NagayaA,B, S. MiyagawaD, Y. HanazonoE, H. NakauchiF, and H. NagashimaA,B A

B

Meiji University International Institute for Bio-Resource Research (MUIIBR), Kawasaki, Japan; Laboratory of Developmental Engineering, Department of Life Sciences, School of Agriculture, Meiji University, Kawasaki, Japan; C JSPS Research Fellow, Tokyo, Japan; D Division of Organ Transplantation, Department of Surgery, Osaka University Graduate School of Medicine, Osaka, Japan; E Division of Regenerative Medicine, Center for Molecular Medicine, Jichi Medical University, Tochigi, Japan; F Center for Stem Cell and Regenerative Medicine, Institute of Medical Science, The University of Tokyo, Tokyo, Japan

Genome editing technologies have been used as a powerful strategy for the generation of genetically modified pigs. We previously developed genetically modified clone pigs with organogenesis-disabled phenotypes, as well as pigs exhibiting diseases with similar features to those of humans. Here, we report the production efficiency of various gene knockout cloned pigs from somatic cells that were genetically modified using zinc finger nucleases (ZFN) or transcription activator-like effector nucleases (TALEN). The ZFN- or TALEN-encoding mRNAs, which targeted 7 autosomal or X-linked genes, were introduced into porcine fetal fibroblast cells using electroporation. Clonal cell populations carrying induced mutations were selected after limiting dilution. The targeted portion of the genes was amplified using PCR, followed by sequencing and mutation analysis. Among the collected knockout cell colonies, cells showing good proliferation and morphology were selected and used for somatic cell nuclear transfer (SCNT). In vitro-matured oocytes were obtained from porcine cumulus-oocyte complexes cultured in NCSU23-based medium and were used to obtain recipient oocytes for SCNT after enucleation. SCNT was performed as reported previously (Matsunari et al. 2008). The cloned embryos were cultured for 7 days in porcine zygote medium (PZM)-5 to assess their developmental ability. Cloned embryos were transplanted into the oviduct or uterus of oestrus-synchronized recipient gilts to evaluate their competence to develop to fetuses or piglets. Cloned embryos reconstructed with 7 types of knockout cells showed equal development to blastocysts compared with those derived from the wild-type cells (54.5–83.3% v. 60.7%). Our data (Table 1) demonstrated that the reconstructed embryos derived from knockout cells could efficiently give rise to cloned offspring regardless of the type of genome editing methodology (i.e. ZFN or TALEN). Table 1. Production efficiency of gene knockout cloned pigs using genome editing Target gene

Genome editing tool

Type of knockout

X-linked [IL2RG]

ZFN

–

Autosomal [FBN1] Autosomal X-linked

ZFN

Heterozygous

TALEN TALEN

Homozygous –

Autosomal Autosomal [PDX1] Autosomal

TALEN TALEN ZFN

Heterozygous Homozygous Heterozygous

Cloned embryos transferred Oviduct

Uterus

– – 272

264 199 – 206 132 – 131 – – –

261 – 108 101 65

Pregnancy/Recipients

Cloned offspring/ fetuses obtained [%]

2/2 2/2 2/2 2/2 1/1 2/2 1/1 1/1 1/1 1/1

3 [1.1]1 4 [2.0]2 11 (1) [4.0] 8 (1) [3.9] 5 (1) [3.8] 9 (7) [3.4]3 4 (3) [3.1]4 8 [7.4]5 4 [4.0]6 4(2) [6.2]

1

Day 39 fetuses. Full-term fetuses (Day 113) [Watanabe et al. 2013]. 3 Preterm birth (Day 109–110). 4 Preterm birth (Day 108–109 and Day 113–114). 5 Day 50–51 fetuses. 6 Day 55–56 fetuses. 2

This study was supported by JST, ERATO, the Nakauchi Stem Cell and Organ Regeneration Project, JST, CREST, Meiji University International Institute for Bio-Resource Research (MUIIBR), and JSPS KAKENHI Grant Number 26870630.


32


109

ALLOCATION OF INNER CELL MASS AND TROPHECTODERM CELLS OF NUCLEAR TRANSFER EMBRYOS CULTURED IN MEDIUM SUPPLEMENTED WITH EPIDERMAL GROWTH FACTOR AND INSULIN-LIKE GROWTH FACTOR-I A. T. CaputcuB, S. AratA, M. CevikC, T. AkkocB, G. CetinkayaB, and H. BagisD

A Namik Kemal University, Faculty of Agriculture, Department of Agricultural Biotechnology, Tekirdag, Turkey; The Scientific and Technological Research Council of Turkey, Marmara Research Center, Genetic Engineering and Biotechnology Institute, Kocaeli, Turkey; C Ondokuz Mayis University, Faculty of Veterinary Medicine, Department of Reproduction and Artificial Insemination, Samsun, Turkey; D Adiyaman University, Faculty of Medicine, Department of Medical Genetics, Adiyaman, Turkey B

This study was conducted to determine the additive effects of exogenous growth factors and different macromolecules during in vitro oocyte maturation (IVM) and sequential embryo culture of nuclear transfer (NT) embryos. Oocytes were matured in TCM-199 supplemented with 10% fetal calf serum (FCS), 50 mg mL1 sodium pyruvate, 1% penicillin/streptomycin (10 000 U mL1 penicillin G, 10 000 mg mL1 streptomycin), 5 mg mL1 LH, and 0.5 mg mL1 FSH without growth factors (Treatment 1) or with 50 ng mL1 epidermal growth factor (EGF; Treatment 2) or with 50 ng mL1 EGF and 100 ng mL1 insulin-like growth factor-I (IGF-1; Treatment 3). Cloned bovine embryos were produced by transferring granulosa cells into enucleated meiosis II oocytes. Following activation, reconstructed embryos were cultured in Quinn’s Advantage Cleavage Medium (QACM) supplemented with 8 mg mL1 essentially fatty-acid free (FAF) BSA for 72 h. Then, developing embryos from granulosa cells were cultured in Sequential Quinn’s Advantage Blastocyst Medium (QABM) supplemented with 4 mg mL1 essentially FAF-BSA (Sigma-Aldrich, St. Louis, MO, USA) þ 5% FCS (Group 1), 4 mg mL1 BSA þ 5% FCSþ100 ng mL1 IGF 1 (Group 2), and 4 mg mL1 BSA þ 5% FCSþ100 ng mL1 IGF-1þ50 ng mL1 EGF (Group 3) for an additional 5 days under low oxygen tension (5% CO2, 5% O2, 90% N2) at 38.58C in high humidity conditions. Maturation rates of oocytes matured in the presence of EGF (75.5%) and EGFþIGF-I combination (75.0%) were significantly higher than those of oocytes matured (63.8%) in the presence of only FCS (P , 0.05). The developing NT embryos derived from granulosa cells of the Anatolian Grey Cattle showed no significant differences in fusion (53.62%, 53.25%, 57.36%), cleavage (67.98%, 74.20%, 66.80%), or blastocyst rates (32.65%, 29.47%, 41.77%) among culture groups (P . 0.05). When 13 to 23 embryos per group were examined by using differential staining, the results showed that the IGF-I alone and combination with EGF in the sequential embryo culture medium (Group 2: 46.61%. and Group 3: 41.37%) significantly increased the number of inner cell mass (ICM)/total blastocyst cell ratio in comparison with Group 1 (29.32%, no IGF-I and EGF; P , 0.05). Our results showed that the addition of growth factors to IVM medium and sequential culture medium changed the cell ration of cloned bovine embryos to the advance of ICM without changing total cell number. Supplementation of media with growth factors can alter the allocation of ICM and trophectoderm cells in NT embryos.

33

TELOMERASE ACTIVITIES IN CLONED BEAGLE DOGS

G. A. Kim, H. J. Oh, M. J. Kim, Y. K. Jo, E. M. N. Setyawan, Y. B. Choi, S. H. Lee, and B. C. Lee Seoul National University, Seoul, South Korea Telomerase is important ribonucleoprotein for restoring telomere length from its own RNA template. Regarding cloned animals derived from somatic cell nuclear transfer (SCNT), interesting questions have been raised about whether the cloning process restores cellular telomerase activity undergone by their donor cells. The present study was conducted to determine the effects of cloning on telomerase activity in the dog and normality of telomerase activity in cloned dogs. Focusing our attention on differences in telomerase activity depending on the age, we analysed telomerase activity in dogs produced by natural breeding of various ages. Comparison of the telomerase activities of cloned dogs and those of dogs produced by natural breeding was also performed. For SCNT, 2 cell donors, 7- and 9-year-old beagles, were used and donor cells were isolated from ear skin. After establishing donor cell lines, the enucleated canine in vivo-matured oocytes and the cells were injected and fused by electrofusion. After 30 days from embryo transfer, pregnancy diagnosis was performed and 7 cloned dogs were produced on the due date. For standardization of telomerase activity in beagles produced by natural breeding, blood of total 14 dogs at each age (10 months, 20 months, 5, 7, and 8 years old) were collected and telomerase activity was measured by the telomeric repeat amplification protocol (TRAP) assay. Telomerase activity measurements of at least 6 replications in each dog were performed. For statistical analysis, one-way ANOVA with Dunn’s Multiple Comparison Test was used. Significant differences in telomerase activity were observed between the blood of cloned and donor dogs. It was shown that mean telomerase activities were decreased according to biological aging with significances. Mean telomerase activities in 10 cloned dogs were higher than those of a donor dog. Cloned dogs also showed similar levels of telomerase activities as their age-matched natural bred dogs, suggesting that they are within the variation in normal dogs. These observations indicate that the cloning process restores the telomerase activity in the dog. Thus, complex regulation of telomerase activity during nuclear reprogramming may regulate and be involved in telomerase activity in cloned dogs. It remains to be determined whether telomere length is correlated with telomerase activity and if it accurately reflects the physiological age of cloned dogs. This study was supported by IPET (#311062–04–2-SB010), RDA (PJ008975022013), Research Institute for Veterinary Science, the BK21 program, Nestle Purina Korea, and TS Corporation.

110


34


COMPARISON OF PROLIFERATION AND TELOMERASE ACTIVITY IN FIBROBLASTS DERIVED FROM GYEONG-JU DONGGYEONG DOGS ACCORDING TO THEIR AGE Y. B. Choi, G. A. Kim, H. J. Oh, M. J. Kim, and B. C. Lee Seoul National University, Seoul, South Korea

Donggyeong dog is a breed considered a natural monument in Korea since 2012. Nevertheless, this breed is only found in Gyeong-ju and is classified as endangered. The use of assisted reproductive technologies (ART) could be applied to preserve these endangered dogs. Among various ART, somatic cell nuclear transfer (SCNT) may be a good technique for achieving propagation of genetically identical individuals. For this reason, we investigated the effect of age of the cell donor on several characteristics, including growth pattern, doubling time of cell populations, cell size, viability, and telomerase activity in Gyeong-ju Donggyeong dog fibroblast cultures before SCNT. Primary fibroblast cell cultures were performed using ear biopsies from 1-year-old (D-1yr) and 7-year-old (D-7yr) Donggyeong dogs and cells at passage 2 to 6 from in this study. Cells were plated at 1 105 cells well1 in a 6-well plate. Cells were harvested every 24 h for 6 days, and cell number was determined to measure growth pattern and doubling time. The harvested cells were stained with trypan blue, their size and viability were analysed using a Countess Automated Cell Counter (Life Technologies, Carlsbad, CA, USA). Telomerase activity was measured by telomeric repeat amplification protocol using TeloTAGGG Telomerase PCR ELISAPLUS. All experiments were replicated at least 3 times. Statistical analysis was performed using Graphpad Prism (GraphPad Software Inc., San Diego, CA, USA), and t-test (P , 0.05) was used to compare the growth pattern, doubling time, cell size, viability, and telomerase activity between D-1yr and D-7yr groups. Growth curves in both groups showed the typical ‘‘S’’ shape and no significant differences between D-1yr and D-7yr groups. However, doubling times from 2nd to 5th passages of D-1yr (20.0 0.3 h, 38.0 0.5 h, 38.7 0.5 h, and 53.4 1.4 h) were significantly shorter than those of D-7yr (37.0 1.2 h, 54.0 3.6 h, 63.3 1.8 h, and 100.9 4.4 h). Cells from 6th passage of D-7yr and 7th passage of D-1yr did not reach confluence. Cell size of D-1yr (13.6 0.2 mm) was significantly smaller than that of D-7yr (14.9 0.3 mm; P , 0.001). There was no significant difference between D-1yr (89.4 1.4%) and D-7yr (88.9 1.2%) in cell viability but relative telomerase activity was significantly higher in D-1yr (37.8 7.5) compared with D-7yr (19.0 6.2, P , 0.001). In conclusion, these results suggest that fibroblasts derived from young Donggyeong dogs are more suitable for SCNT than those from old donors. For further study, dog cloning using D-1yr and D-7yr should be performed to evaluate the effect of donor age in canine SCNT efficiency.

35

EFFECT OF 6-DIMETHYLAMINOPURINE TREATMENT DURATION ON PRONUCLEAR FORMATION AND IN VIVO DEVELOPMENT OF CANINE CLONED EMBRYO

H. J. OhA, G. A. KimA, M. J. KimA, Y. K. JoA, Y. B. ChoiA, E. M. N. SetyawanA, S. H. LeeA, H. J. KimB, and B. C. LeeA A

Department of Theriogenology and Biotechnology, College of Veterinary Medicine, Seoul National University, Seoul, Republic of Korea; B Haemaru Referral Animal Hospital, Gyeonggi, Republic of Korea

Artificial activation is an important step for successful somatic cell nuclear transfer (SCNT). In order to clone animals, diverse methods of activation have been studied to increase the developmental efficiency of cloned embryos. Here, we investigated the pronucleus formation and in vivo development of canine cloned embryos produced by different durations of 1.9 mM 6-dimethylaminopurine (DMAP) treatment. For canine SCNT, in vivo-matured oocytes were enucleated, microinjected into the perivitelline space with donor cells, and fused by electrical stimulation. For activation, the fused couplets were cultured for 4 min in 10 mM calcium ionophore, and then they were divided into 2 groups: (1) the 2DMAP group was cultured for 2 h in DMAP; (2) the 4DMAP group was cultured for 4 h in DMAP. Activated cloned embryos were subjected to 2 analyses: (1) observing the pronuclear formation by bromodeoxyuridine (BrdU) incorporation at 2 h, 4 h and 8 h post-activation (hpa), and (2) following fetus formation and pregnancy efficiency after embryo transfer into naturally synchronous recipients. Pregnancy diagnosis was performed by ultrasonography on Day 26 of embryo transfer. Data were analysed using Graph Prism software (GraphPad Software Inc., San Diego, CA, USA). All cloned embryos of the 2DMAP group showed BrdU incorporation at 2 hpa, whereas 4DMAP embryos showed 77.7% BrdU incorporation at 2 hpa (P , 0.05). Incorporation of BrdU was detected in all cloned embryos of both experimental groups after 4 hpa and 8 hpa. A total of 370 cloned embryos were transferred to 24 surrogate mothers (182 cloned embryos into 12 recipients in 2DMAP group and 188 cloned embryos into 12 recipients in 4DMAP group). There was no significant difference in pregnancy rate (2DMAP; 41.6% v. 4DMAP; 33.3%) or implantation rates (2DMAP; 4.9% v. 4DMAP; 3.7%) between the 2 groups. In conclusion, DMAP exposure for 2 h in activation completed pronucleus development of canine reconstructed embryos. However, none of the applied tested treatments resulted in increased implantation rates. This study was supported by RDA (#PJ008975022014), IPET (#311062–04–3SB010), Research Institute for Veterinary Science, Nestle´ Purina PetCare and the BK21 plus program.

36

EFFECT OF SUBEROYLANILIDE HYDROXAMIC ACID TREATED DONOR CELLS ON DOG CLONING

M. J. KimA, H. J. OhA, G. A. KimA, H. N. SuhB, Y. K. JoA, Y. B. ChoiA, D. H. KimC, H. J. HanB, and B. C. LeeA B

A Department of Theriogenology and Biotechnology, College of Veterinary Medicine, Seoul National University, Seoul, Republic of Korea; Department of Veterinary Physiology, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, Republic of Korea; C National Institute of Animal Science, Suwon, Republic of Korea

Although dog cloning technology has been applied to conservation of endangered canids, propagation of elite dogs and production of transgenic dogs, the efficiency of cloning is still very low. To help overcome this problem, we evaluated the effect of treating donor cells with suberoylanilide hydroxamic acid (SAHA), a histone deacetylase inhibitor (HDACi), on dog cloning efficiency. Relative mRNA expression of the bax1, bcl2, and



111

Dnmt1 in fibroblasts treated with different concentrations (0, 1, 10, 50 mM) of SAHA and durations (0, 20, 44 h) were assessed using real-time polymerase chain reaction. After determining an optimum concentration and duration, histone acetylation levels (H3K9, H4K5/K8/K12/K16) of SAHA-treated cells were analysed using immunostaining. The SAHA-treated cells were used as donor cells for somatic cell nuclear transfer, and activated reconstructed embryos were transferred to recipients. Pregnancy diagnosis was performed by ultrasonography at least 29 days after the embryo transfer. All experiments were repeated more than 3 times and the data were analysed using Graph Prism software (GraphPad Software Inc., San Diego, CA, USA). An unpaired t-test was used to compare transcripts levels and fluorescence intensities. A chi-squared test was used to compare the implantation rates. The bax1/bcl2 ratio of the 1 mM SAHA group was similar to that of control but significantly increased in the 10 mM and 50 mM groups. Expression of Dnmt1 was decreased in the 1 mM SAHA group, and the 10 mM and 50 mM groups showed the lowest expression compared with the control group. Although the bax1/blc2 ratio was not affected by the SAHA treatment duration, 20-h treatment group showed significantly decreased Dnmt1 levels compared with control group. As a pan-HDAC inhibitor, 1 mM for 20 h of SAHA treatment significantly increased acetylation of H3K9, H4K5, H4K8, and H4K16. For control and SAHA groups, a total of 76 and 64 cloned embryos were produced and transferred to 7 and 5 recipients, respectively. Three fetuses were diagnosed in both groups but there was no significant difference in the pregnancy rate. In conclusion, although SAHA treatment as used in this study significantly decreased bax/bcl2 and Dnmt1 transcripts of donor nuclei, as well as increased H3 and H4 acetylation, it would not enough to increase in vivo developmental competence of cloned dog embryos. This study was supported by RDA (#PJ008975022014), IPET (#311062–04–3SB010), Research Institute for Veterinary Science and the BK21 plus program.

37

EFFECT OF CELL MANIPULATION FOR PRODUCTION OF TRANSGENIC CELL LINES ON GOAT CLONING EFFICIENCY

L. T. MartinsA, S. Gaudencio NetoA, L. H. AguiarA, C. E. M. CalderońA, K. C. S. TavaresA, I. S. CarneiroA, A. S. MoraisA, F. X. A. Giraõ NetoA, R. M. PinhoA, A. P. AlmeidaA, C. R. LazzarottoA, J. M. ChiesB, L. R. BertoliniA, F. ForellC, and M. BertoliniA B

A University of Fortaleza (UNIFOR), Fortaleza, CE, Brazil; Quatro G Pesquisa e Desenvolvimento Ltda, Porto Alegre, RS, Brazil; C Santa Catarina State University (UDESC), Lages, SC, Brazil

The generation of transgenic cell lines through standard cell transfection/antibiotic selection procedures may have a negative effect on cell viability, which in turn may compromise SCNT cloning efficiency. The aim of this study was to evaluate goat cloning efficiency by using transfected and nontransfected and transgenic and nontransgenic somatic cells as nucleus donors. Skin fibroblast cells from 1 adult doe were subjected to transfection by electroporation with the pBC1-hGCase-Neo transgene cassette containing the human glucocerebrosidase gene sequence (hGCase), following antibiotic cell colony selection. Four distinct syngeneic donor cell types were used for cloning: (a) wild type (nontransfected, nontransgenic) control cells (C1) at low passage (P3), (b) transfected negative control (transfected, nontransgenic) cells (CT) at high passage (P8), and (c) 2 lines of transfected, transgenic cells (CA, CB) at high passages (P8 through P10). Donor cell cycles were synchronized by high confluence (,95%) and 24-h serum starvation. Cloning procedures were performed by standard micromanipulation procedures. Following membrane fusion after a 1.25 kV cm1 DC pulse for 45 ms, reconstructed structures were incubated in cytochalasin B for 1 h, and then activated in ionomycin/6-DMAP. After 12 h of IVC in G-1TM medium (Vitrolife, Englewood, CO, USA), 1-cell stage cloned embryos were surgically transferred into the oviduct of synchronous recipient females. To ascertain herd fertility and health and adequate procedures for embryo manipulation, synchronization protocols, and surgical interventions, groups of control females were subjected to cervical AI or surgical transfer of in vivo-produced 1-cell stage goat embryos (ET). Pregnancy diagnosis was performed by ultrasonography on Day 23, with weekly examinations until term. Data were analysed by the x2 test (P , 0.05), and are presented in Table 1. The transfection process and passage number did not appear to affect development, as no differences in pregnancy rates were observed between cloned groups, although results with control cells (C1 and CT) and with CA and CB lines were similar to and lower than the AI and ET groups, respectively. Loss rate after cloning was high (88.8%), which may be due to faulty reprogramming, as other procedural and biological variables involved in the cloning process were endorsed by pregnancy rates and term viable pregnancies observed in the AI and ET groups. Cloning using CA donor cells at P9 resulted in two liveborn kids, with one dying soon after birth. Both animals were confirmed by molecular analyses as hGCase transgenic clones. Table 1. Overall efficiency after AI, superovulation and embryo transfer (ET) or cloning by nuclear transfer (NT) using control (C1), sham-transfected (CT), and 2 transgenic (CA, CB) syngeneic fibroblast cells lines in goats Group

NT

ET AI

Cell (passage)

CA (9–10) CB (8) C1 (3) CT (8) – –

Embryos, no.

276 135 58 30 56 –

P , 0.05.

a,b

This research was funded by FINEP.

Recipients, no.

20 10 4 2 9 14

Pregnancies No.

%

Per embryo

4 3 1 1 7 10

20.0b 30.0b 25.0ab 50.0ab 77.8a 71.4a

1 : 69 1 : 45 1 : 58 1 : 30 1:8 –

Abortions, no.

Newborns, no.

Perinatal death, no.

3 3 1 1 0 0

2 0 0 0 11 14

1 0 0 0 3 3

112


38


EFFECT OF OOCYTE MATURATION DURATION ON BLASTOCYST RATES AFTER EQUINE SOMATIC CELL NUCLEAR TRANSFER Y. H. Choi, I. C. Velez, B. Macıás-Garcıá, and K. Hinrichs Texas A&M University, College Station, TX, USA

In equine cloning, the scarcity of equine oocytes places emphasis on development of the most efficient nuclear transfer (NT) methods possible. In other species, using oocytes matured for the shortest duration needed to reach metaphase II has increased NT efficiency. In the present study, we examined the effect of duration of oocyte maturation at the time of enucleation on equine cloned blastocyst production. Oocytes were collected from live mares by transvaginal ultrasound-guided aspiration of all visible follicles $5 mm in diameter. The oocytes were held overnight (16–22 h) at room temperature, matured in vitro, and reconstructed with donor cells as described in our previous study (Choi et al. 2013 Theriogenology 79, 791–796). In Experiment 1, oocytes were divided into 2 groups and matured for 20 or 24 h. After enucleation, oocytes were reconstructed by direct injection of donor cells. Reconstructed oocytes were held for 5 h and then activated by treatment with 5 mM ionomycin for 4 min, then injection with sperm extract, followed by incubation in 2 mM 6-DMAP for 4 h. The activated reconstructed oocytes were cultured in global human embryo culture medium under 5% CO2, 6% O2, and 89% N2 at 38.28C for 7 to 11 days (20 mM glucose was added at Day 5) and blastocyst rate was recorded. Because a low maturation rate was found at 20 h in Experiment 1, in Experiment 2 oocytes were denuded at 20 h and those that were mature were enucleated and used for NT; those that had not cast out a polar body at 20 h were cultured for an additional 3 h (20 þ 3h) and then evaluated for polar body formation and used for NT, which was conducted as in Experiment 1. Data were analysed by Fisher’s exact test. In Experiment 1, 203 oocytes were collected in 46 aspiration sessions. The rate of oocyte maturation to metaphase II was significantly lower for oocytes cultured for 20 h (35/116, 30%), than for those cultured for 24 h (47/80, 59%). However, the rate of blastocyst development was significantly higher for oocytes cultured for 20 h (11/27, 41%) than for 24 h (2/38, 5%). In Experiment 2, 89 oocytes were collected in 18 aspiration sessions. After 20 h of maturation culture, 22 oocytes were mature (25%). After an additional 3 h of culture, 21 additional oocytes had matured. There were no significant differences between the two treatments (20 and 20 þ 3h) in reconstruction rates (77%, 17/22, and 90%, 19/21, respectively) or blastocyst rates (24%, 4/17, and 32%, 6/19, respectively). These results indicate that duration of in vitro maturation, or the duration of presence of cumulus cells, influences blastocyst development after somatic cell NT in the horse. This appears to be due to a benefit of using oocytes immediately after they reach metaphase II; if this is ensured as in Experiment 2, the duration of maturation itself had no effect. This work was supported by the American Quarter Horse Foundation, the Link Equine Research Endowment Fund, Texas A&M University, and by Ms. Kit Knotts.

39

PLACENTA ABNORMALITIES IN SHEEP SOMATIC CELL CLONES AT 20 DAYS OF GESTATION M. Czernik, P. Toschi, D. Iuso, F. Zacchini, GE Ptak, and P. Loi University of Teramo, Teramo, Italy

Somatic cell nuclear transfer (SCNT) has a broad spectrum of potential applications, ranging from therapeutic cloning, production of transgenic animals, drug production, regenerative medicine and even for the rescue of endangered species. It is already more than 16 years since Dolly, first cloned mammal, was born, and many improvements in SCNT have been made by using different epigenetic and technical approaches but the efficiency is still disappointingly low. Only ,0.1 to 3% of reconstructed embryos develop to term. SCNT is associated with high rate of fetal, perinatal, and neonatal losses and production of abnormal offspring. Many factors have been implied in the pathogenesis of the NT fetal losses, but it seems that the highest incidence is placental abnormalities, confirmed by our first reports studied on full-term sheep placentas. Reports strongly suggest that post-mortality in cloned lambs is mainly caused by placental abnormalities such as placentomegaly, hypoplasia of trophoblastic epithelium, altered basement membrane, and reduced vascularisation. The pathogenesis of these changes is poorly understood, so here we analysed early sheep placenta (20 days) for better understanding of mechanisms involved. Blastocysts obtained by nuclear transfer of somatic cells (adult sheep fibroblasts) were transferred into recipient ewes. Naturally mated ewes were analysed as controls (CTR). Conceptuses were recovered at Day 20 of gestation. Then, part of their placentas were fixed for histological and transmission electron microscope (TEM) analysis; other parts of the tissues were snap frozen in liquid nitrogen for subsequent mRNA analysis. Expression of genes regulating vasculo- and angiogenesis (ANG1, ANG2, FGF-2, FGF-2R, VEGF, and Tie-2) as well as imprinted genes (IGF-2, H19, PHLDA-2) were analysed. Statistical analysis was performed using GraphPad software (GraphPad Software Inc., San Diego, CA, USA). Gene expression was analysed using the nonparametric Mann-Whitney test; P , 0.05 was considered significant. Expression of all analysed imprinted genes as well as vasculo- and angiogenesis factors in NT placentas at Day 20 of development were down-regulated (v. CTR). Histological analysis showed reduced vascularization and increased apoptosis in placental tissue. The observation of ultrathin sections confirmed placental abnormalities. Cells presented decreased density of mature mitochondria, high number of cytoplasmic vacuolization, numerous cytoplasmic vesicles and autophagosomes, less developed cells to cell junctions, and disruption of chorionic villi, being irregularly and sparsely arranged. The results of the present study indicate that the placental abnormalities affecting particularly the vascular compartment start from early stage of placenta development. Moreover, imprinted genes, which have been already shown to determine the transport capacity of the placenta by regulating its growth, morphology and nutrient abundance, were deregulated in NT early placentas. All those factor can lead to the developmental failure of cloned fetuses.


40


113

TRICHOSTATIN A TREATMENT EFFECTS ON IN VITRO DEVELOPMENT OF INTERSPECIES NUCLEAR TRANSFER CAT EMBRYOS DEPEND ON RECIPIENT CYTOPLASM SPECIES L. T. K. Do, Y. Sato, M. Taniguchi, and T. Otoi

Laboratory of Animal Reproduction, The United Graduate School of Veterinary Science, Yamaguchi University, Yamaguchi, Japan The developmental ability of interspecies somatic cell nuclear transfer (iSCNT) embryos decreases as the taxonomic distance between the donor and recipient species increases. Treatment of cat iSCNT embryos using bovine oocytes with 50 nM of trichostatin A (TSA) improves in vitro embryonic development (Wittayarat et al. 2013 Cell. Reprogram. 15, 301–308). This study investigated whether the TSA treatment effects differ between the development of cat iSCNT embryos reconstructed with porcine and bovine oocytes. Porcine and bovine cumulus-oocyte complexes were in vitro matured for 44 h and 24 h, respectively. After cumulus cell removal, enucleation was performed by aspiration of the metaphase II plate and the first polar body using a piezo-driven pipette. A cat fibroblast cell was then injected into cytoplasm of successfully enucleated oocyte. Reconstructed cybrids were electrically activated by a single 1.5 kV cm1 pulse for 100 ms (pig-cat embryos), or a 2.3 kV cm1 pulse for 30 ms (cow-cat embryos). Pig-cat and cow-cat embryos were cultured in porcine zygote medium (PZM)-5 and modified synthetic oviducal fluid medium (mSOF), respectively. After electrical activation, pig-cat and cow-cat embryos were cultured in medium supplemented with 5 mg mL1 cytochalasin B þ 50 nM TSA (TSA group) or without TSA (control group), and the cow-cat embryo medium was also supplemented with 10 mg mL1 cycloheximide. After 2 h, TSA-treated pig-cat and cow-cat embryos were incubated in medium supplemented with TSA for 22 h, followed by 48 h incubation without TSA. Pig-cat and cow-cat control embryos were cultured in medium without TSA for 70 h after activation. Then, all pig-cat and cow-cat embryos were cultured in porcine blastocyst medium (PBM) or mSOF medium supplemented with 5% fetal bovine serum, respectively, for 5 additional days. Four to seven replicates were performed for each experiment. Data were analysed using Student’s t-test. For pig-cat embryos, no difference was observed in cleavage rates between both groups, but development to the blastocyst stage was higher in the pig control group (n ¼ 147, 8.0%) than that of pig TSA group (n ¼ 131, 0.7%; P , 0.05). In contrast, development to the blastocyst stage in cow-cat embryos was not observed in the cow control group (n ¼ 125, 0%), but it was observed in cow TSA group (n ¼ 136, 3.7%). These results indicate that TSA treatment effects are species-specific, but those effects remain to be clarified.

41

UPDATING THE ZONA-FREE METHOD FOR MOUSE CLONING USING HM1 EMBRYONIC STEM CELLS I. LagutinaA, M. LizierB, M. PaulisB, F. LucchiniC, A. CastelliB, L. SusaniB, C. GalliA,D, and P. VezzoniB A Avantea, Laboratory of Reproductive Technologies, Cremona, Italy; UOS/IRGB/CNR, Humanitas Clinical and Research Center, Rozzano, Italy; C CRB-UCSC, Cremona, Italy; D Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia, Italy; E Avantea Foundation, Cremona, Italy B

The zona-free method of SCNT designed for bovine and pig cloning (Booth et al. 2001; Vajta et al. 2001; Oback et al. 2003) was successfully used for horse (Galli et al. 2003). Although simple and efficient in farm animals, its application in the mouse met several problems (Ribas et al. 2005, 2006). The aim of our work was to produce cloned mice using HM1 embryonic stem (ES)cells adapting a zona-free method. Seven- to 24-week-old superovulated B6D2F1 female mice were used as oocytes donors. Cumulus cells were removed by 0.3% hyaluronidase and the zona pellucida by 0.5% pronase in KSOM-HEPES (KSOM-H) 1 h later (Ribas et al. 2006) or immediately after hyaluronidase treatment at 378C. The HM1 ES cells were cultured in KnockOut DMEM supplemented with leukemia inhibitory factor and 15% fetal bovine serum with or without 2i (Ying et al. 2008) and were synchronized at M phase by 3 ng mL1 nocodazole for 3 h before fusion. Only spherical cells were selected for NT. Metaphase II chromosome spindle complexes were removed by micromanipulation in KSOM-H medium with 5 mg mL1 cytochalasin B. Lectin-treated enucleated oocytes were attached to the donor cells in KSOM-H with nocodazole and fused by 2 pulses of 1.3 kV cm1 DC for 30 ms in 0.3 M mannitol medium. Following 10- to 15-min incubation in KSOM-H, the fusion was assessed and repeated if the constructs were nonfused. Cloned embryos were activated in 1 mM SrCl2 in Ca2þ-free KSOM medium for 2 to 2.5 or 5 to 6 h and cultured in 20-mL KSOM droplets using the well-ofthe-well (WOW) method (Vajta et al. 2000) under mineral oil at 378C and 5% CO2. Day 4 compacted morulae and blastocysts were surgically transferred into the uterus of Day-2.5 pseudopregnant recipients that were sacrificed on Day 19.5 to examine fetal development. The donor mice age was important for oocyte survival: ,16% of oocytes of 7- to 10-week-old mice lysed before or during fusion in 33% of experiments (n experiments ¼ 15), whereas oocytes of older mice were not sensitive to enzymatic treatment and electric impulses even after 3 fusion rounds (n ¼ 19). The time of pronase treatment did not affect oocyte survival, whereas extending the time between hyaluronidase treatment and enucleation revealed self-activation in ,25% of oocytes. The fusion efficiency of ES cells was significantly lower compared with serum-starved fibroblasts (61%, n ¼ 623 v. 100%, n ¼ 80). The duration of SrCl2 treatment did not affect embryo development (cleavage: 82% v. 84%; Day 4 blastocysts: 49% v. 52%). ES cell culture with 2i increased Day 4 blastocyst development (60.7% v. 50.4%; P ¼ 0.07), and their ability to implant (52.6% v. 38.2%; P ¼ 0.06). Moreover, only NT embryos derived from 2i-ES cells developed to term (8.2%, n ¼ 5; P ¼ 0.08), and produced live fetuses (4.9%, n ¼ 3). In light of these results, the fusion of ES cells remains the critical step in the mouse zona-free protocol. Partially supported by grant Superpig from Regione Lombardia.

114

42


Cryopreservation/Cryobiology

CONVERSION OF THE CHROMATIN OF SOMATIC CELLS INTO SPERMATID-LIKE STRUCTURES D. IusoA, M. CzernikA, P. ToschiA, F. ZacchiniA, H. ShiotaB, S. BarralB, S. CurtetB, T. BuchouB, G. PtakA, S. KhochbinB, and P. LoiA B

A University of Teramo, Teramo, Italy; INSERM-UJF U823 Institut Albert Bonniot, Grenoble, France

The post-meiotic phase of spermatogenesis is characterised by a radical reorganization of the chromatin, leading to its nucleosomal to toroid transition. The replacement of histones with protamine is a gradual process regulated to the hierarchical translation of repressed mRNAs leading to the following events: incorporation of testis-specific histone variants and general histone hyperacetylation, bromodomain proteins, transition proteins, concluded by protamine incorporation on DNA. In this work, we tested whether the induced expression of human protamine 1 (PR1) in sheep somatic cells could induce a protamine/toroid conformation of interphase nuclei. Sheep adult fibroblasts (SAF) were cultured in DMEM with 10% fetal bovine serum from second to eighth passage. Then, SAF at 80% confluence were transfected with 3 mg of pPR1-red fluorescent protein (RFP) and pRFP (CTR) with lipofectamine. At 4 h post-transfection, cells were treated with 5 nM trichostatin A (TSA; histone deacethylase inhibitor) for an additional 16 h. Transfected cells (visualised through the RFP tag) were analysed for nuclear morphology (transmission electron microscopy), PR1-RFP expression (confocal microscope, RT-PCR, Western blot), cytofluorimeter, DNA damage (comet assay, pH2A.X immune-detection), and chromatin immune-precipitation assays (ChIP). Moreover, to visualise the histone/protamine exchange, we transfected with PR1 mouse GFP-H2B fibroblasts. Protaminized cells were used as donors for nuclear transfer (NT) and TH2B (testis/oocyte-specific histone normally present in male pronucleus, a marker of reprogramming) was detected in pronuclear stage of NT zygotes. The x2 test was used for statistical analyses. We demonstrated that PR1 translocates into the nuclei and gradually compacts them into elongating spermatid-like structures in 48 h; TSA treatment facilitates the process [TSA 83.3% (50/60); without TSA 55.2%; 58/105; P , 0.0003]. A complete histone-to-protamine exchange was also visualised in GFP-H2B nuclei (mouse fibroblasts) 40h after PR1 transfection. Cytofluorimetric analysis demonstrated that protamine incorporation occurs in any cell cycle stage and without DNA breaks. Next, protamine-protamine binding was excluded by ChIP analysis, which confirmed protamine-DNA binding. Finally, protaminized nuclei transplanted into enucleated oocytes incorporated maternal histone TH2B (3/8), whereas no signal was detected in control cells (0/9), suggesting that protaminized nuclei are better remodelled. We conclude that the induced expression of PR1 forces the somatic chromatin to acquire a structure overlapping elongated spermatid/spermatozoa, a conformation that perfectly matches the nuclear reprogramming machinery of the oocyte. Further work will determine whether protaminized cells are better reprogrammed upon nuclear transfer.

Cryopreservation/Cryobiology 43 NEW METHOD FOR ONE-STEP WARMING/IN-STRAW CRYOPROTECTANT DILUTION FOR IN VITRO-PRODUCED BOVINE BLASTOCYSTS AFTER VITRIFICATION WITH THE CRYOLOGIC VITRIFICATION METHOD J. N. Caamanõ, E. Go´mez, B. Trigal, M. Munõz, S. Carrocera, D. Martıń, and C. Dıéz SERIDA, Gijoń, Asturias, Spain Vitrification is considered an alternative to slow-rate freezing to cryopreserve in vitro-produced (IVP) bovine embryos. However, the use of vitrified IVP embryos for embryo transfer under field conditions is difficult because of the requirements of the current thawing protocols. The objective of this study was to develop a simple one-step warming/in-straw cryoprotectant dilution procedure for IVP bovine blastocysts that were vitrified using the cryologic vitrification method. In this study, 109 Day-7 IVP blastocysts were subjected to vitrification using the conventional fibreplugs (groups of 5 embryos were loaded in 3 mL of vitrification medium). Warming was performed in one-step in MS1 (0.25 M sucrose in BV ¼ TCM 199-Hepes þ 20% FCS) either using a 4-well plate for 5 min (control group) or in a new system that allowed in-straw cryoprotectant dilution designed to avoid losses of embryos and to maintain the temperature required during this procedure. This new system is composed of an adaptor with a wider opening that is coupled to the French straw and a heated metal chamber to protect and keep the straw at 418C. Warmed embryos were washed and subsequently cultured in mSOFaaci þ 6 gL1 BSA þ 10% FCS for 48 h. Re-expansion (at 2, 24, and 48 h) and hatching rates (at 24 and 48 h) were recorded. Data were analysed by ANOVA and are presented as LSM standard error. Embryo survival rates of embryos warmed by the one-step warming/in-straw cryoprotectant dilution procedure did not differ from the control group (see Table 1). These results suggest that the cryologic vitrification method combined with our warming system for in-straw cryoprotectant dilution may be used for direct embryo transfer under field conditions. Table 1. Embryo survival rates of in vitro-produced embryos vitrified by the cryologic vitrification method and warmed by the new one-step warming/in-straw cryoprotectant dilution procedure Warming group

Control One-step/in-straw dilution

N

52 57

2h

24 h

48 h

% RE

% RE

% Hatching

% Hatched

% RE

% Hatching

% Hatched

100.2 8.7 80.1 8.7

98.6 1.0 89.1 1.0

40.1 10.8 50.7 10.8

24.8 4.3 23.0 4.3

94.2 1.0 87.9 1.0

85.6 1.4 71.5 1.4

76.4 1.7 53.8 1.7

N ¼ cultured embryos after warming; RE ¼ re-expanded blastocysts. Data are least squares means standard error of the mean.

This study received grant support: INIA-RTA 2011–0090 and FEDER. M. Munõz was supported by grant MICINN-RYC08-03454, and B. Trigal by a grant from Cajastur. The authors are members of the COST Action FA1201 Epiconcept.


44


115

THE EFFECT OF SUCROSE CONCENTRATION FOR SINGLE-STEP DILUTION ON THE VIABILITY OF CRYOTOP-VITRIFIED IN VITRO-PRODUCED BOVINE EMBRYOS S. Kondo, K. Imai, and O. Dochi Rakuno Gakuen University Graduate School, Ebestu, Bunkyodai, Hokkaido, Japan

The aim of this study was to test sucrose concentrations for single-step dilution on the viability of vitrified in vitro-produced bovine embryos. Blastocysts (n ¼ 173, 7 to 8 days after fertilization) were vitrified using the Cryotop (Kitazato, Tokyo, Japan) method placement by incubating the blastocysts in Dulbecco’s phosphate buffered saline supplemented with 20% calf serum, 7.5% ethylene glycol, and 7.5% dimethyl sulfoxide for 3 min and then transferring into vitrification solution (Dulbecco’s phosphate buffered saline supplemented with 20% calf serum, 16.5% ethylene glycol, 16.5% dimethyl sulfoxide, and 0.5 M sucrose). Each embryo was placed on a Cryotop with minimum volume of vitrification solution, and then the Cryotop was plunged into liquid nitrogen. Total time from placement in vitrification solution to plunging into liquid nitrogen was 1 min. The blastocysts were warmed by incubation in the single-step dilution medium for 5 min [0 M sucrose (n ¼ 42), 0.25 M sucrose (n ¼ 44), 0.5 M sucrose (n ¼ 43), and 1.0 M sucrose (n ¼ 44)] at 38.08C. After dilution, the embryos were washed in TCM-199 supplemented with 20% calf serum and 0.1 mM b-mercaptoethanol and were cultured for 72 h in the same medium at 38.58C in an atmosphere of 5% CO2. The rates of re-expanded blastocysts and hatched blastocysts were determined at 24 and 72 h after warming, respectively. Data were analysed using the chi-squared test. The percent of re-expanded blastocysts at 24 h after warming in dilution medium supplemented with any level of sucrose was significantly higher (P , 0.05) than in blastocysts warmed without sucrose (Table 1). The hatched blastocyst rate of embryos at 72 h after warming in dilution medium with 0.5 M sucrose was significant higher than that with no sucrose. There were no differences in hatched blastocyst rates between the sucrose concentrations supplemented to the dilution medium. These results suggest that embryos vitrified by the Cryotop method can be diluted in single-step dilution using 0.25, 0.5, or 1.0 M sucrose supplemented to the medium. Table 1. The effect of sucrose concentration for single-step dilution on the viability of Cryotop vitrified in vitro-produced bovine embryos Sucrose (M) 0 0.25 0.5 1.0

No. of vitrified embryos

No. of re-expanded blastocysts (%) at 24 h

No. of hatched blastocysts (%) at 72 h

a

42 44 43 44

24 (57.1) 35 (79.5)b 36 (83.7)b 34 (77.3)b

22 (52.4)a 32 (72.7)ab 33 (76.7)b 30 (68.2)ab

Values within a column with different superscripts are significantly different (P , 0.05).

a,b

45

SPINDLE CONFIGURATION AND DNA FRAGMENTATION OF VITRIFIED BOVINE OOCYTES AFTER IN VITRO MATURATION WITH L-CARNITINE AND/OR RESVERATROL J. F. W. SpricigoA,B, N. ArcaronsA, T. MogasA, M. A. N. DodeC, and R. MoratoD A

Universitat Autonoma de Barcelona, Barcelona, Spain; B University of Brasilia, Brasilia, DF, Brazil; C Embrapa – Cenargen, Brasilia, DF, Brazil; D University of Girona, Girona, Spain

After cryopreservation, oocytes may suffer morphological and functional damage, due to the high cytoplasm lipid content and to the reactive oxygen species formation. The aim of this work was to evaluate the spindle configuration and the DNA fragmentation of vitrified/warmed oocytes after in vitro maturation (IVM) in a media supplemented with L-carnitine and/or resveratrol, a lipolytic and antioxidant agent, respectively. The IVM viable COC with at least 3 cumulus cell layers and homogenous cytoplasm were randomly distributed into 4 groups: (1) control: conventional IVM media with TCM-199, epidermal growth factor, and 10% FCS; (2) L-CAR: control media supplemented with 0.6 mg mL1 of L-carnitine; (3) RES: control media supplemented with 1 mM mL1 of resveratrol; and 4) LþR: control media supplemented with 0.6 mg mL1 of L-carnitine and 1 mM mL1 of resveratrol. After 22 h of IVM, half of the COC from each group were vitrified and warmed, using the cryotop methodology. After warming, the oocytes were allowed to recover in their respective media for 2 additional hours. After 24 h of IVM, oocytes from all treatments were completely denuded and fixed and stained using specific fluorescent probes. The microtubule/chromosome configuration and the DNA fragmentation were analysed by immunocytochemistry under a fluorescent microscope (A.40FL, Carl Zeiss, Oberkochen, Germany). All statistical analyses were conducted with IBM SPSS 19 (IBM; Chicago, IL, USA). ANOVA was performed to analyse differences in meiotic spindle configuration, and the Chi-squared test was used for DNA fragmentation. The significance level was 5%. Although vitrification may cause severe oocyte damage, IVM with L-carnitine alone or in association with resveratrol was able to reduce the percentage of abnormal spindle configurations (Table 1), whereas the addition of resveratrol alone or its association with L-carnitine reduced DNA fragmentation of IVM oocytes after a vitrification/warming process. These results indicate the IVM supplementation with RES and/or L-CAR could modify oocyte composition, increasing its cryotolerance. However further studies are required to confirm the beneficial effect of these molecular interactions.

116



Table 1. Evaluation of spindle configuration (Experiment 1) and apoptotic cell status (Experiment 2) of fresh or vitrified/warmed oocytes matured with RES and/or L-CAR Item

Spindle configuration Total n

Control L-CAR RES LþR Control VIT L-CAR VIT RES LþR VIT a–c

46

78 84 67 76 57 55 68 42

TUNEL assay

Abnormal n (%) ab

23.1 (18) 11.9 (10)a 14.9 (10)a 17.1 (13)a 54.4 (31)c 45.5 (25)bc 52.9 (36)c 47.6 (20)bc

Total n

Apoptotic n (%)

59 43 58 61 67 49 52 59

3.4 (2)ab 4.7 (2)ab 5.2 (3)ab 1.6 (1)a 11.9 (8)b 10.2 (5)b 7.7 (4)ab 5.1 (3)ab

Different letters in the same column differ significantly (P , 0.05).

SPINDLE CONFIGURATION OF IN VITRO-MATURED BOVINE OOCYTES EXPOSED TO SODIUM CHLORIDE OR SUCROSE PRIOR TO CRYOTOP VITRIFICATION N. ArcaronsA, R. Morato´B, J. F. W. SpıćigoA, M. A. M. M. FerrazA, and T. MogasA A

Universitat Auto`noma de Barcelona, Bellaterra, Spain; B Universitat de Girona, Girona, Spain

It has been previously described that a simple treatment with medium containing elevated NaCl or sucrose concentrations increases the cryotolerance and developmental competence of in vitro-matured porcine oocytes after vitrification and parthenogenetic activation (Lin et al. 2009 Reprod. Fertil. Dev. 21, 338–344). This work was designed to study whether the exposure to increased concentrations of NaCl or sucrose before vitrification improves cryotolerance of in vitro-matured bovine oocytes. In Experiment 1, in vitro-matured oocytes were exposed to different NaCl and sucrose concentrations (from 375 to 808 mOsm) for 1 h. In Experiment 2, and according to the results obtained in the first experiment, oocytes were exposed to 375 mOsm NaCl or sucrose solution, vitrified, and warmed. Nontreated oocytes were used as controls. In both experiments, oocytes were fixed after treatment and microtubule, and chromosome distribution was analysed by immunocitochemistry. All statistical analyses were conducted with the IBM SPSS 19 for Windows (IBM corp., Chicago, IL). ANOVA was performed to analyse differences in meiotic spindle. Statistical significance was set at P , 0.05. After exposure to 375 mOsm of NaCl or sucrose, similar percentages of oocytes showing normal chromosome distribution were obtained compared to the control group (83.4, 71.8, and 85.0%, respectively). Groups treated with higher concentrations (443 to 808 mOsm) triggered significantly lower proportions of normal spindles. After vitrification/warming, no significant differences were observed between nonvitrified oocytes (71.3%) and those treated with NaCl before vitrification/warming procedure (41.9%) when normal chromosome organisation was analysed. Significantly higher percentages of normal chromosome configuration were observed when oocytes were exposed to sucrose before vitrification (34.2%) compared with control-vitrified oocytes (23.3%). However, pretreatment with NaCl or sucrose before vitrification did not trigger significant differences in terms of percentages of normal microtubule configuration (41.9 and 32.9%, respectively) compared with control-vitrified oocytes (40.2 and 24.4%, respectively), although both treatments differed significantly from control (79.1 and 81.7%, respectively). In conclusion, this study showed that a 375-mOsm NaCl or sucrose pretreatment of bovine oocytes before vitrification did not have a deleterious effect on the organisation of the meiotic spindle of vitrified/warmed bovine oocytes. Further experiments are required to investigate whether in vitro-matured oocytes subjected to this osmotic treatment could improve their development competence after being vitrified/warmed.

47

THE AVIAN CHORIO-ALLANTOIC MEMBRANE: A SUITABLE SHORT-TERM CULTURE SYSTEM FOR BOVINE OVARIAN TISSUE K. L. BeckA,B, J. SinghA, and M. AnzarA,B A

B

University of Saskatchewan, Saskatoon, Saskatchewan, Canada; Agriculture and Agri-Food Canada, Saskatoon, Saskatchewan, Canada

Successful cryopreservation of bovine ovarian tissue holds enormous potential for long-term maintenance of female gametes to preserve genetic diversity by tissue banking. Traditionally, in vitro culture followed by histopathological examination has been used to assess the post-thaw viability of cryopreserved tissues. Recently, in ovo transplantation of mammalian tissues on the chorio-allantoic membrane (CAM) of a growing chicken embryo has emerged as an alternative method for short-term culture. The purpose of this experiment was to compare CAM culture of bovine ovarian tissue over a 5-day period with the in vitro culture system. Fertilized White Leghorn eggs were incubated at 378C and 62% relative humidity. A window (1 2 cm) was cut into the eggshell on Day 3 of incubation. Ovaries were retrieved from a local abattoir and brought to the laboratory within 6 h. Ovarian cortex pieces (1–2 mm3) were randomly assigned to control, CAM-culture, or in vitro-culture groups. Control-group tissues were fixed immediately in 4% paraformaldehyde. The CAM was traumatized on Day 10 of incubation to expose the underlying blood vessels, and tissue pieces were grafted at the site (one graft per egg). For in vitro culture, the ovarian cortex pieces were placed on tissue culture inserts within 6-well plates



117

containing TCM199 with 1% insulin-transferrin-selenium, 100 mIU mL1 of FSH, 100 IU mL1 of penicillin, and 50 mg mL1 of streptomycin and incubated at 388C in 5% CO2. Ovarian tissues from the CAM and in vitro culture group were removed on Day 1, 3, and 5 of grafting/culture, fixed, embedded in paraffin, sectioned at 5 mm, stained with hematoxylin-eosin, and analysed under a light microscope. The numbers of normal and degenerated follicles (indicating follicle survival) and number of blood vessels containing bovine and avian red blood cells (indicating angiogenesis) were counted using standard stereological procedures. All ovarian cortex grafts from surviving chick embryos showed adhesion with the CAM and a marked neo-vascularization in the graft areas. Gross and histological examination revealed the circulation of avian blood cells in ovarian stromal vessels with a concomitant decrease in the number of bovine blood vessels over the incubation period. Total follicle densities (mean s.e.m.) on Day 1, 3, and 5 were 13.3 5.9, 27.9 6.7, and 36.9 7.3 in the in vitro-cultured group and 36.7 13.0, 73.6 24.0, and 44.02 12.67 per millimeter cubed in the CAM-cultured group, respectively. Overall, total follicle density was higher in the CAM-cultured group (P , 0.05). Likewise, the normal follicle densities on Day 1, 3, and 5 were 10.4 4.9, 15.5 3.6, and 20.7 6.3 in the in vitro-cultured group and 30.5 8.5, 45.7 18.4, and 22.7 7.3 per millimeter cubed in the CAM-cultured group (P . 0.05). In conclusion, in ovo CAM grafting system was as successful as the in vitroculture system and may be considered an acceptable alternative to the traditional in vitro-culture system for bovine ovarian tissue.

48

GLOBAL GENE EXPRESSION PATTERN OF BOS INDICUS AND BOS TAURUS VITRIFIED EMBRYOS

R. CancianA, M. MacelaiA, G. TavaresA, R. S. ValenteA, E. S. CaixetaB, A. Martins Jr.C, R. MachadoD, J. BuratiniE, F. S. MesquitaA, F. C. Landim-AlvarengaE, and M. J. SudanoA A

Federal University of Pampa, Uruguaiana, RS, Brazil; B Unifenas, Alfenas, MG, Brazil; C Saõ Paulo State University, Araçatuba, SP, Brazil; D CPPSE – Embrapa, Saõ Carlos, SP, Brazil; E Saõ Paulo State University, Botucatu, SP, Brazil

The cryopreservation of in vitro-produced (IVP) bovine embryos is one of the most challenging areas of the assisted reproductive biotechnologies. The aim of the present study was to evaluate the global gene expression pattern of Bos indicus (Nellore) and Bos taurus (Simmental) IVP embryos after vitrification. Follicular aspiration was performed on Nellore (n ¼ 14) and Simmental (n ¼ 14) cows, and oocytes (n ¼ 840 and 450; respectively) were submitted to in vitro maturation and in vitro fertilization. Presumptive zygotes were denuded and cultured in SOFaa with 0.5% BSA and 2.5% FCS during 7 days under standard culture conditions. Blastocysts (grade 1 and 2) were vitrified, warmed, and cultured for an additional 12 h under the same conditions. Nellore (n ¼ 8) and Simmental (n ¼ 8) IVP blastocysts considered viable after vitrification, with re-expanded blastocoel, were submitted to total RNA extraction (PicoPure, Arcturus, Applied BiosystemsÒ, Foster Dity, CA, USA), DNAse I treatment (QiagenÒ, Valencia, CA, USA), and amplification (RiboAmp, Applied BiosystemsÒ). Fragmented cRNA were obtained through 30 IVT Express Kit (AffymetrixÒ, Santa Clara, CA, USA) to perform the hybridization using GeneChip Bovine Genome Array (AffymetrixÒ). Microarray data analysis was performed using the FlexArray 1.6.1.1 software. Genes with at least a 1.5-fold change and a P-value of less than 0.05 were considered differentially expressed. Of the 1278 genes differentially expressed between Bos taurus and Bos indicus vitrified embryos, 1108 were annotated, with 1193 genes up-regulated and 85 genes down-regulated in Bos taurus compared with Bos indicus IVP vitrified embryos. Differentially expressed genes were associated with the functional networks of cell cycle, cellular movement and DNA replication, recombination and repair; RNA post-transcriptional modifications; gene expression, protein synthesis; RNA damage and repair; cellular function and maintenance; and cell death and survival. The top 6 canonical pathways generated by Ingenuity Pathway AnalysisÒ with the differentially expressed genes were ELF2 signalling, oxidative phosphorylation, tricarboxylic acid cycle, protein ubiquitination pathway, mTOR signalling, and IGF-1 signalling. In conclusion, Bos taurus IVP embryos seem to trigger different cellular response mechanisms to the vitrification stress in comparison with Bos indicus IVP embryos. Differential response is mainly represented by different expression profiles of genes regulating important canonical pathways involved in cellular response to stress that could be related with the higher post-cryopreservation survival capacity observed in Bos taurus embryos. Research was supported by FAPESP, CNPq, FAPERGS, and LNBio – National Laboratory of Biosciences/MCT.

49

EFFECTS OF DIETARY CONJUGATED LINOLEIC ACID SUPPLEMENTATION ON BOVINE OOCYTE LIPID METABOLISM, LIPID COMPOSITION, AND EMBRYO CRYOTOLERANCE C. L. BaileyA, J. A. Sarmiento-GuzmańA, S. E. FarmerA, G. T. Gentry Jr.A, J. W. LynnB, K. R. BondioliA, and R. A. GodkeA A

School of Animal Sciences, Louisiana State University Agricultural Center, Baton Rouge, LA, USA; B Department of Biological Sciences, Louisiana State University, Baton Rouge, LA, USA

Reduced tolerance to chilling and cryotolerance of oocytes and embryos has been associated with greater cytoplasmic lipids. Previous studies in the cow have demonstrated nutrition-induced modification of follicular components. trans-10, cis-12 conjugated linoleic acid (CLA) was identified as a potent inhibitor of milk fat synthesis in lactating cows, and inclusion of CLA in bovine embryo culture medium reduced embryo lipid content and improved post-thaw embryo survival. Dietary supplementation of cows with CLA could alter oocyte fatty acid metabolism, oocyte lipid composition, and embryo cryotolerance, and responses may be different between Bos indicus and Bos taurus cattle. Therefore, a series of experiments were conducted to evaluate effects of dietary CLA on bovine oocyte lipid content and lipid metabolism and cryosurvival of in vitro-produced embryos from CLA-supplemented oocyte donor cows. Lactating Holstein cows (n ¼ 39) were supplemented 100 g per head/d CLA or Ca salts of palm oil to determine effects of dietary CLA on milk production and milk composition. Nonlactating Holstein (n ¼ 8) and Brahman (n ¼ 17) cows were

118



individually supplemented with 150 g per head/d CLA or no lipid supplement. Cumulus-oocyte complexes (COC) were collected after 41 1 day of CLA supplementation, and mRNA was isolated for qPCR. Relative gene expression in COC from CLA- and control-fed cows was evaluated for genes involved in lipid metabolism (CPT1, FADS2, and PPARa). Crossbred (Angus Red Angus Brangus) cows (n ¼ 28) were randomly allotted to a 2 2 factorial experiment and fed 150 g per head/d CLA or no lipid supplement. Oocytes were collected (Day 129 and 143 of CLA supplementation), matured, fertilized, and cultured in vitro for 7 days in serum-free culture medium. Embryos were cryopreserved in individual 0.25-mL plastic straws containing 1.5 M ethylene glycol using a slow-cooled method. Post-thaw survival and hatching were evaluated using a 24-h in vitro culture (mSOF with 5% FBS) assay. Milk yield, milk composition, and Nile Red intensity were analysed using the GLM procedure of SAS (SAS Institute Inc., Cary, NC, USA). Follicle and oocyte responses were analysed with the Mixed procedure of SAS. Relative gene expression of COC was evaluated using the REST 2009 Software. In vitro embryo production, post-thaw survival, and hatching rates were analysed using Chi Square. Milk fat was depressed (P , 0.001) by 10.1% in lactating Holstein cows fed CLA. Dietary supplementation of Holstien and Brahman cows with CLA did not alter expression of genes (CPT1, FADS2, and PPARa) in COC. Dietary supplementation of crossbred cows with CLA before oocyte collection did not influence cryotolerance of in vitro-produced embryos. Lipid content of oocytes (measured by Nile Red florescence) and follicle, oocyte, and embryo production was not influenced by CLA supplementation of Holstein and Brahman cows. The highly regulated mechanisms involved in fatty acid uptake by ovarian components may help explain the lack of ovarian response to dietary CLA in the current study.

50 BOVINE SPERM DEATH KINETICS: TEMPORAL CHANGES IN PRODUCTION OF REACTIVE OXYGEN SPECIES AND PLASMA MEMBRANE INJURY OF DAIRY AND BEEF FROZEN-THAWED SEMEN M. AhmadA,B, N. AhmadA, and M. AnzarB,C A

B

Department of Theriogenology, University of Veterinary and Animal Sciences, Lahore, Pakistan; Department of Veterinary Biomedical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, SK, Canada; C Agriculture and Agri-Food Canada, Saskatoon Research Center, Saskatoon, SK, Canada

The extent of changes in sperm structure and function affect the success of fertilization ultimately during the pathway to ovum in the female reproductive tract. The success of AI with frozen-thawed semen varies in dairy and beef breeds of bovine because of differed alterations in sperm during transport in female tract after insemination. To our knowledge, no report is available comparing the changes in dairy and beef sperm leading to death in female tract. Therefore, this study was aimed to investigate the changes in motility, generation of reactive oxygen species (superoxide and hydrogen peroxide), and their relation to sperm death [asymmetry (apoptosis) and rupture of plasma membrane] of dairy and beef frozen-thawed semen during incubation at 378C for 24 h. This incubation was aimed to mimic the environment of female reproductive tract. Frozen dairy semen (n ¼ 4 bulls) was procured from a Canadian breeding station, whereas beef semen was collected from breeding beef bulls (n ¼ 3; 5 replicates), diluted with Tris-based extender (composition was same as used in dairy semen), cooled to þ48C over 90 min, and cryopreserved by programmable freezer using standard rate as used in dairy semen. Two straws per replicate were thawed at 378C from both types of semen, pooled separately, and incubated at 378C for 24 h in capped tubes. Each pooled semen sample was evaluated for motility with CASA, superoxide (O 2 , and hydrogen peroxide (H2O2) radical using HE/YoPRO and H2DCFDA/PI assay, respectively, and asymmetry of plasma membrane using YoPRO/PI assay through flow cytometric analysis at 0, 2, 4, 6, 12, and 24 h of incubation. The MIXED procedure of SAS (SAS Institute Inc., Cary, NC, USA) was used to analyse the data as 2 6 factorial model for 2 types of semen (dairy and beef) and 6 time points using time as repeated measure. A threshold limit of 30% was considered for motility and live sperm to get optimum fertility. Sperm motility remained higher (P , 0.05) than threshold limit till 6 h in dairy (50.95 2.62%) and 2 h in beef semen (30.28 6.95%). Dairy semen possessed more (P , 0.05) nonapoptotic sperm without O 2 (HE/YoPRO) till 6 h of incubation than beef semen. The increase in apoptotic sperm containing superoxide radical (HEþ/YoPROþ) over time was more (P , 0.05) in beef semen till 6 h of incubation. The rise in dead sperm containing H2O2 (H2DCFDAþ/PIþ) was recorded more in beef than in dairy semen until 6 h of incubation. Live sperm without apoptosis (YoPRO/PI) were higher until 24 h in dairy (49.36 4.56%) compared with beef semen (24.89 3.85%), whereas viable sperm with apoptosis (YoPROþ/PI) were found similar in both types of semen over time. In conclusion, dairy frozen-thawed semen possessed more live sperm without reactive oxygen species (superoxide and hydrogen peroxide) until 6 h of incubation than did beef semen. The decrease in superoxide radical was more in dairy than in beef semen. Dead and apoptotic sperm increased more in beef frozen-thawed semen over time during incubation. This inference suggests performing the insemination late near ovulation with beef frozen-thawed semen because of less viable life than dairy semen.

51

STRESS PRECONDITIONING OF SPERMATOZOA WITH SUBLETHAL CONCENTRATIONS OF ETHANOL IMPROVE POST-THAW SPERM QUALITY IN BULL H. Vaseghi-DodaranA, M. ZhandiA, M. SharafiA, E. Nejati-AmiriA, A. Nejati-JavaremiA, and A. Mohammadi-SangcheshmehB A

Department of Animal Science, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran; B Department of Poultry Science, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran; C Department of Animal and Poultry Science, College of Aburaihan, University of Tehran, Pakdasht, Tehran, Iran

A variety of controlled mild stressors have been applied for activation of temporary response in oocytes, embryos, and somatic cells. So far, several stressors have been used to induce mild stress, including that of hydrostatic pressure, osmotic stress, mechanical stress, and oxidative challenges. Based on these evidences, we hypothesised that the ethanol in sublethal concentration would be capable of generating mild stress that may ultimately



119

leads to an adaptive response in spermatozoa. To evaluate this hypothesis, semen samples (n ¼ 24, 6 ejaculates/bull) from 4 Holstein bulls were collected and pooled for each replicate. Pooled samples were divided into 5 equal parts and each part diluted with tris-glycerol-based (OptidylÒ) extender containing 0 (O-E0), 0.03 (O-E3), 0.09 (O-E9), and 0.15 (O-E15) % (vol/vol) ethanol and frozen. After thawing, sperm motility and velocity parameters (sperm class analysis), apoptosis status (Phospatidylserin Translocation Detection commercial kit), plasma membrane integrity (eosinNigrosin staining), malondialdehyde concentration (thiobarbituric acid reaction), and mitochondrial activity (rhodamine-123 and propidium iodide) were evaluated. The data were analysed using Proc Mixed of SAS 9.1 (version 9.1; SAS Institute Inc., 2002, Cary, NC, USA). Tukey’s test was used to compare least squares means. As a result, the O-E9 group showed higher (85.2%) percentage of total motility compared with O-E0 (73.6%), O-E3 (51.9%), and O-E15 (67.5%) groups (P , 0.05). A highest (P , 0.05) percentage of live spermatozoa were observed in the O-E9 (62.9%) group as compared with O-E0 (49.4%), O-E3 (50.3%), and O-E15 (49.6%) groups, and also the proportion of apoptotic spermatozoa in the O-E9 (10.6%) group tended to be lowest as compared with those of O-E0 (15.6%), O-E3 (17.2%), O-E15 (14.1%) groups (P . 0.05). The plasma membrane integrity was higher (P , 0.05) in O-E9 (90.8%) compared with O-E3 (75%) and O-E15 (77.2%) groups; however, the difference was not significant when the O-E9 group was compared with the O-E0 group (83.2%; P . 0.05). Obtained results revealed that malondialdehyde level was lower in O-E3 (1.03%), O-E9 (0.63%), and O-E15 (0.89%) groups compared with the O-E0 (1.94%) group (P , 0.05). Furthermore, the percentage of live spermatozoa with active mitochondria was higher in O-E9 (57.7%) and O-E15 (57.5%) groups compared with O-E0 (49.1%) and O-E3 (38.2%) groups (P , 0.05). These results strongly suggest that supplementation of OptidylÒ extender with sublethal concentration of ethanol influences post-thawed bull sperm quality in a dose-dependent manner. However, further studies are needed to empirically determine the effect of supplementation on fertilization and pregnancy outcome.

52

EFFECT OF CARBOXYLATED POLY-L-LYSINE ON THE POST-THAW VIABILITY OF IN VITRO-PRODUCED BOVINE BLASTOCYST

A. N. HaA, K. L. LeeA, Md. FakruzzamanA, S. S. KimA, P. R. ParkA, J. I. JinA, S. H. HyonC, and I. K. KongA,B B

A Department of Animal Science, Division of Applied Life Science (BK21 plus); Institute of Agriculture and Life Science, Gyeongsang National University, Jinju, Republic of Korea; C Center for Fiber and Textile Science, Kyoto Institute of Technology, Matsugasaki, Kyoto, Japan

Recently, there has been development of an antifreeze polyamino acid (carboxylated poly-L-lysine: PLL) as new cryoprotectants (CPA). This compound counts as amphoteric macromolecular cationic and anionic substituents (polyampholyte) by chemically modifying poly-lysine. In addition, PLL is highly safe and frequently used as a food additive in substitution for other CPA. Other common CPA have high toxicity and caused physiological damage. In vitro-produced blastocysts were randomly assigned into 3 groups: (1) vitrified embryos with PLL vitrification solution [PLL-vit-1: 15% PLL þ 15% ethylene glycol (EG); PLL-vit-2: 30% PLL þ 30% EG þ 0.5 M sucrose], (2) vitrified embryos with Vajta et al. solution (Conv-vit-1: 7.5% dimethyl sulfoxide þ 7.5% EG; Conv-vit-2: 16.5% dimethyl sulfoxide þ 16.5% EG þ 0.5 M sucrose), and (3) nonvitrified blastocysts (control). All embryos were frozen by droplet vitrification method. First, the PLL-vitrified embryos were exposed to 5, 10, and 15 min in the PLL-vit-1 and then putted for 30 to about 60 s in the PLL-vit-2. Then, we compared with each group regarding exposure time of Vit-1. Post-thaw survival rate of each exposure time did not significantly differ among the 3 groups (100 v. 100 v. 100%). However, hatching rate of the 10-min exposure group was higher than that of 5- and 15-min groups (75.0 v. 25.0 v. 66.7; P , 0.05). Therefore, we confirmed that exposure time of Vit-1 was exposed for a minimum of 10 min. The post-thawed survival rate of each vitrification method was not significantly different between PLL-vit and Conv-vit groups (97.7 v. 86.4%). The total cell numbers of blastocyst did not significantly differ among groups. However, the apoptotic cell numbers of blastocyst was significantly different between the control and Conv-vit groups (0.4 0.6 v. 4.4 3.9; P , 0.05) but was not different in control v. PLL-vit (0.4 0.6 v. 2.1 2.4) and Conv-vit v. PLL-vit (4.4 3.9 v. 2.1 2.4). In conclusion, PLL-vit for bovine blastocyst could reduce toxicity and osmotic shock and showed high efficiency on the quality of post-thawed bovine blastocysts compared with that of Conv-vit. This work was partly supported by a grant from the Next-Generation BioGreen 21 Program (No. PJ009587022014), IPET (Grant No. 112020-3), and a scholarship from the BK21 plus program. A-Na Ha, Kyeong-Lim Lee, and Md. Fakruzzaman were supported by BK21 plus fellowships at Gyeongsang National University, Republic of Korea.

53

EFFECT OF ADDITION OF L-CARNITINE AND CONJUGATED LINOLEIC ACID DURING BOVINE EMBRYO CULTURE ON CRYOSURVIVAL, LIPID CONTENT, AND GENE EXPRESSION A. RuizA, P. J. HansenA, and J. BlockA,B A

University of Florida, Gainesville, FL, USA; B OvaTech LLC, Gainesville, FL, USA

The objective was to determine the effects of addition of L-carnitine (LC) and trans-10, cis-12 conjugated linoleic acid (CLA) during bovine embryo culture on cryosurvival, lipid content, and gene expression. For all experiments, embryos were produced in vitro using abattoir-derived oocytes. Following insemination, presumptive zygotes were randomly assigned in a 2 2 factorial to be cultured in SOF-BE1 supplemented with or without 3.03 mM LC and 100 mM CLA until Day 7. For Exp. 1, blastocyst- and expanded-blastocyst-stage embryos (n ¼ 777) were slow-frozen in 1.5 M ethylene glycol. Embryos were thawed and then cultured for 72 h. Re-expansion and hatching rates were recorded at 24, 48, and 72 h. There was no effect of LC on post-thaw re-expansion rates, but CLA reduced (P , 0.05) and tended (P , 0.08) to reduce re-expansion rate at 24 and 48 h, respectively (76.5 2.5 v. 70.4 2.5 and 79.5 2.2 v. 76.0 2.2, respectively). Whereas hatching rate at 72 h tended (P , 0.08) to be higher for embryos cultured with LC (67.8 2.5 v. 74.4 2.5), treatment with CLA reduced (P , 0.05) hatching rate at 48 h (62.3 2.6 v. 54.9 2.6). In Exp. 2,

120



to determine lipid content, expanded blastocyst-stage embryos (n ¼ 263) were harvested and stained using Nile Red. Embryos were examined for fluorescence using an epifluorescence microscope, and intensity of fluorescence per unit area was quantified using ImageJ software (NIH, Bethesda, MD, USA). There was a significant interaction (P , 0.01) between LC and CLA affecting embryo lipid content. Whereas addition of CLA during culture increased lipid, treatment with LC and the combination of LC and CLA reduced lipid (22.8 1.1 v. 19.1 1.1 v. 28.4 1.1 v. 19.2 1.2 for no additive, þLC, þCLA, and þLC and CLA, respectively). For Exp. 3, the effect of LC and CLA on the relative abundance of genes involved in lipid metabolism (ELOVL6, SCD1, SQLE, HMGCS1, CYP51A1, FDPS, FDFT1, LDLR, and SC4MOL) was determined. Pools of 5 expanded blastocyststage embryos from each treatment were collected across 5 replicates. The RNA was purified and synthesised into cDNA for RT-qPCR analysis. The SDHA, GAPDH, and YWAZ were used as housekeeping genes. Addition of LC during culture reduced (P , 0.05) the abundance of 4 of the 9 genes analysed (SQLE, HMGCS1, CYP51A1, and FDPS) and tended (P , 0.08) to reduce a fifth (FDFT1). In addition, there was a tendency (P , 0.08) for LC to increase the abundance of SCD1. Addition of CLA during culture had minimal effects on transcript abundance. In particular, CLA treatment reduced (P , 0.01) ELOVL6 and tended (P , 0.08) to increase SCD1. In contrast to previous studies, post-thaw cryosurvival was not significantly improved by treatment with LC or CLA. Results indicate that reduced embryo lipid content caused by LC treatment is due, in part, to an alteration in the abundance of genes involved in lipid metabolism. Further research is still necessary to determine whether in vivo survival following transfer of cryopreserved embryos can be enhanced by treatment with LC or CLA. Support was provided by USDA AFRI Grant 2010–85122–20623.

54

CRYOPRESERVATION OF BOVINE IN VITRO-PRODUCED EMBRYOS: INTRINSIC FACTORS DETERMINING VITRIFICATION OUTCOMES M. N. SaucedoA, M. KuromeA, M. ReichenbachB, E. Wolf A, and H.-D. ReichenbachC A

Chair for Molecular Animal Breeding and Biotechnology, LMU, Munich, Oberschleissheim, Germany; B Bayern Genetik GmbH, Grub, Germany; C Institute for Animal Breeding, Bavarian State Research Center for Agriculture, Grub, Germany

As a part of a study on bovine embryo genomic evaluation, effects of an intact (iZP) or opened zonae pellucidae (oZP) of in vitro-produced embryos on vitrification outcomes were assessed. In the first experiment, only iZP embryos were subjected to vitrification, using either the hollow fibre vitrification method (HFV; Matsunari et al. 2012 J. Reprod. Dev.) or the cryologic vitrification method (CVM; CryoLogicÒ, Blackburn, Victoria, Australia). Developmental stage (morula ¼ M; early blastocyst ¼ EaB; blastocyst ¼ B) and quality (good ¼ 1; fair ¼ 2) before vitrification were evaluated. In a first set of experiments, quality 1 and 2 iZP embryos were vitrified either by the HFV or the CVM method. A significant difference between the 2 methods was found when comparing overall survival rates (24–48 h post-thaw; HFV 59.32% v. CVM 78.9%; P , 0.001; unpaired t-test, GraphPad Prism, GraphPad Software Inc., La Jolla, CA, USA). Concerning hatching rates, no significant difference was found (HFV 48.7% v. CVM 57.8%; P . 0.1). In order to evaluate influence of embryo stage and quality on HFV or CVM outcomes, iZP embryos vitrified by the HFV method were classified regarding quality (1: n ¼ 207; 2: n ¼ 66; total n ¼ 273) and embryo stage (M: n ¼ 78; EaB: n ¼ 74; B: n ¼ 121). Concerning survival rates, no significant difference was found between M 1 (57.4%) and M 2 (44.6%), or EaB 1 (80%) and EaB 2 (68%). However, a significant difference was found when comparing B 1 (77%) and B 2 (29%; P , 0.05). With regard to hatching rate, no significant difference was found between M 1 (39.9%) and M 2 (30%), or EaB 1 (66.6%) and EaB 2 (57%). However, significant difference was found between B 1 (60.9%) and B 2 (22%; P , 0.05). With regard to the CVM (1: n ¼ 172; 2: n ¼ 82; total n ¼ 254), no significant difference was found when analysing survival rates of EaB 1 (82%) and EaB 2 (80%), or B 1 (87%) and B 2 (74%), whereas the survival rates were significantly different between M 1 (80%) and M 2 (53%; P , 0.05). Significant differences regarding hatching rates were not found between M 1 (51%) and M 2 (28%) or EaB 1 (55%) and EaB 2 (65%), whereas the hatching rate of B 1 (76%) was not significantly higher than that of B 2 (48.8%; P , 0.05). In a second set of experiments, oZP EaB (1: n ¼ 14) and oZP B (1: n ¼ 30) were vitrified by the CVM method. No significant difference regarding survival rates concerning stage (95 and 72%, EaB and B, respectively), or between treatments (EaB iZP v. oZP, and B iZP v. oZP; P . 0.1) was found. Effect of ZP, either intact or opened, does not seem to affect survival rates (judged by their re-expansion 24–48 h post-thaw) of good-quality embryos. The authors thank the Bavarian Research Foundation for the financial support (AZ-1031-1; DOK-153-12).

55

EFFECT OF TREHALOSE FOR FROZEN-THAWED RAM SPERM MOTILITY PARAMETERS M. M. Toishibekov, M. T. Jazkbayev, and B. B. Molzhigitov Institute of Experimental Biology, Almaty, Kazakhstan

Computer-assisted sperm analysers have become the standard tool for evaluating sperm motility because they provide objective results for thousands of mammalian spermatozoa. Ram semen was collected using electro-ejaculation from 10 adult rams of Chingizskaya indigenous sheep breed. Motility was determined using computer-automated semen analysis (Hamilton Thorne Motility Analyzer, Beverly, MA, USA). Trehalose solution (0.375 M) was added to Tris-buffered saline solution to give the following trehalose extenders: 25, 50, 75, and 100% (vol:vol), and analysed for motility using computer-automated semen analysis. The sperm pellets were resuspended at 248C in cooling extender – trehalose extenders of each concentration containing 5% egg yolk. The diluted semen was cooled to 58C within 2 h. The semen was then further diluted 1 : 1 with freezing extender – each trehalose extender containing 1.5% glycerol to obtain a sperm concentration of 2.0 108 cells mL1 – and then loaded into 0.5-mL straws. Straws were frozen using a programmable freezer with a freezing curve of 58C to 58C at 48C per min, 58C to 1108C at 258C per min, and 1108C to 1408C at 358C per min, and then the straws were plunged into liquid nitrogen for storage. Frozen samples were thawed in a 378C water



121

bath for 30 s and analysed for motility using computer-automated semen analysis. Statistical analyses were performed with a Student’s test. The fresh semen samples showed the next results: motility 88.3 2.4%, progressive motility 26.8 6.9%, and progressive velocity 61.9 4.2 mm s1. Motility of the frozen-thawed spermatozoa was 63.6 2.9% (25% trehalose), 55.6 5.2% (50%), 32.4 4.7% (75%), and 23.6 3.2 (100%). Progressive motility was 15.6 3.9% (25%), 13.7 3.7% (50%), 4.5 1.3% (75%), and 5.2 1.3% (100%). Progressive velocity was 93.5 8.3 mm s1 (25%), 85.4 8.1 mm s1 (50%), 65.7 6.1 mm s1 (75%), 35.2 3.3 mm s1 (100%). Motility of the frozen-thawed spermatozoa significantly decreased with increasing concentrations of trehalose in the extender (P , 0.05). These preliminary studies showed that further research is needed of use trehalose for ram spermatozoa cryoconservation.

56

THE EFFECT OF VITRIFICATION FOR SHEEP OOCYTES VIABILITY Y. M. Toishibekov, R. K. Tursunova, and M. Sh. Yermekova Institute of Experimental Biology, Almaty, Kazakhstan

Advances in reproduction technologies, such as in vitro maturation, IVF, and in vitro culture, stimulated research for efficient cryopreservation techniques for mammalian oocytes. It is well known that the oocyte is the largest cell of an animal’s body and as such, is full of water and, in many species, fat, making it difficult to cryopreserve. The objective of this work was to study the effect of vitrification for cryopreservation of the metaphase II plate (MPII) of sheep oocytes. Ovaries from 20 ewes of Kazakh Arkharo-Merino breed were acquired after slaughter and maintained at 378C in TCM-199. The maturation medium was TCM-199, containing 1 mM of glutamine, 10% FBS, 5 mg mL1 FSH, 5 mg mL1 LH, 1 mg mL1 oestradiol, 0.3 mM sodium pyruvate, and 100 mM cysteamine. The oocytes were incubated in 400 mL of medium in 4-well dishes covered with mineral oil. The IVM conditions were 5% CO2 in humidified air at 398C for 24 h. Then they were placed for 10 min in a media with Hoechst 33342 (3 mg mL1) and cytochalasin B (7 mg mL1) to facilitate the enucleation of the MPII with a minimum volume of ooplasm. The MPII plates were divided into 2 groups: the vitrification group was exposed to vitrification media containing 1.12 M ethylene glycol (ET) þ 0.87 M ME2SO for 5 min and was exposed in vitrification media containing 2.24 M ET þ 1.75 M ME2SO for 5 min, and then in vitrification solution containing 4.48 M ET þ 40% ME2SO þ 0.25 M sucrose for 30 s. Oocytes were loaded into cryoloop and plunged into liquid nitrogen (LN2). Oocytes were thawed in a 258C water bath and then placed in TCM-199 at 20% fetal bovine serum. After 15 min of incubation the oocytes were activated for extrusion of the second polar body in 1 mg mL1 Ca ionophore for 5 min and washed for 5 min followed by 4 h in 6-DMAP (0.12 mM) þ cycloheximide (0.6 mg mL1). After activation the MPII were washed and cultured for 20 h. The control group received the same treatment, but they were not vitrified. Differences between the experimental groups were tested using Chi-squared test. Our research showed the expulsion of the second polar body after activation was observed in more than 62.2% of the MPII that were not vitrified (control group), whereas 40.5% of vitrified plates had expulsion of polar bodies (P , 0.05). These preliminary studies showed that it is possible to vitrify MPII plates. On the other hand, the drastic reduction of the volume of the sheep oocytes might make cryopreservation possible with greater efficiency.

57

THE EFFECT OF VITRIFICATION FOR SHEEP EMBRYO VIABILITY G. A. Valieva, M. M. Toishibekov, S. M. Askarov, and B. B. Molzhigitov Institute of Experimental Biology, Almaty, Kazakhstan

This work evaluated different methods for sheep embryo cryopreservation by vitrification (V) and super-cooling ultra-rapid vitrification (SCURV). The vitrification method was applied according to the method described by Vajta et al. Both treatments used a vitrification solution (VS) containing 20% ethylene glycol, 20% dimethylsulfoxide (Me2SO), 0.5 mol L1 sucrose in Dulbecco’s phosphate buffered saline (DPBS) with 10% BSA. The super-cooled LN facilitates heat transmission between LN and the cryosolution interface, and this is efficient for bovine semen and blastocyst cryoconservation (Arav et al. 2002). By surgical flushing 25 super-stimulated ewes, 109 transferable morulae were harvested; 35 morulae were transferred fresh to synchronized recipients (control) and the others were cryopreserved by V (n ¼ 36) or SCURV (n ¼ 38), respectively, thawed or warmed, and transferred to recipients. Embryos were vitrified using the HSV Kit. They were first incubated in 50% VS for 2 min and then transferred for 30 s into 100% VS. Each embryo was loaded by HSV Kit, which was immediately submerged into and stored in LN. Warming was done by placing the narrow end of the straw into DPBS þ 0.25 M sucrose for 5 min. Embryos were then transferred into DPBS þ 0.125 M sucrose for 3 min and finally to DPBS until transfer. The SCURV morulae were then exposed to 50 and 100% VS at 378C for 2 min and 30 s, respectively. Embryos after saturation in VS were transferred on a surface of a nylon loop (volume 20 mL, diameter 0.5 mm) and using negative pressure of LN in the chamber for freezing with the VIT-Master. Thawing vitrified embryos was accomplished by placing the vitrified embryos in solutions of sucrose 0.25 M and 0.125 M with expositions 2 and 3 min accordingly. After thawing embryos, only good-quality embryos were transferred. Statistical analyses were performed with Student’s t-test. The lambing rate following transfer of fresh, frozen-thawed vitrification and SCURV methods were 18, 12, 14 lambs accordingly. No statistical difference was found for the percentage of does lambing following transfer thawed after vitrification (33.4 5.2a%) and SCURV methods (36.8 6.3b%). The survival rate following transfer of fresh embryos (51.4 4.8c) was higher and in line with previous findings using VS. Differences were statistically significant (ac,bc P , 0.05). Importantly, our data suggest that the HSV Kit can be used to produce viable morulae for implantation as the SCURV, and to as vitrification method. Although further work on the developmental competence of embryos cryopreserved with the SCURV method are needed, these data suggest that with SCURV a faster freeze rate and lower level of cryoprotectants is able to minimize ice crystal formation and should be further evaluated as a routine mechanism for cryopreserving sheep embryos.

122


58


EFFECT OF MELATONIN IMPLANT ON BLANCA DE RASQUERA BUCKS DURING SPRING ON SPERM MORPHOMETRY BEFORE AND AFTER CRYOPRESERVATION A. Tabarez, W. Garcıá, and M. J. Palomo Universitat Auto`noma de Barcelona, Barcelona, Spain

In order to improve sperm cryopreservation throughout the year and accelerate the process of preservation of this Catalonian goat breed in extinction danger, we proposed to assess the effect of melatonin implant application in Blanca de Rasquera males during spring on sperm head morphometry of fresh and thawed sperm. Therefore 8 bucks of 30 months old approximately were divided into 2 groups. In one of the groups, 2 melatonin implants (MelovineÒ, CEVA) were inserted into bucks 60 days before starting the collection of semen, and the other group was kept untreated. Briefly, fresh ejaculates from each group of 4 bucks were collected in spring, immediately mixed in equal quantities, and centrifuged twice (600 g for 10 min). Then the pellet was resuspended in a Tris-based medium containing 15% (v/v) of powdered egg yolk supplemented with 5% glycerol. Afterward, sperm samples were refrigerated at 58C for 4 h before being frozen in LN vapour. Buck sperm head morphometry was analysed by computer-assisted sperm analysis (ISASÒ) on fresh and thawed sperm previously stained with Diff QuickÒ. Data were analysed by GLM multivariate procedure (IBM SPSS, 2011; mean s.e., n ¼ 6), showing significant differences among treatments in all the morphometric parameters except head perimeter and rugosity (Table 1). Our results suggest that melatonin application in bucks increases the ellipticity and elongation of fresh and thawed sperm, meanwhile the cryopreservation process reduces both parameters. Likewise melatonin implants increase significantly the head length only on thawed sperms as cryopreservation process increases the head width, area in sperms from implanted males and regularity only in sperms from nonimplanted bucks. These head changes on fresh and thawed sperm morphometry should be deeply investigated in order to know how they could affect sperm cryosurvival and fertility. Table 1. Effect of melatonin implant on Blanca de Rasquera bucks during spring on morphometry of fresh and thawed sperm Fresh 7.72 0.04 4.36 0.04a 28.43 0.30ab 21.47 0.15 1.78 0.02b 0.77 0.01 0.28 0.00b 0.93 0.00a ab

Length Width Area Perimeter Ellipticity Rugosity Elongation Regularity a–c

Fresh þ melatonin

Thawed

7.80 0.02 4.32 0.02a 28.33 0.15a 21.57 0.04 1.81 0.01c 0.77 0.00 0.29 0.00c 0.93 0.00ab

7.70 0.03 4.44 0.01b 28.66 0.17ab 21.39 0.07 1.74 0.01a 0.79 0.00 0.27 0.00a 0.94 0.00b

bc

Thawed þ melatonin a

7.84 0.03c 4.42 0.01b 28.96 0.15b 21.56 0.07 1.78 0.01b 1.20 0.42 0.28 0.00b 0.94 0.00b

In the same row, different superscripts shows significant difference (P , 0.05).

This research was supported by INIA (RZ2009–00008–00–00), Generalitat de Catalunya (2009SGR0621 and CUR-DIUE), and FSE and Fundacioń Carolina.

59

POST-THAW SURVIVAL OF VITRIFIED, IN VITRO-PRODUCED PORCINE EMBRYOS: COMPARISONS OF VITRIFICATION SOLUTIONS, SOLUTION TEMPERATURE, AND BLASTOCOELE COLLAPSE METHODS L. K. BartolacA,B, C. Sjo¨blomB, and C. G. GrupenA A B

The University of Sydney, Camden, NSW, Australia; Westmead Fertility Centre, Westmead, NSW, Australia

Current post-thaw survival rates of vitrified in vitro-produced porcine blastocysts are much lower than those of other domestic species. The main reason for this is the suboptimal development of in vitro-produced porcine embryos, and the endemically high lipid content of porcine oocytes. Currently, there are several vitrification protocols that have been used to successfully vitrify blastocysts from other species, but many of these have not been used to vitrify porcine embryos. Furthermore, the practice of collapsing the blastocoele cavity before vitrification is used routinely in human clinics and in other domestic animals; however, there has been little data published regarding the collapse of porcine blastocysts before vitrification. In this study we compared several different vitrification protocols containing different constituents and altered constituent concentrations. We also compared 2 methods of blastocoele collapse before vitrification. The aim of this study was to determine the optimum conditions for cryopreserving porcine embryos. All experiments were performed on Day 7 in vitro-produced porcine blastocysts. In experiment 1 embryos were vitrified in either a standard solution (17% ethylene glycol þ 17% dimethyl sulfoxide þ 0.4 M sucrose) or 17% ethylene glycol þ 17% propandiol þ 0.4 M sucrose. In experiment 2 embryos were vitrified in either the standard solution or 17% ethylene glycol þ 17% dimethyl sulfoxide þ 0.4 M trehalose. In experiment 3 embryos were vitrified in the standard solution at 38.58C or at room temperature. In experiment 4 embryos were collapsed before vitrification by micro-pipetting or via 2 sucrose solutions. Survival of embryos was determined by the presence of a blastocoele cavity 24 h after thaw. Data were subjected to ANOVA and an appropriate post-hoc test when differences were found. The post-thaw survival of embryos vitrified in the standard solution (58%) and the propandiol solution (61%) did not differ. Also, the survival rates of blastocysts vitrified using sucrose (72%) and trehalose (72%) were the same. The survival rate of embryos vitrified in warmed media was significantly lower than embryos vitrified in media at



123

room temperature (54 and 71%, respectively; P , 0.05). In experiment 4 the post-thaw survival of noncollapsed and embryos collapsed via micropipetting was similar (55 and 44%, respectively); however, survival tended to decrease if embryos were collapsed using sucrose before vitrification (25%; P ¼ 0.093). These findings indicate there was little impact on post-thaw survival rates due to the vitrification solutions used. However, the temperature of the solutions appears to influence post-thaw survival. Contrary to findings in other species, collapsing the blastocoele cavity before vitrification did not improve cryosurvivability; it had no effect or, in the case of sucrose, a negative effect on survival. This may be due to the inherent sensitivity of in vitro-produced porcine embryos to manipulations.

60

PREDICTING FROZEN BOAR SPERM FERTILITY USING NOVEL AND CONVENTIONAL ANALYSES

B. W. DaigneaultA, K. A. McNamaraA, P. H. PurdyB, S. L. Rodriguez-ZasA, R. L. KrisherA, R. V. KnoxA, and D. J. MillerA A

University of Illinois, Urbana-Champaign, IL, USA; USDA-ARS-NCGRP-NAGP, Fort Collins, CO, USA

B

Cryopreserved boar sperm is seldom used for AI because fertility is reduced. Despite many potential advantages of frozen-thawed sperm for AI, lack of reliable fertility estimation of frozen ejaculates before AI limits the application of frozen sperm. Conventional post-thaw evaluation of sperm does not accurately estimate fertility. Identifying sperm traits that predict fertility would help select ejaculates that produce adequate litter sizes. Our objective was to identify traits of cryopreserved sperm that are related to boar fertility for AI through the use of novel and traditional laboratory analyses. Semen from 14 boars of several breeds was cooled to 158C for shipping before freezing. Post-thaw motility was evaluated using a microscope and confirmed with computer-automated sperm analysis. Sperm viability and acrosome integrity were measured at 0, 30, and 60 min post-thaw. In addition to traditional analyses, each sperm sample was tested by IVF to record fertilization, cleavage, and blastocyst development. A sperm-oviduct binding assay was used to compare the number of sperm bound to epithelial aggregates harvested from the isthmus. Additionally, a competitive zona binding assay using 2 distinct fluorophores for boar identification was used to count the number of sperm from each boar bound to the zona. Frozen sperm from the same ejaculates subjected to laboratory analyses were used to determine actual boar fertility. Fertility was measured by AI of mature gilts using 4.0 109 total sperm from one boar at 24 h and a second boar at 36 h after the onset of oestrus, and AI order was reversed in consecutive replicates. Fertility was expressed as the percentage of the litter sired by each boar. Reproductive tracts were harvested at 32 days after AI, and fetal paternity was identified using microsatellite markers. The actual boar fertility was regressed against the mean of each laboratory evaluation by boar, and the assays that best predicted fertility were identified using stepwise logistic regression. The model generated was highly predictive of fertility (P , 0.001, r2 ¼ 0.87) and included 5 traits: acrosome compromised sperm (0 and 30 min), percent live sperm (0 min), percent total motility (30 min), and the number of zona bound sperm. An additional model in which fertility was assessed by the number of piglets sired by boar also predicted fertility (P , 0.05, r2 ¼ 0.57) and shared many of the same traits. These models were highly accurate when used to predict actual fertility of cryopreserved boar sperm. This approach may be used to screen ejaculates before AI and advance the use of frozen boar sperm by the swine industry. Research was supported by Agriculture and Food Research Initiative Competitive Grant no. 2010-85112-20620 from the USDA National Institute of Food and Agriculture.

61

THE EFFECTS OF COLLECTION SEASON AND STORAGE DURATION IN LIQUID NITROGEN ON POST-WARMING SURVIVAL AND NUCLEAR MATURATION OF IMMATURE PORCINE OOCYTES PRESERVED BY SOLID SURFACE VITRIFICATION T. NagaiA,B, T. SomfaiC, N. T. MenD, H. KabekoE, J. NoguchiE, and K. KikuchiE A

Food and Fertilizer Technology Center, Taipei, Taiwan; B Seoul National University, Seoul, Korea; C NARO Institute of Livestock and Grassland Science, Tsukuba, Ibaraki, Japan; D University of Tsukuba, Tsukuba, Ibaraki, Japan; E National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan We investigated the effects of collection season and storage duration of vitrified porcine oocytes in liquid nitrogen (LN2) on their survival and maturation ability after warming. A total of 3338 cumulus-enclosed oocytes were vitrified using solid surface vitrification, preserved, and warmed according to previous report (Somfai et al. 2014 PLoS One 9, e97731) in 26 occasions between October 2012 and March 2014. Vitrified oocytes were stored in LN2 for various durations from 0 (vitrified but without storage) to 243 days. The date of preservation and length of storage (days) of vitrified oocytes in LN2 were recorded. Warming of vitrified oocytes was conducted on a hotplate set at 428C. After warming, oocytes were subjected to in vitro maturation according to Kikuchi et al. (2002 Biol. Reprod. 66, 1033–1041). Then oocytes were denuded and their live/dead status and nuclear maturation were assessed under stereo microscope based on their morphology and the presence of the first polar body. After linear regression analysis, it was found that there was no correlation between the duration of storage of vitrified oocytes in LN2 for up to 243 days and their survival rate after warming (R ¼ 0.254; P ¼ 0.210) or the maturation rate of surviving oocytes (R ¼ 0.147; P ¼ 0.471). Vitrification during spring (March 1–May 31) resulted in significantly higher rates of survived oocytes compared with vitrification during winter (December 1–February 28; 86.9 and 73.1%, respectively; P , 0.05), whereas the mean survival rates of oocytes vitrified during summer (June 1–August 31; 79.0%) and autumn (September 1–November 31; 81.9%) did not differ significantly from those of other seasons (ANOVA). After in vitro maturation, nuclear maturation of surviving

124



oocytes did not differ significantly among oocytes vitrified at different seasons (ranging between 59.1 and 67.8%). The results indicate that the oocyte collection season affects survival of vitrified oocytes, whereas storage duration in LN2 does not affect this parameter. Furthermore, nuclear maturation of oocytes that survive after vitrification and warming is not affected by their collection season and storage length. This work was supported by JSPS KAKENHI Grant Number 26870839.

62

COMPARISON OF SUGARS, COMBINATIONS OF PERMEABLE CRYOPROTECTANTS, AND EQUILIBRATION REGIMENS FOR THE SOLID SURFACE VITRIFICATION OF IMMATURE PORCINE OOCYTES T. SomfaiA, N. T. MenB,C, H. KanekoB, J. NoguchiB, S. HaraguchiA, T. NagaiD,E, and K. KikuchiB A

NARO Institute of Livestock and Grassland Science, Tsukuba, Ibaraki, Japan; B National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan; C University of Tsukuba, Tsukuba, Ibaraki, Japan; D Food and Fertilizer Technology Center, Taipei, Taiwan; E Seoul National University, Seoul, Republic of Korea

Cryotop and solid surface vitrification are frequently used methods for the cryopreservation of porcine oocytes. These methods differ not only in the vitrification carrier but also in the cryoprotectant (CPA) treatment including the type of sugar, permeable CPA (pCPA) combinations, and the equilibration regimen. This study compared the distinct points of CPA treatment of these 2 methods to determine the optimum CPA treatment for the solid surface vitrification of immature porcine oocytes. We vitrified and warmed follicular cumulus-oocyte complexes by our method (Somfai et al. 2014 PLoS One 9, e97731). In each experiment, the vitrification solution consisted of 50 mg mL1 polyvinyl pyrrolidone, 0.3 M of the actual sugar, and 35% [v/v] in total of the actual pCPA combination (depending on the experiment). After warming, the cumulus-oocyte complexes were subjected to in vitro maturation, IVF, and embryo culture (Kikuchi et al. 2002 Biol. Reprod. 66, 1033–1041). Oocyte survival was assessed after IVF by morphological evaluation, and live oocytes were subjected to in vitro embryo culture. Cleavage and blastocyst rates were calculated from cultured oocytes on Day 2 (Day 0 ¼ IVF) and Day 6, respectively. Each experiment was replicated at least 3 times. Results were analysed by ANOVA. In Experiment 1, we compared trehalose (n ¼ 416) and sucrose (n ¼ 440) as supplementations during vitrification and warming (0.3 M and 0.4 M of each, respectively). There was no significant difference between oocytes vitrified with trehalose or sucrose in terms of survival, cleavage, and blastocyst development (83.2% v. 80.3%, 39.7% v. 42.4%, and 3.6% v. 5.9%, respectively). Thus, vitrification and warming media were supplemented with sucrose thereafter. In Experiment 2, we compared 1 : 1 combinations of ethylene glycol with propylene glycol (EGþPG group, n ¼ 452) and ethylene glycol with dimethyl sulfoxide (EGþDMSO group, n ¼ 465) used as pCPA for equilibration (4% [v/v] pCPA in total for 15 min) and vitrification (35% [v/v] pCPA in total for 30 s). Oocyte survival rate was higher (P , 0.05) in the EGþPG group compared with the EGþDMSO group (73.8% v. 51.1%, respectively); however, cleavage and blastocyst development rates of surviving oocytes were not significantly different between the 2 groups (30.5% v. 44.5% and 4.1% v. 6.3%, respectively). In Experiment 3, we compared an equilibration treatment in 4% [v/v] of EGþPG for 13 to 15 min (regimen A, n ¼ 368) with an equilibration in 15% [v/v] of EGþPG for 5 to 7 min (regimen B, n ¼ 363) for oocyte vitrification. Survival, cleavage, and blastocyst development rates were higher (P , 0.01) for oocytes vitrified using regimen A compared with those vitrified using regimen B (82.5% v. 22.7%, 24.0% v. 7.7%, and 3.2% v. 0%, respectively). In conclusion, trehalose and sucrose are equally effective during vitrification and warming, the combination of EGþPG as pCPA is superior to EGþDMSO, and equilibration in 4% pCPA for 13 to 15 min is superior to that in 15% pCPA for 5 to 7 min for the vitrification of immature porcine oocytes. This work was partly supported by JSPS KAKENHI Grant Number 26870839.

63

STEPWISE THAWING PRESERVES MITOCHONDRIA MEMBRANE POTENTIAL OF BOAR SPERMATOZOA EXTENDED IN GLYCEROL-FREE MEDIUM CONTAINING TREHALOSE R. Athurupana and H. Funahashi Department of Animal Science, Okayama University, Okayama, Japan

Motility and penetrability of spermatozoa are significantly affected by the energy produced in mitochondria. The survival of cryopreserved spermatozoa is influenced by the warming rate as well. The objective in the present study was to evaluate the effect of stepwise thawing on post-thaw motility and mitochondria activity of boar spermatozoa. The sperm samples collected from a Berkshire boar with high fertility at an AI centre were diluted in egg yolk-based and glycerol-free freezing extender containing 100 mM trehalose and 0.25% Equex STMTM. The samples were cryopreserved using the straw freezing procedure. Best thawing durations in high temperatures were examined in a previous study. Straws were immersed in 80, 70, and 608C water for 6, 8, and 10 s and continued to thaw in 398C for 54, 52, and 50 s, respectively. Sperms thawed at 398C for 60 s were considered as the control. Frozen-thawed spermatozoa were analysed for motility with computer-assisted semen analysis and mitochondrial membrane potential (MMP) with JC-1/PI staining (Table 1). Data were analysed with ANOVA and Pearson correlation. Motility and MMP of frozenthawed sperm were significantly lower than fresh samples. Motility was fairly high compared with frozen-thawed controls, when thawed rapidly in 2-steps, though the difference was not significant. The MMP was also significantly higher when thawed in 2-steps from 80 or 708C, then to 398C, as compared with frozen-thawed controls, and it was positively correlated with the thawing temperature (r ¼ 0.64; P , 0.01). There was a positive trend



125

between thawing temperature and motility, but it was not significant (r ¼ 0.37; P ¼ 0.11). In conclusion, our results suggest that stepwise thawing with a rapid thawing at the beginning preserves post-thaw motility and MMP of boar spermatozoa. Table 1. Effect of thawing temperature on post-thaw motility and mitochondrial membrane potential (MMP)1 Thawing temperature (8C)

Motility (%)

High MMP (%)

Fresh (positive control) 808C then 398C 708C then 398C 608C then 398C 398C (control)

97.4 5.6a 30.2 8.8b 34.6 2.6b 34.0 1.6b 19.3 1.2b

87.9 2.5a 47.5 4.8b 47.3 4.3b 42.4 1.7cb 30.3 4.1c

P , 0.05. Mean s.e.m., n ¼ 5.

a–c 1

64

COULD FROZEN-THAWED BOAR-SEMEN FERTILITY BE INCREASED WITH SEMINAL PLASMA ADDITION?

M. A. TorresA, G. M. RavagnaniA, M. de Lima OliveiraA, D. F. LealA, G. Amorim de CamposA, S. M. M. K. MartinsA, B. B. D. MuroA, A. S.’A. MorettiA, F. O. PapaB, J. A. Dell’Aqua JuniorB, M. A. AlvarengaB, and A. F. Cesar de AndradeA A

Faculdade de Medicina Veterina´ria e Zootecnia, FMVZ/USP, Pirassununga, SP, Brazil; Faculdade de Medicina Veterina´ria e Zootecnia, FMVZ/UNESP, Botucatu, SP, Brazil

B

Post-thawed addition of seminal plasma (SP) in equine cryopreserved semen increased the integrity of plasma and acrosomal membranes (Andrade et al. 2011 Reprod. Dom. Anim. 46, 682–686) and these possibly affect sperm lifespan, improving fertility (Garcia et al. 2010 Anim. Reprod. Sci. 119, 160–165). This study was conducted to verify the pregnancy (PR) and fertility rate (FR) of addition of homologous SP in thawed boar semen. First, SP collections were made with polled sperm rich-fraction. Semen was centrifuged (500 g for 10 min) and supernatant was removed, centrifuged one more time (2500 g for 30 min), vacuum filtered through membranes (0.22 mm), and stored at 808C for future use. Samples collected to frozen were pooled and divided in 2 aliquots, control (cryopreserved with SP; CON) and cryopreserved without SP (WSP; SP was removed and discarded after centrifugation – 500 g for 10 min). Samples were extended in freezing extender (BotupharmaÒ) to a final concentration of 300 106 spermatozoa per milliliter, packaged in 0.5-mL straws, and frozen in an automatic system (TK Tecnologia em CongelaçaõÒ) using a rate of 0.58C min1 until 58C, 208C min1 until 1208C, and then immersed in LN (1968C). Ten straws, from each treatment, were thawed in water bath (378C/30 s) and extended in Beltsville thawing solution to obtain 1.5 109 sperm in 40 mL. The other 10 straws of WSP were thawed and extended in Beltsville thawing solution plus 10% (v:v) of SP to originate treatment TSP (thawed added of seminal plasma). Thirty-three (11 per treatment) gilts had synchronized ovulation with altrenogest (25 mg/5 mL, RegumateÒ) administration per 18 days. Following day after withdrawal the altrenogest was administered with an intramuscular injection of 600 IU of eCG (NovormonÒ) and 2.5 mg of pLH (LutropinÒ-V) after 72 h; a single deep intrauterine insemination was made 36 h after. Five days after, females were slaughtered and embryos were collected (by oviducts flushed) and evaluated by esteromicroscopia. Fertility rate and PR were analysed by SAS program (SAS Institute Inc., 2010, Cary, NC, USA). Fertility rate was analysed by Mixed models, and treatment effects were analysed by orthogonal contrasts (C1: effect without SP ¼ CW v. NC; C2: effect of post-thawed addition of SP ¼ CP v. CW), and PR was evaluated by binary distribution with PROC GLIMMIX test. Fertility rate was not affected (P . 0.05) by cryopreservation of boar semen in presence or absence of SP nor by its addition in Beltsville thawing solution (10.58 3.92, 9.57 4.92, 21.29 7.37 for CON, WSP, and TSP, respectively). Treatments did not influence (P . 0.05) PR (50.00, 36.36, 72.73 for CON, WSP, and TSP, respectively). Thus, neither SP addition in thawed boar semen nor cryopreservation with or without SP can be beneficial to PR and FR, in our experimental conditions. However, a numeric large difference was observed. Therefore, these results lead us to believe that SP have a potential to increase the fertility and pregnancy rate, and that can be verified in further studies, with more repetitions. Research was supported by Agroceres Multimix, Botupharma and FAPESP process 2013/08070-8 and 2011/23484-8.

65

ARE ‘‘BAD FREEZER’’ STALLIONS ALSO ‘‘BAD COOLER’’ STALLIONS?

C. Ramires Neto, M. M. B. Castro-Chaves, Y. F. R. Sancler-Silva, R. C. Uliani, P. V. L. Oliveira, C. P. Freitas-Dell’aqua, F. O. Papa, and M. A. Alvarenga Department of Animal Reproduction and Veterinary Radiology, School of Veterinary Medicine and Animal Science, UNESP, Botucatu, SP, Brazil Several factors can interfere with sperm cryopreservation resistance, especially the genetic factors and those related to the plasma membrane composition of the sperm and seminal plasma. However, it is still unclear if the same factors that confer freezing resistance will perform the same role during the cooling process. Thus, the aim of this study was to determine the relation between the resistance to freezing and cooling processes in stallions. Two ejaculates from each of 75 stallions were used. All animals showed good quality of fresh semen (total motility higher than 60% and plasma membrane integrity higher than 50%). After collection, the semen was diluted 1 : 1 with commercial skim milk-based extender (BotuSemenTM, Botupharma, Brazil) and then a part was designed to cooling and the another to freezing. The cooled semen was divided into

126



2 groups: Group PS, in which the semen was diluted with Botu-SemenTM at a concentration of 50 106 sperm mL1, and Group SPS, which was subjected to a centrifugation at 600 g for 10 min and resuspended with Botu-SemenTM at 50 106 sperm mL1. Semen samples from both groups were placed in the same cooling passive system for a period of 24 h/58C. To accomplish the freezing process, the semen sample was subjected to centrifugation at 600 g for 10 min. The supernatant was discarded, and the pellet was re-suspended in a Botu-CrioTM. The straws were frozen according to the manufacture. The sperm parameters from fresh semen, cooled semen for 24 h with and without seminal plasma, and frozen semen were evaluated for kinetics by computer-assisted semen analysis and for plasma membrane integrity (IMP%) by epi-fluorescence microscopy. The animals were classified in relation to their resistance to cooling and freezing processes as follow: ‘‘bad coolers’’ – reduction in sperm total motility and in plasma membrane integrity higher than 35% after 24 h of cooling in samples with seminal plasma; ‘‘good coolers’’ – reduction in sperm total motility and in plasma membrane integrity lower than 35% after 24 h of cooling in samples with seminal plasma; ‘‘bad freezer’’ – sperm total motility lower than 40% and progressive motility lower than 20% in seminal sample after thawing; ‘‘good freezer’’ – sperm total motility higher than 60% and progressive motility higher than 30% in seminal sample after thawing. The comparison between the resistance to cooling and freezing processes was performed by Fisher’s exact test. The level of significance was 5%. No difference (P , 0.05) between the resistance to cooling and freezing processes was observed. The percentage of stallions ‘‘good freezer’’ and ‘‘good cooler’’ was 54%, ‘‘good freezer’’ and ‘‘bad cooler’’ was 22.6%, ‘‘bad freezer’’ and ‘‘good cooler’’ was 12%, and ‘‘bad freezer’’ and ‘‘bad cooler’’ was 10.6%. Within stallions classified as ‘‘good freezer’’ and ‘‘bad cooler,’’ 52.9% also were ‘‘good cooler’’ when the seminal plasma was removed before the cooling process, and 47.1% remained as ‘‘bad cooler.’’ The result of this study demonstrates that there is a strong relation between the resistance to cooling and freezing processes in stallions. In stallions categorized as ‘‘bad cooler,’’ the seminal plasma presents a major influence on the quality and longevity of cooled semen.

66

EFFECT OF ADDITION OF CHOLESTEROL-LOADED CYCLODEXTRIN BEFORE FREEZING ON QUALITY AND FERTILITY OF STALLION FROZEN SEMEN F. O. Papa, C. Ramires Neto, Y. F. R. Sancler-Silva, H. L. Resende, G. A. Monteiro, C. P. Freitas-Dell’aqua, and M. A. Alvarenga

Department of Animal Reproduction and Veterinary Radiology, School of Veterinary Medicine and Animal Science, UNESP, Botucatu, SP, Brazil The aim of the present study was to evaluate the effect of cholesterol-loaded cyclodextrin on the quality and fertility of stallion frozen semen. Three ejaculates from each of 4 stallions were used. The semen was diluted (1 : 1) with a skim milk-based extender (Botu-SemenTM, Botupharma, Brazil). The samples were divided into 2 groups: control group (CG), composed of semen diluted only with extender, and treated group (TG), composed of semen diluted with extender plus 750 mg mL1 of cholesterol-loaded cyclodextrin. Both groups were incubated for 15 min at 208C. The semen was frozen with Botu-CryoTM (Botupharma, Brazil) extender according to the manufacturer’s protocol in 0.5-mL straws containing 100 106 of total sperm. The sperm kinetic parameters were analysed by computer-assisted semen analysis, and plasma membrane integrity by flow cytometer (propidium iodide and fluorescein isothiocyanate -PSA) on post-thaw. The fertility trial was carried out inseminating 2 cycles of 20 mares (total of 40 cycles) immediately post-ovulation using 4 straws of CG or TG (400 106 total sperm), one from each stallion in a randomised design. Comparison of sperm parameters was performed by t-test and fertility by Fisher’s exact test. No difference (P . 0.05) was observed in total motility (%, CG ¼ 57.9 6.5 v. TG ¼ 60.2 6.7), progressive motility (%, CG ¼ 26.9 4.8 v. TG ¼ 28.5 4.8), percentage of rapid sperm (%, CG ¼ 43.5 8.8 v. TG ¼ 45.7 7.6), membrane integrity (%, CG ¼ 20.1 5.1 v. TG ¼ 20.3 6.3), and fertility (CG ¼ 60% v. TG ¼ 70%) between the groups. The results of this study showed that the use of cholesterol-loaded cyclodextrin did not affect sperm kinetic parameters and fertility in stallion with good quality in post-thaw semen. Further studies must be performed with stallions sensitive to freeze-thawing process.

67

EFFECTS OF ANTIOXIDANTS LACTOFERRIN AND CATALASE ON STALLION FROZEN SEMEN

H. S. MartinsA, M. F. BritoA, I. B. M. SampaioA, R. StahlbergB, M. R. SouzaA, C. F. A. M. PennaA, and M. A. LagaresA B

A Federal University of Minas Gerais, Belo Horizonte, Minas Gerais, Brazil; Pontifical Catholic University of Minas Gerais, Belo Horizonte, Minas Gerais, Brazil

During cryopreservation, the sperm were submitted to an increased generation of reactive oxygen species. Furthermore, because of the large portion of seminal plasma removal, there is a decrease of sperm antioxidant protection. Addition of antioxidants proteins found in seminal plasma, such as lactoferrin (Lf) and catalase (Cat), to the freezing semen extenders could protect the sperm during cryopreservation. Lactoferrin is a transferrin, which prevents the hydroxyl radicals generation, and Cat plays an antioxidant role. The aim of this study was to determine the effects of Lf and Cat supplementation to the INRA 82 freezing extender (Battelier et al. 1997) on sperm motility parameters and membrane functionality of stallion frozen semen. Semen from 6 stallions was collected with an artificial vagina, diluted with Kenney extender (1 : 1), and centrifuged (500 g, 10 min). The supernatant was discarded, and sperm number per milliliter was calculated. Semen was resuspended with 3 extenders to 100 106 sperm mL1. The treatments were distributed in (F1) control, INRA 82 freezing extender (Battelier et al. 1997), (F2) F1þ 500 mg mL1 lactoferrin, and F3) F1 þ 200 IU mL1 catalase. Semen samples were packaged in 0.5-mL straws and cooled to 58C (0.278C min1). For semen freezing, the straws were laid over the LN vapor for 20 min and plunged into the LN. The straws were thawed at 378C for 30 s. Motility parameters of frozen semen were determined using a computer sperm cell analysis, and sperm membrane functionality was assessed by the hyposmotic swelling test (Lagares et al. 1998). The data were analysed using Friedman test using stallion as a block. A probability of P , 0.05 was considered significant. There was no significant difference between the percentage of total sperm motility (median, minimum-maximum value; F1: 29.9, 11.0–82.7; F2: 49.8, 7.7–55.2; F3: 39.8, 5.7–92) and progressive sperm motility (F1: 7.1, 3.2–23.3; F2: 13.4, 2.6-22.4; F3: 15.6, 1.1–29.6), and functional sperm membrane



127

(F1: 26.7, 14.7–56.2; F2: 50.5, 15.7–61.7; F3: 46.6, 13.8–50.9) with regard to the treatment. However, the velocity parameters: velocity average path (F1: 29.3, 22.1–33.80; F2: 34.6, 24.8–44; F3: 35.7, 18.2–42.6), velocity curvilinear (F1: 36.9, 30.5–45.1; F2: 42.5, 34.7–51; F3: 44.6, 25.5–50.9), and velocity straight line (F1: 23.4, 17–3.60; F2: 28.9, 18.8–38.2; F3: 26.6, 13.6–37.2) in the treatment with Lf (F2) were higher compared with the control (F1; P , 0.05). These results corroborate with studies reporting the lack of positive effect on equine sperm motility when antioxidants were added to skim milk-based extenders. Although the addition of Lf or Cat to skim milk-based extenders did not improve the motility sperm characteristics and sperm membrane functionality, more studies about the positive effect of Lf on the velocity parameters are necessary. Lactoferrin could then play an important role on the oxidative metabolism, which provides energy to the sperm movement. Acknowledgments to the Coordenaçaõ de Aperfeiçoamento de Pessoal de Nı´vel Superior (CAPES), Brazil, for the financial support.

68

DIFFERENCE IN THAWING CURVE OF STALLION FROZEN SEMEN DILUTED IN 2 EXTENDERS C. P. Freitas-Dell’aqua, C. Ramires Neto, Y. F. R. Sancler-Silva, P. M. Papa, J. A. Dell’aqua, M. A. Alvarenga, and F. O. Papa

Department of Animal Reproduction and Veterinary Radiology, School of Veterinary Medicine and Animal Science, UNESP, Botucatu, SP, Brazil Commercial freeze extenders have different composition and ratio of cryoprotectors; freezing and thawing protocols are different for each extender. The aim of this experiment was to observe the effect of thawing curve in stallion frozen semen with 2 commercial extenders. Two ejaculates from each of 9 stallions of different breeds (Quarter Horses and Mangalarga Marchador) were used. Semen was collected using an artificial vagina, and the ejaculate was divided into 2 groups following the manufacture’s protocol: group 1 (INRA), in which the semen was diluted 1 : 1 with the extender INRA 96TM (IMV, Paillette Crista, France) and group 2 (BC), in which the semen was diluted (1 : 1) with the extender Botu-SemenTM (Botupharma, Brazil). The samples of the 2 groups were centrifuged at 600 g for 10 min, the supernatant was discarded, and the pellet was resuspended with INRA FreezeTM (group INRA, IMV) and with BotucrioTM (group BC, Botupharma) at the concentration of sperm 100 106 sperm mL1. After this, the semen was packaged in 0.5-mL straws. For each group the freezing process was carried out according to the manufacturer’s instructions. The straws were thawed in a water bath with 3 different thawing curves: 378C for 30 s (37/30), 468C for 20 s (46/20), and 758C for 7 s (75/7) before analysis. The aim of these rates is to keep the semen in 378C post-thaw. The sperm kinetic analysis was performed by computerized method (CASA, HTM-IVOS, IMV, USA) and the analysis of plasma membrane integrity by flow cytometer (BD LSR Fortessa, Becton Dickinson, Mountain View, CA, USA). Data of sperm kinetic and of plasma membrane integrity were compared among the 3 thawing curves for one extender using analysis of variance. Differences were considered significant at a probability level of 5%. No differences were observed in total motility (%, BC 37/30 ¼ 72.8 14.4; BC 46/20 ¼ 70.0 14.2; BC 75/7 ¼ 70.3 12.0 v. INRA 37/30 ¼ 57.2 19.1; INRA 46/20 ¼ 50.0 21.9; BC 75/7 ¼ 58.8 20.8), progressive motility (%, BC 37/30 ¼ 36.9 8.2; BC 46/20 ¼ 34.4 10.5; BC 75/7 ¼ 33.6 7.8 v. INRA 37/30 ¼ 25.3 12.7; INRA 46/20 ¼ 21.9 13.9; BC 75/7 ¼ 28.9 14.8), rapid sperm (%, BC 37/30 ¼ 59.7 16.4; BC 46/20 ¼ 56.8 17.1; BC 75/7 ¼ 58.1 14.9 v. INRA 37/30 ¼ 38.3 20.9; INRA 46/20 ¼ 35.3 22.9; BC 75/7 ¼ 44.4 23.8), and plasma membrane integrity (%, BC 37/30 ¼ 49.1 14.8; BC 46/20 ¼ 43.1 13.1; BC 75/7 ¼ 46.7 11.8 v. INRA 37/30 ¼ 32.2 10.7; INRA 46/20 ¼ 29.6 10.1; BC 75/7 ¼ 37.4 9.1) among the 3 thawing curves for INRA and BC groups. In this study, we can conclude there is no influence of the 3 tested thawing curves in sperm quality for stallion frozen semen with INRA Freeze and Botucrio extenders.

69

REACTIVE OXYGEN SPECIES EVALUATION OF DONKEY FROZEN SEMEN ADDED TO HOMOLOGOUS SEMINAL PLASMA ON POST-THAW

P. V. L. Oliveira, J. V. Oliveira, C. Ramires Neto, Y. F. R. Sancler-Silva, C. P. Freitas-Dell’aqua, and F. O. Papa Department of Animal Reproduction and Veterinary Radiology, School of Veterinary Medicine and Animal Science, UNESP, Botucatu, SP, Brazil For many years the pregnancy rate of donkey frozen semen presented lower results in donkey jennies; however, a recent study showed an increase in pregnancy rates using frozen semen added to seminal plasma on post-thaw. A hypothesis for this result is the higher uterine inflammation response after breeding when using seminal plasma. The same studies demonstrated higher uterine inflammation in the presence of higher reactive oxygen species concentration. The aim of the present study was to evaluate the content of reactive oxygen species in donkey frozen semen added to homologous seminal plasma on post-thaw. Five ejaculates from each 3 donkeys were used. Semen was diluted (1 : 1) with a skim milk-based extender (Botu-SemenTM, Botupharma, Brazil). The semen was frozen with Botu-CryoTM extender (Botupharma, Brazil) in an isothermal box in straws containing 100 106 of total sperm. The samples were thawed at 468C for 20 s. After this, the straws of each donkey were divided in 2 group: control group (CG), in which the semen was incubated at 378C for 5 min, and plasma seminal group (PG), in which the semen was incubated at 378C for 5 min with 70% of homologous seminal plasma. Sperm kinetic parameters were evaluated by computer-assisted semen analysis, and the plasma membrane integrity (propidium iodide and fluorescein isothiocyanate -PSA) and reactive oxygen species (5–6-carboxi-2,7-diclorodihidrofluoresceindiacetate) were evaluated by flow cytometer. Comparison of sperm parameters was performed by t-test. Total motility (%, CG ¼ 75.4 8.2a v. PG ¼ 57.5 16.4b), progressive motility (%, CG ¼ 42.0 8.7a v. PG ¼ 33.3 13.2b), progressive angular velocity (mm/s, CG ¼ 95.8 10.8a v. PG ¼ 88.9 10.9b), and percentage of rapid sperm (%, CG ¼ 58.4 12.5a v. PG ¼ 41.0 17.3b) were higher in CG compare with PG. No difference (P , 0.05) was observed in membrane integrity (%, CG ¼ 20.7 7.4 v. PG ¼ 20.6 7.8); however, reactive oxygen species (%, CG ¼ 12.3 10.6a v. PG ¼ 81.8 32.5b) were higher in PG. The results of this study showed that the addition of homologous seminal plasma on post-thaw decreases the sperm kinetic parameters and viability of donkey frozen semen but increases reactive oxygen species, and this may cause higher uterine inflammation response in donkey jennies and increase their fertility.

128


70


INCORPORATING MULTIPLE STAGES OF MASS SPECTROMETRY INTO LIPID PROFILING OF OOCYTES AND PRE-IMPLANTATION EMBRYOS V. PirroA, A. K. JarmuschA, C. R. FerreiraA, A. F. Gonza´lez-SerranoB, J. E. HallettA, R. HouserA, H. NiemannB, and R. G. CooksA B

A Purdue University, West Lafayette, IN, USA; Friedrich-Loeffler-Institut, Institute of Farm Animal Genetics, Neustadt, Germany

Lipid profiling by mass spectrometry (MS) is increasingly used for the analysis of oocytes, embryos, and other reproductive cells. This analytical approach has several advantages, such as simple preparation (no need to perform extraction or separation), low detection limits (no need of sample pooling), and detection of structurally intact and diverse lipids. Many degrees of freedom are ensured by MS techniques (e.g. with the adoption of diverse ionization sources, mass analyzers, data acquisition systems), and this broadens the classes of lipids that can be detected and identified. Tandem or high-resolution MS experiments are normally performed for chemical characterisation. However, the use of novel approaches is a constant need to obtain deeper structural insights into lipids of biological interest, resulting in an information-rich dataset. Here we propose the use of multiple stages of MS for lipid profiling, specifically MS/MS data domain (i.e. ion mapping) experiments, so that comprehensive structural and relationship information (i.e. classes) can be extracted from a dataset. Indeed, the data generated have 2 dimensions of mass (i.e. precursor and product ions) and one of ion intensity, resulting in a datacube structure. Cutting through the datacube in different ways allows the extrapolation of (i) chemical composition of specific compounds (i.e. product scans) and (ii) pattern recognition for compounds that share identical neutral or charged fragments loss (i.e. neutral loss and precursor scans, respectively). The global chemical information enclosed into the datacube can be also processed by means of multiway statistical analyses to chemically characterise cells and cellular compartments. Preliminary data have been acquired, and the development of statistical tools for data processing is ongoing. Bovine and rat embryos were used for the experiments and analysed by extraction spray ambient MS. Experiments were performed with a Thermo Finnigan LTQ linear ion trap. Dimethylformamide-acetonitrile (1 : 1 v/v) was used as spray solvent. The ion mapping experiment was configured to scan ions of mass-tocharge (m/z) ratio 700 to 900 and perform MS/MS every m/z 1.5 window with a collision energy of 25 (arbitrary units). Fragments were detected in the m/z range of 150 to 900. Chemical differences are present between bovine and rat embryos, of note are palmitic, oleic, and stearic acids. The application of ion mapping to characterise species-specific and developmental dynamics regarding lipid composition is currently under investigation.

71

EFFECT OF CHOLESTEROL-LOADED CYCLODEXTRINS ON PRE- AND POST-THAW FUNCTION OF FELID SPERM I. A. PlourdeA, H. L. BatemanB, and W. F. SwansonB A

The Ohio State University College of Veterinary Medicine, Columbus, OH, USA; B Cincinnati Zoo and Botanical Garden, Cincinnati, OH, USA

Propagation of genetically diverse felid populations would benefit from more effective assisted reproduction strategies, including enhanced methods for sperm cryopreservation. In felids, sperm cryopreservation has been improved by substituting soy-lecithin for egg yolk in cryomedium (Vick et al. 2012 Theriogenology 78, 2120–2128). In other species, such as elephants (Kiso et al. 2012 Reprod., Fert. Dev. 24, 1134–1142) and cattle (Purdy et al. 2004 Cryobiology 48, 36–45), the addition of cholesterol-loaded cyclodextrins (CLC) to sperm before freezing has been shown to produce superior cryopreservation results. In this study, our objectives were to (1) assess cholesterol content of cat sperm membranes and capacitation status following incubation with CLC; (2) evaluate post-thaw sperm motility, acrosome status, and fertility in vitro following CLC treatment and freezing in a soy-based cryomedium; and (3) conduct a preliminary assessment of cholesterol content in nondomestic cat sperm. Freshly collected domestic cat sperm (n ¼ 2 males, 3–4 ejaculates/male) were incubated with CLC (0, 1.5, or 3.0 mg mL1), and cholesterol levels were measured using an Amplex Red Cholesterol Assay. Sperm aliquots from each CLC concentration were treated with calcium ionophore (2 mM, 30 min) during in vitro incubation and stained with fluorescein isothiocyanate/PNA to evaluate induced acrosomal loss. To assess post-thaw parameters, cat sperm treated with CLC were frozen in straws using soy-lecithin cryomedium, thawed, and cultured in vitro over time. To evaluate fertility, oocytes were collected laparoscopically from gonadotropin-treated domestic cats (n ¼ 7 females, 147 oocytes total) and inseminated with low numbers of thawed-frozen sperm pretreated with 0 or 1.5 mg mL1 CLC. Data were analysed using ANOVA and mean differences assessed with Fisher l.s.d. or chi-squared analysis. Sperm cholesterol levels were increased (P , 0.05) after exposure to both 1.5 and 3.0 mg mL1 CLC. Prefreeze motility was decreased (P , 0.05) and capacitation was delayed at 3.0 mg mL1 CLC relative to treatment with 0 or 1.5 mg mL1 CLC. Both post-thaw motility and percentage of acrosome intact sperm were reduced (P , 0.05) with the highest CLC concentration, but results were similar (P . 0.05) for 0 and 1.5 mg mL1 CLC. Fertilization percentages did not differ (P . 0.05) between treatment groups (0 CLC, 33.3%, 25/75; 1.5 mg mL1 CLC, 26.4%, 19/72). Preliminary results from a single cheetah (Acinonyx jubatus) and single fishing cat (Prionailurus viverrinus) suggest that sperm membrane cholesterol may be lower compared to the domestic cat. Cholesterol content appeared to increase in both species after exposure to 1.5 mg mL1 CLC. In summary, our findings suggest CLC treatment increased cholesterol content of felid sperm membranes. The higher CLC concentration was detrimental to sperm motility, capacitation, and post-thaw sperm traits. The lower CLC concentration did not improve post-thaw sperm function in domestic cats. Research supported by the Procter & Gamble Wildlife Conservation Scholarship Program.


72


129

COMPARISON OF CRYOPRESERVATION METHODS: SLOW COOLING VERSUS RAPID COOLING BASED ON SPERM VIABILITY OF SPERMATOZOA OBTAINED FROM THE CAUDA EPIDIDYMIS OF ALPACA (VICUGNA PACOS) E. Mellisho and M. Moina Facultad de Zootecnia, Universidad Nacional Agraria La Molina, La Molina, Lima, Peru

In alpacas, the male has a low reproductive performance due to the small size of the testes, extended period of ejaculation, and low quality of semen. This work had an objective to evaluate 2 methods of cryopreservation on sperm viability of spermatozoa obtained from the cauda epididymis of male alpacas. Testes from 19 male alpacas (.3 years old) were obtained from the slaughterhouse of Huancavelica and transported to the laboratory in isothermal conditions within 3 h of slaughter. The spermatozoa were obtained by slicing the head of the epididymis, diluting in tris-yolk-glycerol at environment temperature, and then refrigerating for 2.5 h at 58C. The freezing process was carried out by 2 methods, slow cooling and rapid cooling, the results for percentage of progressive motility, vital staining (eosin nigrosin staining), and hypoosmotic swelling test for each method were evaluated. Cryopreservation of spermatozoa by slow cooling was using 0.25-mL straws immediately after the addition of the extenders and sealed with polyvinyl alcohol. The freezing procedure consisted of placing a metallic rack in a polystyrene foam box of 25 20 15 cm (length width height) and pouring LN (1968C) within the box, keeping the level of LN below the surface of the metallic rack by 6 cm. The straws were placed onto the metallic rack exposing them to the vapors of the LN and closing the box hermetically by 10 min to freeze and then store by immersion in LN. The cryopreservation of spermatozoa by rapid cooling was carried out in pellets of 0.25 mL immediately finishing the addition of the extenders a final concentration of 60 106 sperm mL1. The freezing process consisted of placing the suspension of spermatozoa in holes made on the surface of a block of solid carbon dioxide (dry ice, 798C) with a micropipette placing aliquots of 0.25 cc quickly and successively, trying to not let the time between the first pellet formed and the last exceed a minute, and then stored by immersion in LN. Semen was thawed at 378C in hot bath for 1 to 2 min for pellets and 30 s for straws. Percentage of progressive motility, vital staining, and hypoosmotic swelling test were analysed statistically using ANOVA at a significance level of P , 0.05 using the statistical program SASÒ 8.0 (Statistic Analysis System, SAS Institute Inc., Cary, NC, USA). There were statistical differences between the 2 methods slow cooling and rapid cooling for percentage of progressive motility (21.7%a v. 36.2%b), vital staining (30.4%a v. 39.7%b), and hypoosmotic swelling test (21.6a v. 19.0a) for the epididymis spermatozoa. We conclude according to the viability parameters for frozen-thawed spermatozoa that the method of rapid cooling (pellets) is a good alternative for cryopreserved spermatozoa from male alpaca epididymis.

73

APPLICATION OF THE HOLLOW FIBER VITRIFICATION METHOD TO THE CRYOPRESERVATION OF HIGHLY CRYOSENSITIVE EMBRYOS

A. UchikuraA, H. MatsunariA,B, K. NakanoA, S. HataeA, Y. MatsumuraA, Y. AsanoA, T. TakeishiA, H. NakauchiC, and H. NagashimaA,B A

Laboratory of Developmental Engineering, Department of Life Sciences, School of Agriculture, Meiji University, Kawasaki, Kanagawa, Japan; B Meiji University International Institute for Bio-Resource Research (MUIIBR), Kawasaki, Kanagawa, Japan; C Institute of Medical Science, University of Tokyo, Minato, Tokyo, Japan

We recently demonstrated that the hollow fibre vitrification (HFV) method (Matsunari et al. 2012) could effectively be applied to the cryopreservation of embryos from diverse species. In this study, we applied the HFV method to the cryopreservation of highly cryosensitive specimens, such as in vitro matured (IVM)/IVF-derived porcine zona-free morulae and blastomeres isolated from those morulae, as well as IVM/IVFderived cattle embryos at early cleavage stages. Porcine parthenogenetic morulae (d-4) derived from IVM oocytes were treated with 0.25% pronase to remove zona pellucidae. The resulting blastomeres were isolated from the zona-free morulae by a decompaction treatment followed by gentle pipetting. Bovine IVM-IVF embryos at the 2 to 4 cell (d-1), 8 to 16 cell (d-3), and morula stages (d-5) were then subjected to vitrification. The HFV procedure was performed as described previously using 15% dimethyl sulfoxide, 15% ethylene glycol, and 0.5 M trehalose as cryoprotectants. Four to twenty embryos, or all of the blastomeres isolated from a single morula, were individually loaded into a cellulose acetate hollow fibre (25 mm long, 185 mm j, 15 mm membrane thickness) and vitrified. Survival of the vitrified embryos was assessed by in vitro development to blastocysts. Blastomeres recovered after vitrification were aggregated in micro-wells to examine their ability to form blastocysts. The HFV method was demonstrated to be effective for cryopreserving zona-free in vitro-produced porcine morulae and the blastomeres isolated from them (Table 1), as well as bovine IVM-IVF embryos at early cleavage stages. These data demonstrate that the HFV method is effective for highly cryosensitive specimens, such as IVM/IVF-derived porcine zona-free morulae and blastomeres isolated from those morulae, and IVM/IVF-derived cattle embryos at early cleavage stages. These achievements may expand the technological options in the production of cloned and genetically modified pigs that are useful for biomedical research.

130



Table 1. Survival of zona-free porcine morulae and isolated blastomeres after vitrification (top) and blastocyst formation rates in bovine early-stage in vitro matured-IVF embryos after vitrification (bottom) Item

Vitrification

Cultured

Developed to blastocysts (%)

Zona-intact morula

þ þ þ

23 22 23 22 171 171

21 (91.3)a 20 (90.9)a 21 (91.3)a 22 (100)a 16 (94.1)a 16 (94.1)a

Zona-free morula Blastomeres

2–4 cell (%) Vitrified Nonvitrified

8–16 cell (%)

a

Morula (%)

a

33/40 (82.5)a 33/40 (82.5)a

40/60 (66.7) 47/60 (79.7)a

36/56 (64.3) 41/55 (74.5)a

a

No significant difference. Blastomeres isolated from 17 morulae.

1

This study was supported by JST, ERATO, the Nakauchi Stem Cell and Organ Regeneration Project, and MUIIBR.

74

EFFECT OF POWDERED EGG YOLK IN THE EXTENDER AND DONOR AGE ON FRESH AND THAWED SPERM MORPHOMETRY IN SMALL RUMINANTS M. J. Palomo, W. Garcia, and A. Tabarez Universitat Auto`noma de Barcelona, Bellaterra, Spain

Our aim was to reduce heterogeneity and microbiological contamination risk on small ruminant semen cryopreservation by replacement of fresh egg yolk by pasteurized powdered egg yolk, assessing simultaneously the effect of the donor age (1 year v. 2 years old) on sperm head morphometry of fresh and thawed sperm. Briefly, fresh ejaculates from 8 rams and from 8 bucks were collected in autumn during 2 consecutive years. Immediately after collection, ejaculates from each species were mixed in equal quantities, and pooled semen was centrifuged twice (600 g for 10 min). Then the pellet was split into 2 aliquots and resuspended in an extender containing 15% (v/v) of fresh or powdered egg yolk supplemented with 5% glycerol in a Tris-based medium. Afterward, sperm samples were refrigerated at 58C for 4 h before being frozen in nitrogen liquid vapours. Buck and ram sperm-head morphometry was analysed by computerassisted sperm analysis (ISASÒ) on fresh and thawed sperm previously stained with Diff QuickÒ, and the data were analysed using ANOVA (mean s.e., n ¼ 6). From ram sperm studies, no differences were found between fresh and post-thaw sperm, neither between egg yolk-based extenders or donor ages, showing the following mean values of head length (8.4 0.0 mm), width (4.9 0.0 mm), area (34.2 0.1 mm2), perimeter (23.4 0.1 mm), ellipticity (1.7 0.0), elongation (0.2 0.0), rugosity (0.8 0.0), and regularity (0.9 0.0). Likewise buck semen did not show significant differences on sperm-head dimensions after cryopreservation, only on head-shape parameters as ellipticity, elongation, and regularity between fresh and thawed sperm from 2-year-old donors, independently of egg yolk used as cryoprotectant. However, the age of the buck had a significant effect on all assessed morphometric parameters in fresh and thawed sperms, except regularity (Table 1). Our results suggest that, from a morphometric point of view, the powdered egg yolk can be used satisfactory on small ruminant sperm cryopreservation, but in goats, the head changes due to the donor age should be considered. Table 1. Effect of fresh v. powdered egg yolk (EY) in the extender and donor age on fresh and thawed buck-sperm morphometry Item Length Width Area Perimeter Ellipticity Rugosity Elongation Regularity

Buck age

Fresh sperm

Thawed sperm fresh EY

Thawed sperm powdered EY

1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2

8.18 0.10 7.72 0.04* 4.32 0.02* 4.45 0.02* 29.92 0.35* 28.92 0.25* 22.38 0.2* 21.70 0.08* 1.90 0.03* 1.74 0.00a* 0.74 0.00* 0.77 0.00* 0.31 0.01* 0.26 0.00a* 0.93 0.00 0.93 0.00a

8.17 0.04 7.84 0.06* 4.20 0.03* 4.39 0.02* 29.07 0.28 29.23 0.18 22.36 0.10 21.87 0.12 1.95 0.02* 1.79 0.02b* 0.73 0.00 0.77 0.00 0.32 0.00* 0.28 0.00b* 0.93 0.00 0.92 0.00b

8.12 0.04* 7.84 0.03* 4.18 0.03* 4.40 0.03* 28.76 0.15 29.31 0.21 22.22 0.08 21.88 0.07 1.95 0.02* 1.79 0.01b* 0.73 0.00 0.77 0.00 0.32 0.01* 0.28 0.00b* 0.93 0.00 0.92 0.00b

*

*

Different superscripts in the same row shows significant difference (P , 0.05). Within a column for a same parameter, an asterisk shows significant difference (P , 0.05).

a,b *

Research supported by INIA (RZ2009–00008–00–00), Generalitat de Catalunya (2009SGR0621 and CUR-DIUE), and FSE and Fundacioń Carolina.

Developmental Biology

75


131

EPIGENETIC EFFECTS OF VITRIFICATION ON PRONUCLEAR DOMESTIC CAT EMBRYOS J. H. GaliguisA, C. E. PopeA, M. N. BiancardiA, C. DumasA, G. WangB, and M. C. Go´mezA B

A Audubon Center for Research of Endangered Species, New Orleans, LA, USA; Departments of Microbiology and Immunology, Medicine, and Genetics, Louisiana State University Health Sciences Center, New Orleans, LA, USA

Vitrification remains a promising technique in the preservation of valuable genetic material; however, in the cat, success has varied. Live kittens have been produced from embryos vitrified at early cleavage stages, but phenotypic abnormalities in some kittens suggest possible epigenetic effects of the vitrification process. It has been reported that cryopreservation alters epigenetic events in somatic donor cells, which indirectly influences physical status of cloned offspring. However, extending post-warming in vitro culture of donor cells corrects these epigenetic modifications, resulting in normal embryos/clones. Accordingly, in the present study, vitrification was performed at the pronuclear stage to lengthen pretransfer culture time, and vitrified cat zygotes were assessed by analysing (1) histone acetylation/methylation, (2) global DNA methylation, (3) pluripotent gene expression, (4) in vitro development, and () in vivo viability. In vivo matured/IVF oocytes were vitrified in 15% dimethyl sulfoxide, 15% ethylene glycol, and 0.5 M sucrose at 16 h post-insemination (PI). After warming in 1.0 M sucrose at 388C, embryos were fixed at 18 h or 40 h PI, and the nuclear intensity of either acetyl/dimethyl-H3K9 or 5-methylcytosine was determined by immunofluorescence. Results showed that at 18 h PI, mean H3K9ac intensity of vitrified embryos (11.8; n ¼ 6) was higher than that of corresponding nonvitrified (fresh) controls (4.5; n ¼ 6) and the fresh (3.2; n ¼ 11) and vitrified (0.6; n ¼ 7) 40-h groups (2-way ANOVA; P , 0.05). H3K9me2 in the fresh (36.9) and vitrified (32.5) 18-h embryos was similar but increased relative to both fresh (10.7) and vitrified (9.2) 40-h groups (P , 0.05). Mean DNA methylation (5MeC) in the fresh (31.6; n ¼ 1) and vitrified (24.7; n ¼ 3) 18-h groups was similar to that of the fresh 40-h group (19.8; n ¼ 4) but higher than that of the vitrified 40-h group (15.0; n ¼ 5; P , 0.05). To assess expression of POU5F1 and Nanog, qRT-PCR was performed on Day 8 blastocysts. Relative to controls (n ¼ 9), mean POU5F1 and Nanog levels in vitrified blastocysts (n ¼ 24) were 1.38- and 1.98-fold higher, respectively (one-way ANOVA; P . 0.05). In terms of in vitro development, Day 2 cleavage of vitrified zygotes (59%; n ¼ 508) was similar to that of controls (66%; n ¼ 340), but Day 8 blastocyst formation was reduced (9 v. 31%; t-test; P , 0.05). In vivo viability was assessed by oviducal transfer of 41 Day 1 embryos into 2 recipients. One pregnancy was established (50%), with 3 live kittens weighing 70, 79, and 131 g delivered without assistance on Day 65 of gestation. The 2 smaller kittens died within a few hours of birth, with the smallest exhibiting an umbilical hernia and organ exteriorization. The third kitten developed into a normal, healthy adult. In summary, mean H3K9me2, 5MeC, and POU5F1/Nanog expression of vitrified zygotes was similar to corresponding controls. H3K9ac increased at 18h PI as a result of vitrification, but was reduced after culture to 40 h PI. Although vitrified zygotes cleaved in vitro at rates similar to controls, blastocyst development was reduced. In vivo viability was demonstrated; however, postnatal survival of kittens produced was low.

Developmental Biology 76 EX VIVO MODEL TO STUDY THE EFFECT OF ACUTE EXPOSURE TO DI-(2-ETHYLHEXYL) PHTHALATE ON BOVINE OOCYTE MATURATION AND DEVELOPMENTAL COMPETENCE D. KaloA,B, R. HadasA, and Z. RothA,B A

Department of Animal Sciences, Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot, Israel; B Center of Excellence in Agriculture and Environmental Health, The Hebrew University of Jerusalem, Rehovot, Israel

Di-(2-ethylhexyl) phthalate (DEHP) and its metabolites are environmental toxicants that potentially affect mammalian health. However, their effects on ovarian function, and in particular oocyte developmental competence, are less known. We established a model of acute exposure to DEHP to examine its immediate and long-term effects on follicles and oocyte competence. Lactating Holstein cows were synchronized and gavaged with DEHP (OXPLASTÒO, ZAK, Ke˛dzierzyn-Koz´le, Poland; 100 mg kg1 per day, n ¼ 4) or water (n ¼ 5) for 3 days. Liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis revealed high DEHP metabolite levels in both the urine and plasma during DEHP exposure (acute phase), followed by relatively low levels through the subsequent 34 days (chronic phase). In the chronic phase, cows were synchronized with prostaglandin (PG)2a-gonadotropin-releasing hormone (GnRH) (day 0) and ovaries were monitored by ultrasonography (Aloka SSD-900, 7.5 MHz; Aloka, Tokyo, Japan) through an entire oestrous cycle. On Day 18 of the cycle, cows were administered with PG2a and within 30 h, follicular fluid (FF) was aspirated from the preovulatory follicle by ultrasonic scanner connected to a vaginal sector transducer (7.5-MHz, PieMedical, Maastricht, the Netherlands). For each group, the FF were pooled and analysed for DEHP metabolites (MEHP, MEHOH, MEHHP) by LC-MS/MS. These FF further served as maturation medium for in vitro embryo production. For all cows, FF aspirated before DEHP administration did not contain any of the examined metabolites. However, during the chronic phase, the level of MEHP (but not MEHOH, MEHHP) was higher (22.31 v. 0.00 nM) in the FF aspirated from treated cows (FF-DEHP, n ¼ 4) relative to controls (FF-control, n ¼ 5). To examine the effect of MEHP on oocyte maturation and developmental competence, cumulus-oocyte complexes aspirated from abattoir ovaries (n ¼ 250 5 replicates) were matured (22 h, 38.58C, 5% CO2) in FF-control or FF-DEHP, then in vitro fertilized (18 h, 38.58C, 5% CO2) and cultured for 8 days in KSOM (38.58C, 5% CO2, 5% O2). The proportion of oocytes with expanded cumulus cells (84.5 v. 81.2%) and distribution of oocyte within cortical granule types (I–III) did not differ between groups at the end of maturation. The proportion of oocytes with metaphase II plate and first polar body (i.e. nuclear-matured) was lower in the DEHP-treated group relative to the control (34.7 v. 64.3%, n ¼ 100/group; P , 0.0001). Moreover, a decreased proportion of 2- to 4-cell-stage embryos (53.12 v. 67.61%; P , 0.04) and 7-day blastocysts (4.2 v. 12%; P , 0.08) was noted for the FF-DEHP group. In summary, the findings reveal long-lasting effects of DEHP exposure, expressed by MEHP incorporation into the FF, suggesting potential deleterious effects on developmental competence of the follicle-enclosed oocyte.

132



77 EFFECT OF HEAT SHOCK DURING IN VITRO MATURATION ON HETEROCHROMATIN COMPACTION IN BOVINE EMBRYOS AT 4- AND 8-CELL STAGES: PRELIMINARY STUDY L. S. A. CamargoA, T. Aguirre-LavinD, P. AdenotD, T. D. AraujoB, E. D. SouzaC, and N. BeaujeanD A Embrapa Dairy Cattle, Juiz de Fora, MG, Brazil; Federal University of Juiz de Fora, Juiz de Fora, MG, Brazil; C Federal University of Espirito Santo, Vitoria, ES, Brazil; D UMR1198 Biologie du Developpement et Reproduction, INRA, Domaine de Vilvert, Jouy-en-Josas, France B

High temperatures cause several reproductive losses in cattle. Under in vitro conditions, heat shock decreases oocyte developmental competence and influences embryonic gene expression (Gendelman and Roth 2012 Anim. Reprod. Sci. 134, 125–134). This preliminary study aimed to evaluate whether heat shock during oocyte in vitro maturation (IVM) could have any further effect on chromatin remodelling of fertilized embryos at 4- and 8-cell stages, once such modifications are required for the gene activation in bovine embryos. We evaluated the distribution of heterochromatin 1 (HP1b) and of histone H3 trimethylated at lysine 9 (H3K9me3), both reportedly correlated with heterochromatin formation, in 4- and 8-cell stage embryos derived from control (C) and heat-shocked (HS) bovine oocytes. Immature cumulus-oocyte complexes (COC) collected from crossbred cows in Brazil were exposed for 12 h to 38.88C (C group) or 41.08C (HS group) followed by 12 h at 38.88C, totalizing 24 h of IVM at 5% CO2 in air. Oocytes were in vitro fertilized (IVF) with non-sexed sperm and denuded zygotes were in vitro cultured in CR2aa medium at 38.88C and 5% CO2, 5% O2 and 90% N2. Four- and 8-cell embryos at 44 h post-IVF were fixed in 4% paraformaldehyde and stained with anti-mouse HP1b and anti-rabbit H3K9me3 first antibodies. Immunofluorescence was evaluated by confocal microscopy (Zeiss LSM 700, MIMA platform, INRA) and 3D images processed by ZEN Lite software (Zeiss, Jena, Germany). Three different distribution patterns of fluorescence were identified based on morphological criteria: diffuse, little clusters, and big clusters. Proportions of embryos in every distribution pattern were compared between C and HS groups by Chi-squared test. No difference (P . 0.05) on cleavage rate was found between C and HS groups until 44 h post-fertilization. Embryos at the 4-cell stage from HS group displayed an increased (P , 0.01) proportion of nuclei with H3K9m3 big clusters (44%, n ¼ 7/16 embryos), whereas embryos from C group displayed only few nuclei with this pattern (5%, n ¼ 1/18). At the 8-cell stage, distribution of H3K9m3 was similar (P . 0.05) between C and HS groups. For HP1b, embryos at the 4-cell stage from HS group displayed an increased (P , 0.05) proportion of nuclei with little clusters (81%, n ¼ 13/16 embryos), whereas embryos from C group had low proportion of nuclei with this same pattern (40%, n ¼ 7/18). Mostly 4-cell stage embryos from C group presented the diffuse pattern (61%, n ¼ 11/18 v.18%, n ¼ 3/16 in the HS group; P , 0.05). At the 8-cell stage, some embryos from the C group (31%, n ¼ 5/16) still showed nuclei with diffuse distribution of HP1b, whereas no nucleus with this pattern was found for the HS group. These preliminary data suggest that bovine embryos derived from heat-shocked oocytes can display precocious heterochromatin compaction, represented by the accumulation of H3K9me3 and HP1b at the 4-cell stage, compared with embryos derived from non-heat-shocked oocytes, which may affect embryonic genome activation with consequences for further gene expression. Research was supported by CNPq, FAPEMIG, FAPES and Laboratoire d’Excellence Revive (Investissement d’Avenir, ANR-10-LABX-73).

78

NONINVASIVE CELL LINEAGE TRACING IN BOVINE EMBRYOS FROM 2-CELL STAGE UP TO BLASTOCYST STAGE L. P. Sepulveda-RinconA, D. DubeB, P. AdenotB, L. LaffontB, S. RuffiniB, L. GallB, W. E. MaaloufA, V. DuranthonB, and N. BeaujeanB A

Child Health, Obstetrics and Gynaecology, University of Nottingham, Nottingham, United Kingdom; B INRA, UMR1198 Biologie du De´veloppement et Reproduction, Jouy-en-Josas, France

The first lineage specification occurs during pre-implantation mammalian development. At the blastocyst stage, 2 cell lineages can be distinguished: the inner cell mass (ICM) and the trophectoderm (TE). The exact timing when embryo cells are skewed to these lineages is not clearly determined in mammalian species. In murine embryos, it has been suggested that the first cleavage plane might be related to the embryonic-abembryonic (Em-Ab) axis at blastocyst stage. Thus, the daughter cells of the 2-cell embryo might already be predisposed to a specific cell lineage further on development. The objective of the present study was to observe how the first cleavage in bovine embryos may be related to cell lineage allocation at the blastocyst stage, using a noninvasive tracing approach. Bovine oocytes were harvested, in vitro matured, and fertilised. At the 2-cell stage, embryos were injected in one blastomere with the membrane tracer DiI. At the blastocyst stage, embryos (n ¼ 346) were classified as orthogonal when the Em-Ab axis was orthogonally divided by the borderline between labelled and non-labelled cells; as deviant if the borderline was overlapping the Em-Ab axis; and as random when the labelled and non-labelled cells were randomly distributed. Total cell count (TCC) and the ICM/TE ratio was allowed by DNA staining with 40 ,6-diamidino-2-phenylindole (DAPI) and by immunostaining of the ICM with Sox2 antibody. Analysis of variance was performed by one-way ANOVA employing IBM SPSS v21 (SPSS Inc., Chicago, IL, USA) to determine any difference between the cell lineage allocation patterns, TCC, and the ICM/TE ratio. P-values ¼ 0.05 were considered significant. All values are reported as mean standard error of mean. Within 40 repetitions, the blastocyst classification was as follows: orthogonal 14.9% (2.32, n ¼ 56), deviant 22.2% (2.58, n ¼ 80), and random 62.9% (2.64, n ¼ 210). A significant difference was found in the incidence between the random group against the orthogonal and deviant, but not between the latter two. Regarding TCC, a significant difference was observed only between the orthogonal (99.6 11.7 cells, n ¼ 15) and deviant (135 7.3 cells, n ¼ 25) groups, but not with random embryos (116 5.5 cells, n ¼ 42). Finally, no significant difference was found among the groups concerning the ICM/TE ratio (0.43 0.07 for orthogonal, n ¼ 7; 0.54 0.06 for deviant, n ¼ 14; and 0.40 0.03 for random embryos, n ¼ 26). In conclusion, bovine embryos present a marked tendency for a random distribution of the daughter cells derived from the 2-cell blastomeres. However, around 37% of the blastocysts present a patterned cell division, where the daughter cells remain together through pre-implantation development. The effect of these cell lineage allocation patterns on implantation and further embryo development needs to be addressed. The authors acknowledge Laboratoire d’Excellence Revive (Investissement d’Avenir, ANR-10-LABX-73) and CONACyT Mexico for funding.



79

133

MICRORNA EXPRESSION IN BOVINE CUMULUS CELLS K. Uhde, L. T. A. van Tol, T. A. E. Stout, and B. A. J. Roelen

Department of Farm Animal Health, Utrecht University, Faculty of Veterinary Medicine, Utrecht, the Netherlands A mammalian oocyte within an ovarian follicle is surrounded by cumulus cells, together this structure is known as the cumulus-oocyte complex (COC). Cumulus cells are important for the development of the oocyte, they support the maturation process of the oocyte within the ovary and aid in sperm recognition. Because it is known that a Dicer knockout leads to infertility, microRNAs (miRNA) are focused to have an important role in oocyte development. MiRNAs are small noncoding RNA sequences that act as transcriptional regulators. Little is known about the expression of miRNA in cumulus cells or how cumulus-derived miRNA may regulate or be used to indicate the developmental competence of the maturing oocyte. Our aim was to investigate miRNA expression in oocytes and to identify and establish how specific miRNA influence the acquisition of developmental competence by bovine oocytes. Normalization of qPCR data requires stable reference genes. To this end, we tested the expression of various miRNA with respect to their ability to be used as reference miRNA for bovine cumulus cells; these included miR-103, miR-93, miR-26, let-7a, miR-191, and the small noncoding nuclear RNA U6. Cumulus-oocyte complexes were recovered from the ovaries of slaughtered cows and matured in vitro. Small samples of cumulus cells were collected from these COC before and after maturation. From the cumulus cell groups recovered at different stages, small RNA were extracted and cDNA was synthesised, followed by qRT-PCR. To identify the optimal combination of reference genes, the geNorm algorithm was used. MiR-26a and let-7a were identified as the most stably expressed miRNAs, whereas U6 showed the most variable expression levels. Future investigations are planned to identify miRNA in cumulus cells that can be used as markers for oocyte developmental competence. Using a single oocyte-embryo culture system will enable us to retrospectively relate cumulus miRNA expression to the developmental capacity of the oocyte. This work was supported by EU FP7 EpiHealthNet (N8317146).

80

DNA METHYLATION OF INSULIN-LIKE GROWTH FACTOR 2 (IGF2) GENE IN DAY 14 IN VITRO-PRODUCED BOVINE EMBRYOS OF DIFFERENT SIZES J. O. CarvalhoA, M. M. FrancoB, G. M. MachadoB, and M. A. N. DodeB A

University of Saõ Paulo, Piracicaba, SP, Brazil; Embrapa Genetic Resources and Biotechnology, Brası´lia, DF, Brazil

B

In mammals, a correct DNA methylation reprogramming and the maintenance of genomic imprinting after fertilization are essential for embryo development and pregnancy. One important imprinted gene, related to embryo development and placentation, is the insulin-like growth factor 2 (IGF2) gene. Therefore, embryos with different sizes could show differences in the methylation pattern of IGF2 gene. The aim of this study was to evaluate the methylation pattern of the differentially methylated region (DMR) located within exon 10 of the IGF2 gene, of in vitro-produced Nellore bovine embryos that were different in size on day D14 of development. The embryos were produced from oocytes obtained by follicular aspiration of slaughter house ovaries. On D7 after in vitro fertilization only grade I blastocysts were selected and, in groups of 10 embryos, were transferred nonsurgically to the uteri of previously synchronized recipients with similar conditions. Seven days after being transferred, embryos were collected (Day 14 of development) and measured using Motic Images Plus 2.0 program (Motic, Richmond, BC, Canada). Embryos .45 mm were considered large (L) and those ,25 mm were considered small (S). After being measured, a portion of each trophoblast layer was biopsied and used to determine the methylation status of the IGF2 gene by bisulfite sequencing. The methylation pattern was evaluated on individual embryos considered as separate replicates. At least 5 to 8 clones were evaluated per embryo and the sequences were analysed with the BiQAnalyser software (Max-Planck-Institut fu¨r Informatik, Saarbru¨cken, Germany), using the GenBank sequence NM_174087.3 as reference. The methylation pattern of the different groups was compared using Kruskal-Wallis test (P , 0.05). No differences in DNA methylation were found between S (26.7 8.3%, n ¼ 37 clones, 5 embryos) and L (34.8 2.9%, n ¼ 20 clones, 4 embryos) embryos. It is already known that the region studied is hypermethylated in sperm and hypomethylated in oocytes and, in some somatic cell types, it is expected to be around 50% methylated, being an imprinted region. Although we found a lower percentage of methylation than that expected for an imprinted region, this pattern may be the physiological pattern for trophoblast cells. This is the first report describing the methylation pattern of this region of the IGF2 gene in Day 14 bovine embryos of different sizes. It can be concluded that the methylation pattern of the intragenic DMR on exon 10 of IGF2 gene of in vitro-produced embryos on Day 14 of development is not affected by embryo size. This work was supported by CNPq, FAP-DF.

81

JAK-STAT SIGNALLING IS CRITICAL FOR INNER CELL MASS DEVELOPMENT IN BOVINE BLASTOCYSTS F. Meng, B. Forrester-Gauntlett, H. Henderson, and B. Oback AgResearch, Ruakura Research Centre, Hamilton, New Zealand

The inner cell mass (ICM) of mammalian blastocysts comprises 2 transient lineages, namely hypoblast and epiblast, which develop into extraembryonic and embryonic tissues, respectively. In the mouse, epiblast cells autocrinally secrete fibroblast growth factor (FGF) to induce hypoblast differentiation, and pharmacological FGF/mitogen-activated protein kinase (MAPK) signal inhibition converts all ICM cells into epiblast. We conducted a chemical screen for additional signal enhancers of epiblast identity in bovine Day 8 blastocysts. From the morula stage onwards, in vitrofertilised (IVF) embryos were cultured in the presence of 9 small molecule inhibitors, targeting 9 principal signal pathway components. Inhibitors included SB431542, LDN193189, BIBF1120, Forskolin, BI-D1870, A66/TGX 221/ZSTK474, and AZD1480, targeting TGFb-RI, BMP-RI,

134



VEGFR/PDGFR/FGFR, adenylate cyclase, ribosomal S6 kinase (RSK), PI3K, and JAK2 signalling, respectively. Using (1) blastocyst quality (by morphological grading), (2) cell numbers (by differential stain), and (3) lineage-specific candidate gene expression (by quantitative PCR) as readouts, we sought to identify positive and negative regulators of ICM development and lineage determination. Based on our previous digital mRNA profiling data (McLean et al. 2014 Biol. Reprod., in press), we selected discriminatory epiblast-specific (FGF4, NANOG) and hypoblast-specific (PDGFRa, SOX17) markers for qPCR analysis. Each inhibitor was compared, alone or in combination, to an appropriately diluted dimethylsulfoxide (DMSO) vehicle control in at least 3 biological replicates. Statistical significance was determined using a generalised linear mixed model with binomial distribution and logit link for developmental data and REML for log cell counts and log gene expression data, applying fixed treatment effects and random run and sample within run effects. Blocking TGFb1-, BMP- or VEGF-/PDGF-/FGF-signalling did not affect blastocyst development, ICM v. trophectoderm (TE) cell numbers, or gene expression. Repression of PI3K signals via AG66 and TGX, but not ZSTK alone, modestly decreased grade 1–2 blastocyst development (P , 0.05) but had no effect on cell numbers or gene expression. Stimulating adenylate cyclase activity increased NANOG levels (2.5-fold; P , 0.05), while RSK inhibition reduced FGF4 and PDGFRa expression (4-fold and 2-fold, respectively; P , 0.05). Suppressing JAKSTAT signalling, on the other hand, consistently compromised grade 1–2 blastocyst development and ICM numbers relative to DMSO controls (18/ 235 ¼ 7% v. 59/159 ¼ 29%, n ¼ 5 IVF runs; 12 v. 47 ICM cells, N ¼ 25 and N ¼ 7 embryos counted, respectively; P , 0.0001). Epiblast and hypoblast markers were up to 40-fold reduced (FGF4, NANOG, SOX17; P , 0.0001) or completely abolished (PDGFRa; P , 0.0001). This effect was specific to the ICM because TE numbers and TE-specific gene expression (CDX2, KTR8) were not significantly altered. In summary, we have established Day 8 blastocysts as a useful chemical screening platform and demonstrated that bovine ICM development critically depends on JAK-STAT signalling.

82

STRUCTURAL REMODELLING OF THE NUCLEAR ENVELOPE IN BOVINE PRE-IMPLANTATION EMBRYOS

J. PopkenA,B, A. GrafC, S. KrebsC, H. BlumC, T. GuengoerB, V. ZakhartchenkoB, E. Wolf B, and T. CremerA A

Division of Anthropology and Human Genetics, LMU Biocenter, Planegg-Martinsried, Bavaria, Germany; Chair for Molecular Animal Breeding and Biotechnology, Gene Center, LMU, Munich, Bavaria, Germany; C Laboratory for Functional Genome Analysis (LAFUGA), Gene Center, LMU, Munich, Bavaria, Germany

B

In the present study, we investigated the changes of the nuclear envelope and its underlying lamina, as well as features of higher order chromatin organisation in bovine embryos generated by in vitro fertilization during pre-implantation development. We used super-resolution, 3-dimensional structured illumination microscopy combined with 2-colour immunostaining of the nucleoporin Nup153 and lamin B serving as markers for nuclear pore complexes (NPC) and the nuclear lamina, respectively. DNA was counterstained with 40 ,6-diamidino-2-phenylindole (DAPI). We examined 20 nuclei for the zygote (10 male pronuclei and 10 female pronuclei; n ¼ 10) and the blastocyst (10 trophectoderm and 10 inner cell mass nuclei; n ¼ 1) stage, and 10 nuclei for each the 2-cell (n ¼ 5), 4-cell (n ¼ 3), 8-cell (n ¼ 2), 19-cell (n ¼ 1), and morula (n ¼ 1) stages. We report 4 major findings: (1) At the onset of major genome activation (MGA) nuclei showed a peripheral location of chromosome territories (CT), separated by wide IC channels and surrounding a major lacuna depleted of chromatin. The NPC were exclusively present at sites where DAPI-stained DNA contacted the nuclear lamina, whereas extended lamina regions without such contacts lacked NPC. In post-MGA nuclei, the CT formed a higher order chromatin network distributed throughout the entire nuclear space and the major lacuna disappeared. In line with a switch to a ubiquitous lining of DNA at the lamina, NPC were also uniformly distributed throughout the entire nuclear envelope. These findings shed new light on the conditions that control the integration of NPC into the nuclear envelope. (2) The switch from maternal to embryonic production of mRNA was accompanied by an increased amount of nuclear lamina invaginations covered with NPC, which may serve the increased demands of mRNA export and protein import. (3) Other invaginations, as well as interior nuclear segments and vesicles without contact to the nuclear envelope, were exclusively positive for lamin B. Because an increase in these lamin B positive structures occurred in concert with a massive nuclear volume reduction, we suggest that they reflect a mechanism for fitting the nuclear envelope and its lamina to a shrinking nuclear size throughout bovine pre-implantation development. (4) Throughout the cytoplasm, randomly distributed extranuclear clusters of Nup153 without associated lamin B were frequently observed from the zygote stage up to MGA. These clusters may represent a deposit of maternal Nup153 and likely other nucleoporines not studied here. Corresponding RNA-Seq data revealed deposits of spliced, maternally provided NUP153 mRNA and little unspliced RNA before MGA, which increased strongly at the initiation of embryonic NUP153 expression at MGA. After MGA, these clusters were exclusively located at or near the nuclear border and were no longer present at the morula stage and later. In conclusion, our findings demonstrate the dynamic adaptation of the nuclear envelope to the special needs of bovine pre-implantation development and show the necessity of chromatin association for the integration of nuclear pores into the nuclear envelope.

83

STAGE-SPECIFIC PROTEOME SIGNATURES IN EARLY BOVINE EMBRYO DEVELOPMENT D. R. DeutschA, T. Fro¨hlichA, K. A. OtteA, A. BeckB, F. A. HabermannC, E. Wolf A,B, and G. J. ArnoldA

A

Gene Center, Laboratory for Functional Genome Analysis LAFUGA, Ludwig-Maximilians-Universita¨t Mu¨nchen, Munich, Bavaria, Germany; B Chair for Molecular Animal Breeding and Biotechnology, Department of Veterinary Sciences and Gene Center, Ludwig-Maximilians-Universita¨t Mu¨nchen, Munich, Bavaria, Germany; C Chair for Anatomy, Histology and Embryology, Department of Veterinary Sciences, Ludwig-Maximilians-Universita¨t Mu¨nchen, Munich, Bavaria, Germany

Development of early embryonic stages before activation of the embryonic genome depends on sufficiently stored products of the maternal genome and adequate activation, deactivation, and relocation of proteins. To establish protein function, several posttranslational events (e.g. proteolytic activation, phosphorylation, or secretion) are frequently essential and thereby prevent prediction of protein abundance from transcript abundance. Consequently, proteomic studies are indispensable to characterise the molecular processes governing early embryonic development and to establish



135

corresponding regulatory networks. Here, we present a quantitative proteome analysis of bovine zygotes and embryos at the 2-cell and 4-cell stage. Cumulus-oocyte complexes (COC) were prepared from bovine ovaries obtained from a local abattoir and selected for a compact layer of cumulus cells. In vitro maturation, fertilization, and embryo production were performed according to standard procedures. For quantitative isobaric tags for relative and absolute quantitation (iTRAQ)-liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis, protein from batches of 50 MII oocytes (serving as a reference), zygotes, 2-cell and 4-cell stage embryos, respectively, was extracted. Quantitative proteome analysis of iTRAQ-labelled tryptic peptides was performed on an Orbitrap XL instrument (Thermo Fisher, Waltham, MA, USA) coupled to an Eksigent nanoliquid chromatography system (AB Sciex, Framingham, MA, USA). The tandem MS data were analysed by MASCOT and filtered for a false discovery rate (FDR) of ,1%. Quantification of iTRAQ signals was accomplished with the Qþ module of the Scaffold software (Proteome Software Inc., Portland, OR, USA). t-Tests, ANOVA and principal component analysis (PCA) analysis were performed using R (R Core Development Team, Vienna, Austria). From 4 biological replicates, 1072 proteins were identified and quantified. Eighty-seven differed significantly in abundance between the 4 stages (log2 fold change $ |0.6|, P # 0.05). The proteomes of 2-cell and 4-cell embryos differed most from the reference MII oocyte, and a considerable fraction of proteins continuously increases in abundance during the stages analysed. Bioinformatic analysis of abundance altered proteins provided evidence that the proteins RPS14 and HNRNPK involved in the p53 pathway play a major role during early development, as well as proteins of the lipid metabolism, in particular APOA1. Furthermore, a group of proteins (e.g. SPTBN1, PPP1CC, RABGAP1, STMN1, and WEE2) is engaged in mitosis. In addition, we detected relevant differences between transcript and protein abundance levels; for example, for WEE2. In conclusion, this study identified and quantified numerous proteins important for early embryogenesis so far not described in the mammalian system, and contributed protein profiles for key players previously described. Our results highlight the importance of innovative proteomic tools and workflows to complement transcriptome data of early embryogenesis.

84 PAIRS OF BLASTOMERES FROM BOVINE DAY 5 MORULAE ARE ABLE TO CONTRIBUTE TO INNER CELL MASS AND TROPHECTODERM IN CHIMERIC EMBRYOS GENERATED BY AGGREGATION WITH TWO DAY 4 MORULAE K. SimmetA, M. ReichenbachB, S. JungC, R. FriesC, T. GruppB, C. Gscho¨dererB, J. ScherzerB, H. D. ReichenbachD, and E. Wolf A A

Chair for Molecular Animal Breeding and Biotechnology, Ludwig-Maximilians-Universita¨t Mu¨nchen, Oberschleissheim, Germany; B Bayern-Genetik GmbH, Grub, Germany; C Chair for Animal Breeding, Technische Universita¨t Mu¨nchen, Freising, Germany; D Bavarian State Research Center for Agriculture, Institute of Animal Breeding, Grub, Germany

The multiplication of high-value embryos by chimera formation using asynchronic aggregation is a promising alternative to embryonic cell nuclear transfer. Single blastomeres from a donor embryo are aggregated with 2 host embryos, thus several chimeras can be constructed per donor embryo. Due to the advanced developmental stage, the donor blastomeres are likely to contribute to the inner cell mass (ICM) and later give rise to the embryo proper, whereas the host embryos form extra-embryonic tissues. To test if pairs of blastomeres from Day 5 morulae are able to form the ICM when aggregated with 2 Day 4 host embryos, we produced transgenic donor embryos carrying a fluorescent reporter gene (enhanced green fluorescent protein, eGFP) by using semen from an eGFP transgenic bull (Reichenbach et al. 2010 Transgenic Res. 19, 549–556) for in vitro fertilization and in vitro host embryos produced by a standard procedure. The zona pellucida of all embryos was removed by treatment with 1 mg mL1 pronase. Donor embryos were assessed for eGFP expression by fluorescence microscopy and disaggregated by gentle pipetting after incubation in Mg2þ- and Ca2þ-free medium. Pairs of blastomeres were then placed between 2 host embryos and cultured individually in a well-of-the-well culture dish. On Day 6 after aggregation, fully developed blastocysts were assessed for eGFP fluorescence. In 3 replicates, n ¼ 30 chimeras were produced by aggregation; 13 (43%) developed to blastocysts, of which 2 (15%) showed local eGFP expression in the ICM and 7 (54%) showed a generalized expression. From the results of this study we conclude that Day 5 morulae may be multiplied in an efficient manner by using the chimera formation technique, which makes this approach applicable to ex vivo-derived embryos. In future investigations we will study the effect of using donor blastomeres from either the inside or outside of the donor morula and test the use of tetraploid host embryos to increase the rate of blastocysts with the desired genotype in the ICM. Finally, we aim to introduce this multiplication approach to the production of genotyped embryos with a genomic estimated breeding value (gEBV) and intend to produce calves with identical gEBV. Funded by the Bavarian Research Foundation (AZ-1031–1).

85

LOW-MOLECULAR-WEIGHT METABOLITES IN BOVINE IN VITRO PRODUCTION CULTURE MEDIA AS EMBRYO QUALITY MARKERS ¨ . JaakmaA,C M. No˜mmA, E. MarkA, K. KilkB, S. Ko˜ksA,B, and U A

Estonian University of Lifesciences, Tartu, Estonia; B University of Tartu, Tartu, Estonia; C Competence Centre on Reproductive Medicine and Biology, Tartu, Estonia The need for noninvasive embryo quality assessment techniques has increased as the in vitro production of cattle embryos has become more popular and necessary in the beef and milk production industries. In this study, we assessed the metabolomic profile of embryo culture media to determine whether it is possible to evaluate differences in low-molecular-weight metabolites in the culture media composition of morula stage embryos

136



compared with embryos that develop to the blastocyst stage. Single bovine embryos were cultured in 60-mL SOFþ0.4% BSA droplets under mineral oil. Twenty microliters of culture media was removed at Day 2, 5, and 8 post-fertilization. Cultured droplets without a zygote served as the control samples. A total of 42 samples were analysed using liquid chromatography-mass spectrometry (Q-Trap 3200, Ab Sciex, Framingham, MA, USA), followed by principal component analysis. Our preliminary results indicated significant differences (P , 0.00001) in 10 low-molecular-weight compounds between the groups. Three of those compounds (588, 589, and 702 Da) were represented in higher concentrations only in embryos that advanced into the blastocyst stage. These first results could allow the identification of embryos with improved viability and give better understanding of the development of pre-implantation embryo. This study was supported by CCRMB, Project ANIREP (3.2.0701.12–0036) and institutional grant IUT8–1.

86

BIRTH OF HEALTHY CALVES AFTER INTRAFOLLICULAR OOCYTE TRANSFER

M. HoelkerA, A. KassensB, E. HeldA, C. WrenzyckiC, U. BesenfelderD, V. HavlicekD, H. SiemeB, D. TesfayeA, and K. SchellanderA A

Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn, Bonn, Germany; B Reproductive Medicine Unit, University of Veterinary Medicine Hannover, Hannover, Germany; C Clinic for Veterinary Obstetrics, Gynecology and Andrology, JLU Giessen, Giessen, Germany; D Reproduction Center Wieselburg, VetMed University, Vienna, Austria

The in vitro production (IVP) of bovine embryos is a well-established technique that has been available for nearly 20 years. However, there remain major differences between IVP-derived blastocysts and their in vivo-derived counterparts. Many studies have pointed out that most of these differences are due to the in vitro developmental environment. To circumvent these negative effects due to in vitro culture conditions, a new method – intrafollicular oocyte transfer (IFOT) – was established in the present study. Using modified ovum pick-up (OPU) equipment, in vitro-matured oocytes derived from slaughterhouse ovaries were injected into the dominant preovulatory follicle of synchronised heifers (follicular recipients) enabling subsequent ovulation, in vivo fertilization, and in vivo development. A total of 810 in vitro-matured oocytes were transferred into 14 heifers. Subsequently, 222 embryos (27.3%) were recovered after uterine flushing at Day 7. Based on the number of cleaved embryonic stages, 64.2% developed to the blastocyst stage, which did not differ from the IVP-derived embryos (58.2%). Interestingly, lipid content of IFOT-derived blastocysts did not differ from the fully in vivo-produced embryos, whereas IVP-derived blastocysts showed significantly higher lipid droplet accumulation compared with fully in vivo-derived and IFOT-derived blastocysts (P , 0.05). Accordingly, IFOT blastocysts showed significantly higher survival rates after cryopreservation than complete IVP-derived embryos (77% v. 10%), which might be attributed to a lower degree of lipid accumulation. In agreement, transfer of frozen-thawed IFOT blastocysts to synchronized recipients (uterine recipients) resulted in much higher pregnancy rates compared with transfer of IVP-derived blastocysts (42.1 v. 13.8%) but did not differ from frozen-thawed ex vivo blastocysts (52.4%). Of these presumed IFOT pregnancies, 7 went to term, and microsatellite analysis confirmed that 5 calves were indeed derived from IFOT, whereas 2 were caused by fertilization of the follicular recipient’s own oocyte after AI. Taken together, IFOT-derived blastocysts closely resemble in vivoderived blastocysts, confirming earlier suggestions that the ability to develop to the blastocyst stage is already determined in the matured oocyte, whereas the quality in terms of lipid content and survival rate after cryopreservation is affected by the environment thereafter. However, to the best of our knowledge, this is the first study reporting healthy calves after intrafollicular transfer of in vitro-matured oocytes.

87

OVARIAN RESERVE, EMBRYO PRODUCTION, AND THEIR CORRELATION WITH ¨ LLERIAN HORMONE (AMH) IN HOLSTEIN COWS ANTI-MU J. Verstegen and A. Rozner MOFA Global LLC, Verona, Wisconsin, USA

Anti-Mu¨llerian hormone (AMH) is a small peptide hormone that has been associated with ovarian follicular reserve in humans and in some animal species including bovine. Profiles of AMH, as well as the relationship between serum AMH to oocyte number and in vivo embryo production, were evaluated in Holstein cows. AMH levels were determined in 15 unstimulated cows at monthly intervals for 4 months and in 394 male and 399 female developing Holstein animals from birth to adulthood. Also, AMH was measured in 41 heifers at the time of ovum pick-up (OPU) and 125 heifers at the time of embryo flushing. Superovulation was induced before OPU or embryo flushing using a modified Ovsynch protocol with 4 days of decreasing FSH (Pluset HÒ, MOFA Global, Verona, WI, USA). Blood samples were collected using serum tubes and spun within 2 h. The samples were stored at 208C until evaluated for AMH using the AMH-Bovine specific immunoassayÒ (MOFA Global). AMH levels in males and females peaked at 2 months of age and then decrease as they reached adulthood. The average AMH level of adult cows was stable for each of the 4 monthly measurements, with a high correlation between all values per animal (r2 ¼ 0.9077; P , 0.01), suggesting that AMH levels are consistent for at least 4 consecutive months. However, AMH levels were lowest during the summer months, suggesting a seasonal change in AMH secretion. Animals repeatedly ovarian stimulated showed decreasing AMH levels (509 295, 299 210, 211 119) with subsequent stimulations. There was also a significant decrease in the number of embryos recovered (5.7 4, 2.2 1.9; P ¼ 0.02); however, the number of oocytes was not altered by multiple stimulations (9.9 9.8, 8.1 6.2; P ¼ 0.57). Because AMH and embryo numbers decreased after multiple stimulations, the first AMH value and results of the first OPU or embryo flush were used for the correlation of AMH to the number of oocytes or embryos. Animals were separated into 3 AMH categories: low (,100), normal (100–400), and high (.400 pg mL1). High AMH OPU animals had significantly higher numbers of oocytes than the normal or low AMH groups (13.8 9.2, 9.2 5.3, 5.6 3.9; P ¼ 0.001). High AMH flushed animals had significantly higher numbers of embryos than animals with low AMH (10.9 8.0, 5.7 5; P ¼ 0.002). Statistical analyses were performed using Statview 5. Differences were



137

determined using Student’s t-test; P , 0.05 was considered significant. In conclusion, AMH serum concentrations are consistent over multiple months; however, blood should not be taken for animal selection by AMH after ovarian stimulations have begun and should be interpreted with caution during the summer months. AMH is highly associated with superovulation response and oocyte and embryo production and should improve efficiency of multiple-ovulation embryo transfer.

88

CHANGING MATERNAL NUTRITION IN EARLY PREGNANCY MODIFIES FETAL OVARY DEVELOPMENT IN NELLORE COWS

H. F. CostaA, M. C. V. MiguelA, A. M. PedrosoB, S. P. GobboA, F. L. LopesA, J. R. PeiroA, and G. P. NogueiraA A

UNESP-FMVA-DAPSA, Aracatuba-SP Brazil; B EMBRAPA, Sao Carlos

Environmental influences such as nutritional restriction during early gestation in cattle may impair fetal development and compromise functions in adulthood. During the first trimester of gestation fetal gonads are formed. We hypothesised that either restriction or excess of nutrients ingested by cows during the first third of pregnancy interferes with fetal body weight (BW) and ovary development. Twenty-one uniparous Nelore cows (BW ¼ 488 24 kg, body condition score, BCS ¼ 3.1 0.1) were subjected to timed AI with sexed semen (female) of a single bull and individually allocated to different diets. The diet of the control group (C) met the maintenance requirements, and the groups of high (A) and low (B) were either 180% or 60% of maintenance respectively. Live weight and BCS were assessed weekly to adjust the diet according to the individual weight of each animal. At 60 days of gestation, 9 fetuses (3/group) were removed by colpotomy (accessed through vagina), weighed, and their ovaries were dissected and weighed. One fetal ovary (of each pair) was analysed by RNA-seq (mRNA). The effects of treatments on both ovarian and fetal weight were compared by ANOVA (proc GLM, SAS 9.3, SAS Institute Inc., Cary, NC, USA). During the 60 days of treatment, cows from Group A gained 66 kg (from 474 6 kg to 541 10 kg) and 1.25 points in BCS (from 3.0 to 4.25), whereas the cows in group B lost 61 kg (from 458 3 kg to 397 6 kg) and 1 point in BCS (from 3.2 to 2.2). Fetal ovary weight (sum of the two) was lower in group B (0.007 0.001 g; P , 0.04) than in groups A (0.02 0.004 g) and C (0.013 0.007 g), which did not differ (P . 0.08) between each other. Fetuses in group B weighed less (12.8 1.14 g; P , 0.006) than in groups A (20.56 2.2 g) and C (20.03 0.8 g). Maternal nutritional status during the first 60 days of gestation changed the transcriptome of fetal ovaries. There were differences in the pattern of gene expression between the control, high, and low intake groups. A total of 79 genes out of 20 657 showed differential expression between treatments (false discovery rate 0.05), some of which were related to embryonic and ovarian development. Thus, we conclude that changing maternal nutrition during the first 60 days of gestation will change the transcriptomic profile of fetal ovaries. Poor maternal nutrition jeopardizes ovarian size and weight and fetal weight, suggesting impairment on the production of ovarian follicles. This is a critical period in fetal ovarian development, as oocytes grow and differentiate, and need to escape from degenerative processes to remain in the ovaries. Thus, the developmental impairment at the beginning of meiosis could reduce the number of oocytes in the fetal ovary. Histological examination of fetal ovaries is underway to evaluate the number of oocytes. Funding provided by FAPESP 2011/50839-1; CNPq 487036/2013-3, CAPES.

89

EFFECT OF NONESTERIFIED FATTY ACIDS ON IN VIVO OR VITRO EMBRYO PRODUCTION IN KOREAN NATIVE CATTLE (HANWOO) J.-J. ParkA, H.-J. YooA, K.-W. KimA, E.-J. ChuA, H.-W. ChoB, K.-S. CheongB, S.-H. LeeC, and S.-H. YeonC A

Animal Reproduction & Biotechnology Center, Myung-Poom Hanwoo Consulting, Hoengseong, South Korea; B South Branch of Gangwondo Veterinary Service Lab, Wonju, South Korea; C Hanwoo Experiment Station, National Institute of Animal Science, R. D. A, Pyeongchang, South Korea

Recent reports suggest that high concentrations of nonesterified fatty acids (NEFA) negatively affect oestrous cycle, fertility, in vitro oocyte maturation, embryo quality, and viability. This study was performed to determine the relationship between plasma concentration of NEFA and embryo quality in Hanwoo cattle. In experiment 1, embryo recovery rate from superovulated donor cows 7 days after AI was evaluated. Donors, at random stages of the oestrous cycle, received a CIDR (Day 0). On Day 7, 200 mg of FSH was administered followed by 40, 30, 20, and 10 mg of FSH in declining doses twice daily by intramuscular injection for 4 days. On the third day of FSH administration, 25 mg of prostaglandin F2a was given and the CIDR was withdrawn. After FSH injections were complete, donors were artificially inseminated twice on Day 11 and 12 at 12-h intervals. At first AI, 250 mg of gonadotropin-releasing hormone (GnRH) was administered. During embryo collection, plasma samples were obtained from jugular veins to measure NEFA concentrations by chemistry analyzer. Next, the effect of NEFA on embryo development in vitro was examined (experiment 2). After in vitro maturation and fertilization of abattoir oocytes using standard procedures, zygotes were cultured in mSOFaa supplemented with 5% (vol/vol) oestrous cow serum (ECS) collected from 8 random cows representing 8 different NEFA concentrations (72.6, 126, 175.5, 244.6, 311, 393, 527.3, and 979 g dL1) and compared with mSOFaa without serum (no-serum control). Statistical analysis was performed by ANOVA (SAS 9.1, SAS Institute Inc., Cary, NC, USA) and Duncan’s multiple range tests where appropriate. Recovery of total and transferable morulae and blastocysts was related to NEFA levels of donor cows. The donor group with the lowest plasma NEFA levels yielded the most embryos, of which most were high quality (n ¼ 3, 173 11 g dL1 NEFA; 14 3 total recovered embryos of which 85 7% were transferable). Higher NEFA plasma levels reduced both the absolute number of embryos recovered and the fraction of transferable embryos (n ¼ 8, 301 20 g dL1 NEFA with more than the 10 recovered of which 56 5% were transferable; n ¼ 6, 301.5 37 g dL1 NEFA with 8 2 total embryos recovered of which 19 8% were transferable; n ¼ 4, 288.5 58 g dL1 NEFA with ,7 embryos recovered of which 45 4% were transferable). In experiment 2, cleavage and blastocyst rates were not significantly different (P . 0.05) between the groups. However, embryos exposed to the 2 lowest concentrations of NEFA showed a higher hatching rate compared with control and embryos exposed to the 3 highest NEFA levels (126 and 175.5 g dL1 NEFA: 75.33, 77.67%

138



hatching respectively v. control, 979, 527.3, 393 g dL1 NEFA: 48.33, 32.78, 45.33, 44.52% hatching; P , 0.05). However, embryo developmental rate was highly variable. Our data suggest that high plasma NEFA concentrations can have negative effects on in vivo and in vitro embryo production, whereas low levels may be beneficial. This research was supported by Bio-industry Technology Development Program (No.112130-3), Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea.

90

DESTABILIZATION OF COHESIN REC8 CAUSES ANEUPLOIDY AFTER THE SECOND MEIOSIS IN MURINE POST-OVULATORY AGED OOCYTES G. ShimoiA, K. KudohB, Y. KameyamaA, and R. HashizumeA

B

A Faculty of Bioindustry, Tokyo University of Agriculture, Abashiri, Hokkaido, Japan; Hachinohe Industrial Research Institute, Aomori Prefectural Industrial Technology Research Center, Hachinohe, Aomori, Japan

We have previously reported that the early embryos derived from post-ovulatory aged oocytes frequently exhibit aneuploidy, resulting from abnormalities in the cleavage apparatus of MII oocytes. Other studies have also described a potential mechanism that results in aneuploidy, which is attributed to the failure of a cell cycle checkpoint. The spindle assembly checkpoint (SAC), which acts during metaphase, is a monitoring system that equally distributes sister chromatids by correctly attaching spindle fibres to the appropriate centromere. Cohesin, a functional protein complex of the SAC, includes the REC8 subunit, and acts as an adhesion factor for sister chromatids. Segregation of sister chromatids occurs following the degradation of the cohesin complex by the separase enzyme. The segregation process can be mediated by meiosis-specific REC8, which contains a recognition site for separase. In this study, we examined the expression of meiosis-specific REC8 protein in murine post-ovulatory aged oocytes, and verified the association with aneuploidy induced during second meiosis. Superovulated oocytes from the ICR mouse strain were aged by culture for 3 to 24 h in vitro. To eliminate the male genome factor, chromosomal analysis was performed using oocytes activated by SrCl2, without fertilization. The expression level of REC8 in oocytes, before and after activation, was analysed by Western blot, using a rabbit anti-REC8 antibody (primary) and horseradish peroxidase-conjugated anti-rabbit antibody (secondary). In the 6- and 12-h aged groups, 23.8% and 40.3% of oocytes, respectively, exhibited aneuploidy after the second meiosis. The rate of aneuploidy in the 12-h aged group was significantly higher than that in the fresh oocyte group (10.3%; P , 0.05). It could be speculated from our previous data that this fact contributed to the occurrence of aneuploidy in early embryos derived from the aged oocytes. In 3-, 6-, 12-, and 24-h aged groups, the results of semiquantitative analysis of REC8 levels in MII oocytes (nonactivated) were 1.32 0.38, 1.30 0.58, 1.15 0.21, and 0.98 0.14, respectively. REC8 levels in the 24-h aged group were significantly lower than in the fresh group (1.86 0.56, P , 0.05). The expression levels of REC8 in activated oocytes at 3 and 6 h were 0.53 0.01 and 0.55 0.04, respectively. REC8 levels in the 12-h (1.00 0.03) and 24-h (0.95 0.04) groups were significantly higher than in the fresh group (0.49 0.09; P , 0.05). The significant reduction of REC8 levels at anaphase, after oocyte activation, was not observed in oocytes aged 12 h or more. In MII oocytes, REC8 levels tend to decrease gradually with post-ovulatory age. Destabilisation of the cohesin REC8 subunit may contribute to the nondisjunction of sister chromatids during second meiosis in post-ovulatory aged oocytes, ultimately resulting in aneuploidy.

91

SILDENAFIL CITRATE MODIFIES FETOPLACENTAL DEVELOPMENT IN A RABBIT MODEL OF INTRAUTERINE GROWTH RESTRICTION J. Lo´pez-TelloA, M. Arias-AlvarezB, A. Gonza´lez-BulnesC, S. AstizC, R. M. Garcıá-GarcıáD, M. Rodrı´guezA, P. L. LorenzoD, and P. RebollarA A

Dpto. Produccioń Animal, ETSIA, UPM, Madrid, Spain; Dpto. Produccioń Anima, Facultad Veterinaria, UCM, Madrid, Spain; C Dpto. Reproduccioń Animal y Conservacioń de Recursos Zoogene´ticos, INIA, Madrid, Spain; D Dpto. Fisiologıá Animal, Facultad Veterinaria, UCM, Madrid, Spain B

The failure of fetuses to achieve their full growth potential is known as intrauterine growth restriction (IUGR). Sildenafil citrate (SC) is a phosphodiesterase 5 (PDE-5) inhibitor, which enhances nitric oxide (NO)-dependent vasodilatation, and it may have a potential therapeutic role in the treatment of IUGR. The aim of this study was to evaluate the effect of SC on placental and fetal development in a diet-induced rabbit model of IUGR. A total of 24 rabbits does weighing 4.3 0.49 kg on average were used. At Day 9 of pregnancy, females were randomly allocated into 3 experimental groups: one group was fed ad libitum during pregnancy (Group C; n ¼ 8); the rest of the does had 50% restricted daily intake and were treated or not with 20 mg of SC daily from Day 22 of pregnancy until parturition (Groups SC and R, respectively, n ¼ 8 for both). At Day 28 of pregnancy, half of the pregnant does from each group were euthanised to study fetoplacental development, while the remaining does were allowed to deliver. At Day 28, weight, length, and thickness of fetal and maternal placentas, and fetal weight and size [crown-rump length (CRL), and transversal thoracic diameter (TD)] were assessed. A fetus was considered IUGR when it weighted less than the 10th percentile for its normal gestational weight. Statistical analysis was performed using the PROC GLM procedure. Nutritional restriction induced a higher rate of fetuses IUGR than control group (31.0% v. 15.1%; P , 0.05). The percentage of fetuses with IUGR was 23% in SC group (no significant differences with groups C and R). However, SC increased the thickness of maternal and fetal placentas compared to group R (0.4 0.02 v. 0.2 0.02 cm; 0.6 0.02 v. 0.3 0.02 cm; P , 0.05 respectively), being similar to group C (0.4 0.02 and 0.5 0.03 cm). Maternal placental weight in group C showed higher values (1.5 0.08 g; P , 0.05) than both restricted groups (1.2 0.07 g). CRL in group SC was larger than in group R (10.5 0.12 v. 10.0 0.12 cm; P , 0.05) and similar to that in group C (10.5 0.15 cm). The neonates in group SC showed higher values for CRL (10.9 0.15 cm) than those from groups R and C (10.5 0.11, 10.2 0.20 cm; P ¼ 0.05). Regarding TD, fetuses in group SC showed higher values than group R (2.3 0.04 v. 2.1 0.03 cm; P , 0.05) and equaled



139

that of group C (2.3 0.03 cm). In conclusion, maternal malnutrition prejudices fetoplacental development, causing IUGR. Treatment with SC in the last third of gestation counteracts fetal growth retardation by favouring placental development and function and, thus, fetal growth. These results confirm that administration of SC may have a potential benefit in pregnancies complicated by placental insufficiency and IUGR. We acknowledge CM, FSE, and AGL2011-23822 for funding.

92

NUCLEAR INVAGINATIONS ADAPT TO RABBIT EARLY EMBRYONIC DEVELOPMENT

J. PopkenA,B, M. Dahlhoff B, T. GuengoerB, V. J. Schmid C, A. StraussD, T. CremerA, V. ZakhartchenkoB, and E. Wolf B A B

Division of Anthropology and Human Genetics, LMU Biocenter, Planegg-Martinsried, Bavaria, Germany; Chair for Molecular Animal Breeding and Biotechnology, Gene Center, LMU, Munich, Bavaria, Germany; C Institute of Statistics, LMU, Munich, Bavaria, Germany; D Division of Genetics, LMU Biocenter, Planegg-Martinsried, Bavaria, Germany

Nuclear invaginations carrying nuclear pores may facilitate increased mRNA export and protein import to areas inside the nucleus remote from the nuclear border. In this study on rabbit embryos, we investigated whether large early embryonic nuclei and the increased import/export demands around major embryonic genome activation (MGA) at the 8-cell stage affected the quantity of nuclear invaginations carrying nuclear pores. To achieve this objective, we used super-resolution 3-dimensional structured illumination microscopy on 10 pronuclei or nuclei per stage of 23 in vivo-fertilized and in vitro-cultured embryos stained with antibodies for the nucleoporin NUP153 and lamin B and stained with 40 ,6-diamidino2-phenylindole (DAPI) for chromatin. Statistical comparisons between stages were performed using the Wilcoxon rank-sum test. At the zygote stage, the female pronucleus displayed on average 16.5 and the male pronucleus featured on average 15.25 wide and narrow nuclear envelope invaginations, carrying large or tiny amounts of cytoplasm. Subsequent stages showed predominantly wide invaginations targeting nucleoli. The contact areas between nucleoli and invaginations were free of nuclear pores. In contrast, narrow invaginations, which are the almost exclusive type of invaginations during cattle and mouse pre-implantation development, were not in contact with nucleoli. At the 2-cell stage, the number of invaginations increased to an average of 27.3 invaginations per nucleus (P , 0.05) and increased again to peak at the 4-cell stage with 51.2 invaginations per nucleus (P , 0.01). At the 8-cell stage (MGA), the amount of nuclear invaginations was reduced to 25.4 invaginations per nucleus (P , 0.01). The reduced number of nuclear invaginations at the 8-cell stage could be associated with a significant decrease in average nuclear volume from 2593 mm3 at the 4-cell stage to 960 mm3 at the 8-cell stage (P , 0.001) and a subsequent reduced average distance from areas inside the nucleus to the nuclear border. Nuclear invagination numbers continued their decline at the 21-cell stage with 5.2 invaginations per nucleus (P , 0.001), whereas nuclear volumes decreased to 618 mm3 (P , 0.001). The morula stage, with 6.9 invaginations per nucleus (P ¼ 0.9), and the blastocyst stage, with 4.5 invaginations per nucleus (P ¼ 0.5), showed no more significant changes. Large NUP153 cytoplasmic clusters present before MGA may represent a maternally provided NUP153 deposit. MGA may mark the switch from the use of a NUP153 deposit to on-demand production. Additionally, over- and underrepresentation analyses on mitotic blastomeres revealed that NUP153 association with chromatin is initiated during metaphase before the initiation of the regeneration of the lamina (P , 0.001; chi-squared goodness-of-fit test). In conclusion, rabbit embryonic development is accompanied by stagedependent changes of the amount of nuclear invaginations carrying nuclear pores. Although cattle and mouse embryos almost exclusively feature narrow invaginations restricted to the nuclear periphery and not in contact with nucleoli, rabbit embryos feature additional wide invaginations that can reach across the nucleus and target nucleoli.

93

THE INVOLVEMENT OF E-CADHERIN IN THERMOPROTECTIVE FUNCTION OF INSULIN-LIKE GROWTH FACTOR-1 IN 4-CELL HAMSTER EMBRYOS

A. C. TrejoA, I. B. AbadA, V. M. V. MezaA, A. M. VillaB, J. Z. Abad C, M. C. Navarro-MaldonadoC, and D. G. AmbrizA B

A Univeridad del Papaloapan, Loma Bonita, Oaxaca, Me´xico; Benemerita Universidad Autońoma de Puebla, Tecamachalco, Puebla, Me´xico; C Universidad Autońoma Metropolitana, Iztapalapa, Distrito Federal, Me´xico

Studies have demonstrated that the early pre-implantation embryo is very sensitive to effects of heat stress in vitro. Heat stress reduces the total cell number in blastocysts and increases apoptosis in blastomeres. Insulin-like growth factor-1 (IGF-1) has been widely studied as a thermoprotective agent for its anti-apoptotic actions. Addition of IGF-1 to the culture medium decreases the effects of heat stress on blastocysts but has no effects on 2-cell embryos. Molecular mechanisms by which IGF-1 decreases apoptosis involve activation of the PI3K/Akt pathway. It is also known that adherens junctions contribute to PI3K/AKT activation mediated by the transmembrane glycoprotein E-cadherin, which is involved in Ca2þdependent cell-cell adhesion. Within 2- to 8-cell embryos, E-cadherin is mainly inactive and has cytoplasmic localization. 6-Dimethylaminopurine (6-DMAP) induces premature cell flattening and E-cadherin redistribution to adhesion sites in 4-cell embryos. The aim of this study was to induce Ecadherin redistribution in 4-cell hamster embryos and evaluate the thermoprotective function of IGF-1 in these embryos. Four-cell embryos were incubated in the presence of 6-DMAP to induce E-cadherin redistribution to adhesion sites and cultured for 24 h under conditions of heat stress and compared with controls without 6-DMAP. Culture medium was supplemented with IGF-1. At the end of culture, developmental stage and rate of apoptosis were determined and analysed by ANOVA using the General Linear Model (GLM) of SAS (SAS Institute Inc., Cary, NC, USA) procedure with statistical significance at P , 0.05. E-Cadherin redistribution induced by 6-DMAP increased development to the 6-cell stage after 24 h (63.57% v. 38.81%, respectively; P , 0.05) and reduced apoptosis (25% v. 33%, respectively; P , 0.05) under heat-stress conditions. In conclusion, we hypothesise a role for E-cadherin-mediated cell flattening in promoting IGF-1-mediated thermoprotection in pre-compact 4-cell hamster embryos. Further studies are required to confirm this link.

140


94


CHRONOLOGICAL TRANSITION OF GONOCYTES TO SPERMATOGONIAL STEM CELLS DURING PREPUBERTAL AND PUBERTAL PERIODS IN DOMESTIC CATS N. TiptanavattanaA, A. RadtanakatikanonB, S. BuranapraditkunC, P. HyttelD, H. M. HolmesD, P. SetthawongA, M. TechakumphuA, and T. TharasanitA

A

Department of Obstetrics, Gynaecology and Reproduction, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand; B Pathology Unit, Department of Pathology, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand; C Allergy and Clinical Immunology Unit, Department of Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand; D Department of Veterinary Clinical and Animal Sciences, Faculty of Health and Medical Sciences (SUND) University of Copenhagen, Frederiksberg C, Denmark

The pubertal age of domestic cat (Felis catus) as defined as a complete spermatogenesis has been reported to occur around 8 months of age. During the initial phase of testicular development, the transition of gonocytes to spermatogonial stem cells (SSC) takes place within the seminiferous cords. This stage-specific transition has been demonstrated to facilitate SSC isolation and enrichment. Because information for this aspect in domestic cats is limited, this study aimed to identify the phase transition of gonocytes to SSC during newborn to puberty. Cat testes were collected and classified by age into 3 groups: group 1: 0–4 months (n ¼ 5), group 2: 4–6 months (n ¼ 5), and group 3: 6–12 months (n ¼ 5). Testes were studied for conventional histology, transmission electron microscopy (TEM), and FACS analysis on GFRa-1 expression, a SSC marker. For histology, tissues were fixed, sectioned, and stained with H&E. Serial changes of germ cell development within the testes were observed using light microscopy. In addition, ultrathin sections (60 nm thickness) of testes were cut and examined with TEM for ultrastructure analysis. Immunolabelling and flow cytometry of GFRa-1 were used to identify the SSC population after testicular cell dissociation. The percentages of spermatogonia per tubule were analysed by one-way ANOVA, and data are presented as mean s.e. The development of testicular germ cells from gonocyte to spermatozoon was gradually demonstrated in histological sections, depending on age of the cats. For group 1, the gonocytes were clearly presented in the seminiferous cord. These gonocytes were in proliferative phase, as they frequently contained homogeneous euchromatin and less organelles. In group 2, the gonocytes transformed to spermatogonia as indicated by their small size (range 8.11–13.55 mm) with oval to flattened shape, chromatin condensation, and darkened cytoplasm. These cells migrated and settled onto the basement membrane of seminiferous cord. At this stage, mitochondria and small clumps of heterochromatin increased when compared with group 1. Some spermatogonia occasionally developed through the meiosis by 6 months of age (group 2), whereas complete spermatogenesis was first identified in 9-month testes (group 3). The percentage of spermatogonium/tubule in group 2 (15.84 0.67) was significantly higher (P , 0.001) than group 1 and 3 (1.99 0.22 and 6.88 0.53, respectively). Because the SSC-like cells (based on their histological morphology) were predominantly found in group 2, the testes (n ¼ 5, 4–6 months of age) were additionally digested to confirm GFRa-1 expression. Of total testicular cells, a high proportion of GFRa-1 positive cells (12.32 6.31%) were identified by FACS. In conclusion, this study provides information regarding the age-dependent development of testicular germ cells in domestic cats. The findings provide the transition period of gonocytes to SSC that occurs around 4 to 6 months of age. This study can be applied for the enrichment of feline SSC upon testicular digestion.

95

DOSAGE COMPENSATION OF X CHROMOSOME INACTIVATION CENTER (XIC)-LINKED GENES IS ALREADY ACHIEVED IN PORCINE BLASTOCYST J. Y. HwangA, J.-N. OhA, D.-K. LeeA, C.-H. ParkB, and C.-K. LeeA

A

Department of Agricultural Biotechnology, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul, Korea; B Institute of Green Bio Science and Technology, Seoul National University, Kangwon-do, Korea

X-chromosome inactivation (XCI) is an epigenetically essential process for balancing dosage of X-linked genes between male and female eutherian. Importance of this complex and species-specific event has been highlighted recently in developmental and stem cell biology. However, the process has been confirmed only in restricted species, even though the species-specific studies are needed for comprehensive understanding of XCI in specific species. XCI is regulated by the various genes, many of which are coded on the X chromosome inactivation centre (XIC). Among the XIC-linked genes, especially non-coding RNA (ncRNA) like XIST, which is master gene for XCI, are known to regulate XIC. But the centre is not identified in various species. In this study, we identified XIC in pig and analysed the dosage differences of XIC-linked gene in porcine embryos. At first, the centre was searched in pig. The genomic length of the porcine XIC was similar to human XIC and the order and coding strand of the counterparts in pig XIC were same as the human XIC-linked genes. However, sequence comparison between human XIC-linked gene and its porcine counterpart showed that ncRNA around XIST were less conserved rather than protein-coding genes. This would be caused by rapid evolution of genomic region harboring ncRNA. The expression of XIC-linked genes was compared between male and female porcine embryonic fibroblast (PEF) to confirm that dosage compensation is completed in PEF. Most of the genes were not expressed sex-specifically, but two genes, XIST and an uncharacterized gene, LOC102165544, were expressed female preferentially in PEF. Interestingly, LOC102165544, which had low sequence homology with human JPX, was expressed about 2-fold higher in female PEF. This means that XIST and LOC102165544 are XCI-escaping genes. Among the XIC-linked genes, CHIC1, XIST, LOC102165544, and RLIM were stably expressed in embryonic stage, and XIST and LOC102165544 were up-regulated after morula formation. As XIST accumulation is a requisite for XCI initiation, expression levels of the 4 genes between male and female blastocysts were compared. Interestingly, expression levels of CHIC1 and RLIM were not different in male and female blastocysts. This means their dosage would be already compensated in porcine blastocyst. Additionally, to confirm loci of the 2 genes CHIC1 and RLIM harbor one of the inactive alleles in female blastocyst, the DNA methylation pattern was examined. One of the CHIC1 alleles was inactive but RLIM CpG site was hypo-methylated in female blastocyst. This would indicate that one of the RLIM alleles is transcriptionally inactivated by chromatin modification rather than by DNA methylation of the allele. Regulatory regions of XIST and LOC102165544 were demethylated in blastocyst and this showed XCI was not finished in porcine blastocyst. Conclusively, our results demonstrate the XCI already occurs in porcine blastocyst at least one gene but it is not completed. This work was supported by Next BioGreen21 program (PJ009493), Rural Development Administration, Republic of Korea.



96

141

EFFECT OF MOF GENE ON PREIMPLANTATION DEVELOPMENT OF PIG PARTHENOGENETIC EMBRYOS R. Wu, D. Song, Z. Cao, Y. Li, F. Fang, and Y. Zhang

College of Animal Science and Technology, Anhui Agricultural University, Hefei, Anhui Province, China The Mof gene (males absent on the first) is crucial to X-chromosome dosage compensation in the fly. It acts specifically to catalyse acetylation of histone H4 lysine 16 (H4K16ac) as one histone acetyltransferase of the MYST family, playing essential roles during mammalian development. However, little is known about Mof gene in pigs. The present study was designed to explore effects of Mof on pre-implantation development of pig parthenogenetic embryos obtained as reported by Cao et al. (2012 Zygote 20, 229–236). Immunofluorescent staining was performed to examine protein expression level of porcine Mof (pMof) and H4K16ac, and fluorescent intensity was measured by Image J software (NIH, Bethesda, MD, USA). Data are presented as mean standard error, and statistical analyses of the fluorescent intensity value, embryo development rate, and quality were performed using ANOVA with SPSS software (version 15.0, SPSS Inc., Chicago, IL, USA), and P-value ,0.05 was considered significant. First, the coding sequence (CDS) of the pMof gene was cloned and the spatio-temporal expression patterns of the CDS were determined in pig oocytes, early embryos, and other tissues. A 1471-bp-long cDNA of pMof was obtained with 99.34% and 98.25% amino acid sequence homology and 92.88% and 88.96% nucleotide sequence homology to the human and mouse MOF homologues. We observed that pMof is expressed predominantly in oocytes and early embryos but at low levels in sperm and other organs. We found that pMof decreased from pronuclear to 8-cell stages and remained low until the blastocyst stage based on RT-qPCR results (n ¼ 10 for each stage embryos). In contrast, pMof protein expression as examined by immunofluorescent staining (n ¼ 15 for each stage embryos) remained high throughout the pre-implantation development period. After porcine embryonic genome activation, pMOF remained detectable in 4-cell (n ¼ 10) and 8-cell (n ¼ 10) embryos despite amanitin treatment for 24 h. Thus, the mRNA level of MOF was not decreased after transcription inhibition suggesting that MOF is a maternal gene. To assess functional significance, we examined the expression of H4K16ac, a target of pMof, and found that the level of H4K16ac was constantly low from pronuclear to morula stage, but increased dramatically in blastocysts. When we knocked down pMOF by cytoplasmic injection of siRNA into porcine MII oocytes, rate and cell number of blastocysts declined significantly [blastocyst rate: uninjected (n ¼ 228) v. negative-siRNA (n ¼ 220) v. MOF-siRNA (n ¼ 230) ¼ 65.8 3.75% v. 57.5 4.30% v. 46.3 5.72%; cell numbers: uninjected v. negative-siRNA v. MOF-siRNA ¼ 84.73 5.25 v. 77 5.50 v. 55.08 6.56]. A marker for DNA double-strand breaks and repair, g-H2AX, increased in parallel to more apoptotic cells. Knockdown of MOF reduced H4K16ac. Overall, pMof is highly conserved among human, mouse, and pig; pMof is essential to pre-implantational development of pig parthenogenetic embryos involved in regulating H4K16ac. Research was supported by NSFC (31272442).

97

MAGNITUDE AND SPECIFICITY OF EFFECTS OF MATERNAL AND PATERNAL GENOMES ON THE FETO-PLACENTAL UNIT R. XiangA,B, C. A. S. EstrellaA,B, C. J. FitzsimmonsA,B, Z. A. KrukA,B, D. A. ThomsenA,B, D. L. RutleyA, K. L. KindA,B, C. T. RobertsB,C, and S. HiendlederA,B A

JS Davies Epigenetics and Genetics Group, School of Animal and Veterinary Sciences, The University of Adelaide, Roseworthy Campus, Roseworthy, South Australia, Australia; B Robinson Research Institute, The University of Adelaide, Adelaide, South Australia, Australia; C School of Paediatrics and Reproductive Health, The University of Adelaide, Adelaide, South Australia, Australia

The placenta, a major determinant of fetal growth in eutherians, facilitates maternal-fetal cross talk and mediates programming of postnatal phenotype via genetic and epigenetic mechanisms. However, magnitude and specificity of effects of maternal and paternal genomes on placental and fetal phenotype and their relationships are unclear. Using an outbred bovine intra-species model with well-defined Bos taurus taurus and Bos taurus indicus maternal and paternal genetics, we generated purebred and reciprocal cross fetuses (Animal Ethics No. S-094-2005) to dissect and quantify effects of parental genomes, fetal sex, and nongenetic maternal effects (maternal weight and post-conception maternal weight gain) on 41 gross and histomorphological feto-placental parameters. Analysis of data from 73 fetuses recovered at midgestation (Day 153) with general linear models (Xiang et al. 2014 JBMR http://dx.doi.org/10.1002/jbmr.2263) using the GLM procedure of R version 22.14 (R Development Core Team, Vienna, Austria) revealed that maternal and paternal genome combined explained the highest proportion of variation (47.2–99.5%) in 30 investigated parameters with significant (P , 0.05–0.0001) models. Fetal sex accounted for up to 32.2% (P , 0.05–0.0001) and nongenetic maternal effects for up to 25.1% (P , 0.05–0.001) of variation in 11 and 14 parameters, respectively. Partitioning of parental (epi)genome variation showed that the maternal genome predominantly contributed to variation in gross (80.3–95.7%; P , 0.05–0.0001) and histomorphological (51.5–82.1%; P , 0.05–0.0001) placental parameters, fetal weight (54.1%; P , 0.0001), and fetal organ weights (43.7–73.1%; P , 0.05–0.0001), whereas the paternal genome predominantly contributed to fetal fluids weight (73.0%; P , 0.001), umbilical cord weight (73.9%; P , 0.05) and length (73.2%; P , 0.01), and placental (69.6%; P , 0.05) and umbilical cord (83.2%; P , 0.0001) efficiency. Our finding that the maternal genome determined placental phenotype (i.e. nutrient source) and the paternal genome determined umbilical cord and fetal fluid phenotype (i.e. nutrient flow) is in line with predicted expression patterns of genomic imprinting effects by both maternal-offspring coadaptation (Wolf and Hager 2006 PLoS Biol. 4, e380) and conflict-of-interest (Moore and Haig 1991 Trends Genet 7, 45–49) hypotheses in the feto-placental unit. Furthermore, there were 4 maternal genome determined relationships between placental weights and umbilical cord phenotype (P , 0.05–0.0001) and 28 paternal genome and/or fetal sexdetermined relationships between fetus-, organ- and fetal fluid weights and umbilical cord phenotype (P , 0.05–0.0001). The finding of specific relationships between placenta and fetus merging in clusters differentiated by maternal and paternal genome effects suggests the existence of (epi) genetic-regulated morphological modules within the feto-placental unit. Funded by the JS Davies Bequest.

142

98



UTERINE INVOLUTION AND VASCULAR PERFUSION DURING EARLY POSTPARTUM IN MARES R. P. ArrudaA, K. M. LemesA, L. A. SilvaB, E. C. C. CeleghiniA, M. A. AlonsoA, G. PugliesiA, H. F. CarvalhoA, F. J. AffonsoA, D. F. SilvaA, and T. G. LeiteA A

Laboratory of Semen Biotechnology and Andrology, Department of Animal Reproduction, Faculty of Veterinary Medicine and Animal Science, University of Saõ Paulo, Saõ Paulo, Brazil; B Department of Veterinary Medicine, Faculty of Animal Sciences and Food Engineering, University of Saõ Paulo, Pirassununga, Saõ Paulo, Brazil

In horses, a rapid involution of the uterus occurs right after parturition, allowing the reestablishment of a favourable uterine environment for embryo development. However, limited evidence is found regarding the vascular events during puerperal period in mares. We aimed to evaluate the morphological (size of uterus and uterine fluid content) and haemodynamic (endometrial and mesometrial vascular perfusion) characteristics of the uterine involution process. Mares (n ¼ 10) were evaluated by transrectal ultrasonography from the first day postpartum (d1) to the sixteenth day after first ovulation (D0 ¼ ovulation). For ultrasound exams, a duplex B-mode and Doppler ultrasound instrument (M5 VET; Mindray Medical International Limited, China) equipped with a transrectal transducer was used. The previously pregnant (PH) and nonpregnant (NPH) horns were individually evaluated. Data were analysed for the main effects of horns (PH and NPH), day, and their interaction, using the PROC MIXED procedure of SAS software (9.3 version; SAS Institute Inc., Cary, NC, USA). Discrete variables were analysed by ANOVA. A reduction (P , 0.05) in the uterine diameter was observed during the first 7 days postpartum, but the rate of uterine involution (decrease in uterine size) decreased thereafter. The involution was complete around the d21 for the NPH and around d24 for the PH. Presence of uterine luminal fluid (mm) was increased between d1 (no fluid) and d2 (31.41 2.88) postpartum, followed by a decrease between d4 (30.43 4.52) and d7 (10.20 1.76). No fluid was observed after d16 postpartum or after the third day postovulation (D3). For endometrial and mesometrial vascular perfusion, only a day effect (P , 0.05) was observed. An increase in the endometrial and mesometrial vascularization was detected, respectively, between d1 and d4, and between d1 and d2. Vascular perfusion did not differ after d4 for endometrial tissue, whereas it was reduced (P , 0.05) between d2 and d10 for mesometrium. For the vascular perfusion after ovulation, an increase (P , 0.05) from D0 to D5, followed by a decrease (P , 0.05) between D5 and D11 and an increase (P , 0.05) between D11 and D14 was observed in the endometrial and mesometrial tissues. The profile of the vascular perfusion in endometrium and mesometrium after first ovulation postpartum is similar to that observed during oestrous cycles and early pregnancy, indicating a return of the uterus to the prepregnant uterine characteristics in mares. Research was supported by FAPESP process no. 2010/10692-9 and CNPq process no. 135954/2011-8.

99

GLUCOCORTICOID RECEPTORS ARE EXPRESSED IN OVARIES OF NEWBORN AND ADULT FEMALE HORSES D. ScarletA, I. WalterB, and C. AurichA A

Centre for Artificial Insemination and Embryo Transfer, Vetmeduni Vienna, Austria; B Institute of Anatomy, Histology and Embryology, Vetmeduni Vienna, Austria

In contrast to other domestic animal species, in vitro maturation (IVM) of oocytes in the horse is still not successful. Oocytes for IVM are obtained either from slaughterhouse ovaries or via ovum pick-up from living mares. Both situations may be associated with a stress-induced glucocorticoid release. So far, neither an involvement of glucocorticoids in follicle and oocyte maturation nor the presence of glucocorticoid receptors (GCR) in ovarian tissue has been investigated in the horse. We hypothesised that GCR are expressed in equine ovarian tissue independent of the animal’s age and stage of the oestrous cycle. Ovaries (n ¼ 40) were collected from killed newborn female foals (n ¼ 10) and killed or slaughtered adult mares (n ¼ 10). For assessment of GCR mRNA expression, ovarian samples were fixed in Tissue-Tek O.C.T. Compound (Sakura Finetek, Zoeterwoude, the Netherlands) and stored at 808C. Various cell populations were isolated using laser capture microdissection on cryosections. After RNA extraction, samples were analysed by qualitative RT-PCR and real time-PCR. For analysis of GCR protein, tissue was fixed in Bouin’s solution and histological slides immunostained using a monoclonal antibody for GCR (Ab2768, Abcam, Cambridge, UK), followed by visualisation with diaminobenzidine. One tertiary follicle per slide (40; light microscopy) was analysed and percentages of cells staining positive for GCR calculated. Statistical analysis was done with the SPSS Statistics 21 software (SPSS Inc., Chicago, IL, USA). Expression of mRNA for GCR was detected in oocytes, cumulus cells, granulosa, and theca cells, independent of age and stage of the oestrous cycle. In both neonates and adults, nuclei of the oocytes and cumulus cells stained positive for GCR regardless of stage of folliculogenesis. Also, GCR were constantly expressed in granulosa cells from both preantral and antral follicles. Percentage of granulosa cells staining positive for GCR (adult: 73.6 3.2, fillies: 72.4 1.9%) was higher (P , 0.001) than of theca cells (adult: 56.8 3.9, fillies: 57.2 1.9%), but not affected by age. GCR were lacking in ovarian stroma of adults but not of neonates. In periovulatory follicles from adult mares, GCR were abundant in developing luteal cells. GCR were also detected in the nuclei of luteal cells in corpora haemorrhagica and corpora lutea. Follicular atresia was associated with a decrease of GCR independent of cell type and age. This study describes for the first time the expression of GCR in horse ovaries, which are present independent of age of the animal, stage of folliculogenesis, and oestrous cycle stage. Results suggest that glucocorticoids are involved in follicular and oocyte maturation, ovulation, and luteal function in the horse. Presence of GCR in the ovaries of newborn horses suggests a role of glucocorticoids in ovarian tissue maturation. Nevertheless, detrimental effects of excess glucocorticoid secretion due to stress on follicular development, oocyte maturation, and luteal function cannot be excluded in the mare.

Early Pregnancy


143

Early Pregnancy 100

EMBRYO SURVIVAL AND CONCEPTUS ELONGATION FOLLOWING ASYNCHRONOUS EMBRYO TRANSFER IN CATTLE F. Randi, B. Fernandez, M. McDonald, C. Johnson, N. Forde, and P. Lonergan University College Dublin, Dublin, Ireland

Maternal progesterone (P4) regulates early conceptus growth and development in ruminants. Early embryo transfer studies in sheep and cattle demonstrated a need for close synchrony between the embryo and the uterine environment of the recipient. However, manipulating P4 may be one way of strategically regulating the temporal changes that normally occur in the uterine environment in order to allow flexibility in the timing of embryo transfer. For example, previous studies have demonstrated that P4 administration during the first few days of the oestrous cycle facilitates pregnancy establishment with older embryos. The aim of this study was to examine the effect of embryo-uterine synchrony on conceptus elongation in cattle. Oestrous cycles of crossbred beef heifers were synchronised using an 8-day P4-Releasing Intravaginal Device (PRID DeltaÒ, CEVA, Mountain View, CA, USA) with administration of a prostaglandin F2a analogue (EnzaprostÒ, CEVA; 5 mL equivalent to 25 mg of dinoprost) given on the day before PRID removal. Heifers were checked for signs of oestrus 4 times per day commencing 30 h after PRID withdrawal. Only those seen in standing oestrus (n ¼ 50) were randomly assigned to 1 of 5 treatment groups to receive Day 7 in vitro-produced blastocysts (n ¼ 10 per recipient) (1) on Day 5 post-oestrus; (2) on Day 5, with P4 supplementation via PRID from Day 3 to 5 þ 750 IU of eCG at PRID insertion; (3) on Day 5, PRID Delta from Day 3 to 5 plus 3000 IU of hCG at PRID insertion; (4) on Day 7, or (5) on Day 9. At embryo age Day 14, all heifers were slaughtered and the uterus was flushed to recover and measure conceptuses. Data are summarised in Table 1. Fewer recipients yielded conceptuses (P , 0.05) and fewer conceptuses overall were recovered (P , 0.05) following transfer on Day 5 compared with Day 7 or Day 9. Supplementation with P4 resulted in short cycles (evidenced by corpus luteum regression and/or a recent ovulation at slaughter) in 33.3 to 54.5% of recipients receiving embryos on Day 5. Mean conceptus length was greater (P , 0.05) following transfer to an advanced uterus. In conclusion, transfer of embryos to a retarded (Day 5) uterine environment results in poor embryo survival. Supplementation with P4 shortened the interoestrous period in a significant number of heifers. Transfer to an advanced uterine environment promotes conceptus elongation, presumably driven by P4. Table 1. Embryo survival and conceptus length data Treatment

Day 5

Day 5 P4/eCG

Day 5 P4/hCG

Day 7

Day 9

No. of recipients No. (%) of recipients yielding conceptuses No. (%) of conceptuses recovered No. (%) of short cycles Mean ( s.e.) conceptus length (mm)

12 7 (58.3) 24 (20.0) 1 (8.3) 0.56 0.06

11 4 (36.4) 12 (10.9) 6 (54.5) 1.7 0.34

10 5 (50.0) 20 (20.0) 3 (33.3) 1.5 0.26

10 9 (90.0) 51 (51.0) 1 (10.0) 3.2 0.45

11 11 (100.0) 54 (49.1) 0 (0.0) 21.8 2.38

101

SUPPLEMENTATION WITH SUNFLOWER SEED ALTERS THE ENDOMETRIAL LIPID COMPOSITION IN BEEF COWS

C. M. B. MembriveA,B, M. B. CordeiroB, D. PazzaneseC, G. PugliesiD, M. F. Sa´ FilhoD, and M. BinelliD A

Saõ Paulo State University, Dracena, Saõ Paulo, Brazil; Saõ Paulo State University, Araçatuba, Saõ Paulo, Brazil; C University of Saõ Paulo, Piracicaba, Saõ Paulo, Brazil; D University of Saõ Paulo, Pirassununga, Saõ Paulo, Brazil

B

Embryo death between 15 and 19 days of pregnancy is caused by the increase in the release of endometrial prostaglandin F2a (PGF2a) involved in the luteolysis process in cattle. Compounds rich in linoleic acid, such as sunflower seeds, provide lipid changes in the endometrium, and may be involved in the ability of PGF2a biosynthesis. Previous studies observed that the conception rate increased in Nelore cows supplemented with sunflower seed for 22 days from the timed AI (66.7% v. 46.3%; Peres et al. 2008, Acta Sci. Vet. 36, 639) and in crossbred heifers submitted to timed embryo transfer (55.66% v. 36.94%; Membrive et al. 2013 Acta Sci. Vet. 36, 603). We aimed to test the hypothesis that supplementation with sunflower seed promotes endometrial changes in lipid composition. Thus, we compared the composition of fatty acids in endometrial tissue in cows supplemented or not with sunflower seed. Nelore (n ¼ 30) cows received an intravaginal device containing progesterone (1 g; DIB, Syntex Biochemistry & Pharmaceutical Industries SA, Buenos Aires, Argentina) associated with an im injection of oestradiol benzoate (2 mg; Benzoate HC, Hertape Calier Animal Health SA, Juatuba, MG, Brazil). The devices were removed after 8 days, when cows were treated im with cloprostenol sodium (2 mg; SincrocioÒ, Ourofino Animal Health Ltd., Cravinhos, SP, Brazil), oestradiol cypionate (0.5 mg; ECPÒ, Zoetis Ltda., Saõ Paulo, Brazil) and eCG (300 IU; FolligonÒ, Intervet Veterinary Ltda., Cotia, Brazil). Two days after removal of the device, females were assigned into 6 groups to receive 1.7 kg/animal/day of 40% soybean meal, 44% crude protein (CP) þ 60% sunflower seed for 6 (n ¼ 4), 14 (n ¼ 5) and 22 days (n ¼ 6), or 53% soybean meal, 44% CP þ 47% corn for 6 (n ¼ 4), 14 (n ¼ 5) and 22 days (n ¼ 6). Both diets were formulated with 72% total digestible nutrients and 24% CP. Females were slaughtered 24 h after the end of supplementation and endometrial tissue was isolated and stored at 1968C. The fatty acids in endometrial tissue were

144


Early Pregnancy

assessed by gas chromatography. Data were analysed by SAS Proc GLIMMIX (SAS Institute Inc., Cary, NC, USA). The fatty acid profile (54 compounds) was analysed and 43 fatty acids were present in the endometrial tissue. The lacking fatty acids in endometrial tissue were C4:0, C11:0, C12:1, C: 13:0, C13:0 iso, C13:0 anteiso, C14:0 iso, C15:1, C18:1 trans-16, C18:2 cis-12, trans-10, and C21:0. The fatty acids that showed a higher percentage compared with the Control group were C18:1 trans-10-trans-11-trans-12 and C10:1. The fatty acids that showed low percentage compared with the Control group were C15:0 iso, C20:5, C20:3n-3, C23:0, C24:0, and C22:5. In conclusion, supplementation with sunflower seed promotes changes in the endometrial lipid profile that may reduce the pregnancy loss in beef cows. Research supported by FAPESP, FUNDUNESP, and Santa Encarnaçaõ Farm.

102 SUPPLEMENTATION WITH ESTRADIOL CYPIONATE AT THE ONSET OF A SYNCHRONIZED PROESTRUS ALTERS THE UTERINE GENE EXPRESSION OF SUCKLED ANESTROUS BEEF COWS M. F. Sa´ FilhoA, G. PugliesiA, A. M. Gonella-DiazaA, M. SponchiadoA, M. F. MendanhaA, R. S. RamosA, S. C. S. AndradeB, G. GasperinB, M. D. GoissisA, F. S. MesquitaA,C, L. L. CoutinhoB, P. S. BaruselliA, and M. BinelliA A

Departament of Animal Reproduction, FMVZ-USP, University of Sao Paulo, Sao Paulo, SP, Brazil; B Laborato´rio de Biotecnologia, Depto. de Zootecnia. ESALQ-USP, Piracicaba, SP, Brazil; C Universidade Federal do Pampa, Curso de Medicina Veterina´ria, Uruguaiana, RS, Brazil

The present study evaluated the effect of oestradiol cypionate (ECP) supplementation at the onset of a proestrus [i.e. at progesterone (P4) device removal of the synchronization of ovulation protocol] on the global endometrial gene expression of suckled anestrous beef cows. A total of 12 suckled cows presenting absence of corpus luteum detected by ultrasound received 2 mg of oestradiol benzoate IM and an intravaginal P4 device. Eight days later, P4 devices were removed, and the cows received 500 mg of sodium cloprostenol IM. Cows were blocked according to body condition score and diameter of largest follicle (LF) at P4 device removal and were randomly assigned to receive an IM treatment with 1 mg of ECP (ECP, n ¼ 6) or not (CON, n ¼ 6) at the P4 device removal. All cows received 10 mg of buserelin acetate 48 h after P4 device removal and were timed AI immediately after. Cows presenting a new corpus luteum formed 6 days after the gonadotropin-releasing hormone treatment had an endometrial fragment collected by transcervical biopsy. RNA-Seq analysis was performed and the transcriptome profile was obtained. The significance of differential gene expression was assessed with the package DESEqn 2 v.1.2.10 and the differential expression estimation was based on the GLM followed by the Wald test. The significance threshold was established as an FDR- Benjamini-Hochberg-adjusted P-value of ,0.1. The integrated analysis was performed using DAVID database. In total, 135 transcripts were differentially expressed between ECP and CON groups, of which 73 genes were up-regulated by ECP supplementation and 62 genes were up-regulated in the CON cows. Two pathways were overrepresented by the ECP-induced transcripts: pathways in cancer (n ¼ 5 genes) and small cell lung cancer (n ¼ 3 genes). On the other hand, ECP-inhibited transcripts indicated the enrichment of 3 pathways: Parkinson’s disease (n ¼ 3 genes), oxidative phosphorylation (n ¼ 3 genes), and Alzheimer’s disease (n ¼ 3 genes). More specifically, ECP-induced transcripts associated with pathways in cancer [gene symbol (fold change); respectively] were LAMC3 (1.55), PTCH1 (1.51), PTCH2 (1.52), PIK3R3 (1.22), and PIAS1 (1.18), whereas ECP-inhibited transcripts associated with oxidative phosphorylation were ATP5F1 (1.18), ATP5J (1.24), and NDUFB3 (1.37). Therefore, ECP supplementation at onset of the synchronized proestrous slightly alters the uterine transcriptome. The enriched pathways affected by the ECP supplementation described in this work need to be studied more but these results show candidate pathways that can be associated with uterine environment and receptivity and with possible regulation by oestradiol supplementation given at the onset of the proestrous.

103

CIRCULATING MICRORNAS FOR EARLY DIAGNOSIS OF BOVINE PREGNANCY J. IoannidisA, C. AshworthA, R. RaueB, and X. DonadeuA A

The Roslin Institute, Edinburgh, Midlothian, United Kingdom; B Zoetis Research and Development, Brussels, Belgium

Early diagnosis of pregnancy can shorten calving intervals, improve annual milk production and increase overall profits from modern dairy herds. At present, accurate diagnosis is only possible after the third week of pregnancy. Circulating microRNAs (miRNAs) have been proposed as diagnostic biomarkers for numerous human conditions such as cancer and diabetes. Moreover, distinct circulating miRNA profiles have been associated with different stages of human pregnancy. The objective of this study was to determine whether differential miRNA profiles occur in circulation during early pregnancy (Day 24 or earlier) in cattle that could be used for diagnostic purposes. Holstein-cross heifers were oestrous-synchronised and artificially inseminated (AI, n ¼ 11) or sham-inseminated (control, n ¼ 8) at first detected oestrus. Plasma samples were collected on Days 0, 8, 16 and 24 after insemination. Circulating miRNA levels were independently determined in pooled plasma samples (n ¼ 3 pools for each of pregnant Day 24 and nonpregnant Days 0, 8, and 16) using Qiagen qPCR arrays (Qiagen, Valencia, CA, USA) and in individual samples (n ¼ 11 samples for each pregnant Days 16 and 24, and 8 samples for each of nonpregnant Days 0, 8, and 16, respectively) using Illumina miRNA sequencing. The qPCR array data were analysed using the DDCq method. The miRNA sequencing data were normalised using EdgeR. Differential expression between pregnant and nonpregnant groups was determined using 2-sample t-tests with false discovery rate (FDR) adjustment. Differences in miRNA expression were validated by RT-qPCR. Out of a total of 191 miRNAs analysed in pooled samples using qPCR arrays, 8 were differentially expressed (,3-fold, FDR ,0.1) in Day 24 pregnant heifers relative to nonpregnant heifers (Days 0, 8, and 16 combined). No miRNAs were differentially expressed (FDR .0.1) between nonpregnant time-points. Changes in levels of 11 miRNAs were validated by RT-qPCR in individual plasma samples; although expression trends for these miRNAs were the same as in pooled samples, none of the changes in individual samples were significant after FDR adjustment (P . 0.1). Deep sequencing (96 million miRNA reads) identified 231 miRNAs in bovine plasma. There were no significant differences

Early Pregnancy


145

(FDR .0.1) in the expression of any miRNAs between pregnant heifers (Days 16 or 24) and nonpregnant (Days 0, 8, and 16 individually or combined). In addition, no significant differences were identified among nonpregnant time-points. In summary, we successfully performed miRNA profiling of bovine plasma using both deep sequencing and qPCR; however, we did not detect differences in miRNA expression between early pregnant (Day 16 or 24) and nonpregnant heifers. Changes in circulating miRNA levels may involve low abundance miRNAs that cannot be accurately quantified using current technology. Alternatively, changes in circulating miRNA levels may only occur later during pregnancy in cattle.

104

EXPRESSION OF ACTIVIN A AS A LOCAL REGULATOR IN THE BOVINE OVIDUCT Y. Yamamoto, Y. Kobayashi, Y. Yoshimoto, and K. Okuda Okayama University, Okayama, Japan

Activin (ACV) is known as a local regulator of several reproductive functions including follicular development and implantation in mammals. ACVA is a glycopeptide belonging to the transforming growth factor b superfamily, and is a homodimer of inhibin ßA (INHBA) subunits. Follistatin (FST), an ACV-specific binding protein, inhibits ligand-receptor binding. ACV receptor (ACVR) is a hetero-tetramer consisting of 2 kinds of protein, ACVR1 or ACVR1B and ACVR2A or ACVR2B. The oviduct provides an optimal environment for sperm capacitation, fertilization, and early embryonic development. Previous reports have demonstrated that ACVRs were expressed in bovine oocytes and embryos, and that early embryonic development is facilitated by ACVA in vitro. ACVA produced by the bovine oviduct may affect gametes and embryos as well as oviductal cells as a local regulator in cow. Bovine oviductal samples were classified into 6 stages of the oestrous cycle (day of ovulation; Days 2–3 after ovulation; Days 5–6; Days 8–12; Days 15–17; Days 19–21). We examined (1) protein expression of ACVA and FST in oviductal fluid collected from the ampulla and isthmus, (2) mRNA expression of INHBA and FST in the ampullary and isthmic oviductal tissues during the oestrous cycle, (3) the effects of oestradiol-17b (E2: 0.1, 1, 10 nM) and progesterone (P4: 1, 10, 100 nM) on mRNA expressions of INHBA and FST in cultured oviductal epithelial cells isolated from the ampulla and isthmus, and (4) mRNA expression of ACVRs in tissues and in cultured epithelial and stromal cells. The main findings were as follows: (1) Both ACVA and FST were detected throughout the oestrous cycle in the oviductal fluid of the ampulla and isthmus. (2) INHBA expression was higher in the isthmus than in the ampulla. FST expression in the ampulla was lowest at peri-ovulation, INHBA expression in the isthmus was highest on the day of ovulation and FST in the isthmus during Days 2–6 was highest. Because an increase of ACVA production and a decrease of FST production raise ACVA bioactivity, ACVA seems to be most active at peri-ovulation in both the ampulla and isthmus. (3) In the cultured isthmic oviductal epithelial cells, 10 nM E2 significantly stimulated INHBA expression, but tended to suppress FST expression. Therefore, the bioactivity of ACVA seems to be controlled by E2 during the oestrous cycle in the isthmus. (4) The expression of ACVR1B and ACVR2A was clearly detected in the tissues as well as in cultured epithelial and stromal cells. The overall findings suggest that ACVA secreted into oviductal fluid plays an important role in oviductal functions, including fertilization in the ampulla and sperm motility and viability in the isthmus. It is also suggested that ACVA acts on both epithelial and stromal cells as a local regulator of cellular functions, such as cellular proliferation and secretion in the cow.

105

EFFECT OF LYSOPHOSPHATIDIC ACID ON PROSTAGLANDIN PRODUCTION IN THE BOVINE OVIDUCT

Y. YoshimotoA, Y. YamamotoA, Y. KobayashiA, I. Woclawek-PotockaB, E. SinderewiczB, and K. OkudaA B

A Laboratory of Reproductive Physiology, Graduate School of Environmental and Life Science, Okayama University, Okayama, Japan; Department of Reproductive Immunology and Pathology, Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, Olsztyn, Poland

The oviduct is an essential organ for successful pregnancy in mammals. The transport of gametes and early embryos is mainly induced by contraction and relaxation of smooth muscle. The contraction and relaxation of bovine oviductal smooth muscle are induced by prostaglandin (PG) F2a and PGE2, respectively. Lysophosphatidic acid (LPA), a type of phospholipid, is involved in various physiological actions such as promoting inflammation and cellular proliferation in various organs. LPA acts through at least 6 G protein-coupled receptors. Both LPA and LPA receptors are expressed in endometrium and, moreover, LPA affects PG production by the endometrium in cow. Based on the above findings, we hypothesised that LPA is locally involved in PG production by oviductal cells to promote motility of oviductal smooth muscle in cow. Oviductal samples ipsilateral to a corpus luteum or a dominant follicle at peri-ovulation (0–6 and 19–21 days after ovulation) were collected in abattoir. Messenger RNA expression of LPA receptors (LPAR1–6) and LPA-producing enzymes (ATX, PLA1a, PLA1b) was examined in ampullary and isthmic tissues. Expression in cultured epithelial and stromal cells isolated from the bovine oviduct were also examined to determine the cells possessing LPA receptors and LPA-producing enzymes. In addition, the effect of LPA (0.1, 1, 10 mM) on the expression of cyclooxygenase (COX )-1 and COX-2 (PG-synthesising enzymes) and on PGE2 and PGF2a production by cultured epithelial and stromal cells was investigated. The significant differences (P , 0.05) were determined by Student’s t-test for 2 groups, and by one-way ANOVA followed by Tukey’s multiple comparison test for more than 3 groups. LPAR1–6, ATX, PLA1a, and PLA1b were expressed in both ampullary and isthmic tissues as well as in both cultured epithelial and stromal cells. The expression of LPAR1–3 was significantly lower in the isthmic tissues than in the ampullary tissues, whereas the expression of LPAR4–6 was significantly higher in the isthmic tissues than in the ampullary tissues. The expression of COX-2 was significantly stimulated by 10 mM LPA in cultured isthmic stromal cells. In addition, LPA significantly stimulated both PGE2 and PGF2a production by cultured isthmic stromal cells. In the isthmus of the oviduct, LPA produced by epithelial and stromal cells may stimulate the expression of COX-2 in the stromal cells, followed by increased PG production. Because the mRNA expression of LPAR4–6 is higher in the isthmus than in the ampulla, those effects of LPA might be mediated by activation of LPAR4–6. The overall findings suggest that LPA is one of the regulating factors for transport of gametes and early embryos by controlling the motility of smooth muscle in the bovine oviduct.

146


106

Early Pregnancy

THE RECEPTIVE BEEF COW ENDOMETRIUM: POTENTIAL KEY FEATURES FAVOURING THE COMMUNICATION BETWEEN EMBRYONIC AND MATERNAL TISSUES

V. Van HoeckA, M. R. FrançaA, G. GonellaA, A. LangbeenB, G. PugliesiA, and M. BinelliA A

B

Saõ Paulo University, Saõ Paulo, SP, Brazil; University of Antwerp, Wilrijk, Antwerp, Belgium

A receptive state of the endometrium is crucial for proper communication with the pre-implantation embryo and, thereby, a perquisite for a successful pregnancy. Both reduction of transmembrane mucin and initiation of apoptotic events have been proposed as key features prompting embryo/endometrial cell interaction and facilitating maternal receptivity of the murine and human embryo. In beef cows, however, the signature for receptivity needs to be elucidated. Therefore, we aimed to characterise ‘‘receptive’’ versus ‘‘refractory’’ endometrial tissues with the focus on (1) transcription profiles related to mucin, apoptosis and proliferative pathways, and 2) phenotypic features; that is, epithelial transmembrane mucin and apoptotic cell rates (ACR). Using a bovine model, preovulatory follicle growth was manipulated to produce 2 groups: cows with larger preovulatory follicle, longer proestrus, and higher receptivity (LF-LCL) versus cows with smaller preovulatory follicle, shorter proestrus, and lower receptivity (SF-SCL). Seven days post-induced ovulation, endometrium was collected. Transcriptome profiles of endometrial tissue (n ¼ 3/group) were determined using Illumina RNA sequencing analyses. In addition, paraffin embedded endometrial samples (n ¼ 6/group) were stained with Alcian Blue for semiquantitative analyses of mucin staining intensity and treated with antibodies against activated Casp3 to determine ACR. RNA-seq data showed that cell surface MUC1 gene expression was drastically reduced (fold-change 3.33) in LF-LCL tissue (P , 0.05). In contrast, the LF-LCL endometrial tissue displayed an up-regulated expression of genes involved in apoptosis pathways, such as Casp9, CRADD, DAPL1 (fold-change 1.80, 2.10, and 3.60, respectively; P , 0.05). Moreover, the expression of genes related to proliferation, such as MYC and NOV, was significantly down-regulated in LF-LCL endometrial tissue (fold-change 2.2 and 6.3, respectively; P , 0.01). Histology of endometrial samples revealed that the signal for transmembrane, anti-adhesive, mucin at the LF-LCL epithelium was consistently low, whereas the SF-SCL tissue group displayed variable amounts of transmembrane mucin at the apical epithelial boarder. Immunohistochemistry showed that gland cells from LF-LCL endometrial tissue displayed a significantly higher ACR compared with gland cells of the SF-SCL tissue (29.6 1.52% v. 11.9 1.26%; P , 0.05). In the surface epithelium and the stromal tissue, Casp3 positive cells were rare and ACR was similar between groups. In conclusion, a down-regulated expression of the transmembrane mucin might indicate a receptive condition of the endometrium. Furthermore, the prominent apoptotic characteristics in the LF-LCL tissue suggest that the receptive endometrium must surpass the proliferative status in order to differentiate to more specialised functions, such as embryotrophy.

107

PRODUCTION OF EPIDERMAL GROWTH FACTOR BY BOVINE ENDOMETRIAL CELLS AND ITS EFFECTS ON EMBRYONIC INTERFERONT AND PROSTAGLANDIN T. J. AcostaA,B and K. TakatsuA A

Okayama University, Okayama, Japan; B Obihiro University, Obihiro, Japan

A dynamic interaction between bioactive products of the embryo (blastocyst) and the endometrium is crucial for the successful establishment of pregnancy. In ruminants, the principal signal for maternal recognition of pregnancy is interferon-t (IFNT) secreted by the trophoectoderm between Days 8 and 20 post-fertilization. Epidermal growth factor (EGF) produced by the endometrium acting through EGF receptors (EGFR) present in the blastocyst seems to regulate embryonic production of IFNT. Epidermal growth factor and IFNT have been shown to play crucial roles in controlling luteolytic prostaglandin (PG) F2a (PGF) and luteotropic PGE2 production by bovine endometrium. However, it is unknown how these bioactive molecules regulate uterine function during maternal recognition of pregnancy. To clarify the main source of EGF in bovine endometrium and the mechanisms regulating the interaction between the hatched blastocyst and maternal uterine environment, the production of EGF by cultured endometrial epithelial and stromal cells and the effects of EGF on embryonic IFNT and PG were investigated. In addition, the effects of EGF on PGE2 and PGF production by cultured epithelial or stromal cells were examined. Endometrial epithelial and stromal cells were enzymatically isolated on the day of ovulation, seeded at a density of 100 000 viable cells mL1, and cultured at 388C in a humidified atmosphere of 5% CO2 in air. After the cells reached 90% confluence, they were cultured in the presence or absence of EGF (0.1, 1.0, 10, and 100 ng mL1) for 24 h. Cells cultured in the absence of EGF and their cultured media were collected separately for protein analysis. Hatched bovine blastocysts (Days 8–10) were also cultured and exposed to EGF (1, 10, and 100 ng mL1) for 24 h. Protein concentrations of EGF and IFNT in the cultured media were determined by commercial enzyme immunoassay kit. Hormonal concentrations were analysed by ANOVA followed by Fisher’s protected least-significant difference procedure (PLSD) as a multiple comparison test by StatView (Abacus Concepts Inc., Berkeley, CA, USA). The concentration of EGF in the culture media of epithelial cells cultured in the absence of EGF was significantly (P , 0.05) higher than in the cultured media of endometrial stromal cells. Epidermal growth factor (10 and 100 ng mL1) increased embryonic production of IFNT and luteotropic PGE2 production but not luteolytic PGF by hatched blastocyst. EGF (100 ng mL1) increased both PGE2 and PGF production (P , 0.05) by cultured endometrial epithelial and stromal cells. The overall results suggest that endometrial epithelial cells rather than stromal cells are the main source of EGF. Epidermal growth factor produced by epithelial cells stimulates the production of IFNT by bovine trophoblasts. The capacity of conceptus to increase IFNT and luteotropic PGE2 production rather than luteolytic PGF in response to EGF stimulation may be essential for the establishment of pregnancy in cattle.

Early Pregnancy


108

147

CHARACTERIZATION OF BOVINE OVIDUCTAL EXOSOMES FROM IN VIVO AND IN VITRO ORIGIN

C. AlminãnaA, E. CorbinA, G. TsikisA, C. SoleilhavoupA, L. GalioB, O. SandraB, and P. MermillodA A

INRA, UMR7247 Physiologie de la Reproduction et Comportements, Nouzilly, France; INRA, UMR1198 Biologie du De´veloppement et Reproduction, Jouy-en-Josas, France

B

Successful pregnancy requires an appropriate communication between the mother and the embryo(s). Recent studies indicate that exosomes, small (30–200 nm) membrane vesicles of endocytotic origin, could act as intercellular vehicles in this unique communication system. Exosomes have been identified in vivo in all body fluids including follicular, uterine, and oviductal fluids and can be secreted by most cell types in vitro. Bovine oviductal epithelial cells (BOEC) have been thoroughly used to study embryo-maternal communication and to improve embryo development in vitro. Hence, our objective was to provide a morphologic and proteomic characterisation of exosomes secreted by BOEC in vivo in the oviductal fluid and in vitro in the conditioned media. Oviducts from cows were flushed to recover in vivo exosomes and then BOEC were scraped in order to derive primary cultures. In vitro exosomes were collected from conditioned media of BOEC primary cultures after reaching confluence (10 days). Isolation of exosomes from in vivo and in vitro origin was performed by ultracentrifugation. The presence of exosomes was confirmed in oviductal flushings and conditioned media by electron microscopy. Further characterisation of exosomes was carried out based on morphology (transmission electron microscopy), size (dynamic light scattering, DLS), and protein composition (protein profile analysis by SDS-PAGE and Western immunoblotting). Preliminary results by DLS revealed different size distribution profiles in exosome samples (in vivo: mean size of 93.41 nm; in vitro: 433.5 nm). Because exosomes are considered as ‘‘micromaps’’ of the originating cells, protein patterns expressed by in vivo exosomes and in vitro exosomes were compared with scraped and cultured BOEC, respectively. Protein profile analysis by SDS-PAGE showed quantitative and qualitative differences among the exosome samples, their cells of origin, and the milieu (conditioned media or flushing). Exosome-specific protein bands were detected and will be further characterised. In addition, exosomes from in vivo and in vitro origin exhibited distinct proteomic profiles. Western blot analysis demonstrated that (1) both exosomal protein samples were positive for HSP70, a known exosomal protein, and negative for Grp78, an endoplasmic reticulum marker detected in BOEC; (2) in vivo exosomes expressed oviductal glycoprotein (OVGP), heat shock protein A8 (HSPA8), and myosin 9 (MYH9), 3 oviductal proteins with known roles in fertilization and early pregnancy. However, only HSPA8 and MYH9 were detected in in vitro exosomes. Our results provide the first extensive characterisation of oviductal exosomes from in vivo and in vitro origin, an essential step in furthering our understanding of the early embryo-maternal cross talk.

109

EXPRESSION OF GENES RELATED TO ENDOMETRIAL RECEPTIVITY IN EQUINE ENDOMETRIUM DURING THE ESTROUS CYCLE AND EARLY PREGNANCY M. HititA, A. GuzelogluA, C. OzelA, M. O. AtliB, E. KurarC, and S. A. KayisA A Selcuk University, Konya, Turkey; Dicle University, Diyarbakir, Turkey; C NEU, Konya, Turkey

B

A set of genes that display differential expression levels in the reproductive tract could serve as beneficial markers of endometrial receptivity. SERPINA14 is present in the uterus during pregnancy and suppresses lymphocyte accumulation. Osteopontin is the ligand of integrin b3 and enables trophoblast communication during implantation. Leukemia inhibitory factor (LIF) is involved in inflammatory cell signalling and contributes to implantation by regulating immune cells. The objective was to assess the expression of SERPINA14, osteopontin, and LIF mRNAs in the equine endometrium during the oestrous cycle and early pregnancy. Biopsies were obtained from mares on day of ovulation (d 0, n ¼ 4), late diestrus (LD, n ¼ 4, high progesterone [P4]), and after luteolysis at the beginning of oestrus phase (AL, n ¼ 4, ,1 ng mL1 P4) of the cycle. Biopsies were also taken on days 14 (P14, n ¼ 4), 18 (P18, n ¼ 4), and 22 (P22; n ¼ 4) of pregnancy. Relative mRNA expression levels of genes were quantified using real-time quantitative RT-qPCR in duplicate. Data were analysed using one-way ANOVA, and l.s.d. test was applied. Both the oestrous cycle and early pregnancy increased SERPINA14 mRNA levels compared to d0. Expression of LIF mRNA was not significantly regulated except for a decline at AL. Expression of osteopontin mRNA was up-regulated during the oestrous cycle at LD while early pregnancy inhibited this up-regulation. The results suggest that the genes studied related to endometrial receptivity are strictly regulated accordingly to the stage of oestrous cycle, probably by circulating ovarian steroids, specifically progesterone, and pregnancy-associated factors are also involved in this regulation. This project was partially funded by TUBITAK 107O035 to AG and DUBAP 14VF12 to MOA. MH was supported by OYP 2013-090.

110

BARLEY SUPPLEMENTATION AT MID-GESTATION IN BROODMARES DOES NOT AFFECT FETAL DEVELOPMENT AND IS ACCOMPANIED BY MINIMAL PLACENTAL ADAPTATIONS M. RoblesA, P. PeugnetA, C. DuboisB, L. WimelB, A. TarradeA, and P. Chavatte-PalmerA A

INRA, UMR 1198 Biologie du De´veloppement et Reproduction, Jouy en Josas, France; B IFCE, Chamberet, France

Modifications of maternal environment could alter fetal growth and development through the placenta and thus health in adulthood. The developmental origins of health and disease suggest that maternal nutrition during pregnancy may affect offspring development and subsequent energy metabolism. To understand the effect of common feeding practices during gestation, 24 saddlebred mares were allocated to 1 of 2

148


Early Pregnancy

groups: group B was supplemented twice a day with barley (B) and group F was fed only with fodder (F) between month 7 of gestation and foaling. B mares maintained an optimal body condition score through gestation, with an increase in glycaemia and insulinemia after each meal and insulin resistance in month 9 of gestation. F mares lost condition as assessed by body condition score in the last part of gestation, leading to a moderate undernutrition and a transitional increase in nonesterified fatty acid plasma concentrations. Diets had no effect on feto-placental biometry or on placental structure. In contrast, an increase in microcotyledonary vessel volume was observed in F placentas, indicating placental adaptation, possibly to increase fetomaternal exchanges. There was no overall difference in the expression of genes involved in vascularization, nutrient transfer, growth, and development between placentas from B and F mares. Nevertheless, as seen in other species, sex-specific effects of maternal nutrition were observed in placentas from female foals, with differences in the expression of endogline, kinase insert domain receptor, insulin-like growth factor 2 and insulin-like growth factor 1 receptor genes. This study demonstrates that breeding practices such as supplementation in concentrate at midgestation do not seem to affect fetal development. More work is ongoing to evaluate postnatal health.

111

EXPRESSION OF PHOSPHOLIPASE A2 ISOFORMS IN EQUINE ENDOMETRIUM DURING THE ESTROUS CYCLE AND EARLY PREGNANCY C. OzelA, A. GuzelogluA, M. HititA, M. O. AtliB, E. KurarC, and S. A. KayisA A

B

Selcuk University, Konya, Turkey; Dicle University, Diyarbakir, Turkey; C NEU, Konya, Turkey

Phospholipase A2 (PLA2) is involved in the synthesis of prostaglandins (PG) as it releases arachidonic acid from the membrane phospholipids to be a precursor for cyclooxygenase enzymes. Therefore, it is critically important during luteolysis and at the time of maternal recognition of pregnancy. The embryo must attenuate endometrial PGF2a production, whereas PGE2 is considered to be luteoprotective. Furthermore, implantation also requires the action of PGs. A balance should be maintained in PG synthesis in the endometrium. The objective of this study was to evaluate the expression of isoforms of PLA2 (cytosolic [cPLA2], secretory [PLA2], and calcium independent [iPLA2]) in equine endometrium during the oestrous cycle and early pregnancy. Biopsies were obtained from mares on the day of ovulation (d0, n ¼ 4), late diestrus (LD, n ¼ 4, high progesterone [P4]), and after luteolysis in the beginning of oestrus phase (AL, n ¼ 4, ,1 ng mL1 P4) of the cycle. Biopsies were also taken on days 14 (P14, n ¼ 4), 18 (P18, n ¼ 4), and 22 (P22; n ¼ 4) of pregnancy. Relative mRNA expression levels of genes were quantified using real-time quantitative RT-qPCR. Data were analysed using one-way ANOVA and l.s.d. test. Compared with the day of oestrus (d0), steady-state levels of cPLA2 and sPLA2 were down-regulated at LD, where P4 was high, and expression of both were up-regulated again at AL. In contrast, iPLA2 expression was higher at LD and then decreased again at AL. Pregnancy decreased expression of cPLA2 and sPLA2 mRNA at P14 and P18 compared with their respective cycle days. Late diestrus elevation in the expression of iPLA2 was suppressed by pregnancy at P14; however, it was up-regulated later in pregnancy at P22. The results suggest that expression of cPLA2 and sPLA2 is negatively correlated with circulating progesterone concentrations. Pregnancy further inhibits their expression in the equine endometrium. However, iPLA2 expression seems to be positively correlated by progesterone presence and its expression increased as equine pregnancy advanced. This project was partially funded by TUBITAK 107O035 and SUBAP to AG.

112

EFFECT OF ASYNCHRONOUS EMBRYO TRANSFER ON GLUCOSE TRANSPORTER EXPRESSION IN EQUINE TROPHECTODERM T. A. Stout, C. Gibson, and M. de Ruijter Villani Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands

Equine pregnancy is characterised by an unusually long pre-implantation period (40 days) during which the conceptus is entirely dependent on uterine secretions for nutrient provision; although glucose is an important nutrient during development post-blastocyst formation, little is known about its transport into the early horse conceptus. Equine embryos are also known to tolerate an unusually large degree of uterine asynchrony following embryo transfer (ET). However, negative asynchrony (recipient behind the donor) of more than 5 days markedly retards conceptus growth and development, and thereby offers a unique tool for studying the effect of the uterine environment on early development. In a preliminary study, we detected abundant mRNA expression for the facilitative glucose transporters (SLC2As) 1–3, 5, 8 and 10 and sodium-glucose co-transporter (SLC5A)11 in Day 14 to 28 equine conceptus membranes. In the current study, we evaluated the effect of uterine asynchrony on trophectodermal glucose transporter expression. Day 8 horse embryos were transferred to recipient mares that ovulated on the same day (synchronous; n ¼ 10) or 5 days after (asynchronous; n ¼ 10) the donor mare. The conceptuses were collected 6 or 11 days after ET (Day 14 or 19 of embryo development: n ¼ 5 per group). Trophectodermal mRNA expression for glucose transporters was evaluated by RT-qPCR, and the effects of asynchronous ET and stage of pregnancy were analysed by two-way ANOVA followed by independent-samples t-tests. Gene expression for SLC2A3 and 8 was stable over time and treatment. Expression of SLC2A1 and SLC5A11 decreased between Days 14 and 19 in synchronous pregnancies only (P , 0.05). SLC2A2 expression increased markedly on Day 19 in synchronous (P , 0.01) but not asynchronous pregnancies (P , 0.05). SLC2A5 expression was lower in the asynchronous group on Day 14, but increased beyond expression levels in synchronous pregnancies by Day 19 (P , 0.05). In summary, expression of SLC2A1 and 3, the major placental glucose transporters, was not affected by asynchronous ET. The marked up-regulation of SLC2A2 expression between Days 14 and 19 of synchronous but not asynchronous pregnancy suggests a stage-specific function, whereas the increase in SLC2A5 at Day 19 after asynchronous ET could be a compensatory response to growth retardation. This study was funded by EpiHealthNet (Project number 317146).

Early Pregnancy

113


149

PRELIMINARY CHARACTERIZATION OF OXYTOCINASE IN EQUINE SERUM M. Diel de Amorim, K. Nielsen, and C. Card Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, SK, Canada

Oxytocinase/insulin regulated aminopeptidase (IRAP) or leucyl-cystinyl aminopeptidase (LNPEP) is an enzyme that is involved in the regulation of hormones such as oxytocin, vasopressin, and angiotensin in both humans and sheep. Historically, very low levels of this aminopeptidase were reported in monthly samples obtained from cycling and pregnant mares using an enzymatic colourimetric method. The regulation of oxytocin in horses is of interest because of its central role in uterine clearance, luteal maintenance, parturition, passage of fetal membranes, maternal foal bonding, and milk let-down. A preliminary study was performed with the objective of re-examining the level of serum oxytocinase in nonpregnant control (n ¼ 3 mares sampled every other day; EOD of the oestrous cycle), and n ¼ 5 mares sampled Day 12 to 15; oxytocin-treated (n ¼ 2 mares sampled Day 12 to 15), and early pregnant mares (n ¼ 6 mares sampled EOD), using more sensitive ELISA methodology. Mares were examined daily in oestrus until ovulation (Day 0) and from Days 10 to 21, using transrectal ultrasonography of the reproductive tract. Palpable changes in uterine and cervical tone, ultrasound measurement of dominant follicles, oedema scores (0 to 4 with 4 being maximal oedema), and changes in luteal echotexture and size were recorded. Pregnant mares were bred using AI (.200 million motile and normal sperm) from a proven stallion while in oestrus until ovulation, beginning when the dominant follicle was .35 mm. Oxytocin-treated mares were administered 60 IU IM oxytocin SID from Day 7 to 14. Blood was collected to obtain serum. Changes in serum oxytocinase levels were measured using a commercially available ELISA kit for Horse LNPEP according to the manufacturer’s instructions (MyBioSource, San Diego, CA, USA) and validated for use in our laboratory using serial dilutions of pooled serum with an intra-assay and inter-assay CV ,15%. The lowest standard of the assay was 31.2 ng mL1. Preliminary results of this pilot study demonstrated in control cycles median serum oxytocinase levels below the lowest standard (2.0 to 30.1 ng mL1). Oxytocin-treated mares had median serum oxytocinase levels from 39 to 61 ng mL1 on Days 12 to 15. Early pregnant mares had detectable levels from Day 8 to 21 (medians ranging from 40 to 89 ng mL1). We concluded that serum oxytocinase levels were below the lowest standard in diestrus, and were low but detectable in oxytocin-treated mares. The highest oxytocinase levels were measured during early pregnancy. Further studies of serum oxytocinase in a larger population of mares, along with studies of tissue mRNA levels of oxytocinase, are required to better understand the regulation of oxytocin in horses. Research was supported by the Natural Sciences and Engineering Research Council of Canada (Ottawa, ON, Canada) and the Equine Health Research Fund (University of Saskatchewan, SK, Canada).

114

ASYNCHRONOUS EMBRYO TRANSFER AFFECTS THE EXPRESSION OF IMPRINTED GENES IN EQUINE TROPHECTODERM C. Gibson, M. de Ruijter Villani, and T. A. Stout Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands

Gene imprinting is a form of epigenetic modification that results in parent-of-origin specific monoallelic expression. Imprinted genes play important roles during fetal-placental growth with paternally imprinted genes generally promoting and maternally imprinted genes suppressing fetal growth. Imprinted genes are therefore believed to have important effects on trophoblast differentiation and placental development, and in adjusting fetal nutrition to maternal supply. The horse is an interesting model of early placental development because of its unusually long pre-implantation period (40 days), during which the conceptus is dependent on uterine secretions for nutrient provision. Moreover, horse embryos tolerate a wide range of uterine asynchrony following embryo transfer (ET), offering a unique tool to study maternal influences on conceptus development. This study examined the effect of asynchronous ET on the expression of imprinted genes in equine trophectoderm. Twenty Day 8 embryos were transferred to recipient mares that either ovulated on the same day (synchronous; n ¼ 10) or 5 days after (asynchronous; n ¼ 10) the donor mare. The conceptuses were recovered 6 or 11 days after ET (Day 14 or 19 of conceptus development; n ¼ 5 per group). Bilaminar trophectoderm was isolated and mRNA expression for a range of genes known to be imprinted in equine trophectoderm (H19, PHLDA2, IGF2R, IGF2, PEG3, PEG10, SNRPN, INSR, and INS) was investigated by RT-qPCR. The effects of asynchronous ET and stage of pregnancy on gene expression were analysed by two-way ANOVA followed by independent-samples t-tests. IGF2, PEG3, PEG10, INSR, H19, and PHLDA2 all showed a significant up-regulation in gene expression between Days 14 and 19 of pregnancy; however, expression was higher in synchronous than asynchronous pregnancies at Day 19 (P , 0.05). IGF2R expression increased significantly from Day 14 to 19 in the synchronous pregnancies (P , 0.05), but did not differ between treatments at Day 19. SNRPN expression increased from Day 14 to 19, and was unaffected by asynchrony. INS mRNA was not detectable in trophectoderm. In conclusion, asynchronous ET had a significant effect on gene expression at Day 19 of gestation that was not evident at Day 14. This may be either a contributor to the delayed development that is observed in asynchronous pregnancies or a result/response; in either case, it may affect subsequent development. This study was founded by EpiHealthNet (Project number 317146).

115 CLUSTERED REGULARLY INTERSPACED SHORT PALINDROMIC REPEAT (CRISPR)/CAS9-DIRECTED INACTIVATION OF PORCINE INTERLEUKIN-1B AS A MODEL TO STUDY ENDOMETRIAL RECEPTIVITY AND CONCEPTUS ATTACHMENT J. J. Whyte, M. E. Hennessy, R. D. Geisert, and R. S. Prather University of Missouri, Columbia, MO, USA Embryonic losses in livestock range from 20 to 40%, with two-thirds of these losses occurring in the peri-implantation period. An understanding of successful pregnancy establishment in pigs is important for translational research and commercial pig production. Failure of conceptus-maternal communication is a major contributor to this loss, yet the molecular control of this process remains unclear. Engineered nucleases such as the bacterial

150


Early Pregnancy

clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 system enable precise modification of the genome compared with traditional gene targeting. In the present study, we hypothesised that the CRISPR/Cas9 system can be used to efficiently produce genetically modified embryo models in the pig that will answer key questions about the complex molecular dialogue between conceptus and maternal uterus. We focused on interleukin-1b (IL1B), a cytokine believed to contribute to rapid trophoblast elongation and pregnancy establishment in pigs. The pig is unique in having 2 forms of the IL1B gene: the systemic form (IL1B) and the conceptus form (IL1BL) that is expressed only at peri-implantation. The coding sequence of the 2 forms of IL1B share 92% similarity. Our objective was to develop 2 types of cloned swine embryos, each with a CRISPR/Cas9mediated gene inactivation of either IL1B or ILB1L. To target unique regions of IL1B and IL1BL in our fetal fibroblast somatic cell nuclear transfer (SCNT) donor cells, existing Sus scrofa genome data (10.2 annotation) was combined with donor cell Illumina high-throughput sequencing and Sanger sequencing of PCR products to produce consensus IL1B and IL1BL sequences used for targeted disruption. We developed a CRISPR/Cas9 pipeline to identify potential targets 20 nucleotides in length to disrupt the IL1BL and IL1B start codon, while at the same time screening for any potential off-target matches. The pipeline was able to select a group of 11 CRISPR single-chain guide RNAs (sgRNAs; 6 for IL1B and 5 for IL1BL) from an initial library of 413 sgRNAs. Porcine fibroblasts cultured in DMEM, 15% fetal bovine serum, and 10 mg mL1 gentamicin were trypsinized and transferred to electroporation medium (75% cytosalts, 25% Opti-MEM), diluted to 1 million cells in 200 mL, and added to 2 mm gap electroporation cuvettes. Cells received 2 mg of pairs of sgRNAs bracketing the start codon and were electroporated with three 1-ms square wave pulses at 250 V. Transfected cells were resuspended in DMEM and plated at low density (,50 cells/plate). The Surveyor Nuclease assay was used to determine a minimum of 5 unique cleavage products in the target DNA in each gene form for heterogeneous cell populations. Clonal populations of targeted cells are currently being characterised for use in SCNT and embryo transfer to identify the effects of IL1B/IL1BL disruption on key molecular pathways during early development (Days 8, 12, and 18 of gestation).

116

EFFECT OF EXOGENOUS PROGESTERONE AND GONADOTROPIN-RELEASING HORMONE APPLICATION ON MAINTENANCE OF PREGNANCY IN EARLY PREGNANT EWES AFTER PROSTAGLANDIN F2 ALPHA INJECTION M. Kose, M. S. Kaya, and M. O. Atli Dicle University, Diyarbakir, Turkey

In this experimental study, we tested the hypothesis that exogenous progesterone and GnRH applications would prevent the detrimental effect of prostaglandin F2a (PGF2a; a) on early pregnancy in ewes by sustaining high plasma progesterone level. For this purpose, 9 pregnant ewes (mating day ¼ 0) were divided into 2 groups on Day 18 as follows: (1) PGF2a group (125 mg of D-cloprostenol injection on Day 18, n ¼ 5); (2) PGF2a þ progesterone sponge group (125 mg of D-cloprostenol injection on Day 18 þ 20 mg flugestone acetate for 7 days, n ¼ 4). Moreover, gonadotropin-releasing hormone (GnRH; 10 mg of buserelin acetate, n ¼ 4) was injected intramuscularly to PGF2a þ progesterone sponge group ewes on Day 22 after mating to induce luteinization in dominant follicles. The progesterone sponge was withdrawn on Day 25. Plasma progesterone (P4) concentration was measured on Days 18 and 19 by ELISA. Pregnancies were examined by using transrectal ultrasonography on Days 18, 22, 25, and 35 after mating. Statistical difference between groups was analysed by Chi-squared test. P4 concentration declined to below 1 ng mL1 on Day 19 in both groups. While all pregnancies were terminated (5/5) in the PGF2a group by Day 25, progesterone sponge application prevented pregnancy loss (4/4) in the PGF2a þ progesterone sponge group (P , 0.02). When the progesterone sponge was withdrawn on Day 25, half of the pregnancies (2/4) continued after GnRH application in the PGF2a þ progesterone sponge group until birth. In conclusion, results suggest that exogenous progesterone application is sufficient for maintaining early pregnancy in ewes, even if the corpus luteum is regressed. Furthermore, GnRH application on Day 22 after mating might luteinize dominant follicles and could be sufficient to maintain pregnancy after exogenous progesterone is removed.

117

IN VIVO EVALUATION OF THE CERVICAL STIFFNESS EVOLUTION DURING INDUCED LABOR IN EWES USING ELASTOGRAPHY L. PeraltaA, E. MourierB, C. RichardB, P. Chavette-PalmerB, M. MullerC,D, M. TanterC, and G. RusA A Department of Structural Mechanics, University of Granada, Granada, SPAIN; INRA, UMR 1198 Biologie of Developement and Reproduction, Jouy en Josas, France; C Langevin Institute, ESPCI ParisTech, CNRS UMR7587, Inserm U979, Universite´ Paris VII, Paris, France; D Department of Mechanical and Aerospace Engineering, North Carolina State University, Raleigh, NC, USA B

Despite numerous advances and intensive research in perinatal medicine, spontaneous preterm birth (PTB) is the leading global cause of neonatal mortality and morbidity. On the other hand, labour has to be induced in ,23% of pregnancies worldwide. Both issues may be related to the distensibility of the cervical tissue. Quantitative and objective monitoring of the cervix ripening may provide a complementary method to identify cases at risk of PTB and assess the likelihood of successful induction of labour. Currently, however, no reliable clinical tools for such a quantitative and objective evaluation exist. Elastography aims at imaging tissue stiffness. All elastography techniques rely on the same basics: an external force is applied to the tissue and the resulting movements are then followed. Supersonic shear imaging (SSI) is a dynamic method that uses the propagation of mechanical waves to excite the tissue. Its speed is tracked then by ultrafast imaging, allowing characterisation of stiffness [Bercoff et al. 2004 IEEE Trans. Ultrason. Ferroelect. Freq. Contr. 51, 396–409]. Understanding the mechanisms that take place in normal pregnancy will allow a better comprehension of the cervical remodelling and lead to better methods of diagnosis of PTB and successful induction of labour. In this work, we propose a preliminary assessment of the evolution of stiffness during the cervical maturation process in the sheep. The main goal was to study the feasibility of elastography using SSI to quantify cervical stiffness during the maturation process and to assess the potential of this technique for diagnosis of preterm labour and for labour induction success. Cervical stiffness was quantified, by 2 different operators, in 9 pregnant ewes in vivo by

Early Pregnancy


151

using SSI. The cervical ripening was induced by a dexamethasone injection in 5 animals, and 4 animals constituted the control group. The stiffness of the second ring of the cervix was quantified over a circular region of interest of 5 mm of diameter during vaginal ultrasound examination. Images were acquired every 4 h during 24 h to monitor the cervical maturation induced by the dexamethasone injection. Cervical stiffness was found to decrease significantly throughout the cervical ripening (from 9.5 0.9 kPa to 5.0 0.8 kPa; P ¼ 2.7e5). The intraobserver and interobserver repeatability of measurements were assessed using Bland-Altman analysis with 95% CI. The principal findings of the study were that elastography measurements using SSI technique were highly reproducible in all cases. Second, stiffness of the uterine cervix decreases throughout the maturation process induced by the dexamethasone injection. Finally, it was possible to quantify the decrease of stiffness through the cervical maturation process. Elastography may be a valuable method to quantify objectively and noninvasively the cervical stiffness in vivo, and ultimately could be a useful tool for the diagnosis of PTB and the assessment of labour induction success.

118 COMPARISON OF TRANSCRIPTOME PROFILES FROM ENDOMETRIAL CARUNCLES AND PERIPHERAL BLOOD MONONUCLEAR CELLS REVEAL COMMON AND TISSUE-SPECIFIC BIOLOGICAL PROCESSES REGULATED AT IMPLANTATION IN SHEEP V. MauffreÁ, O. SandraB, C. Giraud-DelvilleB, C. UrienC, L. JouneauB,C, B. LoupB, D. ValourB, C. CotinotB, I. Schwartz-CornilC, B. GrimardA, and F. ConstantA A

ENVA, UMR1198 BDR, Maisons-Alfort, France; INRA, UMR1198 BDR, Jouy-en-Josas, France; C INRA, UR0892 VIM, Jouy-en-Josas, France

B

In mammals, implantation is associated with major changes in gene profiles in the female reproductive tract. Molecular signatures of the endometrium have also been shown to vary according to the ability of the embryo to develop to term. Nevertheless, analysing endometrial gene patterns during implantation is incompatible with the maintenance of pregnancy. Therefore early determination of pregnancy issue requires a noninvasive method. Peripheral blood mononuclear cells (PBMC) could represent such an alternative but their reaction to the presence of an implanting embryo has to be investigated. The aim of this study was to investigate gene expression profiles of endometrial caruncular tissue (CAR) and PBMC collected from pregnant ewes (n ¼ 4) and nonpregnant ewes inseminated with inactivated sperm (n ¼ 4) at Day 15 after oestrus. Differentially expressed genes (DEG) were identified using an ovine custom-designed array derived from the ovine 15K Agilent array (Ruscanu et al. 2013 J. Virol. 87, 9333–9343). Data were normalized by Loess and analysed by a linear model in the Limma R package. P-values were corrected using the Benjamini and Hochberg procedure. Comparing pregnancy versus nonpregnancy led to the identification of 2826 DEG in CAR (P , 0.05) and 396 DEG in PBMC (P , 0.10; 265 DEG common with CAR). Ingenuity Pathway Analysis (IPA; Ingenuity Inc., Mountain View, CA, USA) analysis of the 396 PBMC-related DEG revealed 72 overrepresented biological functions (P , 0.001). Among the 15 most overrepresented functions, 13 were common between CAR and PBMC and were mostly related to the immune system, as ‘‘infectious disease’’, ‘‘cell-to-cell signalling and interaction’’, ‘‘immunological disease’’, ‘‘immune cell trafficking and inflammatory response’’. Using the downstream effect analysis (DEA) of IPA, we identified 163 functions predicted to be increased and 8 functions predicted to be decreased for the CAR DEG dataset, whereas 12 functions were predicted to be increased and 40 functions predicted to be decreased for the PBMC DEG dataset. Interferon (IFN) signalling was strongly present in both datasets, with 44% of PBMC DEG and 29% of CAR DEG found to be related to IFN type I response according to the Interferome database (www.interferome. org). A selection of 12 DEG was validated by qRT-PCR in CAR, intercaruncular areas, and PBMC using 8 pregnant and various groups of nonpregnant ewes (n ¼ 7–9/group). Our data show that PBMC transcriptome is influenced by early pregnancy in sheep, including a major impact of IFN type I such as IFN tau, the signal of maternal recognition of pregnancy. Identifying relevant circulating biomarkers reflecting the quality of the embryo will require further investigation. The authors thank UCEA team (INRA), B. Jost (IGBMC) and F. Moreews (Sigenae).

119

A SHORT PERICONCEPTIONAL MATERNAL HYPERGLYCEMIA IS SUFFICIENT TO DISRUPT THE FETO-PLACENTAL PHENOTYPE IN A RABBIT MODEL

D. Rousseau-RalliardA, A. TarradeA, R. ThiemeB, R. BratA, MC Aubrie`reA, M. DahirelA, A. RollandA, N. DanielA, N. FournierC, P. BoileauD, V. DuranthonA, A. Navarrette-SantosB, B. FischerB, and P. Chavatte-PalmerA A

INRA, UMR1198 BDR, Jouy-en-Josas, France; B Faculty of Medicine, Halle, Germany; C Univ Paris-Sud, EA 4529, Chaˆtenay-Malabry, France; D UVSQ, Me´decine neónatale-CHIPS, Poissy, France Pre-gestational type 1-diabetes (T1D) increases the risk of miscarriage and congenital malformations and programs the offspring to develop metabolic syndrome in adulthood. Management of maternal diabetes is essential during gestation but could be also highly important around the time of conception. Using a rabbit model, the effects of maternal T1D during the periconceptional period on pre-implantation blastocysts have been well documented, but the effects on feto-placental phenotype at 28 dpc (term ¼ 31 days) has not been explored. Diabetes was induced by Alloxan in dams 7 days before mating. Glycemia was maintained at 15 to 20 mmol L1 with exogenous insulin injections. At 4 dpc, embryos were collected and transferred into nondiabetic recipients. At 28 dpc, control (C) and diabetic (D) fetuses were collected for biometric records, placental analyses including stereology and gene expression, and lipid profiles of feto-placental tissues by gas chromatography. Lipid data were analysed by principal component analysis. D-fetuses were growth retarded, hyperglycemic, and dyslipidemic compared with C fetuses. Moreover, placental efficiency was much higher in D- than

152


Early Pregnancy

in C-fetuses. The volume density of fetal vessels was significantly decreased in D-placentas compared to C-placentas, whereas the volume density of trophoblast tended to increase (P ¼ 0.051). This morphometric disruption was associated with a deregulation of the expression of genes related to nutrient supply and lipid metabolism. In fetal plasma, a specific fatty acid signature was observed in D- and C-groups. Moreover, the composition of placental and fetal liver membranes differed according to maternal status and fetal sex. Tissues from D-fetuses contained significantly more n-6 polyunsaturated fatty acids compared with C. Docosahexaenoic acid decreased whereas linoleic acid increased in the cardiac membranes of D-fetuses, indicating a higher risk of ischemia. This study demonstrates that exposure to high plasma glucose during the short periconceptional period is sufficient to adversely program fetal phenotype by reducing fetal growth, altering placental function and lipid profiles in all fetal tissues.

120

MATERNAL EXPOSURE TO DIESEL ENGINE EXHAUST DURING PREGNANCY AFFECTS EARLY EMBRYO DEVELOPMENT IN A RABBIT MODEL

S. ValentinoA,B, M. DahirelA,B, E. MourierA,B, C. ArchillaA, C. RichardA,B, N. DanielA, L. MaulnyA, N. PeynotA, E. CanonA, R. SlamaD, F. CasseeC, A. TarradeA,B, V. DuranthonA, and P. Chavatte-PalmerA,B A

INRA, UMR1198 Biologie du De´veloppement et Reproduction, Jouy-en-Josas, France; B PremUp Foundation, Paris, France; C National Institute for Public Health and the Environment, Centre for Sustainability, Environment and Health, BA Bilthoven, the Netherlands; D INSERM, U823 Avenir Team Environmental Epidemiology Applied to Fecundity and Reproduction, Grenoble, France Airborne pollution has been associated with various adverse effects on human reproductive health, especially intrauterine growth retardation and early pregnancy loss. However, few studies have analysed its effect on early development. Diesel exhaust particles (DEP) have been shown to alter blastocyst formation when diluted in embryo culture medium (2010 Toxicol Sci. 117, 200–208), but no data are available concerning the effect of maternal inhalation of diesel exhaust on early embryo development. Our study has been designed to answer this question using rabbit as a model and DEP doses mimicking daily exposure to traffic in large European cities. New Zealand female rabbits were superovulated by means of 5 subcutaneous administration of pFSH for 3 days before mating, followed 10 to 12 h later by an intravenous administration of 30 IU of hCG at the time of mating (natural mating). Dams were exposed to a representative air pollution mixture; that is, diluted diesel engine exhaust (1 mg m3; N ¼ 14) or clean air (N ¼ 12), for 1 h every morning and afternoon, from Day 3 to Day 6 post-coitum (dpc). At 6 dpc, in vivo-developed embryos were collected from uteri perfused with PBS and counted; their diameter was measured on pictures using ImageJ software (NIH, Bethesda, MD, USA). Another group of female rabbits was exposed to the same inhalation conditions from 3 to 27 dpc without superovulation treatment. Measures by ultrasound were performed on these dams at 7 dpc. Data were analysed by Mann-Whitney test and ANOVA, including dams as cofactor. At 6 dpc, number of embryos per dams was higher in exposed group compared with control (P , 0.05). In contrast, embryo diameter was significantly lower in the DEP exposed group compared with the clean air exposed group (P , 0.01). Gene expression analysis is being performed in these embryos. At 7 dpc, ultrasound measurements evidenced a decrease in embryo diameter, perimeter, and volume in the exposed group compared with control (P , 0.01, P , 0.01, and P , 0.01, respectively). These data indicate that repeated exposure to airborne pollution even for daily short periods affects early development. Consequences of maternal DEP exposure on feto-placental development are under investigation.

121

EXPRESSION OF HYALURONAN SYSTEM COMPONENTS IN THE EARLY PREGNANT OVINE ENDOMETRIUM

Z. KiymaA, M. HititB, C. OzelB, G. SenB, M. KoseC, A. GuzelogluB, M. KayaA, M. O. AtliC, E. KurarD, S. A. KayisB, and M. S. KayaC A OGU, Eskisehir, Turkey; Selcuk University, Konya, Turkey; C Dicle University, Diyarbakir, Turkey; D NEU, Konya, Turkey B

Hyaluronan (HA; hyaluronic acid), a member of glycosaminoglycans (GAG) family, is the main polysaccharide and is expressed in almost all tissues including those of the reproductive tract. Three different hyaluronic acid-synthase (HAS) enzymes, HAS1, HAS2, and HAS3, synthesise HA. The action of HA depends on its molecular size and its cell surface receptor (CD44). Hyaluronidases (HYAL) are a group of enzymes, HYAL-1 and HYAL-2, that degrade HA. Roles of the HA system in reproductive events include oocyte maturation, fertilization, and implantation. It is also known that ovarian steroids, specifically progesterone, regulate the HA system in the endometrium. Moreover, HA-mediated cell signalling participates in embryonic development. The aim of this study was to evaluate expression of the HA system at the mRNA level in the early pregnant ovine endometrium at pre-implantation stage. Therefore, endometrial tissue samples were collected on Day 13 of the oestrous cycle (n ¼ 10) and pregnancy (n ¼ 14). Relative mRNA expression levels of HA system genes were quantified using quantitative RT-qPCR. Data were analysed using one-way ANOVA and l.s.d. test. All of the studied components of the HA system (HAS1, HAS2, HAS3, HYAL1, HYAL2, and CD44) were expressed in the ovine endometrium. Steady-state mRNA levels of HAS1, HYAL1, HYAL2, and CD44 were not significantly different between cyclic and early pregnant ovine endometrium on Day 13. However, expression of HAS2 and HAS3 appeared to be down-regulated in early pregnancy. Considering that both cyclic and pregnant endometrium on Day 13 is under the influence of progesterone, detected differential regulation of some components of HA system in the ovine endometrium may be directly related to the effects of the presence of an embryo. The role of the HA system in ovine endometrium at later stages of pregnancy warrants further investigation. Partially funded by TUBITAK-112R022 to ZK and SUBAP to AG.

Embryo Culture


153

122 SEX-SPECIFIC EFFECTS OF PARENTAL DIET DURING PREGNANCY ON EMBRYO DEVELOPMENT IN THE LONG SNOUT SEAHORSE (HIPPOCAMPUS REIDI; GINSBURG, 1933) F. Otero-FerrerA, M. IzquierdoA, A. FazeliB, and W. V. HoltB A

Grupo de Investigacioń en Acuicultura, University of Las Palmas Gran Canaria, Telde, Las Palmas, Spain; B Academic Unit of Reproductive and Developmental Medicine, University of Sheffield, Sheffield, UK

As in mammals, seahorse embryos develop internally but, unlike in mammals, this process occurs within a paternal structure (the brood pouch). Functionally, the brood pouch supports developing embryos through placenta-like interactions, but as egg quality is determined by the female’s diet, the seahorse system offers opportunities to study the effect of the male’s diet on embryo development while varying the female’s diet independently. In this study, we investigated the hypothesis that development of seahorse embryos is affected differentially by independent manipulation of the male and female parental diets. Adult males and females were fed separately with either wild-caught crustaceans (Male-W or Female-W, respectively) or commercial aquarium diet (Male-C or Female-C, respectively) for 1 month before conception and during the subsequent pregnancy (approximately 15 days). Dietary unsaturated fatty acid content (18:3n-3) and (20:4n-6) in the W diet was approximately double that in the C diet. In total, 5231 first-brood offspring were obtained from 4 treatment groups formed from (1) Male-W Female-W; (2) Male-C Female-W; (3) Male-W Female-C; and (4) Male-C Female-C. Each treatment was replicated with 4 couples. Newborns (10 from each brood) were weighed and dimensions measured. Fifteen-day postnatal survival rates were determined from 40 offspring/couple (N at Day 0 ¼ 160/treatment) and fatty acid profiles were evaluated. Data were analysed by nested analyses of covariance (ANCOVA); replicates were nested within treatments and individual offspring measurements were nested within replicates (male and female parental sizes were used as covariates). Offspring produced by the Male-C Female-W were ,10% taller (both as standard length and tail length; P , 0.05) than those produced by Male-W Female-W couples but their 15-day survival was poorer (12.9% v. 39%; x2 ¼ 39.19, 1 DF; P , 0.001). Fifteen-day survival of the other groups was 0% in both cases. When both male and female parents were fed the commercial diet, their offspring were considerably smaller than those from all the other treatments (P , 0.05). The offspring produced by Male-W Female-C couples showed distortion of the snout:head length ratio, a phenotypic feature that was highly consistent in the Male-W Female-W treatment group. Fatty acid profiles of the offspring showed significant dependence on the preconception dietary treatment; 20:4n-6 and 22:6n-3 contents were significantly lower in Male-C Female-C than in Male-W Female-C (P , 0.01) offspring, showing that the male’s pouch could compensate for the poorer quality of lipids derived directly from eggs. These results support the hypothesis that diet received during the preconception period and pregnancy by the males and females differentially affects embryonic growth and fatty acid content, and suggest that seahorses are a suitable model species for understanding the effects of parental diet on offspring health. Supported by the EU FP7/2007–2013 AquaExcel network (grant agreement No. 262336) and the COST Action (FA1201) (Epigenetics and Periconception Environment).

Embryo Culture 123

EFFECTS OF TAURO URSODEOXYCHOLIC ACID ON DEVELOPMENT OF BOVINE EMBRYOS FROM IN VITRO FERTILIZATION F. Lu, Z. Li, Z. Ruan, X. Liu, S. Du, Q. Ruan, Y. Deng, J. Jiang, and D. Shi Animal Reproduction Institute, State Key Laboratory of Subtropical Bioresource Conservation and Utilization, Guangxi University, China, Nanning, Guangxi, China

Endoplasmic reticulum stress (ERS) is a novel apoptotic pathway and plays an important role for embryonic development. Tauro ursodeoxycholic acid (TUDCA) is a specific chemical chaperone that can inhibit ERS. In this study, we investigated the effects of TUDCA on the development and mRNA expression of ERS-related genes in bovine embryos from IVF in order to improve the efficiency of embryo in vitro culture. Bovine oocytes collected from ovaries at slaughter were cultured in the maturation medium (TCM-199 þ 26.2 mmol L1 NaHCO3 þ 5 mmol L1 HEPES þ 5% fetal bovine serum) for 24 h and fertilized in vitro with bovine sperm. After fertilization, the embryos were respectively placed into the medium (TCM-199 þ 3% fetal bovine serum) containing different concentrations of TUDCA (0, 100, 250, 500, 1000 mmol L1) and cultured in the 5% CO2 at 38.58C. Blastocyst development was evaluated after 7 days of culture, and then the total cell number and apoptosis index of blastocysts were detected with TUNEL. In addition, X-box binding protein 1 (XBP-1) of embryos at 2-cell, 4-cell, morula, and blastocyst stages was detected with RT-PCR, and the change of the mRNA expression of ERS-related (Grp78, Ire1, Chop) and apoptosis-related (Bax, Bcl-2) genes in blastocyst collected at 7 days of culture were analysed by QRT-PCR. A total of 1336 oocytes were used in this study, and each experimental group comprised 6 replicates. The results revealed that the splicing of XBP-1 was present during the development of bovine embryos, and especially obvious at the 4-cell, morula, and blastocyst stages. When embryos were cultured in medium with different concentrations of TUDCA, compared with the control group (0 mmol L1), more embryos developed to blastocyst stage with 500 mmol L1 TUDCA (31.86 7.32% v. 21.11 8.05%; P , 0.05), but the cleavage rate was not significantly different among groups (P . 0.05). The result for TUNEL found that when adding 500 mmol L1 TUDCA to culture, the bovine embryos significantly improved the total cell number of blastocysts (110. 15.21 v. 102.3 8.62; P , 0.05), and the apoptosis index of blastocysts was markedly decreased (3.71 0.91 v. 5.36 1.92; P , 0.05) relative to the control group. Moreover, the result of QRT-PCR analysis showed that treating embryos with 500 mmol L1 TUDCA significantly reduced the mRNA expression level of Ire1 and Chop genes (P , 0.05) and up-regulated the expression of anti-apoptotic Bcl-2 gene (P , 0.05), while down-regulated the expression of pro-apoptotic Bax gene (P , 0.05). Furthermore, XBP-1 splicing in blastocysts also abated after embryos were treated with 500 mmol L1 TUDCA. In conclusion, ERS occurs in bovine embryos during in vitro culture, but treating embryos with 500 mmol L1 TUDCA may reduce ERS to facilitate embryonic development. This work was funded by the China High Technology Development Program (2011AA100607), China Natural Science Foundation (31072033), and Guangxi Science Foundation (2011GXNSFA018084, 2012GXNSFFA060004).

154


124

Embryo Culture

CRYOPRESERVED BOVINE OVIDUCTAL EPITHELIAL CELLS SURVIVAL, GROWTH, AND ABILITY TO SUPPORT EARLY EMBRYO DEVELOPMENT E. Corbin, A. Cordova, J. Grosbois, and P. Mermillod INRA, UMR7247 Physiologie de la Reproduction et des Comportements, Nouzilly, France

Previous experiments demonstrated that co-culture of bovine embryos with bovine oviducal epithelial cells (BOEC) improved blastocyst rate and quality (Cordova et al. 2014). However, the use of primary cell support for improving embryo development in vitro may introduce a higher variability of the results between different BOEC batches used, as well as sanitary risks. The use of well-controlled large batches of frozen BOEC may help to solve these problems. Therefore, the aim of the present study was to characterise the survival and functionality of frozen-thawed BOEC. Bovine oviducts attached to ovaries showing recent ovulation were collected at a local slaughterhouse during 4 replicates (3 oviducts per replicate). Epithelial cells were expelled by gentle squeezing and washed 3 times. Half of the cell pellet was diluted 100-fold in culture medium (TCM199 þ 10% FCS) for culture of fresh cells. The other half was diluted 10-fold in cell freezing medium (TCM199 þ 20% FCS þ 10% dimethyl sulfoxide), allowed to equilibrate in this medium for 10 min, and frozen at 808C in a container filled with isopropyl alcohol. After 4 h, the tubes were transferred into LN for at least 1 h. The tubes were then thawed (5 min in 378C water bath), diluted 1 : 1 in cell culture medium, and centrifuged for 10 min at 100 g. The pellet was then diluted 100 in cell culture medium. Fresh or frozen-thawed cells were seeded in 4-well NUNC plates for 7 days at 38.88C in a humidified atmosphere with 5% CO2 in air. The medium was renewed every 48 h, and the viability of cells was assessed by calcein-AM and ethidium homodimer labelling. After 7 days of culture, the medium was replaced by SOF medium þ 5% FCS, and bovine in vitro-produced zygotes were added the day after and co-cultured for 8 days at 38.88C in a humidified atmosphere with 5% CO2 in air to evaluate embryo development. Half of the medium was renewed every 48 h. Frozen-thawed cells showed the same viability than fresh ones at Days 0 and 7 of culture and reached confluence at the same time (Day 7). Development results are shown in Table 1. Frozen and fresh cells support early embryo development at the same rate. In conclusion, the present study showed that BOEC frozen on the day of collection are equivalent to fresh BOEC in regards to their survival and proliferation and their ability to support early embryo development. At collection, the cells may face stresses that are just as considerable as freezing/thawing (temperature shock, scrapping, change of environment). This may explain why they are not affected by freezing than at collection. The differentiation status of these cells is now under analysis by immunocytochemistry. Table 1. Cleavage rate and blastocyst rate in 3 different types of culture systems Culture system Fresh BOEC Frozen-thawed BOEC

125

No. of zygotes

No. of cleaved

Cleavage rate (%)

No. of blastocysts

Blastocyst rate (%)

360 99

283 74

79 75

123 32

34 32

EFFECT OF BOVINE OVIDUCTAL FLUID ON DEVELOPMENT AND QUALITY OF IN VITRO-PRODUCED BOVINE EMBRYOS

R. LoperaA, M. HamdiA, V. MailloA, C. NunezA, P. CoyB, A. Gutierrez-AdanA, P. BermejoA, and D. RizosA A

Department of Animal Reproduction, INIA. Crt. De la Coruna Km 5.9, Madrid, Spain; B Department of Physiology, Veterinary Faculty, University of Murcia, Murcia, Spain

Although fertilization and early embryonic development take place in the oviduct, the consequences of tubal fluid supplementation during in vitro embryo culture have not been explored. The aim of this study was to evaluate the effect of bovine oviducal fluid (bOF) supplementation during in vitro embryo culture of bovine embryos on their development and quality. The bOF was aspirated from oviducts of slaughtered heifers in the early luteal phase. In vitro-produced zygotes were cultured in SOF (C; n ¼ 927) or SOF þ 5% FCS (Cþ; n ¼ 872) or in SOF þ bOF (n ,900/group) at different concentrations (0.62, 1.25, 2.5, 5, 10, or 25%) in 10 replicates. Blastocysts on Days 7/8 were used for quality evaluation through (a) differential cell count, (b) survival after vitrification/warming, and (c) gene expression (qRT-PCR). One-way ANOVA (development and quality) and t-test (cell count) were used for statistical analysis. The bOF concentrations over 5% were detrimental for blastocysts development (,7% at Day 7) and were discarded. Embryos cultured in absence of FCS exhibited a delay in the kinetics of blastocyst development; at Day 7, the groups cultured without FCS (bOF 0.62– 2.5% and C) had fewer blastocysts (range:12.0 1.7 to 17.4 1.5%) compared with Cþ group (22.9 1.2%). However, blastocyst yield at Day 9 was similar in 0.62 and 1.25 bOF groups (27.5 1.7% and 27.5 1.2%, respectively) compared with Cþ (27.7 1.0%) and significantly higher than 2.5 bOF (22.7 1.5%) and C (21.5 1.4%; P , 0.05). In terms of blastocyst quality, 48 h after vitrification/warming, embryos from bOF 1.25%, 0.62%, and C groups survived significantly higher than Cþ (61.3 2.1; 61.6 4.1; 59.3 3.2; and 30.3 2.5, respectively; P , 0.05). This difference was even higher at 72 h (53.6 1.7; 57.7 3.8; 56.1 2.9; and 25.9 2.3%, respectively; P , 0.05). Total cell number of the embryos cultured in bOF 1.25 and 0.62% groups were significantly higher than Cþ and C (165.1 4.7 and 156.2 4.2 v. 143.1 4.9 and 127.7 4.9, respectively), which was associated with an increased TE cell number in 1.25 and 0.62% bOF groups (119.9 3.7 and 127.0 4.5, respectively). Culture with 2.5% bOF had no effect on either blastocyst yield or quality. Gene expression analysis was performed in 1.25% bOF, C, and Cþ groups. The result suggested a higher glucose (SCL2A1) and lipid (CYP51 and FADS1) metabolism in those groups cultured without serum. Gene DNMT3A and the imprinted gene IGF2R were also significantly up-regulated in bOF and C compared with Cþ (P , 0.05). Interestingly, AQP3, a gene positively correlated with survival after vitrification, was significantly up-regulated in bOF compared with C and Cþ (P , 0.05). In conclusion, in vitro culture with low concentrations of bOF has a positive effect in development and quality of bovine embryos cultured in absence of FCS. Funded by the Spanish Ministry of Science and Innovation (AGL2012–37510).

Embryo Culture

126


155

EXPRESSION OF MYO-INOSITOL OXYGENASE IN BOVINE PRE-IMPLANTATION EMBRYOS AND ITS REGULATION BY ANTI-OXIDATIVE VITAMINS S. Ikeda, M. Sugimoto, and S. Kume Kyoto University, Kyoto, Kyoto, Japan

Myo-inositol (MI) added into in vitro culture media stimulates blastocyst development of mammals, including cattle (Holm et al. 1999 Theriogenology 52, 683–700), and these stimulatory effects are considered to be exerted via the incorporation of MI into phosphatidylinositol (Hynes et al. 2000 Mol. Reprod. Dev. 55, 265–269). Myo-inositol is catabolized by MI oxygenase (MIOX), which may affect bioavailability of MI for phosphatidylinositol pathway. In the present study, we investigated the expression pattern of MIOX transcripts in bovine pre-implantation embryos and the effects of anti-oxidative vitamins, which promote blastocyst hatching (Ikeda 2014 Reprod. Fertil. Dev. 26, 157), on the expression levels of MIOX in bovine blastocysts in vitro. Cumulus-enclosed oocytes obtained from slaughterhouse bovine ovaries were in vitro-matured for 22 h in modified SOF (mSOF) supplemented with 10% v/v FCS and 0.2 IU mL1 FSH. After in vitro maturation, the oocytes were subjected to IVF with Percoll gradient-selected sperm in an mSOF-based medium for 20 h. After IVF, presumptive zygotes were freed from cumulus cells and cultured in mSOF up to Day 8 (IVF ¼ Day 0). All cultures were performed at 38.58C under 5% CO2, 5% O2, and 90% N2. Total RNA was extracted from embryos at the 1-cell, 2-cell, 8-cell, morula, and blastocyst stages (n ¼ 15 duplicates for each stage) and reverse transcribed to cDNA using oligo (dT) primer in a 31.5 mL reaction volume. Transcripts for MIOX were examined by quantitative reverse transcription-PCR (qRT-PCR) using 1 mL of the cDNA solution and succinate dehydrogenase as a reference gene. Moreover, IVF-derived 8- to 16-cell embryos on Day 3 were cultured in mSOF supplemented with or without a vitamin mix (11 mM a-tocopherol and 9 nM b-carotene) up to Day 8, and blastocysts (n ¼ 10 3 replicates) were collected from each treatment. The expression levels of MIOX transcripts in the blastocysts were compared between the treatments by using qRT-PCR. The data were statistically analysed by Mann–Whitney U test. The MIOX transcripts were undetectable at the 1-cell and 2-cell stages and then expressed from the 8-cell stage onward. The vitamin treatment significantly (P , 0.05) decreased the expression level of MIOX in blastocysts. These results suggest that MIOX is one of embryonic-activated genes in bovine pre-implantation embryos, and the level of its expression is regulated by anti-oxidative vitamins. The stimulatory effects of anti-oxidative vitamins on blastocyst development might be in part via the modulation of MI bioavailability.

127

VERO CELLS CONDITIONED MEDIUM IMPROVES EMBRYONIC DEVELOPMENT DURING IN VITRO CULTURE OF BOVINE EMBRYOS M. Barcelo-FimbresA, J. N. GouzeB, N. R. MtangoA, R. KoppangA, and J. P. VerstegenA A

MOFA Global LLC, Verona, Wisconsin, USA; B GenBiotech, Antibes, France

Beneficial effects on embryonic development of co-culture with Vero cells during in vitro culture have been previously reported and related to Vero cells growth factors/cytokines secretion into the medium (1998 Human Reprod. 1600–1605). However, co-culture increases the probability of microorganism contamination during culture. In this study, we aimed to overcome this problem by culturing bovine embryos in conditioned medium derived from Vero cells culture (CM). Vero cells (GenBiotech, Antibes, France) were cultured for 24 h, and then the medium was removed, filtered, and frozen until its use. A total of 701 slaughterhouse bovine cumulus oocytes complexes were matured and fertilized in vitro under standard conditions. After fertilization, zygotes were allocated to 4 different treatments [0 (control), 5, 10, and 20% of CM v/v] for in vitro culture in BBH7 medium (BoviProÒ, MOFA Global, Verona, WI, USA) at 38.58C in 5% O2, 5% CO2, 90% N2 atmosphere for 7 days. A total of 8 replicates were done. Cleavage rates were assessed at 2.5 days, blastocyst rates and embryonic stage at 7 days, and blastocyst total cell number at 7.5 days after fertilization. Data were analysed by ANOVA using GLM; the percentages were transformed using arcsin square root. If the ANOVA was significant (P , 0.05), means were separated by Tukey’s procedure using Statistix 10 software (Tallahassee, FL, USA). No differences in cleavage rates were found between treatments (P . 0.1; Table 1). However, the addition of conditioned medium at all levels increased the blastocyst production at Day 7 of culture (between 11 to 19 percentage points) compared with the control group (P , 0.01; Table 1); likewise, CM addition was superior in total embryo production (Day 7 morulae plus all blastocysts; P , 0.01; Table 1), between 12.5 to 15 percentage points higher than the control group. No differences were found between treatments for blastocyst total cell number at 7.5 days of culture (P . 0.1; Table 1) and overall embryonic developmental stage (P . 0.1; Table 1). In conclusion, we found a superior embryonic development when Vero cells conditioned medium was added at Day 0 of in vitro culture; the positive effect on total embryo production was observed even at 5% of conditioned medium. Table 1. Means (6 s.e.m.) of embryonic development of bovine embryos Treatment

Oocytes no.

Cleavage (%)

Blastocyst Day 7 (%)

Total embryos Day 7 (%)

Total cell number

Blastocyst stage1

Control CM 5% CM 10% CM 20%

159 179 178 185

88.6 2.4 88.9 2.2 90.2 1.4 84.8 2.8

33.8 3.1a 52.8 3.8b 49.4 2.7b 45.0 2.8b

43.8 4.8a 58.8 3.8b 58.8 3.2b 56.3 2.8b

153.8 164.4 172.4 141.5

6.03 6.10 6.08 5.81

Values without common superscripts in the same column differ (P , 0.01). Overall blastocyst stage (5 ¼ early, y , 8 ¼ hatched).

a,b 1

156


128

Embryo Culture

ADDING SERUM OF COWS SUPPLEMENTED WITH b-CAROTENE DURING BOVINE IN VITRO EMBRYO CULTURE HAS NO EFFECT ON EMBRYO DEVELOPMENT J. De BieA, E. MerckxA, S. AndriesA, I. ImmigB, P. E. J. BolsA, and J. L. M. R. LeroyA A

Gamete Research Centre, University of Antwerp, Belgium; B DSM Nutritional Products, Kaiseraugst, Switzerland

Elevated serum NEFA concentrations, typically present in negative energy balance (NEB) cows, are known to compromise bovine in vitro oocyte and embryo quality and developmental competence. These observations seem to be associated with oxidative stress. Therefore, antioxidant supplementation such as b-carotene (bC) can be a promising solution to ameliorate embryo quality and survival. However, little is known about the possible neutralizing effect of bC on NEB-compromised embryos. Accordingly, we hypothesise that bC can overcome the potential negative effects of metabolic conditions associated with NEB on embryo development. To investigate this we aimed to evaluate the effect of serum from bC-supplemented positive energy balance (PEB) or NEB cows on embryonic developmental competence. A total of 5 nonlactating HolsteinFriesian cows were subjected to 4 consecutive dietary treatments, 28 days each: 1) 1.2 maintenance (M) (¼ PEBbC), 2) 1.2 M with daily 2000 mg of bC (Rovimix 10% bC, DSM) (¼ PEBþbC), 3) 0.6 M þ bC (¼ NEBþbC), and 4) after a 6 week acclimatization period 0.6 M (¼ NEBbC). Serum was collected 72 h after ovulation, pooled per dietary treatment, and heat inactivated during 30 min at 568C. In total 1404 bovine slaughterhouse grade 1 cumulus-oocyte complexes were serum-free matured (4 repeats), routinely fertilized, and cultivated for 6.7 days with the addition of 10% serum of the 4 different treatments. Cleavage (48 h post-insemination), blastocyst rates (7.7 days post-insemination), and the rates of blastocysts from cleaved zygotes were calculated. Developmental competence data were compared between the 4 treatments using a binary logistic regression model taking replicate, treatment, and the interaction of both factors into account. The NEFA and bC data were analysed using a paired-samples t-test (IBM SPSS Statistics 20). Bonferroni correction was applied. Serum NEFA concentrations were significantly elevated in NEB compared to PEB (0.36 0.18 mM v. 0.21 0.11 mM; P ¼ 0.011). b-Carotene supplementation drastically increased bC concentrations in serum in NEB (0.44 0.18 mg mL1 v. 3.28 0.78 mg mL1; P , 0.001) as well as in PEB (1.02 0.91 mg mL1 v. 3.04 1.28 mg mL1; P , 0.001). Unexpectedly no significant differences were found on cleavage rates (on average 81%), subsequent development until blastocyst stage (on average 29%), or blastocyst rates from cleaved zygotes (on average 36%). Briefly, our model was not able to indicate any negative effect of NEB serum on in vitro embryo development compared with PEB, and hence no extra beneficial effects of bC could be observed on the outcome. In conclusion, these data show that more research is needed to optimize this model to investigate the effect of specific dietary strategies on pre-implantation embryo quality.

129

EFFECT OF SERUM SUPPLEMENTATION ON AMP-ACTIVATED PROTEIN KINASE (AMPK) ACTIVITY AND LIPID METABOLISM OF IN VITRO-CULTURED BOVINE EMBRYOS S. Prastowo, F. Rings, D. S. Wondim, E. Tholen, C. Looft, C. Neuhoff, K. Schellander, D. Tesfaye, and M. Ho¨lker Animal Breeding and Husbandry Group, Institute of Animal Science, University of Bonn, Germany

A major problem of embryos cultured in vitro with serum is cytoplasmic lipid accumulation resulting in lower cryotolerance compared with those derived from in vivo or in the absence of serum. AMPK is known as a master regulator of lipid, glucose, and protein metabolism in mammalian cells. Moreover, it has been reported as controller of acetyl-CoA carboxylase a (ACC ), the gene responsible for lipid synthesis, and associated with mitochondrial biogenesis and activities in response to oxidative stress. In the present study we aimed to investigate the regulation of AMPK during serum supplementation in vitro. For this, bovine embryos were produced in vitro in SOF media supplemented with oestrous cow serum or fatty acid–free BSA as a system without serum. Triplicate pools (each 10 blastocysts) from each group were used for RNA isolation using ArcturusÒPicoPureÒRNA Isolation Kit (Life Technologies, USA). Reverse transcription was performed using a combination of Oligo(dT)23 and random primers. Quantification of AMPK catalytic a1 (AMPKA1), ACC, peroxisome proliferator-activated receptor gamma coactivator 1 a (PGC1A), and sterol regulatory element binding transcription factor 2 (SREBP2) transcripts were performed using ABI PRISMÒ 7000 SDS system (Applied Biosystems, Foster City, CA, USA) using GAPDH as internal control. Normalized logtransformed transcript amount data were statistically analysed using t-test. In addition, AMPK protein was detected by immunofluorescence, mitochondrial activity by MitoTrackerÒ Red (Invitrogen, Carlsbad, CA, USA), and reactive oxygen species by H2DCFDA molecular probe (Life Technologies, USA), and fluorescent intensity signals were visualised under confocal laser scanning microscopy LSM 710 (Carl Zeiss, Germany). Results showed that the expression of AMPKA1, PGC1A, a mitochondrial biogenesis protein, and SREBP2, a regulator of lipid oxidation, were found to be lower (0.4-, 0.2-, and 0.7-fold, respectively; P , 0.05) in blastocysts derived from cultured with serum compared to without serum. By contrast, ACC was up-regulated in blastocysts cultured with serum by 1.8-fold (P , 0.05) compared to without serum. In comparison to blastocyst cultured without serum, a reduced fluorescent intensity was observed in AMPKA1 protein and mitochondrial activity in blastocyst cultured with serum. The presence of serum was also found to be involved in increasing reactive oxygen species accumulation in embryos cultured with serum. The reduced level of AMPK leads to increased ACC and subsequently enhanced conversion of fatty acids into lipid, which is associated with reduced mitochondrial biogenesis protein, elevated reactive oxygen species level, and reduced lipid oxidation by suppression of SREBP2. In conclusion, the presence of serum in in vitro culture environment affected the AMPK activity and thereby genes associated with lipid metabolism in early bovine embryos.

Embryo Culture

130


157

METABOLIC PROFILING OF MALE AND FEMALE BOVINE EMBRYOS USING NUCLEAR MAGNETIC RESONANCE (NMR) IMAGING

M. RubessaA, A. AmbrosiC, K. M. Polkoff B, J. W. StewartB, K. K. HerzogB, S. E. DenmarkC, and M. B. WheelerC A

Institute for Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, IL, USA; Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL, USA; C Department of Chemistry, University of Illinois at Urbana-Champaign, Urbana, IL, USA

B

It has been previously shown that during the pre-implantation phase of embryo development, the pentose phosphate energy pathway is 4 times more active in female embryos when compared with male embryos (Tiffin et al. 1991 J. Reprod. Fertil. 93, 125–132). The different metabolic and growth rates can be attributed to the different expression of X-linked genes between the sexes during the early stages of pre-implantation development, in which both X chromosomes are still active in female embryos (Okamoto et al. 2004 Science 303, 644–649). The aim of this study was to evaluate, by proton magnetic resonance (H1-NMR) imaging, the different behaviour of female and male embryos. In this study we evaluated only energetic substrates or Krebs cycle’s intermediates. Matured bovine cumulus-oocyte complexes were fertilized in vitro according to our standard procedures (Rubessa et al. 2011 Theriogenology 76, 1347–1355). Presumptive zygotes were placed in individual drops of 50 mL of SOF. Zygotes were incubated in a humidified mixture of 5% CO2, 6% O2, and 88% N2 in air at 398C. After 48 h, the zygotes were placed into WOW culture, and the drops collected in tubes. The embryos were scored for quality on the basis of morphological criteria. In this experiment, we evaluated 10 embryos for each sex, at stage of tight morula, early blastocyst, blastocyst, and expanded; data were obtained from 2 replicates. The embryos had their sex determined according to our standard protocol (Alomar et al. 2008 Anim. Reprod. Sci. 107, 48–61). Samples of media (40 mL) were added to 660 mL of a stock solution prepared by dissolving 5.0 mg of sodium 3-(trimethylsilyl)-2,20 ,3,30 -tetradeuteropropionate (TSP) in 50 mL of deuterium oxide. The TSP acted both as a chemical shift reference and as an internal standard for the purposes of quantitation. The resulting diluted samples were transferred to a 5-mm NMR tube. Samples were analysed on a Varian VNS-750 NB (750 MHz) spectrometer (Agilent Technologies, Santa Clara, CA, USA). Data were statistically analysed with ANOVA using the Generalized Linear Model (GLM) procedure (SAS, version 9, 1999, SAS Institute Inc., Cary, NC, USA), where the independent variable was the sample (female, male embryos and control media without embryos). Tukey’s post-hoc test was used to perform multiple comparisons. The P-level was set at 0.05. All data were expressed as quadratic means and with standard error of the means. The results, reported in Table 1, indicate that there are no statistical differences between the sexes after 48 h of embryo culture. In conclusion, these results confirm that in the first phase of development, the embryos derive their energetic substrates from substrates contained within the embryos themselves. Table 1. Results, least squares mean (standard error) Item Female Male Control

131

Myo-inositol

Citrate

Pyruvate

Lactate

Acetate

2.3366 (0.033) 2.4150 (0.04)

0.222 (0.023) 0.195 (0.028)

0.448 (0.049) 0.355 (0.060)

2.710 (0.045) 2.778 (0.041) 2.830 (0.051)

0.548 (0.034) 0.565 (0.031) 0.590 (0.038)

CHROMOSOMAL ABNORMALITIES IN IN VITRO-PRODUCED 4-DAY-OLD CATTLE EMBRYOS: INFLUENCE OF THE OOCYTE MATURATION MEDIA S. D. Peyra´s and M. M. Millań Department of Genetics, University of Co´rdoba, Cordoba, Spain

Chromosomal abnormalities were related to embryo developmental failures in cattle, being highly increased in IVF-produced compared with multiple-ovulation embryo transfer-produced embryos. The origin of this difference remains unclear, but they were related to the suboptimal environmental culture laboratory conditions. We studied the influence of 3 different maturation media in the appearance of chromosomal abnormalities in early in vitro-produced embryos. A total of 562 oocytes classified as Class A were collected by follicular aspiration in slaughterhouse ovaries and matured by 20 h in 3 different culture media supplemented with 10% FCS and antibiotics as follows: TCM-199 (T, 193 oocytes); DME (D, 178 oocytes); and RPMI-1640 (R, 191 oocytes). Matured oocytes were fertilized by 16 h with 1 106 spz mL1 in IVF-TALP media and cultured by 72 h in SOF media. Later, 48 h after fertilization, 562 presumptive embryos were evaluated showing a normal cleavage rate of 64.7, 55.2, and 54.9% in T, D, and R groups, respectively. After culture, only 181 early embryos (90 hpi) showing normal development were correctly karyotyped following our standard laboratory techniques. Individual blastomeres were stained with Giemsa and assessed by direct observation at 1250 magnification in a brightfield microscope. The percentage of normal diploid embryos (D) and abnormal haploid (H), polyploid (P), or aneuploid (A) embryos were determined. Only embryos showing almost 2 different blastomeres correctly karyotyped were included in this study. Cleavage rates were statistically higher (P , 0.05) in the oocytes matured in T media in comparison with the oocytes matured in D or R media. The percentage of diploid embryos were almost equals in the 3 groups evaluated (Table 1). There was some variation when each kind of chromosomal abnormality was assessed individually, but no statistical differences were observed. These results are in consonance with our previous studies in which we demonstrated the maturation time and morphological quality are the 2 main oocyte-derived factors influencing the ploidy of early embryos. It was also demonstrated that chromosomal complements were affected, in a much lesser extent, by the maturation media supplementation. However, in the present study, the maturation media did not statistically affected embryo ploidy. However, the higher percentage of cleaved embryos using TCM-199 observed agree with fact that this

158


Embryo Culture

maturation media is one of the most widely used in IVF procedures in cattle. Based on our data, we suggest that oocyte maturation, a well established technique in cattle, could be performed using different maturation media without expecting major differences in the embryo ploidy, and therefore, the differences observed in cleavage rate must be originated in other physiological factors. Table 1. Results Oocyte maturation media

Number of embryos analysed

Chromosomal complements Normal embryos

Abnormal embryos

Diploid

TCM-199 DME RPMI-1640

132

63 57 61

Total

Haploid

Polyploid

Aneuploid

n

%

n

%

n

%

n

%

n

%

50 45 46

79.37 78.95 75.41

13 12 15

20.63 21.05 24.59

6 7 6

9.52 12.28 9.84

5 4 5

7.94 7.02 8.20

2 1 4

3.17 1.75 6.56

VITRIFICATION SYSTEM (OPEN AND CLOSED) IN NEW INCUBATOR WITH REDUCED OXYGEN O. WatanabeA, E. SchmittB, F. MeirellesC, A. OliveiraA, A. Bos-MikichD, F. MeirellesC, and Y. WatanabeA A

WTA Watanabe Tecnologia Aplicada Ltda SS, Cravinhos, Brazil; B IMV-Technologies, L’Aigle, France; C Depto de Ciencias Basicas – FZEA/USP, Pirassununga, Brazil; D Depto Cieˆncias Morfolo´gicas/ICBS – UFRGS, Porto Alegre, Brazil Most IVF laboratories uses high oxygen tension (20%) during embryonic culture. However, it is known that under physiological conditions, oxygen tension in the female reproductive tract ranges between 2 and 8%. Therefore, the aim of this study was to evaluate survival and hatching rate after in vitro culture of vitrified/thawed bovine in vitro-produced blastocysts cultured under different oxygen concentrations. The experiment consisted of comparing 2 culture systems using different concentrations of oxygen: conventional incubator (20% O2, Thermo Scientific, model 3130) and a new incubator (5% O2, WTA Watanabe Tecnologia Aplicada, model Eve). Only Day 7 expanded blastocysts grade 1 were used. Embryos were produced according to conventional IVF protocols. Briefly, cumulus-oocyte complexes were aspirated from postmortem ovarian follicles, matured in TCM199 þ 10% FCS þ 0.5 mg FSH mL1 þ 50 mg LH mL1 þ 1 mg oestradiol mL1, for 24 h at 38.58C, 5% CO2 in air. Live spermatozoa from Nellore bull were obtained by centrifugation in Percoll gradients (45 and 90%) and cultured with cumulus-oocyte complexes at 1 million of sperm mL1 in TALP medium þ 10 mg of heparin mL1. After 20 h incubation, zygotes were transferred to CR2 þ 2.5% FCS þ 4 mg of BSA mL1 and granulosa monolayer for 7 days. Expanded blastocysts were randomly allocated to 2 treatments for vitrification (open system – cryotop and closed system – HSV Kit, IMV-Technologies) using the same vitrification media and protocol (VS1: 10% ethylene glycol þ 10% dimethyl sulfoxide and VS2: 20% ethylene glycol þ 20% dimethyl sulfoxide for 8 min and 50 s, respectively). After exposure to the vitrification solutions, 2 embryos were loaded/straw, and the straws were plunged into LN. The warming procedure consisted of, immediately after removal from LN2, transferring the embryos in 2 successive warming solutions with decreased concentrations of sucrose (1 M and 0.50 M for 5 min each). The vitrified/rewarmed embryos were transferred to in vitro culture. There were no differences in survival rates (P , 0.05) between the open and closed vitrification system for blastocysts produced in reduced oxygen in the Eve incubator – 5% O2 (96% – 109/114 and 98% – 158/161, respectively) compared with embryos produced in the high oxygen environment in the Thermo incubator – 20% O2 (93% – 214/230 and 92% – 94/102, respectively). Hatching rates were increased for blastocysts cultured in the lower oxygen environment (EVE treatment: 95 and 98%, respectively, for open and closed vitrification protocols) when compared with the high oxygen environment (Thermo treatment: 86 and 87%, respectively, for open and closed systems); P , 0.05. In vitro culture in a reduced-oxygen environment improves blastocysts competence after vitrification. Financial support was received from CNPq-RHAE.

133

NONINVASIVE ANALYSIS OF EMBRYO METABOLITES USING NUCLEAR MAGNETIC RESONANCE

M. RubessaA, K. K. HerzogB, A. AmbrosiC, J. W. StewartB, K. M. Polkoff B, S. E. DenmarkC, and M. B. WheelerA,B A B

Institute for Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, IL, USA; Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL, USA; C Department of Chemistry, University of Illinois at Urbana-Champaign, Urbana, IL, USA

Wide-spread use of IVF has significantly increased the number of multiple births (Janvier et al. 2011 J. Pediatr. 159, 409–413). A potential solution to this problem is to develop improved methods for embryo selection to permit single-embryo transfer. Identification of a noninvasive technique to assess embryo implantation potential in assisted reproduction would greatly increase success rates and lead to more efficient single-embryo transfer. The aim of this study was to assess whether there are metabolic differences among embryos produced by IVF and embryos obtained by

Embryo Culture


159

parthenogenetic activation. Matured bovine cumulus-oocyte complexes were fertilized in vitro according to our standard procedures (Rubessa et al. 2011 Theriogenology 76, 1347–1355). Presumptive zygotes were placed in individual drops of 50 mL of SOF. Zygotes were incubated in a humidified mixture of 5% CO2, 6% O2, and 88% N2 in air at 398C. For the parthenogenetic group, the oocytes were activated by 5 mM ionomycin in M199 þ 10% FCS for 5 min, and incubation in 2 mM 6-DMAP in M199 þ 10% FCS for 4 h. After 48 h, the zygotes were placed into WOW culture and the drops collected in tubes. The embryos were scored for quality on the basis of morphological criteria. Samples of media (40 mL) were added to 660 mL of a stock solution prepared by dissolving 5.0 mg of sodium 3-(trimethylsilyl)-2,20 ,3,30 -tetradeuteropropionate in 50 mL of deuterium oxide. The sodium 3-(trimethylsilyl)-2,20 ,3,30 -tetradeuteropropionate acted both as a chemical shift reference and as an internal standard for the purposes of quantitation. Samples were analysed on a Varian VNS-750 NB (750 MHz) spectrometer (Agilent Technologies, Santa Clara, CA, USA). Data were statistically analysed with ANOVA using the Generalized Linear Model (GLM) procedure (SAS, version 9, 1999, SAS Institute Inc., Cary, NC, USA), where the independent variable was the sample (IVF or parthenogenetic embryos and control media without embryos). Tukey’s post-hoc test was used to perform multiple comparisons. The P-level was set at 0.05. All data were expressed as quadratic means with standard error of the means. The results, reported in Table 1, show that there were no statistical differences between embryo metabolites with IVF or parthenogenetic activation when we evaluated lactate, formate, myo-inositol, and pyruvate. However, we can see that there are differences when we focused on acetate and citrate. Parthenogenetic embryos produced more citrate than IVF embryos. It is well known that the Krebs cycle produces one molecule of acetate for each molecule of citrate. The present results support that as well with the concentration of acetate being greater in parthenogenetic than in the IVF embryos. These results are a first step in identifying noninvasive, quantitative parameters that indicate which embryos may be the most viable before transfer.

Table 1. Results (least squares means 6 s.e.) Item IVF Parthenogenetic activation Control

134

Myo-inositol

Citrate

2.36 0.03 2.4 0.03 2.42 0.06

0.24 0.01 0.19 0.01B 0.2 0.03B

A

Pyruvate

Lactate

Acetate

Formate

0.45 0.02 0.47 0.20 0.36 0.04

2.76 0.04 2.73 0.04 2.83 0.08

0.55 0.02 0.68 0.02B 0.59 0.05B

A

0.16 0.01 0.17 0.01 0.16 0.02

SERIAL TREATMENT OF RESVERATROL-TROLOX IMPROVED EMBRYONIC DEVELOPMENT OF PORCINE PARTHENOTES

S. H. LeeA, E. J. ParkA, J. H. MoonA, K. Y. SongA, S. J. KimA, J. K. ChoB, and B. C. LeeA A

Department of Theriogenology and Biotechnology, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, Republic of Korea; B College and Institute of Veterinary Medicine, Chungnam National University, Daejeon, Republic of Korea

Antioxidants are widely used for in vitro production of embryos due to their activity as reactive oxygen species scavengers. Among various antioxidants, resveratrol supplementation in in vitro-maturation (IVM) media and trolox supplementation in in vitro-culture (IVC) media improves oocyte maturation and embryonic development in other species, such as cattle and sheep. Limited information is available, however, on the effect of resveratrol and/or trolox on porcine embryos produced in vitro. In this study, we evaluated the effect of resveratrol supplemented to the media of IVM and trolox treatment during IVC on porcine parthenotes. We used TCM-199 as IVM media and porcine zygote medium (PZM)-5 as IVC media. For activation, matured oocytes after 44 h of IVM were electrically activated with 280 mM mannitol and cultured in IVC medium (PZM-5). Statistical analyses of all data were carried out using SPSS 17.0 (one-way ANOVA, followed by Duncan’s multiple range test). In the experiment 1, a total of 618 oocytes were used in 4 independent replicates to evaluate the effect of 4 different concentrations (0, 1, 2, or 4 mM) of resveratrol during IVM on parthenotes. Oocytes treated with 2 mM resveratrol during IVM had significantly higher cleavage rates and blastocyst formation rates (73.0 and 34.4% v. 64.0 and 18.3%, respectively) than the control group. Experiment 2 involved supplementation with trolox (0 mM, 100 mM, 200 mM, 400 mM) to 957 parthenotes during IVC for 7 days (4 replicates). Cleavage rates significantly increased in the 100 mM group (75.6 v. 69.1%), and blastocyst formation rates in the 200 mM group were significantly higher compared to the control group (33.7 v. 23.8%). To determine the combined effects of resveratrol treatment during IVM and trolox treatment during IVC, in the experiment 3 we selected an optimized concentration (2 mM of resveratrol and 200 mM of trolox) from each experiment and evaluated the combined effects (3 times replicated). We designed 4 groups: (1) control, (2) resveratrol only (R), (3) trolox only (T), and (4) resveratrol-trolox (R-T). The R group and R-T group showed significantly higher cleavage rates than the control group (81.8 and 83.1% v. 72.3%). All treatment groups showed significantly increased blastocyst formation rates compared with the control group (39.2, 37.8, and 38.4% v. 23.7%). There is no significant difference in total cell numbers of blastocyst among the control, R, and T groups (47.8 v. 54.2 v. 54.7). However, the R-T group had significantly more cells than the control group (67.1 v. 47.8). Our results suggest that 2 mM resveratrol treatment during IVM, followed by 200 mM trolox treatment during IVC, improves developmental potential of the parthenotes. For a further study, we will apply this condition to somatic cell nuclear transfer, and we also will verify quantitative PCR analysis of apoptosis-related mRNA expression of PA and somatic cell nuclear transfer embryos. This study was supported by the MOTIE (#10033839), IPET (#311011-05-3-SB010), Research Institute for Veterinary Science, TS Corporation, and the BK21 plus program.

160

135


Embryo Culture

EFFECT OF L-ERGOTHIONEINE SUPPLEMENTATION DURING CULTURE ON IN VITRO EMBRYO DEVELOPMENT IN BUFFALO (BUBALUS BUBALIS ) G. Zullo, A. Salzano, G. Bifulco, V. Longobardi, G. Albero, G. Neglia, and B. Gasparrini Department of Veterinary Medicine and Animal Production, Federico II University, Naples, Italy

It is known that in vitro mammalian embryo development is negatively affected by the increased oxidative stress occurring under culture conditions. The oxidative damage of cell components via reactive oxygen species interferes with proper cell function. Buffalo embryos are particularly sensitive to oxidative stress because of their high lipid content (Boni et al. 1992 Acta Med. Vet. 38, 153–161). L-Ergothioneine (LE) is a powerful scavenger of hydroxyl radicals (OH) and an inhibitor of iron or copper ion-dependent generation of OH from hydrogen peroxide (H2O2). The aim of this study was to evaluate whether enriching the in vitro-culture medium with LE improves in vitro embryo production efficiency in buffalo. Abattoir-derived buffalo oocytes (n ¼ 854, over 6 replicates) were in vitro matured and fertilized according to standard procedures (Gasparrini et al. 2006 Theriogenology 65, 275–287). Twenty hours after IVF presumptive zygotes were cultured in SOFaa supplemented by 8 mg mL1 BSA in a controlled gas atmosphere consisting of 5% CO2, 7% O2, 88% N2, in humidified air, at 38.58C with 0 (control; n ¼ 214), 0.05 mM LE (n ¼ 217), 0.1 mM LE (n ¼ 204), and 1 mM LE (n ¼ 219). Cleavage rate was assessed at the time of change of culture (Day 5) and the cleaved elements were cultured for a further 2 days. The embryos obtained by the end of culture, i.e. on Day 7 post-IVF, were scored for quality, based on morphological criteria, and for developmental stage, as previously described (Robertson, Nelson 2010 Manual of the International Embryo Transfer Society 86–105). The percentages of total transferable embryos and Grade 1 and 2 blastocysts in relation to cleaved oocytes were recorded. Because the chronology of development is known to be one of the most reliable parameters for assessing quality, the percentage of fast-developing embryos, i.e. hatched and expanded blastocysts, was also recorded. Data were analysed by Chi-squared test. Cleavage rate was not affected by the treatment (71.4, 66.8, 68.7, and 63.0%, respectively, with 0, 0.05, 0.1, and 1 mM LE). The total embryo output increased in groups supplemented with 0.05 and 0.1 mM LE (31.3, 42.2, 43.8, and 21.7%, respectively, with 0, 0.05, 0.1, and 1 mM LE; P , 0.05). However, the enrichment of in vitro culture with 0.1 mM LE also increased the percentage of Grade 1 and 2 blastocysts compared with the control and to 1 mM LE (21.6, 30.9, 33.9, and 21.7%, respectively, with 0, 0.05, 0.1, and 1 mM LE; P , 0.05). Likewise, 0.1 mM LE gave higher percentages of fast developing embryos than the control and 1 mM LE groups. In conclusion, these results demonstrated a beneficial effect of LE during culture on buffalo in vitro embryo development. The dose response trial indicated that the optimal concentration is 0.1 mM that also influenced the chronology of development and hence embryo viability.

136

INVESTIGATION OF LEPTIN ON DEVELOPMENT OF MOUSE EMBRYOS A. C. Taskin, A. Kocabay, and M. Yucel Koc University, College of Sciences, Istanbul, Turkey

Leptin is a hormone-like protein of 167 amino acids. As an adipocyte-related hormone it has an important role in weight regulation and physical fitness but also has effects on reproductive and other physiological mechanisms. The aim of the present study was to investigate the effects of different concentrations of leptin added to the culture media, the quality, in vitro development rate, and in vivo rate of mouse embryos. Superovulated CB6F1 (C57BL/6XBalb/c) hybrid female mice (5–6 weeks of age) were killed ,18 to 20 h after hCG administration. Single-cell embryos were flushed from the oviducts of the dead mice with human tubal fluid medium supplemented with HEPES and 3 mg mL1 of BSA. They were cultured in Quinn’s cleavage medium supplemented with 4 mg mL1 of BSA in 5% CO2, 378C until reaching 2-cell stage. The 2-cell embryos were randomly divided into 4 groups and cultured in Quinn’s blastocyst medium supplemented with 4 mg mL1 BSA þ 0, 10, 50, and 100 ng mL1 leptin (L0, L10, L50, and L100) in 5% CO2, 378C until the blastocyst stage. Some of the developing blastocysts were used for differential staining for the inner cell mass and trophectoderm (TE) cells [Mallol et al. 2013 Syst. Biol. Reprod. Med. 59,117–122]. Some of them were transferred into pseudopregnant females (CD1) on the 2.5 to 3.5th days and kept until the 13.5th day of pregnancy for the in vivo development rate. The results were evaluated using one-way ANOVA with Bonferroni post-hoc test in SPSS 22.0. The P-values ,0.05 were considered statistically significant. Each experiment was repeated at least 4 times. The blastocyst development rates of L0, L10, L50, and L100 were 92.57% (162/175), 97.16% (205/211), 97.80% (178/182), and 97.85% (182/186), respectively. The in vitro development rates were significantly higher in the L10, L50, and L100 compared with L0 (P , 0.05). The inner cell mass cells of L0, L10, L50, and L100 were 13.17, 14, 16, and 15.43. There was no significant difference between the groups in terms of inner cell mass cells (P . 0.05). The TE cells of L0, L10, L50, and L100 were 47, 56.4, 53.7, and 58.57, respectively. The TE numbers were significantly increased in the presence of L10 and L100 compared with L0 (P , 0.05). The in vivo development rates of L0, L10, L50, and L100 were 13.51% (5/37), 48.72% (19/39), 15.38% (6/39), and 41.03% (16/39), respectively. The in vivo development rates of L10 and L100 were significantly higher than for L0 and L50 (P , 0.05). The resorption rates of L0, L10, L50, and L100 were 10.8% (4/37), 30.8% (12/39), 12.8% (5/39), and 20.5% (8/39), respectively. There was no significant difference between the groups in terms of the resorption rates (P . 0.05). This study found that L10, L50, and L100 were supporting the development of the embryos in the in vitro culture. The L10, L50, and L100 significantly increased the total cell numbers. The L10 and L100 were particularly effective on the number of the TE cells. In conclusion, 10 and 100 ng mL1 leptin have a positive effect on the in vitro, quality and in vivo development of the mouse embryo. Therefore, leptin seems to play an important role on the embryo development and in vivo development. Research supported by TUBITAK-113O223.

Embryo Manipulation


161

Embryo Manipulation 137

SPLITTING OF IVP BOVINE BLASTOCYST AFFECTS MORPHOLOGY AND GLOBAL GENE EXPRESSION OF RESULTING DEMI-EMBRYOS DURING ELONGATION A. E. Vela´squez, D. Veraguas, J. F. Cox, F. O. Castro, and L. l. Rodriguez Department of Animal Science, Faculty of Veterinary Sciences, University of Concepcion, Chillań, Chile

Embryo splitting has been used since the early 1980s to produce identical twins and increase the pregnancy rate per available embryo. However, very little is known about the effect of splitting on embryo development and competence. Indeed splitting could provoke a negative effect on embryo survival and it can be presumed that each demi-embryo might respond differently to the injury. In this sense, even when embryos are genetically and morphologically identical at the moment of splitting, their developmental potential and molecular characteristics might change as a consequence of the intense manipulation or epigenetic differences due to the interaction with the environment. We have proposed an approach to evaluate the effect of blastocyst splitting on the morphological and gene expression in in vivo development up to the filamentous stage. For that, the effect of splitting on bovine embryo development was evaluated during the elongation period by transferring split and nonsplit IVF-derived blastocysts to cattle recipients and collecting them at Day 17 of development. The number of collected embryos, embryo size, and global gene expression was compared between both groups. Collected elongated embryos derived from split blastocyst were compared with time matched collected control embryos. From 14 transferred hemi-embryos, 5 (35.7%) were collected while 9 elongated from 17 controls were recovered (52.9%). Neither the recovery rate nor the average length of the elongated embryos was significantly different between the two treatments. However, when embryos were rated depending on their size, more than 50% of embryos from the control group had a length surpassing 100 mm, while only 33% of the split embryos reached that size. Global gene expression was performed using 2-colour microarray-based gene expression analysis. This was a whole-genome microarray study comparing 10 individual elongated embryos derived from split and nonsplit IVF blastocysts. Genes were considered differentially expressed if the fold change is greater than 2 (up or down-regulation) with P # 0.05. A total of 29 585 transcripts were detected in all embryos. From those, 449 (1.5%) were differentially expressed between elongated embryos derived from split and nonsplit IVF blastocysts, among them, 248 (0.83%) genes were down-regulated and 201 (0.67%) genes were up-regulated in split embryos. Gene ontology analysis identified deregulated genes related with intrinsic component of membrane (ELOVL7, GJA1, LAPTM4B, LDLR, SLC18A2, SLC1A3, SLC38A5, TSPAN13), lipid transporter activity (RBP4, APOA1, MTTP), and organophosphate ester transport (GJA1, GJB1, ATP9B). In conclusion, we showed that splitting affect the in vivo developmental capability and gene expression profile during the elongation period of bovine embryos. However, further studies are needed to determine the longterm effect of this technique to produce viable offspring. This work was partially supported by Fondecyt No. 11100082 and Fondequip No. EQM12113 from the Ministry of Education of Chile.

138

DEVELOPMENTAL COMPETENCE OF BIOPSIED AND SPLIT BOVINE EMBRYOS

M. ReichenbachA, S. JungB, R. FriesB, E. Wolf C, C. GschoedererA, J. ScherzerA, T. GruppA, and H.-D. ReichenbachD A

Bayern-Genetik GmbH, Grub, Bavaria, Germany; Chair for Animal Breeding, Technische Universita¨t Mu¨nchen, Freising, Bavaria, Germany; C Chair for Molecular Animal Breeding and Biotechnology, Ludwig-Maximilian University, Munich, Bavaria, Germany; D Bavarian State Research Center for Agriculture, Institute of Animal Breeding, Grub, Bavaria, Germany B

The aim of the present study was to develop a reliable method to simultaneously split and biopsy valuable bovine embryos for a complete genomic evaluation (gender, polledness, and hereditary abnormalities) and to estimate the breeding value of progeny for traits of economic importance immediately after embryo recovery. A total of 208 good quality embryos collected from superovulated German Simmental animals were biopsied immediately after recovery using an inverse microscope (Zeiss, Germany) at 50 magnification with a single-use steel blade mounted on a holder (Bausch & Lomb, Germany) attached to a micromanipulator (Eppendorf, Germany). Biopsy was performed either by splitting the embryo and cutting of one-third of a half [G1: morulae (M), n ¼ 50; early blastocysts (EB), n ¼ 24; blastocysts (B), n ¼ 16], by just splitting in equal halves (G2: M, n ¼ 16; B, n ¼ 2), or by cutting of just a small biopsy of the embryo (G3: M, n ¼ 53) or of the trophoblast (G3: EB, n ¼ 19; B, n ¼ 28). Biopsied cells were immediately used for DNA amplification. Biopsied embryos (E) and demi-embryos (DE) were in vitro cultured in SOF, under mineral oil, at 398C and 5% CO2, 5% O2, 90% N2 for 24 h, after which survival was recorded. Survival rate of G1 (survival of at least 1 DE: M, 98.0%; EB, 100.0%; B, 93.8%), G2 (survival of DE: M, 75.0%; B, 100.0%), and G3 (embryo survival: M, 96.3%; EB, 100.0%; B, 96.4%) were similar, but in relation to the number of original embryo the highest ratio of DE was obtained in G1 (1.67) v. G2 (0.88) and G3 (0.97; G1:G2/G3; P , 0.01). Within G1, the highest ration to the original number of embryos was by using M (1.78), followed by EB (1.75) and B (1.19; M/EB:B; P , 0.05). To verify the viability of biopsied embryos some DE from G1 (1, the nonbiopsied DE, n ¼ 7, or 2, the biopsied and the nonbiopsied DE per recipient, n ¼ 21), G2 (1 DE per recipient, n ¼ 13), and G3 (1 E per recipient, n ¼ 8) were transferred after 24 h of culture. Overall pregnancy rate (Day 42) of G1, G2, and G3 was 64.3, 23.1, and 50.0%, respectively (G1 : G2; P , 0.05). In G1, pregnancy rates (Day 42) of biopsied embryos differed significantly if either 1 or 2 DE were transferred per recipient (28.6 v. 76.2%, respectively; P , 0.05). A twin pregnancy rate of 38.9% was observed by ultrasonography in recipients when 2 DE were transferred. The results suggest that high survival rates can be obtained with the G1 technique, and splitting during biopsy can increase productivity in programs aimed to evaluate the genomic constitution of early stage embryos. Funded by the Bayerische Forschungsstiftung (AZ-1031-12).

162


139

Embryo Manipulation

EFFICIENT CONDITIONS OF CYTOPLASMIC MICROINJECTION OF FOREIGN DNA TO GENERATE PORCINE TRANSGENIC EMBRYOS D. B. O. Malaweera, G. Y. Kim, S. Ramachandra, J. Y. Jung, Y. W. Lee, and J. K. Cho College of Veterinary Medicine, Chungnam National University, Yuseong-gu, Daejeon, Republic of Korea

To establish the efficient cytoplasmic microinjection system in the porcine embryos, pEGFP-N1 plasmid were microinjected into porcine parthenogenetic (PA) and in vitro-fertilized (IVF) embryos to investigate the optimal injection time, volume, and concentration. In experiment 1, to investigate the optimal injection time, development rates were compared among groups of 4 different time durations (2, 4, 6, and 8 hours) in the PA and IVF embryos with time point after activation and sperm removal, respectively. There were no significant differences (P , 0.05) between the 4 groups regarding the cleavage rates. However, there were significant differences (P , 0.05) in development to the blastocysts (4.4, 8.9, 3.9, 0.6%) and GFP expression in blastocysts (1.3, 5.7, 2.3, 0.0%), which was injected after postactivation of 4 hours compared with another 3 groups. The IVF embryos injected after 2 and 4 hours expressed GFP significantly higher than the other two groups, which injected at 6 and 8 hours (P , 0.05). In experiment 2, EGFP-N1 with 2 different concentrations (20 and 50 ng mL1) was injected in the PA and IVF embryos to investigate the optimal concentration. In PA embryos, there were significant differences in 20 ng mL1-injected embryos, which had higher cleavage (58.8 v. 41.9%) than blastocysts (13.0 v. 11.1%) and GFP expression rates (P , 0.05). In IVF embryos, GFP were expressed only in 20 ng mL1 embryos, GFP (4.2%) in the blastocysts showed no significant difference in the cleavage (77.3 v. 64.7%) and blastocyst rates (26.4 v. 23.5%). In experiment 3, three different volumes (5, 10, and 20 pL) were microinjected into porcine embryos to determine the most appropriate volume. Out of 3 groups, significantly higher development rates of cleavage (68.3, 58.0, 29.3%), blastocysts (11.7, 12.7, 0.5%), and GFP-expressed blastocysts (2.9, 7.8, 0.0%) were shown in the 10-pL group (P , 0.05). In conclusion, these results imply that a 20 ng mL1 concentration, 10 pL of volume, injection 4 hours after activation for PA embryos, as well as injection 2 and 4 hours after sperm removal, a 20 ng mL1 concentration, and 10 pL of volume for IVF embryos were more effective cytoplasmic microinjection conditions.

140

EFFECTIVENESS OF WASHING PROCEDURES FOR REMOVING BRUCELLA ABORTUS FROM IN VIVO-DERIVED WOOD BISON EMBRYOS J. M. PalominoA, M. P. CervantesA, G. MastromonacoB, R. J. MapletoftA, B. AllanC, and G. P. AdamsA A

Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, SK, Canada; B Reproductive Programs & Research, Toronto Zoo, ON, Canada; C Vaccine and Infectious Disease Organization, Saskatoon, SK, Canada

Endemic brucellosis threatens wild herds of wood bison (Bison bison athabascae) in and around Wood Buffalo National Park, the largest genetic reserve of wood bison in the world. The overall goal of our project was to produce and preserve disease-free embryos for the purpose of conserving the genetic diversity of this species. The aim of the present experiment was to determine the effectiveness of washing procedures for removing Brucella bacteria from in vivo-derived wood bison embryos exposed in vitro to the pathogen. Wood bison cows were given 300 mg im of Folltropin diluted in 0.5% hyaluronan on the day of follicle wave emergence (Day 0) and 100 mg im of hyaluronan on Day 2, and then given 2500 IU im of hCG on Day 5 and inseminated 12 and 24 h later. Embryos were collected on Day 13. The experiment was done in 6 replicates (n ¼ 4 bison/replicate) and an average of 9 embryos/replicate were collected. Zona pellucida-intact embryos were kept in holding medium (PBS þ 2% fetal calf serum) and transported to a Biosafety Level 3 laboratory at the International Vaccine Centre, University of Saskatchewan. Embryos were transferred through 5 aliquots of holding medium to remove any contaminant before exposure to Brucella. Embryos were divided equally into 2 Petri dishes (representing later wash groups with v. without antibiotics) containing 2.7 mL of holding medium (n ¼ 2 to 7 embryos per dish/replicate). In a Class II biosafety cabinet, Brucella abortus biovar 1 (1 107 to 1 109 CFU mL1 in 0.3 mL) was added to each Petri dish and incubated for 2 h at 378C in 8% CO2. A sample of holding medium was taken before exposure and after incubation for culture as negative and positive controls, respectively. After incubation, embryos in each Petri dish were subjected to a 10-step washing procedure (according to the IETS Manual, 2010) using wash medium (PBS þ 0.4% BSA) without antibiotics or with antibiotics (100 IU mL1 of penicillin þ 100 mg mL1 of streptomycin). The embryo wash medium was cultured at wash steps 1, 3, 6, and 9. After the tenth wash, the zona pellucida of each embryo was ruptured mechanically using a glass pipette and embryos were cultured individually. Culturing of samples was done on sheep blood agar and specific identification of Brucella organisms was done by PCR. Brucella abortus was detected in 3 embryos from the group washed in medium without antibiotics (3/27), whereas all embryos washed in medium with antibiotics were culture negative (0/27). Brucella abortus was not detected in wash media after the third wash in either group (with or without antibiotics). In summary, Brucella abortus was removed from 89% of in vitro-exposed wood bison embryos using the washing procedure without antibiotics, and from 100% using the washing procedure with antibiotics. Results validate the embryo washing technique for producing Brucella-free wood bison embryos. Thanks to the Canadian Food Inspection Agency for the field strain of Brucella abortus, Bioniche AH for Folltropin and embryo collection supplies, Merck AH for hCG (Chorulon), and Intervac/VIDO for technical and logistical support.

141

EFFECT OF LASER-ASSISTED EMBRYO BIOPSY AND DEVELOPMENTAL STAGE ON EMBRYO SURVIVAL AT TERM IN SHEEP J. L. AlabartA, B. LahozA, P. SańchezA, J. FolchA, J. H. CalvoA,B, and M. J. CoceroC A

CITA de Aragoń, Zaragoza, Spain; B ARAID, Zaragoza, Spain; C INIA, Madrid, Spain

A biopsy procedure causing minimal injury to embryos is essential to exploit the possibilities of the preimplantation genetic diagnosis in sheep biotechnologies. The effect of laser-assisted embryo biopsy on embryo survival at term was studied in ovine in vivo-derived embryos recovered at 2 different developmental stages. We used 294 embryos (quality scores 1 and 2; IETS manual, 1998 Edition) at the stages of compact morula (n ¼ 136)

Embryo Transfer


163

or blastocyst (n ¼ 158) recovered from superovulated Rasa aragonesa ewes at Day 8 after sponge removal. Embryos from each donor ewe were either biopsied (n ¼ 160; 76 compact morulas and 84 blastocysts) or directly incubated at 38.58C in TCM199 and 5% CO2/air (n ¼ 134; 60 compact morulas and 74 blastocysts) during 18 to 22 hours before transfer. During biopsy, embryos were held by a holding pipette (15 mm internal diameter) in Dulbecco’s phosphate-buffered saline without bovine serum albumin (100-mL microdrops). A 40 objective equipped with an infrared laser (1480 nm; 300 mW; XYClone, Hamilthon-Thorne, Parallabs Ltd, St Albans, UK) was used to open a hole in the zona pellucida by one 1-ms laser pulse. Whenever possible, only extruded cells were aspirated through the hole (usually, 3 to 10 cells) using a rounded-end aspiration pipette (19 mm internal diameter). In embryos without sufficient observable extruded cells, the cell mass was aspirated throughout the hole and a portion of the protruded part was ablated using one or several laser pulses of up to 2.4 ms. When performed in blastocysts, cell ablation was carried out in the trophoblastic region opposite to the inner cell mass. After biopsy, embryos were incubated in the same conditions as non-biopsied embryos. Embryos reaching the expanded or hatching/hatched blastocyst stages after culture were transferred in pairs to synchronized recipient ewes. Percentages were analysed by ANOVA for categorical variables using the CATMOD procedure of SAS. The percentage of arrested embryos tended to be higher (P , 0.07) in compact morulas either biopsied (11.8%) or not (10.0%) than in blastocysts (4.8 and 5.4%, respectively). The effects of the biopsy procedure and its interaction with the developmental stage were not significant (P , 0.85 and P , 0.70, respectively). The survival rate at term of the transferred embryos was similar in biopsied and nonbiopsied embryos (P , 0.31), either at the compact morula (62.7 and 72.2%, respectively) or the blastocyst (72.5 and 74.3%) stages. The effects of the developmental stage and its interaction with biopsy were not significant (P , 0.29 and P , 0.49, respectively). The effects of biopsy procedure and its interaction with the developmental stage were not significant (P , 0.33 and P , 0.44, respectively). In conclusion, the procedures presented here allow performing embryo biopsy with minimal injury, either in the compact morula or blastocyst stages. These results highlight the usefulness of laser in embryo biopsy.

142

MOPHOLOGICAL EVALUATION OF CANINE EMBRYOS OBTAINED IN VIVO

C. R. de F. GuaitoliniA, A. A. P. DerussiA, R. VolpatoA, C. L. AckermannA, L. M. MatsubaraA, R. R. D. MazieroA, M. J. SudanoB, L. M. AgostinhoA, F. da C. Landim-AlvarengaA, and M. D. LopesA B

A UNESP, Botucatu, Saõ Paulo, Brazil; UNIPAMPA, Uruguaiana, Rio Grande do Sul, Brazil

The aim of this study was to evaluate re-expansion and ultrastructure of in vivo-produced canine embryos immediately after collection (Co; n ¼ 6) and 24 h after in vitro culture (Co24; n ¼ 6). For embryo collection, two bitches in pro-oestrous were monitored every 48 h by vaginal cytology up to the detection of 80 to 90% of superficial cells. Then, they were inseminated 3 times on alternate days with fresh semen from 1 fertile male. Embryo collections were performed after ovariohysterectomies and uterine flushing 12 days after the first artificial insemination. Each uterine horn was flushed 3 times with 60 mL of DPBS at 36 to 378C and collecting embyos in Petri dishes. Embryos culture were performed at 38.58C under an atmosphere with 5% CO2 and maximum humidity, using SOFaa media added with 20% of fetal bovine serum (FBS). Embryo reexpansion was evaluated after 24 h of culture and the embryos were classified as re-expanded or not re-expanded, according the appearance of the blastocoele by stereomicroscopy (Leica MZ 12.5, Leica Microsystems, Wetzlar, Germany). Twelve embryos were collected, 5 from bitch A and 7 from bitch B; 100% of embryos (6/6) showed re-expansion after 24 h of culture. Blastocoele reexpansion was used as an embryo viability marker. The group Co showed perivitelline space and apical surface of blastomeres covered with microvilli, elongated mitochondria, rough endoplasmic reticulum (RER), tight junctions, and a large amount of lipid droplets that was similar to the results previously described in others mammals species. The Co24 group showed the same characteristcs of the group Co at the time of collection, however with a reduction of lipid droplets and the presence of myelinic structures. In conclusion, the lipid droplet reduction and presence of myelinic structures after 24 h of in vitro culture may indicate lipid consumption associated with embryo expansion.

Embryo Transfer 143

JAPANESE BLACK (WAGYU) CATTLE MULTIPLE-OVULATION EMBRYO TRANSFER: FOLLICLE-STIMULATING HORMONE SOURCE IN A CASE STUDY IN SOUTH CHINA F. DuA, X. MaB, B. XuB, Y. WangB, Y. LiA, L.-Y. AnA, L. YangB, and G. A. PresicceC A

College of Life Sciences, Nanjing Normal University, Nanjing, China; B Lannuo Biotechnologies, Wuxi Inc., Wuxi, China; C ARSIAL, Rome, Italy

The Japanese Black cattle (Wagyu) plays a significant part in the Japanese beef industry because it is numerically the largest breed group and comprises ,93% of the national purebred beef cow herd. Japanese Black cattle are genetically predisposed to intense marbling and to a high percentage of unsaturated fat resulting in a meat characterised by both high quality and price on the market. Like other breeds, genetic improvement and production traits in Wagyu can be fostered by the implementation of traditional reproductive strategies such as multiple-ovulation embryo transfer. A multiple-ovulation embryo transfer case study was performed in a leading production centre in Hainan island, South China. Donors (n ¼ 40) were split into 2 groups receiving either a total dose of 400 mg of FSH Folltropin (FSH USA; Folltropin Bioniche Inc., USA; n ¼ 24), or 10 mg of an FSH formulation produced from the Institute of Zoology of the Chinese Academy of Sciences (FSH CHN; n ¼ 16). In both cases, dosages were equally distributed over a 4-day administration schedule. Both donors and recipients (198 heifers) were synchronized for fixed-time embryo transfer (ET) and AI, respectively, by adopting the Ovsynch protocol. Such protocol consists of GnRH administration at Day 0, followed by prostaglandin administration at Day 7 and a second administration of GnRH at Day 9. Artificial insemination was performed on donor animals at

164


Embryo Transfer

12 and 24 h from the last GnRH administration, whereas for recipient synchronization receiving fresh embryos, the second GnRH administration was given at the time of second AI on donors, and ET was performed 7 days following the first AI. Final synchronization at the time of ET, judged by the ultrasonic presence of a functional corpus luteum, was 53% (105/198). The following parameters for FSH USA and FSH CHN were found to be not significantly different (Student’s t; mean s.e.): i) ovulations (10.5 1.2 v. 8.5 1.2; P ¼ 0.2); ii) embryos (6.3 1.2 v. 5.1 1.1; P ¼ 0.5), and iii) embryos from ovulated donors (6.8 1.3 v. 5.8 1.1; P ¼ 0.6). Recovered embryos from the 2 groups were also not different: i) degenerated embryos (1.0 0.4 v. 0.8 0.2; P ¼ 0.6); ii) morula (4.0 0.8 v. 2.6 0.5; P ¼ 0.1), and iii) early blastocysts (4.0 1.2 v. 3.3 0.5; P ¼ 0.6). Blastocysts were recovered only from donors treated with FSH USA. Out of 233 recovered embryos, 34 were transferred as fresh and 71 as frozen/ thawed. Pregnancy rate at 60 days following ET for fresh and frozen/thawed embryos was 47.1 and 35.2%, respectively (P ¼ 0.2). Within frozen embryos, pregnancy rates derived from transferred morulas and blastocysts were 25 and 45.5% (P ¼ 0.07). When considering the two sources of hormones, overall pregnancy rates were similar between the two groups (28/71, 39.4% v. 13/34, 38.2%; P ¼ 0.9). Finally, pregnancy rates from the transfer of fresh embryos (9/21, 42.8% v. 7/13, 53.8%; P ¼ 0.6) and frozen/thawed embryos (19/50, 38% v. 6/21, 23.8%; P ¼ 0.6) were also not different. In conclusion, all parameters in this study did not differ between the 2 sources of FSH; however, a lower incidence of degenerated embryos and a higher pregnancy rate following transfer of frozen/thawed embryos occurred when FSH USA was used in donor animals.

144

PREGNANCY RATES FOLLOWING THE TRANSFER OF IN VITRO FERTILIZED EMBRYOS TO RECIPIENTS ON DAY 6, 7, OR 8 AFTER OESTRUS R. C. FryA, K. L. FryA, H. A. McCartneyA, W. R. GeddesB, and K. GeddesB B

A SpeedBreed, Melbourne, Victoria, Australia; Doonside, Rockhampton, Queensland, Australia

The aim of this experiment was to investigate the effect of day of synchrony on the pregnancy rate of recipients following the transfer of Day 7 IVF embryos. In addition, the effect of IVF embryo grade and corpus luteum (CL) grade of recipients was determined. A total of 317 cumulus-oocyte complexes collected from 24 dry Brahman cows by TVR were matured, fertilized, and cultured under standard in vitro production procedures (Fry et al. 2003 Theriogenology 59, 446). A total of 89 (44 Grade 1, 43 Grade 2, and 2 Grade 3, IETS classification) in vitro-produced embryos were transferred to parous 4- to 9-year-old dry Brahman cross recipient cattle 7 days after IVF. Two groups of recipient cows were synchronised one day apart with an 8-day CIDR/pg protocol so that oestrous would be concentrated over 3 days with the middle day aligning with the day of IVF (Day 0). Donors that produced a large number of IVF embryos had these divided and transferred into recipients either on Day 1 or Day þ1 of synchrony, and those producing less than 4 IVF embryos were transferred into recipients on Day 0. At embryo transfer the ovaries of the recipient were palpated and then scanned by rectal ultrasound and the grade of CL noted (Grade 1 ¼ large distinct CL by palpation, Grade 2 ¼ small distinct CL by palpation, Grade 3 ¼ CL not distinguishable by palpation). Pregnancy was diagnosed by ultrasound scanning on Day 92. Although recipient numbers were low, differences in pregnancy rate between groups were analysed by Chi-squared. Data from the 2 Grade 3 embryos transferred were not included in the analysis (0/2 pregnant). Similar (P . 0.05) pregnancy rates were found when Day 7 IVF embryos were transferred to either Day 6 (17/32 ¼ 53%), Day 7 (9/24 ¼ 38%), or Day 8 (14/31 ¼ 45%) recipients. Furthermore, neither the grade of the embryo (Grade 1: 20/44 ¼ 45%, Grade 2: 20/43 ¼ 47%) nor the grade of recipient CL (Grade 1: 17/45 ¼ 38%, Grade 2: 17/29 ¼ 59%, Grade 3: 6/13 ¼ 46%) effected pregnancy rate (P . 0.05). This experiment demonstrates the flexibility of the IVF embryo to achieve an acceptable pregnancy rate over a range of recipient stages thereby allowing a high usage rate of good-quality recipients in an IVF embryo transfer program.

145

THE INFLUENCE OF PROPYLENE GLYCOL DRENCHING ON THE SUPEROVULATORY RESPONSE AND EMBRYO QUALITY IN HIGH-YIELDING DAIRY COWS T. Othman, S. Ismael, and M. Ayoub Faculty of Veterinary Medicine, Cairo University, Giza, Egypt

Genetic improvement of dairy cows increased markedly over the last decades; this has marked increased milk yield, which has been associated with reduced fertility parameters. The objective of this study was to determine the effects of feeding propylene glycol (PG) on superovulatory responses of 50 dairy cows and on their embryo quality and quantity. Starting at 1 week before the application of superovulatory regimen, each cow received once daily an oral dose of 150 g of PG (PG group) or water (control group). All cows were superovulated with a total dose of 400 mg of FSH administrated twice daily in decreasing doses over 4 consecutive days. Embryos were recovered nonsurgically 7.5 days after the onset of oestrus using a 2-way catheter. Evaluation of embryo quality was done according to the IETS manual based on 1 to 4 grades. Grade 1 embryos were transferred after freezing; grade 2 and 3 embryos were freshly transferred. The results showed that the number of total ova/embryos recovered, grade 1 embryos, and the number of transferable embryos were significantly higher (P ¼ 0.048, 0.015, and 0.014, respectively) in the PG group (10.33 1.9, 7.08 1.7, and 7.92 1.6, respectively) when compared with control group (6.09 0.9, 2.11 0.45, and 3.92 1.25, respectively). Insignificant increase in grade 2 and grade 3 embryos was indicated in the control group (1.37 0.3 and 0.51 0.18, respectively) when compared with PG group (0.75 0.28 and 0.25 0.13, respectively). On the other hand, the results indicated that there was an increase in the number of degenerated embryos and unfertilized ovum in the PG group (2.33 0.85) compared with control group (2.09 0.6). In conclusion, these results suggested that administration of PG has the ability to positively improve the superovulatory response and embryo quality in high-yielding dairy cows.

Embryo Transfer

146


165

QUANTIFICATION OF PEPTIDE GROWTH FACTORS IN CATTLE UTERINE FLUID BY MULTIPLE REACTION MONITORING-LIQUID CHROMATOGRAPHY-TANDEM MASS SPECTROMETRY

E. Go´mezA, F. J. CorralesB, M. I. MoraB, E. CorreiaA, S. CarroceraA, D. MartinA, J. N. CaamanõA, and M. MunõzA B

A SERIDA, Centro de Biotecnologıá Animal, Spain; CIMA, Universidad de Navarra, Pamplona, Navarra, Spain

Multiple reaction monitoring (MRM) allows targeted quantitative proteomics with a wide dynamic range and limit of detection down to femtomoles. We used MRM to study uterine growth factors (GF) presumed to promote embryonic development. A validated experimental model was used to recover uterine fluid (UF) and analyse GF expression in the presence or absence of embryos. Briefly, Day-6 in vitro-produced embryos (n ¼ 50) or vehicle (sham transfer) were transferred into the uteri of each oestrus-synchronized Holstein heifer (n ¼ 14) during nonconsecutive cycles. Blood P4 concentrations were measured on Days 0 (oestrus), 6, and 8. On Day 8, UF was recovered from embryo and sham recipients. After retrieval, UF were centrifuged and supernatants stored at 1458C. Sham and embryo UF selected for MRM were from n ¼ 10 animals (n ¼ 20 samples). Uterine fluid, recovered after embryo transfer, contained on average n ¼ 43.1 5.2 total and n ¼ 34.1 3.7% viable embryos per recipient. For MRM, UF samples were concentrated, and protein was precipitated and resuspended in ammonium bicarbonate. Protein (20 mg) was reduced with DTT, trypsin-digested, and desalted. Proteotypic peptides for targeted GF were selected with MRM Pilot software (ABsciex, Farmingham, MA, USA), with 3 to 5 transitions programmed for each peptide. A control, unrelated synthetic peptide was spiked as an internal standard. The area of the larger transition for the control peptide was used to normalise the area values of each other peptide. The MRM experiments were performed on a 5500 QTRAP hybrid triple quadrupole/linear ion trap mass spectrometer (ABsciex) equipped with an Eksigent 1Dþplus nanoLC chromatographic system. Data analysis was performed with Analyst 1.5.2 and MultiQuant 2.0.2 softwares (ABsciex). The area of most abundant transition for each analysed peptide was used for relative quantitation. Proteins studied were betacellulin, heparin-binding EGF-like growth factor, neuregulin, artemin, connective tissue growth factor, nerve growth factor, kit ligand, stanniocalcin-1 (STC1), early pregnancy factor (EPF), and hepatoma-derived growth factor (HDGF). Proteotypic peptides were identified in all samples for HDGF, kit ligand, STC1, and EPF (n ¼ 1, n ¼ 1, n ¼ 1, and n ¼ 3 peptides, respectively), which precluded the analysis of the remaining GF. No differences in relative abundance were detected between UF containing or not containing embryos for HDGF, kit ligand, STC1, and EPF (2.85 0.6 v. 4.43 0.6; 0.15 0.02 v. 0.16 0.02; 0.03 0.00 v. 0.04 0.00; and 1.20 0.16 v. 1.09 1.16, respectively). However, STC1 and Day 8 blood P4 were highly correlated (r ¼ 0.71; P ¼ 0.0004), suggesting P4 regulation of STC1. Multiple reaction monitoring-LC-MS/MS is a useful technique to identify some scarce GF in UF at different dynamic ranges. MICINN, project AGL2012-37772 and FEDER. E. C. was supported by MEC-FPU-AP2009-5265. The authors are members of the COST Action FA1201 Epiconcept: Epigenetics and Periconception environment.

147

SOFTWARE FOR MORPHOLOGICAL CLASSIFICATION OF CATTLE BLASTOCYSTS F. D. Matos, J. C. Rocha, and M. F. G. Nogueira Saõ Paulo State University – UNESP, Assis, SP, Brazil

Embryonic morphological classification has great importance for numerous laboratory techniques (from basic to applied research in assisted reproduction). However, the method used to perform the classification of embryos in varying degrees of quality has always been based on the subjectivity of the evaluator. Although quality standards and descriptions of morphological characteristics that categorize an embryo in each grade are established, currently there is not an accurate method that can generate consistent and reliable results. Thus, our work resulted in the development of software able to perform the classification of morphological quality of bovine blastocysts. Artificial intelligence techniques (such as artificial neural networks) were used in the development. Results indicate an overall accuracy of 79.2% in the classification of bovine blastocysts in 3 degrees of quality. For blastocysts classified as excellent or good (class 1), the hit rate is 82.6%; for blastocysts classified as regular (class 2), the hit rate is 16.7%; and for blastocysts classified as poor (class 3), the hit rate is 91.7%.

148

EXPRESSION OF ARTEMIN IN THE BOVINE ENDOMETRIUM, UTERINE FLUID, AND EARLY EMBRYOS M. Munõz, D. Martıń, J. N. Caamanõ, S. Carrocera, and E. Go´mez SERIDA, Gijoń, Asturias, Spain

Artemin, a member of the glial cell line-derived neurotrophic factor (GDNF) family, is expressed in human and mice pre-implantation embryos and reproductive tract (Li et al. 2009 FEBS Lett. 583; Kawamura et al. 2012 PLoS One 7). In mice, artemin promotes in vitro embryo development and decreases apoptosis (Li et al. 2009 FEBS Lett. 583). The presence of artemin in cattle embryos and endometrium, however, is unknown. In this work we analysed artemin expression in bovine blastocysts and endometrium by immunohistochemistry and in uterine fluid (UF) by Western blot (WB). Briefly, Day-6 in vitro-produced (IVP) embryos (n ¼ 50) were nonsurgically transferred to the uterus of heifers (n ¼ 10, 50 IVP embryos per heifer) at nonconsecutive oestrus cycles. On Day 8, embryos and their corresponding diluted UF were flushed; blastocysts that developed entirely in vitro were also collected. In addition, endometrial samples were collected on Day 8 from slaughtered females that were embryo transferred (n ¼ 6) and sham transferred (n ¼ 6) on Day 5. Artemin localization was investigated in blastocysts and in endometrial samples, using immunohistochemical staining methods described elsewhere (Munõz et al. 2012 J. Proteome Res. 11; Go´mez et al. 2014 Reproduction pii: REP-14–0304). The signal-strength comparisons between uterus-exposed and IVP blastocysts were analysed using the software Confocal Uniovi Image-J. Quantification of WB protein bands was achieved by computer-assisted densitometry using Image-J software. Artemin was detected, with similar intensity, in the inner cell mass

166


Embryo Transfer

and trophectoderm from both uterus-developed and IVP blastocyst. All embryos analysed expressed artemin. The signal intensity and staining pattern observed did not differ between uterus-exposed and IVP blastocysts. In the endometrium, the most intense staining for artemin was localised to the apical sites in the luminal epithelium and in the glandular epithelium of superficial glands. There was also diffuse staining in the stroma and deep uterine glands. The uterine region and pregnant or cyclic status did not affect the artemin staining pattern. Artemin was detected by WB in all UF samples analysed (embryo transferred N ¼ 10, sham transferred N ¼ 10). However reliable quantitation of artemin by WB was unfeasible due to the broad dynamic range of artemin expression through samples. In conclusion, our results demonstrate the presence of artemin in bovine uterine endometrium and UF, and embryos during early development. As shown in mice, it is feasible that artemin might exert an autocrine/paracrine role during early embryo development in the cow. The study received grant support: Spanish Ministry of Science and Innovation (MINECO, project AGL2012–37772 and FEDER). M. M. was supported by grant MICINN-RYC08–03454. The authors are members of the COST Action FA1201 Epiconcept.

149

IN VITRO BOVINE EMBRYOS FROZEN BY DIRECT TRANSFER METHOD WITH ETHYLENE GLYCOL S. H. KizilA, M. SatilmisA, N. AkyolB, and T. KarasahinC A

Lalahan Livestock Central Research Institute, 06850 Lalahan, Mamak, Ankara, Turkey; B Kirikkale University Veterinary Faculty, Kirikkale, Turkey; C Aksaray University Veterinary Faculty, Aksaray, Turkey

The objective of this study was to search for capability of freezing by ethylene glycol direct transfer method of in vitro-produced cattle embryos. Fiftysix in vitro-produced good-quality cow embryos were frozen by direct transfer method with ethylene glycol in this study. Cattle ovaries were collected from a slaughterhouse and oocytes were aspirated from follicles with 2 to 8 mm diameters. Then oocytes were let for maturation of 20 to 22 h in 100-mL microdroplets of TCM-199 with 0.1 mM b-mercaptoethanol and 20% FCS. After 5 to 6 h of fertilization in Bracket Oliphant (BO), they were cultured for 7 days in 100 mL of CR1aa medium with 5% FCS under 5% CO2, 98% relative humidity, and 38.58C in a CO2 incubator. Embryos were equilibrated for 15 min in room temperature in 1.8 M ethylene glycol þ 0.1 M sucrose in Dulbecco’s phosphate buffered saline (D-PBS) supplemented with 20% FCS. Embryos were then loaded individually into a 0.25-mL straw and placed directly into a cooling chamber of a programmable freezer with methyl alcohol precooled to 78C. After 2 min, the straw was seeded and maintained at 78C for 8 min more. Then it was cooled to 308C at 0.38C min1 before plunging into liquid nitrogen. The frozen embryos were thawed by allowing the straw to stand in air for 5 to 6 s and then immersing them in a 308C water bath for 10 s. After thawing, embryos were transferred into TCM-199 þ 0.1 mM b-mercaptoethanol þ 20% FCS medium to check in vitro survival rates at 48 h post-thawing. The re-expansion and hatching rate of blastocysts was 64.28% (36 blastocysts). This result indicated that ethylene glycol can be used effectively for cow embryo freezing as a suitable cryoprotectant for direct transfer method.

150 USING A LUTEINIZING HORMONE SURGE DETECTION TEST, PREDI’BOVÒ, TO OPTIMIZE THE TIME OF ARTIFICIAL INSEMINATION DURING A SUPEROVULATION PROTOCOL IN A HOLSTEIN HEIFERS HERD H. QuintonA, F. CharreauxA, A. MorelA, A. RohouA, L. DupuyB, J. DecourtyeB, E. KaraB, and M. C. MaurelB B

A EVOLUTION, Rennes, France; REPROPHARM, Centre INRA Val de Loire, Nouzilly, France

Insemination of superovulated bovine donors in due time is of central importance for fertilization and embryo viability. A preliminary test focusing on LH surge detection during superovulation (unpublished datas) indicated that one quarter of the donors present LH surges 12 to 24 h before heat observation (which could correspond, in the case of AI after heat observation, to post ovulation AI). Therefore, it was hypothesised that the average number of embryos per flush could be improved by inseminating donors with early LH surge 12 h after the beginning of the LH peak whenever the heat occurs.In a donor herd station, a trial was performed with 54 Holstein heifers, equipped with HeatimeÒ tags (system detecting the peak activity linked to the heat) collected twice or 3 times after the following superovulation protocol: D-6 to D-11 ¼ reference heat; D0 ¼ input of an implant of norgestomet (CrestarÒ); D2 8:00 ¼ first FSH (StimufolÒ) injection (FSH1); D4 8:00 ¼ cloprostenol (EstrumateÒ) injection; D4 16:00 ¼ implant removal; D5 8:00 ¼ FSH7 and first LH surge detection test (Predi’BovÒ); D5 16:00 ¼ FSH8 and 2nd Predi’BovÒ test. Two AI’s at interval of 8 to 16h were done (AI’s were performed either at 9:00, or between 17:00 and 19:00). For the standard protocol (¼ STA), thefirst AI occurred after heat observation or activity peak detection by Heatime (whatever the Predi’BovÒ test results were). For the adjusted protocol (¼ ADJ), the first AI occurred from 11 to 16 h after the first positive Predi’BovÒ test result or like STA protocol if both results were negative. Heifers followed alternately the 2 protocols, 27 beginning with the ADJ protocol, 27 others with the STA one. LH surge precocity was not repeatable among donors. In the case of an early LH surge detection (one positive Predi’BovÒ test), the heat activity peak occurred from 2 to 8 h after the FSH8 for 44% of the flushes, from 8 to 24 h after FSH8 for 54% of the flushes and never for 2% of the flushes. When no early LH surge was observed, the heat activity peak occurred more than 8 h after FSH8 for 78% of the flushes. Interval of heat activity peak-FSH8, IA1-heat activity peak and IA1-early LH surge were highly variable but did not effect the mean number of viable embryos. However, we observed a significant effect (P ¼ 0.04) of the precocity of the heat on the average number of total embryos: 13.8 8.4 v. 11.1 8.1 when the interval heat activity peak-FSH8 had been respectively ,8 h or 8 h, respecively. Among the 148 collections, 74 were done after the STA protocol, 74 after the ADJ protocol and 70 followed an early LH surge. The adjustment of the AI depending on the detection of an early LH surge (ADJ protocol) had a significant positive (P ¼ 0.04) effect on the mean percentage of viable embryos per flush (52% 28 in STA group and 62% 31 in ADJ group). Nevertheless, regarding the mean number of viable embryos, this effect failed to reach significance (P ¼ 0.23) (respectively 5.7 5.1 in STA group and 6.7 6.7 in ADJ group). A larger study on more animals is necessary to obtain a significant difference in the number of viable embryos.

Embryo Transfer


151

167

REPRODUCTIVE PARAMETERS OF MINI-HORSE MARES R. C. Uliani, C. Ramires-Neto, and M. A. Alvarenga

Department of Animal Reproduction and Veterinary Radiology, Saõ Paulo State University – UNESP, Botucatu, Brazil The Mini-horse is a new equine breed that is on the rise in Brazil. These are animals with a maximum adult height of 98 cm for females and 93 cm for males, with a well-proportioned body. Those animals are easily handled by children and require small spaces with low maintenance costs. The Minihorse is under constant genetic selection that is aimed mainly at decreasing its height. For this reason, mares of low stature are required, justifying their use in assisted reproduction programs. Reproductive data of these animals are not available in the literature. Only data of full-size mares are referenced, not taking into account the particularities of this breed. Therefore, the aim of this study was to describe one technique of embryo transfer (ET) for Mini-horse mares. Reproductive rates obtained during the 2012/2013 Brazilian breeding season are presented. Thirteen Mini-horse donor mares were monitored daily by transrectal ultrasonography and ovulation induction was performed with injection of deslorelin acetate or hCG, along with natural breeding using the same stallion for all mares. Eight days after detection of ovulation, flushing for embryo collection was performed. The recipient mares were also monitored daily to detect ovulation and those selected ovulated in the range of up to four days after the donor mare. In order to prevent cervical injuries, the large catheter traditionally employed in uterine washing of large mares was replaced by a Foley catheter (24 Fr in diameter). A range of 50 to 250 mL of Ringer’s lactate solution was used to fill the uterus up to 5 times or until the embryo was observed in the collector filter. After the embryo collection, the donor mare received a dose of luteinizing drug (sodic cloprostenol – SincrocioÒ, Ouro Fino, Brazil). The recipient mare was examined for a corpus luteum, absence of uterine fluid or endometrial oedema, and good cervical and uterine tone. Recipients were also selected by height (similar to donors) so that the newborn foal could reach the recipient mare’s udder to nurse. For non-surgical transfer, the embryos were aspirated by an artificial insemination pipette with ,0.5 mL of holding medium interspersed with small columns of air and then inserted into the uterine body of the recipient mares. Daily follicular growth was 2.2 1.0 mm and the size of follicles at ovulation induction was 31.6 2.8 mm. In 57 embryo collections performed, 46 embryos were obtained and transferred into the uteri of recipient mares, resulting in 35 pregnancies. The embryo recovery and pregnancy rate were 80.7% and 76.1% respectively. The relationship between pregnancy and number of embryo flushes performed was 61.4%. The time between two consecutive flushes was 20 4.5 days. The rate of embryonic loss between 20 and 60 days was 20%. The easy handling of the animals and the high rates of ET program success were promising. However, information regarding full-size mares should be used with caution, respecting the specific characteristics of this breed.

152

FACTORS AFFECTING FERTILITY ON AN EQUINE EMBRYO TRANSFER PROGRAM

J. C. Souza, R. V. Portilho, T. L. C. Pinto, F. D. M. Neto, E. P. Filgueiras, M. G. C. M. Silva, and R. S. Moura UFLA, Lavras, MG, Brazil Assisted reproduction through embryo transfer (ET) increases the chances, within a limited group of genetically superior mares, producing a greater number of desirable offspring. Several variables, however, are involved in the process and may impact or even limit the potential of ET to increase a single mare´s foal production within a given breeding season. The objective was to analyse information on variables related to an ET operation carried over 10 years by a single veterinarian in different reproduction centers or directly from the database of all breeders. General management and reproductive data from 150 embryo donor mares, 362 recipient mares and 73 stallions were submitted to statistical analysis by the GENMOD procedure using SASÒ (SAS Institute Inc., Cary, NC, USA). The proportion of positive recoveries (in which one or more embryos were actually recovered) and of pregnant recipients were dependent variables and donor breed (Campolina, Mangalarga, Thoroughbred, Haflinger and Brasileiro de Hipismo), donor (3–18 years old) and stallion age (3–20 years old) type of semen, hormonal ovulation induction (1000–2500 IU of hCG when dominant follicles reached at least 30 mm in diameter), diameter of the dominant follicles at the time of induction in donors and recipients as independent variables. Gestation rate was greater (P , 0.05) for embryos produced by donors of the Campolina breed compared to all others (74.0 v. 57.6%). The positive flush rates of donor age classes #7 (50.2%), .7 and ,12 (60.0%) and $12 (53.2%) years old were similar (P ¼ 0.45). Gestation rates were similar (P ¼ 0.43) between stallions ,6 (70.3%) and $6 (75.8%) years-old. The proportion of positive flushes was greater (P ¼ 0.01) for fresh semen (59.9%) compared to those of natural service, cooled and frozen-thawed semen (54.8, 51.5 and 28.6%, respectively). Pregnancy rates were similar (P . 0.05) between recipient mares hCG-induced (70.6%) and not induced (73.3%) to ovulate. In conclusion, we confirmed that donor breed and type of semen are influential over pregnancy and positive flush rates in the present study. Stallion or donor mare age did not influence fertility traits in this study, which indicates that animals were well managed and used within appropriate age limits. More relevant data may be gathered from the field work of veterinarians in order to enhance the knowledge that supports managing decisions in assisted reproduction techniques.

153

SEASON DOES NOT INFLUENCE EARLY CONCEPTUS GROWTH AND RECOVERY IN THE HORSE C. Aurich and S. Budik Centre for Artificial Insemination and Embryo Transfer, Vetmeduni Vienna, Vienna, Austria

Although the horse is a seasonal breeding species, a considerable number of mares continues to cycle throughout autumn and winter. This allows for embryo collection outside the breeding season. However, slower equine embryo growth during the non-breeding season has been hypothesised. Because in this species, smaller embryo size (,0.3 mm diameter) is beneficial for conceptus cryopreservation, embryo collection outside the breeding season could be an interesting approach for the production of frozen horse embryos. In the present study we have therefore analysed embryo recovery rates in a herd of research mares (Haflinger breed, n ¼ 30) that are used for embryo production throughout the year. Oestrous mares were

168


Embryo Transfer

inseminated (500 Mio progressively motile sperm) at 48-h intervals and ovulation was detected by transrectal ultrasound. Diameter of the conceptus at collection was measured with a microscope scale (,day 11) or by electronic calipers of the ultrasound machine (.day 10). Statistical analysis was done with the SPSS Statistics 21 software. The influence of collection day (7 to 14 after ovulation) and season (SPR: March – May; SUM: June – August; AUT: September – November; WIN: December – February) on conceptus size was analysed by GLM univariate analysis. Influence of season on recovery rate was compared by Chi-squared analysis. Values for conceptus diameter are given as means s.e.M. A total of 352 embryo collection attempts were performed. Mean recovery was 64.2%. It was not affected by season (number of embryos collected: SPR: 51/72, SUM 67/105, AUT 71/ 114, WIN 37/61 flushes). The conceptus diameter was evaluated in a total of 165 embryos. Conceptus diameter significantly increased (P , 0.001) with day of pregnancy (e.g. day 7: 0.5 0.05, day 8: 0.76 0.2, day 10: 3.8 0.2, day 12: 9.8 0.6, day 14: 17.5 1.0 mm), but was not influenced (P ¼ 0.957) by season (e.g. day 10: SPR 4.2 0.6, SUM 3.6 0.4, AUT 3.9 0.4, WIN 3.8 0.6 mm). These results demonstrate that embryo collection in horses can be performed successfully throughout the year if mares continue to ovulate during the non-breeding season. Because conceptus growth is similar with regard to season, production of cryopreserved equine embryos is not facilitated at a specific time of the year.

154

EVALUATION OF EMBRYO RECOVERY RATE AND EMBRYO TRANSFER IN ANGORA GOATS K. Karakas, H. Alkan, G. Onur, D. Ozen, M. Kaymaz, and H. Izgur Ankara University, Ankara, Turkey

The aims of this study were to compare the embryo recovery rate in Angora goats based on application timing; at the beginning (September – October; Group 1) and end (December; Group 2) of the breeding season and to evaluate the viability and survivability of fresh or vitrified-thawed embryos when transferred. For this purpose, nine Angora goats were used as donors and thirthy Angora goats were used as recipients. Donor goats were synchronized and superovulated with traditional protocol and were mated with fertile bucks. At the 156th hour of the mating, embryos were collected surgically and evaluated under a stereo microscope. In group 1, 103 embryos and in group 2, 63 embryos were collected from nine goats. Fresh or vitrified-thawed embryos were transferred surgically to synchronized recipients. In Group 1 fresh/thawed embryos were transferred to 15/15 goats and in group 2, fresh/thawed embryos were transferred to 8/8 goats, respectively. Each recipient received 1 or 2 embryos ipsilateral to the ovary containing one or more corpora lutea. On day 30 of the transfer, goats were examined by transrectal ultrasonography, pregnancy rates of fresh/thawed embryos were 66.6%/26.6% for group 1 and 62.5%/62.5% for group 2. On day 100 of the transfer, goats were examined again by ultrasonography, and pregnancy rates were 46.6%/0% for group 1 and 37.5%/0% for group 2, respectively. After about 50 days, goats were kidded. In group 1, 3 twins and 4 single kids were born; in group 2, 2 twins were born. The total number of collected embryos and pregnancy rates among the groups were analysed using SPSSÒ (version 14.01, Chicago, IL, USA) and for all comparisons, differences were considered with a minimum of 5% significance level. After statistical analyses, the numbers of collected embryos at the beginning and at the end of the breeding season were compared. There was no difference in freezable/transferable embryo quality. As a result, embryos could be collected after superovulation protocols in Angora goats both at beginning and end of the breeding season, however there might be a decrease in numbers of collected embryos and the reasons for this might not be only the seasonal factors but also the environment, care, nutrition and previous superovulation protocols. The pregnancy rate following transfer of fresh embryos was satisfactory but not all does confirmed pregnant kidded; hence, reducing the number of recipients kidding. The pregnancy rate following transfer of vitrified-thawed embryos was generally low and unsatisfactory. Further research is warrented in improving the cryopreservation techniques and thus the embryo survival rate of Angora goat embryos. This study was financed with the University of Ankara Grant.

155

EFFECT OF VITRIFICATION OF MORULAE ON PREGNANCY RATE IN GOAT M. M. Toishibekov, G. A. Valieva, and S. M. Askarov Institute of Experimental Biology, Almaty, Republic of Kazakhstan

This work evaluated alternative methods for goat morulae cryopreservation by using the High Security Vitrification Kit (Cryobiosystem): vitrification (V) and super-cooling ultra-rapid vitrification (SCURV). Vitrification was applied according to the method described by Vajta et al. (1998). Both treatments used a vitrification solution (VS) containing 20% ethylene glycol (EG), 20% dimethylsulfoxide (Me2SO), 0.5 mol L1 sucrose in DPBS with 10% BSA. In our experiment we used the Vit-MasterTM (MTG, Germany). Super-cooled liquid nitrogen (LN) facilitates heat transmission between LN and the cryosolution interface suggested to be beneficial for bovine semen and blastocyst cryoconservation. By surgical flushing of 30 super-stimulated goats, 137 transferable morulae were harvested; 41 morulae were transferred fresh to synchronized recipients (control) and the others were cryopreserved by V (n ¼ 47) or SCURV (n ¼ 49), respectively thawed, and transferred to recipients. Embryos were vitrified using the HSV Kit. They were first incubated in 50% VS for 2 min and then transferred for 30 s into 100% VS followed by vitrification (group V). Accordingly, morula of SCURV group were exposed to 50% VS for 2 min and to 100% VS for 30 s at 378C. Thereafter, embryos were transferred into the VIT-Master for freezing with liquid nitrogen using negative pressure. Thawing of vitrified embryos was accomplished by placing the vitrified embryos in solutions of 0.25 M sucrose for 2 min and 0.125 M sucrose for 3 min, respectively. After thawing only survived embryos were transferred. Statistical analyses were performed with Student’s t-test. After transfer of fresh or frozen-thawed embryos of V and SCURV groups, 25, 17, and 19 kids were born. No statistical difference was found for the percentage of viability of thawed embryos after vitrification (36.2 4.4%), and SCURV methods (38.7 6.5%). The survival of fresh embryos, however, was significantly higher (60.9 5.3%). Differences were statistically significant (P , 0.05). Importantly, our data suggest that the SCURV method can be used for cryopresevation of goat morulae. Nevertheless, further work regarding the developmental competence of embryos cryopreserved with the SCURV method is needed.

Epidemiology/Diseases


156

169

LAPAROSCOPIC UTERINE EMBRYO TRANSFER IN THE CAT C. E. Pope, J. H. Galiguis, C. Dumas, and M. C. Go´mez Audubon Center for Research of Endangered Species, New Orleans, LA, USA

In the first successful transfer of cat embryos (Theriogenology 11, 51–62), the uterus was accessed by midventral laparotomy. That surgical approach was the most widely used method for transferring cat embryos for more than two decades. Then, 10 to 15 years ago pregnancies were reported after early cleavage stage embryos were transferred to the oviduct of recipients using a laparoscopic technique. Even though laparoscopic oviducal embryo transfer has produced higher survival/pregnancy rates than were obtained previously there are valid reasons for establishing a minimally invasive, technically simple method for depositing morulae and blastocysts into the uterus of recipients. Thus, the purpose of the present project was to develop a technique for laparoscopic uterine embryo transfer in the cat. Recipients (n ¼ 4) were gonadotropin-treated females (Theriogenology 81, 126–37) from which prevoulatory oocytes (n ¼ 27–42/retrieval) had been recovered 7 or 8 days previously. The procedure for accessing the reproductive tract has been described (Theriogenology 71, 864–71). Briefly, after abdominal insufflation via a Veress needle, two 5-mm ports were inserted in the midline – one ,2.5 cm anterior to the umbilicus and the other between the two most posterior teats. An endoscope/camera and a Babcock forceps were placed in the anterior and posterior ports, respectively. After the left uterine horn was stabilised with the Veress needle, the Babcock forceps were gently applied at ,2–3 cm from the anterior tip. In the first two attempts, a 16 g 5 cm thin-walled stainless steel (s.s.) trocar/cannula was inserted transabdominally such that it aligned with the anterior portion of the left uterine horn when elevated with the forceps. Then, either a 14-cm, 3.5 Fr tom cat catheter with a s.s. sharp-tipped stylette or a 20/22 g 6 cm indwelling catheter was passed through the s.s. cannula and inserted into the uterine horn. In each case, the length of the s.s. cannula restricted depth of insertion of the catheter into the horn. Polyethylene tubing (PE10) containing the embryos was threaded through the catheter and embryos were expelled with a 1-mL threaded-plunger syringe. The failure to establish pregnancies after transfer of five or six Day 7 or Day 8 IVF-derived ‘‘fresh’’ embryos into the first two recipients was attributed to technical difficulties. So, for the third and fourth procedures, we shortened the s.s. trocar/cannula to 2.5 cm and, for insertion into the horn, a 20/22 g 6 cm indwelling catheter was used. With the third procedure, in which cryopreserved d 8 IVF blastocysts were transferred into a Day 7 recipient, the failure was possibility due sub-optimal in vitro development of embryos after thawing on d 7. For the fourth transfer, 6 ‘‘fresh’’ Day 8 IVF blastocysts – 2 expanding and 4 in the early stages of emerging from the zona pellucida – were auto-transferred into a 3-year-old recipient. A singleton pregnancy was diagnosed by ultrasonography on Day 28 and a live, healthy male kitten (119 g) was born on Day 67. In summary, we demonstrated the feasibility of transferring in vitro-derived cat embryos into the uterus of recipients by the minimally invasive technique of laparoscopy.

Epidemiology/Diseases 157

EFFECTS OF METABOLIC CONDITIONS OF DAIRY COWS DURING TRANSITION PERIOD AND EARLY LACTATION IN WINTER AND SUMMER ON HEALTH AND FERTILITY M. Maturana Filho, K. M. Lemes, J. R. Naves, T. Santin, T. K. Nishimura, and E. H. Madureira Department of Animal Reproduction, Saõ Paulo University, Saõ Paulo, Brazil

The aim of this study was to investigate and determine which metabolic predictors measured during the transition period, have a better association with health and fertility parameters in dairy cows in winter (W) and summer (S).The experiment was conducted with 235 multiparous Holstein dairy cows. The animals were divided, retrospectively into the experimental groups [High Production (AP), $45.9 to 65 kg of milk during peak lactation; Medium production (MP), between 30 and 45.8 kg of milk during peak lactation]. Blood samples and evaluations occurred during the transition period and during the timed fixed artificial insemination (TAI). Data were analysed for the main effects of group, day, and their interaction using the PROC MIXED procedure of SAS software (SAS 9.3, SAS Institute, Inc., Cary, NC, USA). Creatine kinase (CK) plasmatic concentrations increased during peak lactation in all groups, but the difference was not significant. Variations in superoxide dismutase (SOD) concentrations were observed in HP cows in both seasons (HPW and HPS). These cows had higher levels of superoxide dismutase (SOD) when compared of MP cows (MPW and MPS), with significant changes since 7 days before calving and remained higher until 104 days of lactation. The differences were observed in lipid profile, particularly in NEFA concentration. For this variable, there were group (P , 0.001) and day (P , 0.001) effects and also double interactions (day v. season, P , 0.001) and triple interactions (group v. day v. season, P ¼ 0.009). The HPS cows had higher values, as well as a variation pattern of urea concentration (P , 0.05), different from the other groups until 100 days in milk (DEL). No differences were observed in diseases incidences between group or periods (P . 0.05). There was a statistical tendency to all groups in the summer season for earlier calving (P ¼ 0.1), less calf weight (P ¼ 0.07), and retained placenta (P ¼ 0.09) and metritis incidence (P ¼ 0.08). These parameters were strongly correlated with metritis disease incidence and the significant parameters: Earlier calving (P ¼ 0.03), dystocia (P ¼ 0.05), and retained placenta (P ¼ 0.009). The NEFA (0.4 mmol L1) and BHBA concentrations (0.7 mmol L1) were highly correlated with the occurrence of uterine diseases. We observed high levels of AST (around 128 U/L) pre calving in ketotic and in cows with displacement of abomasum. According to these results, we concluded that milk production was not a risk factor for fertility in the first three services. Also, metabolic changes in the transition period were determinant in milk yield and health diseases. Research was supported by FAPESP, CNPq, CAPES, Fazenda Colorado, and Ourofino animal health.

170


158


BOVINE HERPES VIRUS 4 (BOHV4) INHIBITS BOVINE ENDOMETRIAL EPITHELIAL CELL (BEEC) PROLIFERATION M. ChanrotA,D, Y. Z. GuoA, G. BlomqvistB, M. JuremalmB, P. Reinaud C, G. CharpignyC, O. SandraC, P. ChantaraprateepD, R. Ba˚geA, G. DonofrioE, J. F. ValarcherB, and P. HumblotA A Department of Clinical Sciences, SLU, Uppsala, Sweden; Department of Virology, Immunobiolgy and Parasitology, SVA, Uppsala, Sweden; C INRA, UMR1198, Biology of Development & Reproduction, Jouy en Josas, France; D Faculty of Veterinary Science, Rajamangala University of Technology, Nakhonsithammarat, Thailand; E Department of Medical Veterinary Science, University of Parma, Parma,Italy B

BoHV4 is a double-stranded DNA virus which has been associated to endometritis, metritis, and abortions in dairy cow. The objective of this study was to characterise its cytopathic effects on bovine endometrial epithelial cells (bEEC). Bovine uteri were collected from slaughter house and bEEC separated and cultivated as previously described (Guo et al. 2014 Reprod. Fertil. Dev. 26, 165–166). In Experiment 1 (Exp 1), bEEC (passage 5) from 3 cows were cultivated for 6 days without virus or following exposure to serial dilutions (104, 103, 102) of virus. Living cells were counted for each group at start of the experiment and by Day 6. Proliferation or inhibition of proliferation was calculated by (Number of cells Day 6 Number of cells Day 0)/Number of cells Day 0. In Experiment 2 (Exp 2) cells were challenged with a single dosage of virus (MOI 0.01; 1 virus: 100 cells) and culture performed during 1, 2, 3, 4, 5, 6, or 7 days. Cells were counted at Day 0 and each day, proliferation of cells was calculated as (number of cells by Day X – number of cells Day 0)/number of cells Day 0. The effects of the dilution of virus, cow and their interaction (Exp 1) or effects of time, cow, viral exposure, and second-order interactions (Exp 2) on cow cell proliferation were analysed by ANOVA (SAS 9.2, proc GLM; SAS Institute, Inc., Cary, NC, USA). In Exp 1, the amount of living cells by Day 6 was very significantly increased in controls when compared to Day 0 (þ172.6 24%; P , 0.0001). A linear inhibition of proliferation was observed with increasing dilutions of virus. The number of living cells for the highest concentration of virus is not different from Day 0 numbers (26.7 24.6%). Pattern of proliferation differed between cows as evidenced by a significant interaction between cow and virus dilution (P , 0.001). In Exp 2, we observed a very strong increase of proliferation from Day 0 to Day 7 in controls (þ1000 87%; P , 0.0001). From Day 1 to 4, the increase in number of cells was very similar for cells exposed to BoHV4 and in controls. However, after Day 4, cells exposed to virus had a limited proliferation or expressed cell death as the number of living cells by Day 7 were not different from these observed by Day 0 (50 87%; NS). These results show that both time and dose of BoHV4 affect the proliferation of bovine EEC. These results will be used to investigate further the molecular mechanisms by which BoHV4 induces cell death and their sequence. Research was partly funded by RMUTSV.

159

CHANGES IN PROTEIN EXPRESSION PROFILES IN BOVINE ENDOMETRIAL EPITHELIAL CELLS (BEEC) FOLLOWING E. COLI LIPOPOLYSACCHARIDE CHALLENGE

Y. Z. GuoA, C. PirasB, A. SoggiuB, M. ChanrotA,C, R. Ba˚geA, G. AnderssonD, P. ReinaudE, G. CharpignyE, O. SandraE, J. F. ValarcherF, P. RoncadaG, and P. HumblotA A Department of Clinical Sciences, SLU, Uppsala, Sweden; Department of Veterinary Sciences & Public Health, University of Milan, Milan, Italy; C Faculty of Veterinary Science, Rajamangala University of Technology, Thailand; D Department of Animal Breeding and Genetics, SLU, Uppsala, Sweden; E INRA, UMR1198, Biology of Development & Reproduction, France; F Department of Virology, Immunobiolgy and Parasitology, SVA, Uppsala, Sweden; G Istituto Sperimentale Italiano L. Spallanzani, Milan, Italy

B

E. coli is one of the most frequent bacteria involved in uterine diseases. Lipopolysaccharide (LPS) is a component of the outer membrane of Gram-negative bacteria involved in the pathogenic processes leading to postpartum metritis and endometritis in cattle. It also causes inflammation of the endometrium. Increase of cell proliferation by LPS is part of the inflammatory process and has been reported in human epithelial and immune cells (Martin et al. 2000 J. Immunol. 165, 139–147) and from bovine endometrial epithelial cells (bEEC) (Guo et al. 2014 Reprod. Fertil. Dev. 26, 165–166). The aim of this study was to investigate possible changes in protein expression in relation with the proliferative response of bEEC after challenge with E. coli-LPS. In vitro culture of bEEC was performed from 3 cows. On passage 5, bEEC from each individual were exposed to 0, 8, and 16 mg mL1 LPS for 72 h. At time 0 and 72 h later, attached cells were counted and for each time and LPS dosage, cells were frozen for proteomic analyses. The variation of cells number over time was analysed by ANOVA (SAS 9.1, proc GLM; SAS Institute, Inc., Cary, NC, USA). All samples were analysed (every sample run in triplicate) by 2-D gel electrophoresis coupled to matrix-assisted laser desorption/ionization-time-of-flight (MALDI-TOF)/time-of-flight (TOF) mass spectrometry (MS) and shotgun nLC-MS/MS analysis. As reported before, a significant increase in cell number was observed for cells treated with 8 mg mL1 LPS (P # 0.001), whereas changes in cell number were highly variable and nonsignificant for 16 mg mL1 LPS. From each sample, ,800 proteins were visualised. Results from 2-D gel coupled to MALDI-TOF/TOF were very reproducible (same responses between individual cows) and revealed changes in protein profiles very much related (from P , 0.05 to P , 0.01) to proliferative phenotypes for seven proteins. From shotgun analysis, 27 proteins were found significantly differentially expressed (P , 0.05 to P , 0.01) following exposure to LPS (21 up-regulated and 6 down-regulated). Among the 21 found as up-regulated, 20 were differentially expressed both for the 8 and 16 mg mL1 LPS, whereas 5 out of 6 were down-regulated for both dosages. Differentially expressed proteins were associated to cell proliferation, apoptosis, oxidative stress, regulation of histones, allergy, and general cell metabolism pathways. Candidate proteins need to be confirmed from larger series of individuals and relevant pathways further studied. Research was partially funded by RMUSTV.


160


171

STRATEGIC VACCINATION AGAINST BOVINE VIRAL DIARRHEA (BVD), INFECTIOUS BOVINE RHINOTRACHEITIS (IBR) AND LEPTOSPIROSIS IMPROVES PREGNANCY RATE IN FTAI PROTOCOLS IN NELORE BEEF COWS L. A. S. SoutoB, M. Maturana FilhoA, K. M. LemesA, F. D. TorresC, and E. H. MadureiraA A

Department of Animal Reproduction, Saõ Paulo University, Saõ Paulo, Brazil; B Biogeńesis Bago´, Curitiba, Parana´, Brazil; C Axys Analises, Porto Alegre, Rio Grande do Sul, Brazil

The negative effect of some diseases, such as bovine viral diarrhea (BVD), infectious bovine rhinotracheitis (IBR), and Leptospirosis, on bovine reproduction rates are well known. The uses of vaccines are considered to be an important tool available in order to control reproductive losses but their efficiency is still controversial. The aim of this study was to evaluate the effects of vaccination against BVD, IBR, and Leptospirosis to improve pregnancy rate in beef cattle submitted to fixed-timed AI (FTAI). Nelore cows (n ¼ 1172) from 4 beef cattle farms in Brazil were randomly distributed in two experimental groups: Group 1 (treated, n ¼ 584) received the first dose of the inactivated vaccines (Bioleptogen and Bioabortogen H, Biogeńesis Bago´, Garıń, Argentina) at the beginning of the FTAI protocol and the second dose on the pregnancy diagnostic 40 days later; Group 2 (control group, n ¼ 588) received 0.9% saline solution. Serum samples from 3–5% of animals in each farm herd were collected to determinate IBR, BVD, and Leptospirosis challenges, by using ELISA protocol for BVD and IBR (Synbiotics BVD p80 ab monoblocking test and Synbiotics BoHV-1 gB monoblocking test, respectively; Synbiotics Corp., Kansas City, MO, USA); and microaglutination test for Leptospirosis. All animals were submitted to the FTAI protocol: D0 ¼ intravaginal P4 device (Cronipress, Biogenesis Bago´) and application of 2 mg oestradiol benzoate (Bioestrogen, Biogeńesis Bago´); Day 8 ¼ intravaginal device removal þ 0.5 mg oestradiol cipionate (E.C.P, Zoetis Inc., Florham Park, NJ, USA) and 25 mg D-cloprostenol sodium (Croniben, Biogeńesis Bago´) and FTAI after 48 h. Body condition scores (BCS) were measured on Day 0 and pregnancy diagnostic were performed on Day 40. Data were analysed by logistic regression using PROC LOGISTIC procedure of the SAS software (SAS 9.3, SAS Institute, Inc., Cary, NC, USA) as well as the significant differences between the factors was analysed to nonparametric statistical frequency (chi-square test; PROC FREQ). Pregnancy rates on day 40 were greater (P , 0.0001) in Group 1 (58.21%; 340/584) compared to Group 2 (44.73%; 263/588). Effect in BCS by pregnancy rates was observed (P ¼ 0.0165) among animals with higher compared to lower BCS (61.40% v. 47.98%, respectively). Results from BVD, IBR and Leptospirosis prevalence were respectively (78.26%; 95.65%, and 10.20%), demonstrating that all herds were challenger for the 3 agents and a positive correlation with pregnancy rates (P , 0.001) in vaccinated group. In conclusion, vaccination with Bioabortogen H and Bioleptogen contributed to increase pregnancy rates in beef cattle submitted to FTAI; and the positive correlation between high prevalence of BVD, IBR, and leptospirosis, and an increased pregnancy rate by 13.48% can be due to fewer losses caused by the vaccination protection up to Day 40.

161

COMPARISON OF DIFFERENT DIAGNOSTIC METHODS IN EQUINE ENDOMETRITIS

T. ChenierA, M. Diel de AmorimB, R. A. FosterA, A. HillA, T. HayesA, E. ScholtzA, and C. J. GartleyA B

A Ontario Veterinary College, Guelph, Ontario, Canada; Western College of Veterinary Medicine, Saskatoon, SK, Canada

Prolonged endometritis is the most common cause of infertility in mares causing great economic impact. Many mares fail to be diagnosed with endometritis despite the availability of different diagnostic tests. Therefore, the purpose of this study was to compare endometrial swab, low-volume lavage (LVL) and endometrial biopsy as diagnostic methods for endometritis and to report the prevalence of this disease in a referral practice population. Fifty-one mares presenting for routine breeding or infertility work-up were examined by transrectal ultrasonography, before collecting samples for endometrial culture and cytology. Seven of the 51 mares had all the tests except endometrial biopsy. A mare was classified positive for endometritis if she demonstrated two or more of the following 5 criteria on a checklist (new gold standard; NGS): (1) abnormal clinical findings (any of uterine fluid on ultrasound, or excessive oedema for follicular size, or history of subfertility); (2) abnormal gross character of the LVL fluid: (cloudy, discolored, debris) before centrifugation; (3) positive endometrial cytology ($1 neutrophil per high power field, or $1% (1 : 100) neutrophil to epithelial cell ratio on cytology); (4) bacterial growth on culture of the LVL pellet; and (5) histological evidence of inflammation (acute, chronic, and mixed) detected on endometrial biopsy. Data were analysed via kappa coefficient (k) and frequencies were calculated for sensitivity and positive predictive value (PPV) with biopsy being the gold standard and compared to the NGS. Endometritis was diagnosed in 35/44 (79.5%) mares by biopsy (5/35 had acute endometritis, 12/35 had chronic; 18/35 had a combination of acute and chronic endometritis). Based on the endometritis criteria (2/5 items on the checklist), 33/51 (64.7%) mares were diagnosed to have endometritis. All 11 of the barren mares were diagnosed by the checklist, while two of these 11 mares had no evidence of endometritis by biopsy, but had clinical signs or cloudy efflux. The character of the endometrial flush was 45% sensitive (k ¼ 0.046), while culture was 22% sensitive, when compared to endometrial biopsy. When each criterion for endometritis was compared against the NGS, endometrial biopsy was the most sensitive diagnostic method (sensitivity ¼ 86%). Abnormal clinical findings showed moderate agreement with the NGS (k ¼ 0.4138), with a sensitivity of 62% and P ¼ 0.0019. Positive endometrial cytology showed similar agreement (k ¼ 0.3761), and sensitivity (sensitivity ¼ 64%, and P ¼ 0.0069). These studies have also shown the importance of using laboratory data in light of clinical findings, since they have shown that no test by itself is sensitive enough to diagnose a mare with subclinical endometritis, and that this disease might be under diagnosed. Since this study was performed in a referral hospital, there may have been a higher prevalence of endometritis than found in general clinical practice. An endometritis checklist could be used in cases where endometrial biopsies are not readily available.

172


162

Exotic Species

CAN CHLAMYDIA ABORTUS BE TRANSMITTED BY EMBRYO TRANSFER IN GOATS? J. L. PellerinA, A. Ashraf A, M. OseikriaA, K. LaroucauB, F. VorimoreB, C. RouxA, M. LarratA, S. MichaudA, and F. FieniA

A

LUNAM University, Oniris, (Nantes-Atlantic National College of Veterinary Medicine, Food Science and Engineering), Department of Research into the Health Risk and Biotechnology of Reproduction UPSP 5301 DGER, France; B Bacterial Zoonoses Unit, French Agency for Food, Environmental & Occupational Health Safety (ANSES), Maisons-Alfort, France Chlamydia abortus is a gram-negative obligate intracellular bacterium. Its lifecycle includes a resistant infectious form and a metabolically active non-infectious form. Chlamydia abortus infection results in abortion in goats; in nonpregnant animals the infection is usually subclinical. Chlamydia abortus presents a major zoonotic risk for pregnant women. The aim of this study was to investigate whether the embryonic zona pellucida (ZP) protects early embryo cells from infection and to test the efficacy of the washing protocol recommended by the IETS for bovine embryos. The study was performed in triple replicate: 14 donor goats, certified negative by ELISA and PCR to C. abortus, were synchronized, superovulated, and subsequently inseminated by males controlled negative for C. abortus. Fifty-two ZP-intact embryos (8–16 cells) were collected 4 days later, by laparotomy. The embryos were randomly divided into 12 batches. Nine batches of 5 embryos were incubated in a medium containing 4 107 Chlamydia mL1, AB7 strain. After incubation for 18 h at 378C in an atmosphere of 5% CO2, the embryos were washed in batches in 10 successive baths of PBS and 5% FCS solution in accordance with IETS guidelines for bovine embryos. In parallel, 3 batches of ZP-intact embryos (2, 2, and 3 embryos in the first, second, and third batches, respectively) were used as controls by being subjected to similar procedures, but without exposure to C. abortus. The 10 wash baths were collected separately and centrifuged for 1 h at 13 000 g. The washed embryos and the pellets of the 10 centrifuged wash baths were frozen at 208C before examination for evidence of C. abortus using RT-PCR. Chlamydia abortus DNA was found in all batches of infected ZP-intact embryos (9/9) after 10 successive washes. It was also detected in the tenth wash fluid for 4 batches (4/9) of infected embryos. As expected, none of the embryos or their washing fluids in the control batches were DNA positive. These results demonstrate that C. abortus adheres to and/or penetrates the ZP of in vivo caprine embryos after in vitro infection, and that the standard washing protocol recommended by the IETS for bovine embryos failed to remove it. The persistence of these bacteria after washing makes the embryo a potential means of transmission of the bacterium during embryo transfer from infected donor goat to healthy recipients and/or their offspring. Further studies are required to investigate whether enzymatic and/or antibiotic treatment of infected caprine embryos can eliminate C. abortus from the ZP.

Exotic Species

163

RE-ESTABLISHING REPRODUCTIVE CYCLICITY IN A FEMALE ASIAN SMALL-CLAWED OTTER FOLLOWING SUPRELORIN-INDUCED CONTRACEPTION: A CASE STUDY H. L. Bateman and W. F. Swanson Center for Conservation and Research of Endangered Wildlife, Cincinnati Zoo & Botanical Garden, Cincinnati, OH, USA

Asian small-clawed otters (ASCO) are a popular species to exhibit in zoological institutions globally, and are found in managed populations in the United States, Europe, Asia, and Australia. Captive breeding of these otters is integral to population sustainability, with management programs using pedigree analyses to make specific breeding recommendations to ensure long-term genetic viability. Because of the familial social structure of ASCO and limited space within zoos, physical separation of animals is not always possible for temporary breeding prevention, and short-term contraception may be preferred. In US zoos, Suprelorin (deslorelin; Virbac Australia, Milperra, Australia), a GnRH agonist, has been recommended for contraception of female carnivores, due to its small implant size and lack of side effects often associated with hormone-based contraceptives. However, the duration of reproductive suppression with Suprelorin may be excessive and reversibility (i.e. resumption of cyclicity, ovulation, and pregnancies) in implanted females across a range of species has been variable, unpredictable, and prolonged. Since 2006, 49 female ASCO have been implanted with Suprelorin at least once, and, of these, only two females have shown confirmed reversibility with pregnancies. No ASCO females implanted more than once have thus far exhibited reversibility (personal communication, AZA Wildlife Contraceptive Center, St. Louis, MO, USA). In this case study, fecal hormone monitoring of one female ASCO implanted with Suprelorin three times (Dec 2007, Jan 2009, Mar 2010), showed a lack of ovarian cyclicity and ovulation during the three years since her last implant. In an attempt to induce ovarian follicular growth and ovulation, this female was injected (IM) with exogenous gonadotropins (100 IU of equine chorionic gonadotropin followed 80 h later with 3000 IU of porcine luteinizing hormone). Fecal progesterone monitoring confirmed ovulation followed by a 76 day pseudopregnancy, with temporal characteristics similar to those previously reported in naturally cycling ASCO (Bateman et al. 2009 Zoo Biol. 28, 107–126). Following the induced pseudopregnancy and ,55 days of basal progestin levels, this female was observed breeding with a cohabitating ASCO male. Fecal hormone monitoring revealed subsequent ovulation and the occurrence of another pseudopregnancy of normal duration. These preliminary findings suggest that exogenous gonadotropin treatment may be useful for promoting resumption of normal ovarian cyclicity and ovulatory responses in ASCO following prolonged reproductive suppression with Suprelorin.

Exotic Species


164

173

EMBRYO SURVIVAL TO CALVING ACCORDING TO TYPE OF EMBRYO AND EMBRYO TRANSFER METHOD IN ALPACAS

H. W. Vivanco-MackieA, M. D. P. SalazarA, M. MiguelA, C. YoungsB, and M. AsparrinC A

Vivanco International SAC, Lima, Peru´; Iowa State University, Ames, IA, USA; C Michell y Cıá SA, Arequipa, Peru´

B

The objective of the study was to determine the embryo survival up to calving of fresh and cryopreserved (frozen and vitrified) alpaca embryos transferred into alpaca recipients by nonsurgical transcervical embryo transfer and by surgical laparoscopically aided embryo transfer. For this report we have compiled the information from 127 embryo transfers in alpacas done by our group at Mallkini, Puno, Peru, at 4200 m elevation. The embryos have been collected from superovulated donor alpacas flushed at 6.5 days post mating, some were transferred as fresh and some were cryopreserved; the recipients (3 to 7 years old) were selected based on presence of functional corpora lutea at ecosonographic examination and subjected to ovarian cycle synchronization and ovulation induction as per Vivanco (2013). From a total of 133 alpacas selected, 127 were used, from which 82 received fresh, 32 frozen, and 13 vitrified embryos. All embryos were classed as A-class expanded blastocysts at time of transfer. By nonsurgical transcervical embryo transfer, 33 embryos were transferred fresh, 22 were frozen/thawed embryos, and 13 were vitrified/warmed embryos. By surgical laparoscopically aided method, 49 embryos were transferred fresh and 10 embryos were frozen/thawed; no vitrified embryos were transferred by this method. Results are detailed in Table 1. Pregnancy losses occured at up to 9 weeks (63 days) of gestation, the heaviest loss occurs in the first 3 weeks. After 9 weeks of gestation, no losses were registered. In average, 22% of fresh embryos transferred were represented as crias born. None of the cryopreserved embryos survived up to 11 weeks post-transfer. There is no difference in percentage of crias born between nonsurgical transcervical embryo transfers and surgical laparoscopically aided embryo transfers.The heavy embryo losses could be related to nutrition and high-altitude limitations; however, it is difficult to make comparisons with others because reports to date lack information on the actual crias born from embryo transfers in alpacas; most of the reports are based on pregnancy reports up to 30 to 60 days post-transfers. To date, no births from cryopreserved alpaca embryos have been reported. Furher studies on causes of embryo/fetal losses are necessary. Table 1. Results of embryo transfer Embryo type

Transfer method

Fresh Fresh Frozen Frozen Vitrified

Nonsurgical transcervical

Embryos transferred (one embryo/recipient)

Embryo survival at 3 weeks post-fertilization n (%)



Embryo survival up to calving n (%)

33 49 22 10 13

11 (33.3) 18 (36.7) 2 (9.1) 2 (20.0) 2 (15.4)

7 (21.2) 14 (28.6) 0 (0.0) 1 (10.0) 0 (10.0)

7 (21.2) 14 (28.6) 0 (0.0) 0 (0.0) 0 (0.0)

7 (21.2) 11 (22.4) 0 (0.0) 0 (0.0) 0 (0.0)

This study was financed by the Peruvian Fund for Innovation, Science and Technology (FINCYT).

165

EFFECT OF INJECTION OF SEMINAL PLASMA ON OVULATION RATE, CORPUS LUTEUM DEVELOPMENT, AND SENSITIVITY TO PROSTAGLANDIN IN ALPACAS (VICUGNA PACOS) W. F. HuancaA, C. MamaniB, and W. HuancaB A

Faculty of Veterinary Sciences, Universidad Cientifica del Sur, Lima, Peru; Laboratory of Animal Reproduction, Faculty of Veterinary Medicine, Universidad Nacional Mayor de San Marcos, Lima, Peru

B

The seminal plasma (SP) of camelids contains a protein identified as b Nerve Growth Factor with capacity of induced ovulation and develop a corpus luteum. A study was designed to evaluate the effect of application of SP on the interval of time from injection of stimulus to the ovulation and corpus luteum (CL) size (Experiment 1, n ¼ 24) and on the sensitivity of CL to the injection of prostaglandin (196 mg of tiaprost) (PG) at different periods from ovulation (Experiment 2, n ¼ 86). Exp. 1: Adult female alpacas with presence of a follicle $7 mm were assigned to the application of 1 mL of SP via IM (T: n ¼ 12) or application of 50 mg of acetate of busereline IM (T2: n ¼ 12). Exp. 2: Alpacas with presence of a follicle $7 mm were induced to ovulation with 50 mg of acetate of busereline or 1 mL IM of SP. Animals were evaluated by ultrasound to confirm the ovulation and were assigned to the following treatment: T1 (n ¼ 8): SP þ PG Day 4; T2 (n ¼ 8): buserelin acetate þ PG Day 4; T3 (n ¼ 8): SP þ PG Day 5; T4 (n ¼ 8): buserelin acetate þ PG Day 5; T5 (n ¼ 8): SP þ PG Day 6; T6 (n ¼ 8): buserelin acetate þ PG Day 6; T7 (n ¼ 8): SP þ PG Day 7; T8 (n ¼ 8): buserelin acetate þ PG Day 7; T9 (n ¼ 8): SP þ PG Day 8; T10 (n ¼ 8): buserelin acetate þ PG Day 8 and T11 (n ¼ 6) (Control): Application of 1 mL of saline solution. The animals were evaluated by ultrasound with an Aloka SSD500 (Aloka, Tokyo, Japan) and 7.5MHz linear transducer each 2 h (Exp. 1) and each 12 h (Exp. 2) after of application of PG. In Exp. 1, the ovulation rate was 95.7% to T1 and T2 and an interval of time between injection of stimulus and ovulation was 27.4 2.5 h and 26.8 1.8 to T1 and T2, respectively. In Exp. 2, luteolysis was

174


Folliculogenesis/Oogenesis

0.0%, 0.0%, 25.0%, 0.0%, 100.0%, 100.0%, 100.0%, 100.0%, 100.0%, 100.0%, and 0.0% for the treatments T1, T2, T3, T4, T5, T6, T7, T8, T9, T10, and T11 respectively. The results suggest that no differences exist between in the ovulation rate and interval to the ovulation between the application of buserelin acetate or SP and that the CL was sensible at Day 5 to the prostaglandin respect SP and with similar response to the sensibility of CL from Day 6 to Day 8.

Folliculogenesis/Oogenesis 166 IN VIVO MODEL TO EXAMINE THE LONG-LASTING EFFECTS OF ACUTE DI-(2-ETHYLHEXYL) PHTHALATE (DEHP) EXPOSURE ON OVARIAN FUNCTION IN BOVINE Z. RothA,B, R. HadasA, Y. MaorB, and D. KaloA,B A

Department of Animal Sciences, Robert H. Smith Faculty of Agriculture, Food and Environment, the Hebrew University of Jerusalem, Rehovot, Israel; B Center of Excellence in Agriculture and Environmental Health, the Hebrew University, Rehovot, Israel Di-(2-ethylhexyl) phthalate (DEHP) is a commonly used plasticizer. Its metabolites have been shown to have adverse effects on reproduction and development in laboratory animals. However, the mechanisms by which they induce infertility remain elusive. We established an experimental model in which lactating Holstein cows were synchronized (GnRH–PG–GnRH) and tube-fed with DEHP (100 mg kg1 per day; n ¼ 4) or water (n ¼ 5), for 3 days. Urine and plasma samples were collected before (Day 0), during (Days 2 and 4), and after (Days 11, 19, and 24) treatment initiation. For each group, and on each day, samples were pooled and analysed to determine DEHP metabolite concentrations (MEHP, 5OHMEHP, 5oxo-MEHP, 2cx-MMHP, 5cx-MEPP) by liquid chromatography–mass spectrometry/mass spectrometry. Incorporation of DEHP resulted in relatively high metabolite concentrations on the exposure days (acute phase; Days 1–4), which decreased dramatically through the subsequent period (chronic phase; Days .5). For example, the average plasma MEHP concentration in the control group was 0.012 0.0017 mM throughout the experimental period. In the treated group, it increased to 47.7 8.9 mM in the acute phase, then decreased to 0.045 0.02 mM. To examine the effects on ovarian function, cows were resynchronized during the chronic phase, and monitored by ultrasonography scanner (SSD-900, Aloka, Tokyo, Japan; 7.5 MHz) to classify ovarian follicular dynamics. Follicular fluids of the dominant follicles were aspirated with an ultrasonic scanner connected to a vaginal sector transducer (Pie Medical Imaging BV, Maastricht, the Netherlands; 7.5 MHz). Data were analysed using JMP-7 software (SAS Institute Inc., Cary, NC, USA, 2004). Differences among treatments were analysed by one-way ANOVA followed by Student’s t-test. Findings revealed the pronounced effect of DEHP on the dominant follicles. The diameter (15.7 1.8 v. 10.4 1.8 mm) and growth rate (0.88 0.15 v. 0.43 0.17 mm day1) of the first-wave dominant follicle were higher in the control cows (P , 0.05). The developmental pattern of the second-wave dominant follicle differed between groups, with a higher growth rate during the follicular phase (1.99 0.19 v. 0.46 0.29 mm day1; P , 0.02) and a larger diameter of the preovulatory follicle (14.48 0.35 v. 9.67 1.85 mm; P , 0.01) in the control group. The pattern of corpus luteum growth and regression also differed between groups, expressed by higher volume (4.37 103 0.27 v. 2.91 103 0.31 mm3; P , 0.05) in the control group. The proportion of dominant follicles that developed to follicular cysts (. 25 mm) tended to be higher (75 v. 20%; P , 0.09) in the treated group. The average oestradiol concentration in the follicular fluid of the preovulatory follicle was lower in the DEHPtreated group (361.6 130.5 v. 832.6 109.7 ng mL1; P , 0.05). However, the average progesterone concentration in the plasma during the luteal phase were normal (4.5–5.0 ng mL1) and did not differ between groups. The findings reveal the potential risk of DEHP exposure and its long-lasting effects on bovine ovarian function. These impairments are suggested to adversely affect fertility.

167 THE EFFECT OF ELEVATED TEMPERATURE ON THE HEAT SHOCK PROTEIN 70 (HSP70) EXPRESSION IN BOVINE CUMULUS-OOCYTE COMPLEXES AFTER IN VITRO MATURATION P. TrzeciakA, R. R. StarzynskiB, L. RapalaA, S. DabrowskiA, and A. M. DuszewskaA A

Division of Histology and Embryology, Faculty of Veterinary Medicine, Warsaw University of Life Sciencess, Warsaw, Masovian District, Poland; B Department of Molecular Biology, Institute of Genetics and Animal Breeding, Jastrzebiec, Masovian District, Poland

Elevated temperature during in vitro maturation negatively affects the oocyte’s developmental competence, leading to disturbances in nuclear and cytoplasmic maturation. In previous studies, the role of cumulus granulosa cells (CGC) in cumulus-oocyte complexes’ (COC) response to elevated temperature was underestimated. However, CGC play an essential role in folliculogenesis, supporting the oocyte’s metabolism as well as meiotic progression. Thus, CGC may be engaged in COC response to heat shock. Heat shock protein 70 (HSP70) is the major protein engaged in cellular response to heat stress. The aim of this study was to determine the HSP70 expression in both CGC and oocytes in response to elevated temperature after COC in vitro maturation. COC were collected from bovine ovarian follicles (diameter 2–6 mm) from slaughtered cows and divided into two treatment groups: I (control) – COC were in vitro matured in control temperature (38.58C); II (experimental) – COC were in vitro matured in elevated temperature (418C). After in vitro maturation they were mechanically separated into CGC and oocyte. In vitro maturation was conducted in TCM199 25 mM HEPES medium supplemented with 10% FBS, 0.02 IU mL1 NIH-pFSH, 1 mg mL1 17boestradiol, 22 mg mL1 Na-pyruvate and 10 mg mL1 gentamicin, adjusted to pH 7.4 in 5% CO2. The HSP70 expression in CGC and oocytes was performed by real-time PCR and normalized to S18/H2A and S18 gene expression, respectively. In addition, the immunocytofluorescent analysis of HSP70 expression in CGC and oocyte’s were performed. The HSP70 was stained using primary monoclonal mouse antibodies raised against bovine HSP70 and secondary antibody raised against mouse conjugated with Alexa 488. Nuclei were stained with Hoechst 33342. Slides were analysed under laser confocal microscope (FV-500, Olympus, Center Valley, PA, USA). The HSP70 expression in CGC was measured as total optical density of HSP70 and normalized to total optical density of nuclei. Statistical analyses were performed by Portable Statgraphics 5.0



175

Centurion. Mean values of HSP70 expression in CGC and oocytes in real-time PCR and immunofluorescent analysis in CGC were compared using Tukey’s HSD test (a ¼ 0.01). After in vitro maturation, the expression of HSP70 in CGC was higher (0.13 0.052 a.u., n ¼ 35) in experimental temperature compared to the control (0.058 0.008 a.u., n ¼ 35) (P , 0.01). In oocytes, HSP70 expression in experimental temperature (32.5 5.2 a.u., n ¼ 12) was similar to control (29.8 5.6 a.u., n ¼ 12). The immunofluorescent analysis confirmed data from realtime PCR analysis, indicating that the HSP70 expression in CGCs in experimental temperature was higher (0.46 0.07 a.u., n ¼ 10) compared to the control (0.12 0.02 a.u., n ¼ 10; P , 0.01). After COC in vitro maturation in stress conditions, the HSP70 expression was up-regulated in CGC, but not in oocytes. That may indicate that CGCs play the major role in COC response to elevated temperature; however, the analysis of other heat shock proteins expression in CGC and oocytes need to be conducted. Research was supported by 505-10-023300-K00169-99.

168

EFFECT OF WORTMANNIN IN IN VITRO MATURATION OF BOVINE OOCYTES

E. M. Mogolloń-WalteroA, A. J. B. DiasC, H. F. GomesD, D. F. DubeibeB, R. C. MaiaC, and K. S. VianaC A

Grupo de Investigacioń en Ciencia Animal GRICA, Universidad Cooperativa de Colombia, Bucaramanga, Santander, Colombia; Grupo de Investigacioń en Nutricioń, Toxicologıá y Reproduccioń Animal, GRUPONTRA, Universidad Cooperativa de Colombia, Bucaramanga, Santander, Colombia; C Laborato´rio de Reproduçaõ e Melhoramento Gene´tico Animal, Universidade Estadual do Norte Fluminense Darcy Ribeiro, UENF, Campos dos Goytacazes, Rio de Janeiro, Brazil; D Laborato´rio de Integrado de Bioquı´mica Hatisaburo Masuda, NUPEM-Universidade Federal do Rio de Janeiro, Macae´, Rio de Janeiro, Brazil B

It has been shown that phosphatidylinositol 3 kinase (PI3K) participates in oocyte maturation by regulating the activity of important reactions related to the resumption of meiosis and energy metabolism. Changes in the enzyme activity caused by in vitro conditions may impair important events of oocyte maturation and consequently the production of blastocysts. The study aimed to verify the effect of the addition of wortmannin (a specific inhibitor of PI3K) to the in vitro maturation medium on nuclear and cytoplasmic maturation of bovine oocyte, as well as on the production of blastocysts. Cumulus-oocyte complexes (COCs) were matured in vitro in medium supplemented with FCS and 0 (control) or 20 nM of wortmannin and then fertilized and cultured in vitro in the absence of inhibitor. Twenty-two hours after in vitro maturation the determination of PI3K activity of oocytes by Western blot was performed using anti-PI3K subunit P85 antibody/peroxidase. The activity quantification was performed by densitometry of the bands using the Gel Perfect software (Bozzo and Retamal 1991 Arch. Biol. Med. Exp. 63, 510). To check the effect of treatment on energy metabolism, glucose and glycogen concentration of oocytes was quantified by Glucox 500 test (Doles Reagentes e Equipamentos Para Laborato´rios Ltd., Goiaˆnia, Brazil). The oocyte viability determination was performed by double labelling with propidium iodide and calcein AM. To determine the nuclear maturation, the oocytes were stained with 2% acetic orcein, being considered matured those with chromosomes in metaphase plate. To assess the meiotic spindle organisation, the oocytes were labelled with anti-a tubulin-FITC and propidium iodide. The distribution of actin filaments and mitochondria was determined by rhodamine-phalloidin labelling. The distribution of cortical granules was observed by labelling the oocytes with Lens culinaris–fluorescein isothiocyanate (FITC). The cleavage and blastocyst rates were determined at 48 and 168 h post-fertilization, respectively, both calculated on the number of oocytes placed to mature. The treatment means were compared by t-test (SAS Institute Inc., Cary, NC, USA, 2003). Wortmannin produced a reduction around 40% of PI3K activity; however, the levels of glucose and glycogen were not altered. No changes were found in the viability of in vitro matured oocytes or in nuclear maturation rate (P $ 0.05). Treatment did not promote any change in the organisation of meiotic spindle, distribution of actin filaments, and positioning of mitochondria. However, oocytes treated with wortmannin showed a significant increase (P # 0.05) in the migration of cortical granules compared with controls (87.4% 11.4 and 72.8 11.8%, respectively). The cleavage rate was not influenced by treatment, but the blastocyst rate was higher when oocytes were matured in presence of wortmannin (34.2 6.4% v. 20.0 5.0%, respectively; P # 0.05). The results indicate that partial inhibition of PI3K activity in bovine oocytes treated with wortmannin during in vitro maturation did not affect nuclear maturation, but improved the migration of cortical granules, which seems to have contributed to the increased the blastocyst rate.

169 INVASION OF MURINE ANNEXIN A1 IN BOVINE OVARIAN CORTEX TISSUE DURING SHORT-TIME XENOTRANSPLANTATION IN CONVENTIONAL AND IMMUNE DEFICIENT MICE E. Bartholomeus, A. Langbeen, D. Leblon, E. Fransen, P. Ponsaerts, J. L. M. R. Leroy, and P. E. J. Bols University Antwerp, Wilrijk, Antwerp, Belgium In 2012, 6.7 million women worldwide were diagnosed with cancer, including young women and children. Almost 85% of the latter survive the disease. However, the necessary cytotoxic treatment reduces their reproductive potential by damaging the stock of, basically preantral, ovarian follicles. Current fertility preservation techniques try to overcome this problem. Still, the success rate is low due to a lack of optimization and standardization. Nowadays, culturing preantral follicles in vitro is not yet routinely possible. Therefore, we used an in vivo model based on xenotransplantation of bovine ovarian cortex tissue in recipient mice, as an alternative to studying human reproduction. To further characterise this model, we assessed the influence from the host on the graft at the protein level. Visualising murine annexin A1, an anti-inflammatory protein, in the transplanted bovine cortex tissue should help to elucidate the process of immunological rejection. Hereto its distribution around the present bovine follicles is measured. In total, 12 mice (6 conventional fluorescent C57BL/6-eGFP and 6 immune deficient Balb/c-Nu) were used as graft recipients. All mice were anesthetized with an intraperitoneal injection and subsequently sterilized. Small pieces (max. 9 mm3) of adult bovine ovarian cortex, retrieved from slaughterhouse ovaries, were grafted retroperitoneal. After a transplantation period of 14 (3 mice/mice strain) or 28 (3 mice/mice strain) days, the mice were killed and all grafts were successfully recovered. These were fixed (4% formaldehyde) and processed into histological paraffin slides. Murine annexin A1 (Sigma-Aldrich HPA011271) was localised using immunofluorescence through a rhodamine label (RITC filter). We measured the shortest distances between 10 annexin fluorescent signals and the basal membrane of each follicle, found in the graft. We calculated

176



the average of these measurements, resulting in one data point per follicle. The dataset was fitted in a linear mixed model with annexin as dependent variable, and transplantation period and mice strain as fixed effects. Fluorescent signals of murine annexin A1 were found in all grafts form both mice strains, surrounding bovine follicles. Data show no interaction between mice strain and the duration of the transplantation period. The influence of the mice strain showed a trend towards significance (P ¼ 0.08), possibly due to the immunological state of the host. To our knowledge, this is the first time an attempt has been made to characterise the host/donor interaction in xenografting procedures. We can conclude that annexin A1 from the murine host (whether immunodeficient or immunocompetent) invades the bovine graft tissue in a short period of time.

170

GENE SILENCING OF BMPRII IN BOVINE GRANULOSA CELLS F. Cavallari de Castro, M. H. C. Cruz, H. Fernandes, and C. L. V. Leal

Department of Veterinary Medicine, Faculty of Animal Science and Food Engineering, USP, Pirassununga, SP, Brazil Granulosa cells (GC) are important constituents of the follicular environment for oocyte competence acquisition. However, their functionality depends on oocyte-derived factors, such as GDF9 and BMP15, which act through BMPRII receptor signalling. Gene silencing using lipofection has been used as an important tool to investigate the role of cell genes and proteins. The aim of this study was to establish the ideal conditions for lipofection in bovine GC and starting from this protocol to establish a methodology for silencing of the BMPRII gene by RNA interference, and to use this strategy to study the functions of BMPRII in GDF9 signalling. GC were obtained from slaughterhouse ovaries by aspiration of follicles (2 to 6 mm) and subsequently cultured in DMEM medium at 38.58C and 5% CO2 in air. All data analyzes were performed by GraphPad PrismÒ version 5.0 software (GraphPad Software Inc., La Jolla, CA, USA), using one-way ANOVA followed by Tukey’s test. For optimizing the conditions for lipofection, the GC were treated with different amounts of lipofection agents LipofectamineÒ RNAiMAX (Invitrogen, Carlsbad, CA, USA; 1, 2, and 3 mL) or LipofectamineTM 2000 (Invitrogen; 1, 2, and 3 mL) and the transfection indicators SigloÒ (GE Healthcare, Waukesha, WI, USA; 30 to 100 nM) or FUGW transgenic plasmid (100 to 900 nM) during 24 and 48 h. The highest efficiency of lipofection was observed at 24 h of culture with 2 mL of LipofectamineTM 2000 þ 100 nM of SigloÒ. Based on these conditions, different concentrations of siBMPRII (100 to 500 pM) were tested during 24 h of culture and subsequently, different incubation times (0, 6, 12, 18, and 24 h) with the best siRNA concentration in order to establish optimum conditions for gene silencing. GC were evaluated for the relative abundance of mRNA for BMPRII using PPIA and b-actin as endogenous controls by real-time PCR. All concentrations provided similar and highly significant transcript reduction in comparison to control (P , 0.001), so the lowest of them was adopted (100 pM). For different incubation times with 100 pM siBMPRII also a similar decrease was also seen, which was more significant at 24 h (P , 0.01). The best concentration (100 pM) and incubation time (24 h) with the siRNA were analysed by Western blotting, which confirmed the BMPRII reduction also at protein level (P , 0.05). For functional evaluation, GC submitted or no to gene silencing were incubated with or without GDF9 (100 ng) and assessed for expression of genes controlled by GDF9 through its BMPRII receptor (LHR, INHA, and INHBA), besides the CYP17 gene, a marker of potential theca cells contamination. LHR expression was reduced in silenced groups (P , 0.05) and highly suppressed by GDF9 in non-silenced groups (P , 0.001), while INHA and INHBA expression remained constant in the different groups (P . 0.05), suggesting that the control of these genes in bovine does not behave as reported in other species. The lack of amplification CYP17 indicates the nonexistence of the contamination. In conclusion, this study allowed the establishment of an efficient methodology for the silencing of BMPRII by lipofection in bovine GC, which may be used as a tool for the functional study of BMPRII and potentially for other genes of interest. Research was supported by FAPESP and CNPq.

171 EXPRESSION OF THE OVULATION-INDUCING FACTOR/NERVE GROWTH FACTOR HIGH AFFINITY RECEPTOR IN THE OVARIES OF COWS DURING THE PERIOVULATORY PERIOD R. Carrasco, J. Singh, and G. P. Adams Departament of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, Saskatchewan, Canada Ovulation-inducing factor/nerve growth factor (OIF/NGF) influences ovulation and corpus luteum (CL) size and function in camelids and, remarkably, cows. The ovulation effect in induced ovulators is mediated at the hypothalamo-pituitary-axis, but the site and mechanism of action of the luteotrophic effect is unknown. This mechanism may be an important aspect of OIF/NGF in spontaneous-ovulators. The objective of this experiment was to detect changes in expression of the high affinity OIF/NGF receptor (TrkA) in the ovary during the periovulatory period in cattle. Cows (n ¼ 14) were examined daily by transrectal ultrasonography to determine the day of ovulation (Day 0), and were assigned randomly to be unilaterally ovariectomized on Day 2, 4, 6, or in the preovulatory period before or after the LH surge. Cows assigned to preovulatory groups were given a luteolytic dose of prostaglandin when the dominant follicle of the second follicular wave was $10 mm and growing. Cows assigned to the pre-LH group were ovariectomized 24 h after prostaglandin treatment. Cows assigned to the post-LH group were given LH 24 h after prostaglandin treatment and were ovariectomized 18–20 h later. Cows were allowed to rest for one complete interovulatory interval and re-assigned to a different day-group on which the remaining ovary was removed (n ¼ 4 to 5 ovaries/day-group). Ovaries were fixed in paraformaldehyde, and 5-mm sections of ovarian tissue representing the dominant follicle, largest subordinate follicle, and the CL were treated for enzymatic antigen retrieval and blocked in 1% BSA for 1 h. Slides were incubated overnight with the primary antibody (rabbit anti-human TrkA) and for 2 h with the secondary antibody (goat anti-rabbit IgG). Slides were evaluated by fluorescence microscopy. Images of 3 arbitrarily chosen fields (40) were captured for each structure for each day-group, and the average proportion of immunoreactive cells in the theca layer and luteal tissue was estimated using ImageJ software (National Institutes of Health, Bethesda, MD, USA). The intensity of individual cell immunofluorescence was also scored as no reaction (0), faint (1), weak to moderate (2), or strong (3). Data were compared among groups by two-way ANOVA. The proportion of immunoreactive cells was higher in the dominant follicle than in the subordinate follicle or the CL



177

(P , 0.001); no effect of day-group or interaction was detected. The intensity score increased from faint on Day 2 to strong on Day 6, and remained strong in the pre- and post-LH groups. A discernible pattern of change in intensity score was not evident for the subordinate follicle or the CL. The greater proportion of TrkA positive cells and greater immunoreactive intensity in the maturing dominant follicle support the hypothesis that the luteotrophic effect of OIF/NGF in cattle is a result of a local increase in the expression of TrkA in the theca layer of the dominant follicle. Research was supported by the Natural Sciences and Engineering Research Council of Canada.

172

RELATIONSHIPS AMONG GRANULOSA CELL FGF9 MRNA, FOLLICLE SIZE, AND APOPTOSIS IN CATTLE L. F. SchutzA, C. RobinsonA, L. ZhangA, M. TottyA, M. AlbonicoB, and L. J. SpicerA A

Oklahoma State University, Stillwater, OK, USA; B Universita` degli Studi di Milano, Milan, Italy

Fibroblast growth factor 9 (FGF9) has been suggested to act as a dedifferentiation factor during bovine folliculogenesis, reducing steroidogenesis and increasing cell proliferation in granulosa (GC) and theca (TC) cells, but whether endogenous GC production of FGF9 change during bovine folliculogenesis and atresia/apoptosis is unknown. The objective of these studies was to investigate the relationship between FGF9 mRNA, follicle size, and health status of follicles. Ovaries (n ¼ 10 cows) from a local abattoir classified visually as in midcycle phase (i.e. presence of corpus luteum and large follicles) were collected and categorized as small (1–5 mm), medium (5.1–8 mm) or large (8.1–22 mm) in size (Experiment 1). Follicular fluid (FFL) was aspirated for measurement of oestradiol (E2) and progesterone (P4) via radioimmunoassay and GC collected for RNA extraction. Abundance of mRNA for FGF9 and Caspase-3 (CASP3), an effector of apoptosis, were measured by real-time PCR (qPCR). Data were analysed via factorial ANOVA with main factors: follicle size, follicle estrogenic status, and their interaction. The abundance of GC FGF9 mRNA was greater (P , 0.05) in large E2-inactive (E2P4 concentrations) follicles (10.5 22). The abundance of GC CASP3 mRNA was greater (P , 0.01) in small E2-inactive follicles than in large and medium E2-active and E2-inactive follicles. FGF9 mRNA abundance was not correlated with E2/P4 ratio in FFL, but it was positively correlated with CASP3 mRNA abundance (r ¼ 0.35; P , 0.05). GC CASP3 mRNA abundance was negatively correlated with E2/P4 ratio (r ¼ 0.48; P , 0.01). To investigate the relationship between FGF9 and CASP3 mRNA abundance during experimentally-induced apoptosis, GC from large and small follicles were collected (Experiment 2) and GC were plated in medium containing 10% FCS. GC (n ¼ 3 independent pools for small and large follicles) were then treated with or without 10% FCS for an additional 24 h or 48 h followed by RNA extraction and qPCR for measurement of abundance of FGF9 and CASP-3 mRNA. Statistical analyses with ANOVA included main factors: treatment, duration of treatment, and their interaction. In small-follicle GC, FGF9 and CASP3 mRNA abundance were not correlated and were not affected by treatments. In large follicles, FGF9 mRNA abundance was greater in GC treated without FCS (27.5 2.7) than in GC treated with 10% FCS (6.6 2.7) and tended to differ (P , 0.08) between 24 h (22.5 2.7) and 48 h (11.6 2.7). CASP3 mRNA abundance was greater in GC treated without FCS (310 36) than in GC treated with 10% FCS (140 36) but did not differ (P . 0.10) between 24 h and 48 h. In Experiment 2, there was no significant correlation between FGF9 and CASP3 mRNA (r ¼ 0.28; P ¼ 0.2). These results indicate that FGF9 mRNA abundance is greater in GC from large E2-inactive than from E2-active follicles and its production may be increased in large follicles undergoing apoptosis.

173

THE IMPACT OF ELEVATED TEMPERATURE ON HSP70 EXPRESSION IN CATTLE MURAL GRANULOSA CELLS

S. DabrowskiA, R. R. StarzynskiB, P. TrzeciakA, L. RapalaA, A. PoniatowskiA, A. PiliszekC, and A. M. DuszewskaA A

Division of Histology and Embryology, Warsaw University of Life Science, Warsaw, Poland; Division of Molecular Biology, Institute of Genetics and Animal Breeding, PAS, Jastrzebiec, Poland; C Division of Experimental Embryology, Institute of Genetics and Animal Breeding, PAS, Jastrzebiec, Poland B

Elevated temperature has an adverse impact on cattle fertility, causing disorders in ovarian functions and follicle development. Heat shock caused by elevated temperature leads to disruption in the cytoskeleton structure and the nuclear maturation of oocytes. Furthermore, it has an impact on mural granulosa cells (MGC), which are responsible for maintaining an appropriate microenvironment for oocyte development and signal transmission through the ovarian follicle. Heat-shock protein 70 is considered as a fundamental marker of cellular defence mechanisms related to heat shock. It protects other proteins from denaturation by forming complexes and stabilisation of their structure. HSP70 has also an ability to repair damaged proteins and allows them to return to their native structure. Furthermore, members of the HSP70 subfamily participate in the folding of newly synthesised proteins and their transport to different cell compartments. The aim of this study was to determine the impact of elevated temperature on HSP70 expression in mural granulosa cells. MGCs were obtained postmortem from mural layers of cattle ovarian follicles with diameters greater than 15 mm and randomly assigned to one of 5 variants: I (control) – MGCs after isolation; II – MGCs cultured in medium with LH at 38.58C; III – MGCs cultured in medium with LH at elevated temperature, 418C; IV – MGCs cultured in medium without LH at 38.58C; and V – MGCs cultured in medium without LH at elevated temperature, 418C. HSP70 expression was determined using real-time PCR method, and was normalised to s18/h2a expression. Statistical analysis was made in Statgraphics (Statpoint Technologies Inc., Warrenton, VA, USA; P ¼ 0.01) using one-way ANOVA to compare expression of hsp70 between experimental variants and multifactor ANOVA to determine the influence of temperature and LH stimulation on hsp70 expression. Mean values of hsp70 expression in real-time PCR were compared using Tukey’s test (a ¼ 0.05). The significant increase of hsp70 expression was observed in MGCs cultured at 418C (groups III and V) in comparison to MGCs cultured

178



at 38.58C (groups II and IV) and the control group. Simultaneously, there is no significant impact of LH stimulation on hsp70 expression. In conclusion, mural granulosa cells are susceptible to elevated temperature, which induces activation of cellular defence mechanisms performed by increased hsp70 expression. This may lead to disorders in the function of MGCs followed by changes in follicular fluid composition and signal transmission through the follicle. Research was supported by 505-10-023300-L00171-99.

174

COMPARISON OF ORAL ALTRENOGEST, CIDR, AND LONG-ACTING PROGESTERONE FOR SYNCHRONIZATION OF ESTRUS IN MARES C. CardA, M. Diel de AmorimA, J. BruemmerB, and E. SquiresC A

Western College of Veterinary Medicine, Saskatoon, SK, Canada; B Colorado State University, Fort Collins, CO, USA; C Maxwell Gluck Equine Research Center, Lexington, KY, USA

Synchronization of oestrus in mares remains a challenge to practitioners using Assisted Reproductive Technologies. The research objective was to compare adverse reactions and reproductive parameters in mares treated with different sources of progestins for oestrus synchronization. Mixed breeds of mares with a mean age of 3 years (range 2–20) were used. Groups were: 1) altrenogest 0.044 mg kg1 BW PO daily for 10 days (D) (Regumate, Merck, White House Station, NJ, USA) (n ¼ 30), 2) Long-acting progesterone (LAP4) (BET Pharmacy, Lexington, KY, USA) (n ¼ 30) 10 cc IM once in the neck, and 3) Controlled intravaginal drug release (CIDR-B 1.9 g P4; Zoetis, Kirkland, QC, Canada) (n ¼ 15) vaginal insert for 10 days. Mares were randomly assigned to treatment and evaluated using transrectal reproductive ultrasonography on Days 1 (treatment initiation), 5, 10, and daily during oestrus until ovulation (Ov). On Day 10, mares were given 250 mg of cloprostenol (PG) (Estrumate, Merck) IM, and when a follicle (F) .35 mm was detected 2500 IU hCG (Chorulon, Intervet, Millsboro, MD, USA) was administered IM. Adverse reactions were scored as follows: Regumate – any reaction at any time; LAP4 – the injection site was inspected and scored as: 0, no reaction; 1, mild slight raised area; 2, moderate reaction 5 cm; 3, severe reaction 6–10 cm; 4, very severe reaction .10 cm on Day 5 post-injection; CIDR categorical scores were: 0, no discharge; 1, mild vaginal discharge on CIDR at withdrawal; 2, moderate discharge on tail or vulva; 3, severe urine scald or visible discharge; 4, very severe thickened inflamed skin from urine scald or discharge. Chi-squared test at P , 0.05 was used to evaluate the overall frequency of reactions in mares, and the presence of intrauterine fluid. The time from cloprostenol (PG) to F 35, hCG to Ov, PG to Ov, and mm of intrauterine fluid on Days 1–3, was evaluated using the Shapiro–Wilk test and Kruskall–Wallis at P , 0.05. Results of the overall adverse reactions were: Group 1 0/30 (0%), Group 2 9/30 (30%), and Group 3 14/15 (93.3%). The Group 2 treatment resulted in category 0–4 reactions as follows (21/30, 1/30, 5/30, 2/30, 1/30) and for Group 3 category 0–4 (1/15, 13/15, 0/15, 1/15, 0/15), respectively. The overall frequency of adverse reactions was significantly different between groups (P ¼ 0.0000) with Group 2 having the highest rate. Reproductive parameter results were median (quartiles) days from PG to F35 for groups 1–3 respectively: 4 (2.8–6), 5 (0–6), 3 (4–6), hours from hCG to OV: 42(42–42), 42 (42–72), 42 (43–54); and days from PG to OV: 8 (4.5–8), 8 (5–8), 6.6 (4.8–8). Fluid Day 1, Day 2, Day 3 had a median of 0 mm on all days, and on Day 3 mm of fluid was mild 0 (0–0.125) but different between groups (P ¼ 0.0379). The detection of intrauterine fluid on Day 2 (P ¼ 0.005) was different between groups. No follicle wave synchronization was achieved by progestin administration; hence, the main differences noted between groups were the frequency of adverse reactions, rather than the reproductive parameters studied. The cost of the treatment and the frequency of adverse reactions are important considerations when choosing an oestrus synchronization therapy for mares. Research was supported by the Alberta Agriculture Research Institute.

175

FOLLICULAR DEVELOPMENT AND OVARIAN BLOOD FLOW IN MARES WITH EARLY OR LATE OVULATION POSTPARTUM

K. M. LemesA, L. A. SilvaB, E. C. C. CeleghiniA, M. A. AlonsoA, G. PugliesiA, H. F. CarvalhoA, F. J. AffonsoA, D. F. SilvaA, T. G. LeiteA, and R. P. ArrudaA A

Laboratory of Semen Biotechnology and Andrology, Department of Animal Reproduction, Faculty of Veterinary Medicine and Animal Science, University of Saõ Paulo, Saõ Paulo, Brazil; B Department of Veterinary Medicine, Faculty of Animal Sciences and Food Engineering, University of Saõ Paulo, Pirassununga, Saõ Paulo, Brazil

The postpartum period is characterised by the rapid uterine involution process and return of ovarian activity (foal heat), resulting in a fertile oestrus in most of the mares. However, the follicular development and selection processes during this period are not completely known in horses. We aimed to study the characteristics of follicular growth and vascular perfusion in the ovary during the early postpartum period in mares that demonstrated oestrous behaviour and had early (,10 days) or late ($10 days) ovulation. Ten mares were scanned daily from the first day postpartum (Day 1) until the day of the first postpartum ovulation (Day 0). The animals were split in the early (n ¼ 3) and late (n ¼ 7) ovulation groups (averaged interval between parturition and ovulation: 8.0 0.0 and 14.7 1.2 days, respectively). For ultrasound exams a Duplex B-mode and colour Doppler instrument (M5VETÒ, Mindray, Shenzhen, China) was used with a multifrequency linear probe. Data were analysed for the main effects of group, day, and their interaction using the PROC MIXED procedure of SAS software (version 9.3, SAS Institute Inc., Cary, NC, USA). For the follicular growth, no difference (P . 0.05) was detected between the groups when the data were analysed for the days relative to ovulation (from Day 7 to Day 1). However, the dominant follicle was larger (P , 0.05) in the early-ovulated group (37.2 1.6 v. 21.9 1.1) in all days during early postpartum (Day 1 to Day 7). The number of follicles with .25 mm diameter was also greater (P , 0.05) in the early-ovulated group (1.1 0.1 v. 0.1 0.1)



179

during the first 3 days postpartum. In addition, the late-ovulated mares showed greater number of follicles with 20–25 mm during Day 4 to Day 7 (2.0 0.2 v. 0.7 0.1). For the blood flow characteristics, no difference (P . 0.05) was detected in the coloured signals of blood flows in the follicular wall of the dominant follicle or in the ovarian pedicle ipsilateral to the largest follicle. Therefore, the characteristics of the follicle growth on the preceding days of ovulation were similar between the early- and late-ovulated mares and consistent with the follicular dynamics expected in nonpregnant and non-lactating mares. However, when the data were analysed for the days relative to parturition, a greater follicle development was present in mares that ovulate earlier during the postpartum period (,10 days). In conclusion, the results suggest that important events may occur previous to the parturition, resulting in an early follicle development, mainly in those mares that show heat signs and ovulate within 10 days postpartum. Research was supported by FAPESP process number 2010/10692-9 and CNPq process number 135954/2011-8.

176

BLOOD FLOW TO THE CORPUS LUTEUM AND PREOVULATORY FOLLICLE AFTER OVULATION INDUCTION DURING FIRST VERSUS SECOND WAVE IN WATER BUFFALO S. CaunceA, D. DadarwalB, P. S. BrarB, and J. SinghA B

A University of Saskatchewan, Saskatoon, Saskatchewan, Canada; Guru Angad Dev Veterinary and Animal Science University, Ludhiana, Punjab, India

The objective of the study was to compare the blood flow to the corpus luteum (CL) and the preovulatory follicle in dairy buffalo (Bubalus bubalis) when ovulation was induced during the first (low to increasing progesterone levels) versus the second (luteal progesterone levels) follicular wave. We hypothesised that the wall of the first-wave dominant follicle will be less vascular compared with that of the second-wave follicle. The study was conducted during the summer months in Punjab, India. Ovulation was synchronized with prostaglandin F2a (PGF) IM followed by gonadotropinreleasing hormone (GnRH) IM 48 h later (Day 0) and buffaloes were randomised to first wave (FW; n ¼ 6) and second wave (SW; n ¼ 7) groups. FW group was given PGF on Days 6.5 and 7, and GnRH on Day 9.5 followed by AI (14–16 h after GnRH). The SW group was given GnRH on Day 7 (to induce ovulation of first-wave dominant follicle without luteolysis and synchronous emergence of next wave), PGF on Days 13.5 and 14, GnRH on Day 16.5 followed by artificial insemination. Transrectal colour Doppler ultrasonography (MyLab5 Vetwith 7.5 MHz transducer, Esaote S.p.A, Genoa, Italy) was performed daily and 20-s cineloops of each ovary were recorded under standardized gain controls. Images from the cineloops were processed using Fiji (ImageJ, National Institutes of Health, Bethesda, MD, USA) to calculate the area of blood flow (coloured area ¼ vascular area, grey scale area ¼ tissue area, and their ratio) for the preovulatory follicle (on the day before ovulation) and luteal tissue (on the day of PGF injection and 4 days post-ovulation). Data were analysed by t-test from the animals that ovulated one day before (n ¼ 3) or the day of AI (n ¼ 6) and had a functional CL at day 5 post-AI (FW n ¼ 5, SW n ¼ 4). FW follicles ovulated on 8.6 0.3 days from wave emergence compared with SW follicles on 10.0 0.6 days (P , 0.05) but were similar in size (i.e. follicular area on the day before ovulation did not differ between groups; P ¼ 0.5). There was no difference in the blood flow area in the wall of preovulatory follicles (P ¼ 0.4). Vascular area of follicles was strongly correlated with their diameter (r ¼ 0.87). Follicles .13.5 mm in diameter had more blood flow in their wall than smaller follicles (P , 0.01). FW had a tendency (P ¼ 0.07) for smaller luteal area on the day of PGF treatment (FW ¼ 171 24 mm2; SW ¼ 332 81 mm2) and tended (P ¼ 0.06) to have less vascular area in the CL compared to SW group (FW ¼ 30 6 mm2; SW ¼ 67 17 mm2). There was no difference (P ¼ 0.5) between the groups for vascular to CL area ratio. The area of luteal tissue and blood flow to the CL at Day 4 post-ovulation did not differ between the groups (P ¼ 0.4). The diameter of the preovulatory follicle (11.6–15.7 mm) was not correlated with the cross-sectional area of developing CL at Day 4 post-ovulation (r ¼ 0.09). In conclusion, vascularity to preovulatory follicles originating from the first wave v. second wave did not differ and preovulatory follicles $13.5 mm were more vascular than smaller follicles. Research was funded by NSERC; the first author was funded by scholarships from WCVM and GADVASU.

177 DOWN-REGULATION OF P450 AROMATASE AND GLUCOSE TRANSPORTER 4 MRNAS EXPRESSION IN SHEEP OVARIAN FOLLICLES AFTER ULTRASHORT NUTRITIONAL FLUSHING S. M. FerraroA, M. LamasB, and C. G. Gutie´rrezA A

Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autońoma de Me´xico, Me´xico DF; B Centro de Investigacioń y de Estudios Avanzados del Instituto Politećnico Nacional, Me´xico DF

Nutritional supplementation before breeding (flushing) has become a common practice and is a reliable method to increase lambing and twining rates in sheep. We have shown that ultrashort flushing (USF: 1 day long) acutely increases ovulation rate without affecting the body condition or animal weight. A short nutritional stimulus would necessarily be acting either directly at the ovarian level or through hormones and factors other than gonadotropins. The possible mechanisms of action of USF on ovulation rate is the deregulation of the feedback loop between the ovaries and gonadotropin secretion, where nutrition causes a direct inhibition of follicular oestradiol production leading to compensatory secretion of FSH that stimulates folliculogenesis, or direct stimulation of follicular development through hormones and factors other than gonadotropins. We hypothesised that USF enhances the number of follicles selected for ovulation due to either a decrease in the expression of P450 aromatase or alternatively by advancing the maturation of the ovarian follicles, which would be reflected in an increase in LH receptor (LHr) and 3b-hydroxysteroid dehydrogenase (3b-HSD) mRNA expression, an increase in glucose transporter 4 (GLUT4) mRNA expression, or both. To test these hypotheses, the oestrus cycle of 30 ewes was synchronized with progestin intravaginal sponges and prostaglandins. Animals were given the USF on the day of progestin withdrawal. The ovaries were removed surgically before treatment (time 0; n ¼ 6), or at 12, 24, and 48 h after being treated with either glycerol or water (n ¼ 4 per treatment by time category). The ovarian follicles were dissected out and counted. Follicles larger than 3 mm in diameter were pooled and the mRNA extracted for

180



specific P450aromatase, 3b-HSD, LHr, and glucose transporter 4 determinations. USF increased the number of follicles larger than 3 mm at 48 h after treatment (P , 0.05). No effect was observed in the number of small follicles. In the two largest follicles, aromatase and GLUT4 mRNA abundance decreased (P , 0.01) 12 h after treatment. There was no effect of treatment on mRNA for LH receptor or 3b-HSD. These results demonstrate a reduction in aromatase expression in potentially ovulatory follicles 12 h after flushing. The decrease in aromatase may favour a transient increase in FSH concentrations 12 h after flushing that would allow the stimulation and selection of supplementary ovulatory follicles.

178

IS PROGESTERONE THE DETERMINING REGULATORY FACTOR BEHIND OVULATION RATE IN EWES?

J. SohalA, V. ParavinjaA, T. BabyA, M. MurawskiB, T. SchwarzB, D. A. ZiebaB, D. H. KeislerC, and P. M. BartlewskiA A University of Guelph, Guelph, ON, Canada; University of Agriculture, Krakow, Malopolskie, Poland; C University of Missouri, Columbia, MO, USA

B

Ovarian antral follicles in the ewe grow in an orderly succession, producing 3–4 waves per oestrous cycle. In prolific sheep, some large antral follicles from the second-last wave of the oestrous cycle are added to the ovulatory follicles emerging just before oestrus to give a higher ovulation rate; it is feasible that regression of these follicles is prevented by an increase in serum concentrations of FSH and/or LH pulsatility at pro-oestrus. Prolific sheep tend to have a shorter luteal phase than non-prolific breeds and there is a great deal of evidence that luteal progesterone (P4), in addition to regulating LH release, may govern the secretion of FSH heralding the emergence of follicular waves. The specific purpose of the present experiments was to determine whether or not extending the duration of the luteal phase would alter the ovulation rate in prolific sheep. In both studies, exogenous P4 (7.5 mg ewe1 IM) was administered on Days 11 and 12 (Day 0 ¼ ovulation) in moderately prolific Rideau Arcott x Polled Dorset (Exp. 1, n ¼ 8) and highly prolific Olkuska ewes (Exp. 2, n ¼ 7), while the equinumerous groups of animals served as controls (CTR). Transrectal ovarian ultrasonography was performed daily and jugular blood samples were drawn twice a day from Day 9 until ovulation. All single-time point observations were compared between groups by Student t-test. Progesterone injections resulted in uniform increments in serum P4 levels in all animals allocated to the treatment (TRT) groups. However, the mean duration of the interovulatory interval did not differ (P . 0.05) between TRT and CTR groups of ewes in both experiments. The mean ( s.e.m.) ovulation rate was 1.6 0.2 v. 3.2 0.4 (Exp. 1; P , 0.001) and 3.2 0.8 v. 4.0 1.0 (Exp. 2; P , 0.05) in TRT v. CTR ewes, respectively. There were no differences in terms of the timing of penultimate and final wave emergence between the two subsets of animals studied in either experiment. The number/percentage of ovulating follicles from the penultimate wave of the interovulatory interval studied was 0.25 0.16 v. 1.75 0.45 (P , 0.01)/25.0 16.4% v. 75.0 16.4% (P , 0.05) in Exp. 1 and 0.50 0.30 v. 1.60 0.40 (P , 0.05)/13.8 9.0% v. 53.4 16.7% (P , 0.05) in Exp. 2, in TRT v. CTR animals, respectively. In summary, administration of P4 at the end of diestrus reduced the incidence of ovulations from the penultimate wave of the oestrous cycle in moderately and highly prolific strains of sheep. Therefore, progesterone appears to be a key endocrine signal governing the ovulation rate in cyclic sheep, presumably by acting directly at the level of the ovary. The present results may pave a way to devising a simple and inexpensive method of controlling lamb productivity in commercial flocks of sheep and fertility in other polyovulatory species.

179

INTRAFOLLICULAR CONCENTRATION OF FATTY ACIDS IN GOAT ACCORDING TO FOLLICLE DIAMETER AND AGE OF DONOR M. Roura, M. G. Catala´, S. Hammami, M. Rodriguez, X. Moll, F. Garcia, D. Izquierdo, and M. T. Paramio Dpts CAA i Cirurgia, Fc. de Veterina`ria, Universitat Auto`noma de Barcelona, Barcelona, Catalonia, Spain

Oocytes from adult goats have better competence to develop up to blastocyst stage than those from prepubertal females. Previous results in our laboratory showed that oocyte developmental competence in prepubertal goats is positively related to follicle diameter, as oocytes from follicles larger than 3 mm have the same competence as adult goat ones, demonstrating that follicular environment affects oocyte competence for embryo development. Other studies concluded that fatty acids (FA) in follicular fluid (FF) play an important role in oocyte and embryo development. The aim of this study was to analyse FF composition regarding FA percentage comparing samples from adult (3 years old, forage diet) or prepubertal (1 month suckling) Murciano-Granadina goats. FF samples were recovered from follicles larger and smaller than 3 mm by laparoscopy (adult) or aspiration of ovaries collected at slaughterhouse (prepubertal). For the FA analysis, the Sukhija and Palmquist protocol was used with some modifications. Briefly, 200 mL of FF sample was vortexed for 60 s with 250 mL of toluene and 1 mL of HCL (5%) and then warmed in water bath for 1 h at 708C. Subsequently, 1.25 mL of K2CO3 (12%) and 500 mL of toluene was added, vortexed for 30 s, and centrifuged for 5 min (3000 rpm). Finally the supernatant was recovered and dried with Na2SO4. The extracted samples were maintained at 208C until gas chromatographic analysis (123–2362, Agilent Technologies Inc., Santa Clara, CA). The results are shown in Table 1. The analysis of FA composition in FF showed significantly higher concentrations of C15:0 (pentadecanoic), C16:0 (palmitic), C17:0 (margaric), C18:0 (stearic), linolenic acid (ALA), and EPA (eicosapentanoic) in adult goats compared to prepubertal goats, and C17:0, C18:0 linoleic acid (LA), and ALA in larger follicles of prepubertal females, showing some coincidences in follicular environment that could explain previous studies. These results are in agreement with those of Matoba et al. (2014; Rep. Fertil. Dev. 26, 337) who showed that FF associated with more competent oocytes had a significantly higher concentration in ALA than FF from incompetent oocytes in cattle.



181

Table 1. Concentration of FA (%) in FF in adult and prepubertal goats (top) and in FF of large and small follicles (bottom) from prepubertal goat ovaries (3 replicates) Item

C15:0 a

C16:0

C17:0

a

a

C18:0 a

C18:1n9c a

C18:1n11c

LA

ALA

a

b

a

C20:4n6 b

EPA

DHA

a

Adult Prepubertal

0.76 0.33b

26.81 23.44b

1.21 0.60b

23.59 16.47b

22.67 27.53b

2.08 3.50b

9.88 12.02a

1.95 1.07b

5.31 9.18a

1.56 0.92b

1.56 1.81

Large Small

0.33 0.34

23.01b 23.88a

0.64a 0.55b

17.21a 15.72b

27.68 27.39

3.05b 3.94a

12.67a 11.38b

1.22a 0.91b

8.32b 10.04a

1.02 0.82

1.78 1.85

Different letters in the same column (a.b) differ significantly (P , 0.05). Mixed ANOVA test.

180

FATTY ACID COMPOSITION IN FOLLICULAR FLUID OF PREPUBERTAL GOAT OVARIES IN WINTER AND AUTUMN M. T. Paramio, M. Roura, S. Hammami, D. Izquierdo, and M. G. Catala´

Dep. Cie`ncia animal i dels aliments, Fac. Veterinaria, Universitat Auto`noma de Barcelona, Campus Bellaterra, Barcelona, Spain Fatty acids (FA) in follicular fluid (FF) play an important role on oocyte quality and embryo development (Fouladi-Nashta et al. 2007 Biol. Reprod. 77, 9–17). In our laboratory, we have shown in prepubertal goat differences in the percentage of blastocysts produced in vitro according to season. Thus, we have found in winter 15.8% and in autumn a decrease up to 4.7% of blastocysts that were produced from oocytes of 1 month old suckling Murciano-Granadina goat females and IVF with fresh semen. The aim of this study was to analyse composition of FF in order to find an explanation to seasonal changes in in vitro embryo production. Ovaries were recovered in winter and autumn from 1 month suckling goats (MurcianoGranadina) from a local slaughterhouse and the FF of all visible follicles was recovered using a sterile syringe. Each sample containing a pool of FF of different ovaries was frozen at 808C until chromatography analysis. For the FA analysis, the Sukhija and Palmquist (1988 J. Agric. Food Chem. 36, 1202–1206) protocol with some adaptations was used. Briefly, 200 mL of FF sample was vortexed for 60 s with 250 mL of toluene and 1 mL of HCL (5%) and then warmed in a water bath for 1 h at 708C. Subsequently 1.25 mL of K2CO3 (12%) and 500 mL of toluene was added, vortexed for 30 s and centrifuged for 5 min (3000 rpm). Finally the supernatant was recovered and dried with Na2SO4. The extracted samples were maintained in 208C until gas chromatographic analysis (123–2362, Agilent Technologies Inc., Santa Clara, CA). The results in Table 1 express the mean of 3 replicates of follicular fluid pool as micromolar concentration of FA in FF. The FA profile in FF showed significant higher concentrations of a-linolenic (C18:3n3), eicosapentaenoic (EPA), docosahexaenoic (DHA), and omega-3 (n-3 polyunsaturated fatty acid; PUFA) in winter compared to autumn. This could be indicating that these PUFA have a positive effect on oocyte quality because of the higher embryo development of these oocytes during winter. Studies in our laboratory have shown that sperm penetration and normal zygotes were similar in both seasons even though the blastocyst yield was statistically higher in winter. We can speculate that fatty acids in the follicular environment are affecting the oocyte quality, increasing the possibility of reaching the blastocyst stage in prepubertal goat according to season. Further studies should be done to reach a more accurate conclusion. Table 1. Concentration (lM) of fatty acids in FF of prepubertal goat during winter and autumn (3 replicates) Item Winter Autumn s.e.m.

C17:0 15.5 11.6 1.0

C18:0 406.1 355.0 21.8

C18:1n11c 94.7 76.7 5.0

C18:2n6c 273.6 289.5 10.6

C18:3n3 a

38.36 12.89b 2.4

C20:4n6 221.6 204.6 14.1

EPA

DHA a

29.19 9.02b 2.7

a

46.9 23.26b 4.2

n-3 PUFA a

114.45 45.17b 9.0

n-6 PUFA

n6:n3

495.1 494.1 23.6

4.31a 11.42b 0.9

Different letters in the same column (a.b) differ significantly (P , 0.05). Mixed ANOVA test, SAS (version 9.1, SAS Institute Inc., Cary, NC, USA).

181

MTDNA COPY NUMBER IN OOCYTES OF DIFFERENT SIZES FROM INDIVIDUAL PRE- AND POST-PUBERTAL PIGS H. S. Pedersen, P. Løvendahl, K. Larsen, L. B. Madsen, and H. Callesen Aarhus University, Tjele, Denmark

Oocyte competence has been related to mtDNA copy number, but a large variation in mtDNA copy number between oocytes has been observed, caused by, e.g. oocyte donor and oocyte size (Sato et al. 2014 PLOS ONE 9, e94488; Cotterill et al. 2013 Mol. Hum. Reprod. 19, 444–450; El Shourbagy et al. 2006 Reproduction 131, 233–245). However, the correlation between size and mtDNA copy number in single oocytes has not been determined. This study describes the relation between oocytes of defined diameters from individual pre- and postpubertal pigs and mtDNA copy number. Cumulus-oocyte complexes were aspirated from ovaries of 10 pre- and 10 post-pubertal pigs. Cumulus cells were removed and the oocytes were measured (inside-ZP-diameter). Oocytes were transferred to DNAase-free tubes, snap-frozen, and stored at 808C. The genes ND1 and COX1 were used to determine the mtDNA copy number. Plasmid preparations containing ND1 and COX1 were used to prepare standard curves. Q-PCR

182



reactions using ND1and COX1 specific primers and probes were run in triplicate on a ViiA7 real-time PCR system using TaqMan (Applied BioSystems, Foster City, CA, USA). Standard curves showed high correlation coefficients (r2 ¼ 0.99–1.00) and amplification efficiencies (COX1, 91–104%; ND1, 84–92%). As inter-assay control, standard curves were compared using interaction with dates, showing no differences. mtDNA copy number between groups was compared by ANOVA after log-transformation of data. Relationship between oocyte size and mtDNA copy number was analysed using linear regression. Data were analysed by SAS procedures, SGPLOT and GLM (SAS 9.3, SAS Institute Inc., Cary, NC, USA) with P , 0.05 as significance level. In total, 145 pre- and 93 post-pubertal oocytes were analysed (6–15 from each donor). Mean mtDNA copy number in oocytes from any individual donor was either high ($100 000) or low (,100 000) with no differences between pre- and post-pubertal oocytes. No differences were detected in mtDNA copy number using either of the two primers (Table 1). No linear correlation was detected between oocyte size and mtDNA copy number in pre- and postpubertal oocytes (r2 ¼ 0.00). The donor has a strong influence on oocyte mtDNA copy number in pre- and postpubertal pigs, which could influence individual fertility. mtDNA copy number does not seem to explain the higher developmental competence of neither post- compared to prepubertal pigs nor large compared to small prepubertal oocytes. The impact of individual on mtDNA copy number should be considered for experimental designs and future investigations. Table 1. Analysis of pre- and post-pubertal oocytes Group

Oocyte size (mm)

Primer

(mean s.d.) Prepubertal High Low Postpubertal High Low

116 9 115 8 118 7 119 6

mtDNA copy number Log mean s.d.(n, N)

Geometric mean

ND1 COX1 ND1 COX1

4.54 0.46a (73, 5) 4.59 0.28a (73, 5) 3.62 0.21b (72, 5) 3.90 0.19b (72, 5)

350 497a 392 218a 41 806b 80 002b

ND1 COX1 ND1 COX1

4.61 0.14a (37, 4) 4.52 0.28a (37, 4) 3.43 0.33b (55, 6) 3.68 0.63b (56, 6)

406 491a 334 915a 26 641b 48 261b

Different superscripts indicate significant differences (P , 0.05); n ¼ total number of oocytes from N donors.

a,b

182

IMMUNOHISTOCHEMISTRY LOCALIZATION OF GROWTH DIFFERENTIATION FACTOR 9 (GDF-9) AND BONE MORPHOGENETIC PROTEIN 15 (BMP-15) IN CANINE FOLLICLES THROUGHOUT ESTRUS CYCLE D. Maupeu, J. Palomino, and M. De los Reyes University of Chile, Santiago, Chile

Among different developmental proteins, growth differentiation factor-9 (GDF-9) and bone morphogenic protein 15 (BMP-15), members of the transforming growth factor b (TGFb) superfamily, have been described in many species as key mediators for folliculogenesis. The aim of this study was to analyse in canines the presence and localization of GDF-9 and BMP-15 proteins in follicle cells and oocytes during follicle development. To determine the immunolocalization of GDF-9 and BMP-15, sections of 4% paraformaldehyde in PBS ovaries obtained from 15 bitches at different stage of oestrous cycle (proestrus-oestrus n ¼ 5; diestrus n ¼ 5; anestrus n ¼ 5) were dehydrated (xylene–ethanol solutions) and embedded into paraffin blocks. Individual paraffin sections (5 mm) were inactivated with methanol/H2O2. Sections were blocked at 378C in the peroxidase reagent and incubated with rabbit anti-human GDF-9 (1 : 200) or goat anti-human BMP-15 (1 : 150) antibodies overnight at 48C and with secondary antibodies goat anti-rabbit IgG and donkey anti-goat IgG, both HRP conjugated. Previously negative control sections received rabbit serum. Sections were stained with 1 mg mL1 3,3-diaminobenzidine (DAB) and counterstained with haematoxylin. All sections were examined at magnification 200 using an IX71 inverted microscope (Olympus, Center Valley, PA, USA), with an IX2-RFA lamp and a ProgRes CapturePro camera (Jenoptik AG, Jena, Germany). The same exposure time was applied to all samples and digital photos were taken and subsequently analysed. The intensity of immunostaining in both oocyte and follicular cells of each follicle was evaluated with Image J version 1.45s software (National Institutes of Health, Bethesda, MD, USA). The images were transformed to grey scale and the corrected total cell mark was calculated by subtracting the mean staining of background reading to the integrated density of each sample. The results showed that samples of all slices contained primordial, primary, secondary and pre-antral follicles as well as different sizes of antral follicles showed positive GDF-9 and BMP-15 immunoreactions in the oocyte cytoplasm and in the follicles cells. No such labelling was found in the negative controls. Follicle sizes differed in GDF-9 and BMP-15 immunoreactions according to oestrous cycle. The pattern of GDF-9 immunostaining in proestrus, oestrus, and diestrus was more intense within preantral rather than antral follicles/oocytes, whereas BMP-15 immunoreaction was prominent mainly in proestrus stage increasing to antral stage. These preliminary results indicated temporal pattern of GDF-9 and BMP-15 in canine ovarian follicles which might play important roles in follicular/oocyte development and ovulation during oestrous cycle. Research was funded by FONDECYT Grant 1140658.


183


183

ULTRASONOGRAPHIC MONITORING OF CANINE OVARIES CLAMPED AT SUBCUTANEOUS SITE AFTER FOLLICLE-STIMULATING HORMONE TREATMENT T. Terazono, V. V. Luu, L. T. K. Do, M. Taniguchi, M. Takagi, and T. Otoi

Laboratory of Animal Reproduction, the United Graduate School of Veterinary Science, Yamaguchi University, Yamaguchi, Japan Follicle-stimulating hormone (FSH) alone can induce oestrus in bitches, but few reports describe oestrous induction by FSH because pregnant mare serum gonadotrophin (PMSG) has been more successful than FSH for oestrus induction. Real-time ultrasonography can show canine ovarian follicle development, but no method can determine or predict ovulation accurately. Moreover, the ovary location and size complicate imaging. Using ultrasonography, we investigated FSH treatment stimulation of canine ovary follicles, with clamping of the ovaries at a subcutaneous site. Bilateral malacotomy of four 5-year-old Beagle bitches (mean weight 10.3 2.0 kg) with normal oestrous cycles was done using a ventral flank abdominal approach with routine techniques and materials. Each ovary that maintained blood circulation from the suspensory ligament was clamped at a subcutaneous site through muscles of the abdomen. After about six months of bilateral malacotomy, four bitches at the anestrous (two bitches) and diestrous (two bitches) stages of the oestrous cycle were given 0.5 Armour units of FSH twice daily for 5 days. Examinations with ovarian ultrasonography with 7.5 MHz sector transducer, vaginal cytology, and serum concentrations of progesterone and oestradiol were performed daily from the day before the start of FSH treatment through 7 days after FSH treatment. After 15 days of ovarian examination, each bitch received the same FSH treatment twice continually at 15-day intervals. No serosanguineous vaginal discharge was observed during the ovarian examination. The concentrations of progesterone (,0.045–9.6 ng mL1) and oestradiol (,9.7–81.4 pg mL1) varied through all treatments. Comparison of the concentrations of progesterone (,0.045–7.6 ng mL1) and oestradiol (,9.7–30.3 pg mL1) at the start of FSH administration in each trial revealed that elevated concentrations of both progesterone and oestradiol were observed in the first treatment in 3 bitches. Regarding the second and third treatments, no elevation of concentration was found for progesterone or oestradiol. A new follicular growth was observed in 1 animal after the third FSH treatment, but no follicular growth was found for the other animals. No correlation was found between follicular development and the profile of either progesterone or oestradiol. Ultrasonography proved that FSH stimulation alone cannot induce follicular growth by a single treatment, but it might increase the levels of progesterone and oestradiol, which are not correlated with follicular development and oestrous cycles at the start of FSH treatment.

184

FOLLICULOGENESIS AND DONOR AGE INFLUENCE MATRIX METALLOPROTEINASE-2 EXPRESSION IN THE DOMESTIC CAT N. SongsasenA, M. FujiharaA, K. YamamizuB, and D. E. WildtA A Smithsonian Conservation Biology Institute, National Zoological Park, Front Royal, VA, USA; Laboratory of Genetics, National Institute on Aging, National Institutes of Health, Baltimore, MD, USA

B

Matrix metalloproteinases (MMPs) and tissue inhibitor of metalloproteinases (TIMPs) are known to play key roles in the remodelling of extracellular matrix during ovarian folliculogenesis, especially during the final stage of follicle development. To date, little is known about the significance of MMPs and TIMPs during preantral follicle development. This study determined the expression of MMPs and TIMP-1 during various stages of cat folliculogenesis, largely for the purpose of securing information useful to improving in vitro follicle culture. Primordial (,10 follicles/cat), primary (,5 follicles/cat), secondary (,9 follicles/cat), early antral (,9 follicles/cat), and antral (,4 follicles/cat) follicles were physically isolated from ovaries recovered from 15 cats (5 months to 3 years old during follicular stage) undergoing ovariohysterectomy and assessed for expression of MMP1, -2, -3, -7, -9, and -13 as well as TIMP-1 using real-time quantitative polymerase chain reaction (q-PCR; 2–4 replicates/follicle stage). Additional ovaries were obtained from three prepubertal (6 months old) and three adult (1 year old) cats and ovarian pieces were fixed in Bouin’s solution and assessed for MMP-2 and -13 localization using immunohistochemistry. MMP expression data were analysed using the Kruskull-Wallis one-way ANOVA. Follicles from all stages of development expressed MMPs and TIMP-1. Specifically, expression of MMP-2 increased (P , 0.05) as folliculogenesis progressed (10-fold increases from primordial to early-antral and antral stage). There were no differences (P . 0.05) in the expression of other MMPs among follicular classes. For TIMP-1, there was a tendency (P ¼ 0.07) for increased expression after antrum formation (early antral and antral stages). Immunohistochemistry analysis revealed that MMP-2 was expressed in both the oocyte and somatic cells of all follicular stages in prepubertal cats. However, MMP-2 expression was limited to granulosa and theca cells of antral follicles in adult females. MMP-13 was expressed in the granulosa and theca cells of primary, secondary, and antral stage follicles, and there were no differences (P . 0.05) in localization patterns for this protein between prepubertal and adult females. In summary, the study is the first to report the expression of MMPs as well as TIMP-1 in isolated cat follicles. The difference in MMP-2 expression between prepubertal and adult cats suggests that there may be age-specific requirements for in vitro follicle growth. We are keenly interested in this information for underpinning the development of new in vitro microenvironments for growing immature cat follicles. We suspect that such information will be crucial for understanding how to promote the remodelling of the extracellular matrix by creating degradable biomaterials containing MMP-sensitive peptides to allow optimal follicle expansion.

185

PREVALENCE AND PROLIFERATIVE ACTIVITY OF MULTIOOCYTE FOLLICLES IN BITCHES: PRELIMINARY RESULTS R. C. Justino, N. T. Lunardon, K. C. Silva-Santos, R. L. Oliveira, M. M. Seneda, and M. I. M. Martins Universidade Estadual de Londrina, Londrina, Parana´, Brazil

Multioocyte follicles (MOF) are follicles that enclose two or more oocytes. They have been described in many mammalian species, but there is no evidence about their activity in the ovaries. The aim was to estimate the prevalence of MOF and to compare the cell proliferation activity between follicles containing one or more oocytes in the ovaries of prepubertal and adult bitches. Eighty ovaries from prepubertal (n ¼ 20) and adult bitches

184



(n ¼ 20) were obtained by elective ovariohysterectomy (OHE). Immediately after OHE, ovaries were immersed in Bouin’s fixative for histological processing. 5 mm thick sections were mounted on histological slides and stained with periodic acid-Schiff (PAS) and hematoxylin. Cell proliferation was evaluated by immunohistochemistry using the proliferating cell nuclear antigen (PCNA). Monoclonal antibody PCNA (clone PC1O, 1 : 200 dilution, Biocare, Concord, CA, USA) was used according to manufacturer’s instructions and an antibody diluent was used as a negative control. Slides were counterstained with hematoxylin and examined at 200 to 400 magnification under light microscope. Only cells showing PCNA signal exclusively in the nucleus were considered positive. The prevalence of MOF in the ovaries was compared using a Fisher’s exact test (P , 0.05). In all females, the prevalence of MOF was 55% (22/40). MOF containing two or three oocytes were more abundant; however, multioocyte follicles with up to 12 oocytes were observed. The prevalence of MOF at the primordial stage was higher for prepubertal bitches (47 v. 28%) but adult bitches exhibited a higher frequency of secondary MOF (49 v. 25%; P , 0.05). There was no difference in the prevalence of MOF at primary stage between prepubertal and adult bitches (28 v. 23%; P . 0.05). Regarding the cell proliferation activity, PCNA immunoreactivity was detected in oocyte nucleus and granulosa cells of multioocyte follicles at different stages of development. Similarly to what was observed for follicles containing only one oocyte, all nuclei of oocytes within multioocyte follicles exhibited PCNA immunoreactivity and there was a gradual increasing of immunoreactivity in granulosa cells according to the stage of follicular growth. Expression of PCNA by granulosa cells of multioocyte follicles was higher in the secondary and antral stage of development; however, some primordial and primary follicles also exhibited some PCNA-positive cells. In conclusion, the prevalence of MOF at the primordial stage of development was higher in prepubertal bitches, whereas MOF at the secondary stage were more frequent in adult bitches. The PCNA expression pattern by the oocyte nucleus of multioocyte follicles was similar to that observed in follicles containing only one oocyte, which is suggestive of similar activity between these follicles. Furthermore, the presence of proliferative activity in granulosa cells of multioocyte follicles suggests an association of the PCNA expression with more advanced stages of follicular growth.

186 THE EFFECT OF SHORT VERSUS LONG TERM ELEVATED NONESTERIFIED FATTY ACID CONCENTRATIONS DURING MURINE IN VITRO FOLLICLE GROWTH ON OOCYTE DEVELOPMENTAL COMPETENCE S. D. M. ValckxA, L. JordaensA, R. CortvrindtB, P. E. J. BolsA, and J. L. M. R. LeroyA A

Gamete Research Centre, University of Antwerp, Antwerp, Belgium; B EggCentris Bvba, Brussels, Belgium

Metabolic disorders, like obesity and type 2 diabetes are characterised by lipolysis-linked elevated nonesterified fatty acid (NEFA) concentrations. Exposure to high NEFA concentrations during the final phase of bovine in vitro oocyte maturation (24 h) impairs oocyte developmental competence and subsequent embryo quality. However, because elevated NEFA concentrations in vivo are often present for a longer period of time, our recent research focused on a more in vivo-like long-term NEFA exposure (12 d) of whole murine follicles in vitro. The model covers follicular growth from the early secondary to the antral stage in vitro, including final oocyte maturation after an ovulatory stimulus (OS). Results showed an altered follicular growth and physiology (steroid synthesis, gene expression) and a subsequent reduced oocyte developmental competence. However, it remains unclear what specific time frame in follicular development is the most sensitive to such metabolic insult. Therefore, we hypothesised that chronic elevated NEFA concentrations throughout follicle growth affect oocyte developmental competence more severely than short-term NEFA exposure limited to the final phase of oocyte maturation. The aim was to study the effect of elevated NEFA concentrations 1) during the final phase of follicular oocyte maturation (after the OS) and 2) during the whole period of in vitro murine follicle growth until the antral stage, including final oocyte maturation. Early secondary follicles, isolated from the ovaries of 13-day-old B6CBAF1 mice, were cultured in vitro until the antral stage (3 replicates). Follicles were exposed to: BASAL NEFA mix for 12 days (BASAL-BASAL, control); HIGH stearic acid (SA) for 12 days (SA-SA); HIGH NEFA mix for 12 days (NEFA-NEFA); HIGH SA after the OS (BASAL-SA); and HIGH NEFA mix after the OS (BASAL-NEFA). Oocytes were isolated out of antral follicles 20 hours after the OS, routinely fertilized and presumptive zygotes cultured. Cleavage (n cleaved zygotes/ n oocytes) and blastocyst (n blastocysts/n oocytes) rates were documented and analysed by means of binary logistic regression. Cleavage rate was reduced for BASAL-BASAL (37%) compared to BASAL-NEFA embryos (52%; P ¼ 0.045). The BASAL-NEFA treatment (43%) presented with a higher blastocyst percentage than BASAL-BASAL (23%; P ¼ 0.004), NEFA-NEFA (26%; P ¼ 0.037) and SA-SA (15%; P ¼ 0.001) treatments. The BASAL-SA (30%) treatment performed better than the SA-SA treatment (P ¼ 0.049). Even though BASAL-BASAL (control) embryo development was surprisingly low, the results indicate that long-term NEFA exposure during follicle growth in vitro affects oocyte developmental competence more severely than an exposure limited to the final phase of maturation after the OS. The results thus emphasise that the maternal micro-environment throughout follicular growth and not only during final oocyte maturation is essential for optimal oocyte quality.

187

OVARIAN CYCLE LIPID DYNAMICS REVEALED BY DESI-MS IMAGING AND MORPHOLOGICALLY-DRIVEN MULTIVARIATE STATISTICS A. K. Jarmusch, C. R. Ferreira, L. S. Eberlin, and V. Pirro Purdue University, West Lafayette, IN, USA

Understanding the role of lipid metabolism in ovarian physiology is crucial for the progression of reproductive biotechnology. The aim in this work was to explore the lipid composition and dynamics of ovarian tissue, specifically the stroma, follicles, and corpora lutea. Desorption electrospray ionization–mass spectrometry (DESI-MS), an ambient ionization technique, was applied in this investigation, acquiring chemical and spatial information simultaneously. A morphologically-friendly solvent, dimethylformamide-acetonitrile (1 : 1), was used for DESI-MS imaging which allowed for ovarian lipid characterisation and subsequent staining (hematoxylin and eosin) providing morphological information. By this approach, regions-of-interest (ROI) were selected from bovine (n ¼ 8), swine (n ¼ 3), and mice (n ¼ 5) ovaries (including pre-pubescent and cycling adults)



185

based on the stained morphological structures. ROI for stroma (n ¼ 54), follicles (n ¼ 89), and corpora lutea (n ¼ 61) were selected and chemically profiled. Tissue sections (20 mm) were thaw mounted onto glass microscope slides and stored at 808C until analysis. A linear ion trap mass spectrometer equipped with a custom DESI-MS imaging stage was operated in the negative ion mode (m/z 200 to 1000). A 300 300 mm pixel size was used in DESI-MS imaging of ovarian tissue. Hyperspectral DESI images were reconstructed and processed by principal component analysis (PCA) that allowed visualisation of relationships among spatial (i.e. morphology) and chemical features. Ions indicated by PCA were analysed using univariate analysis (ANOVA), supporting the significance of particular lipids between morphological structures, e.g. adrenic acid (P ¼ 1.7 108) and m/z 836 (P ¼ 8.9 109) between corpora lutea and follicles. All morphological structures could be differentiated by multivariate statistics (.90% prediction rate) independent of the species, indicating conserved lipid constitution. Smaller differences in the lipid profiles were noted between species, poly-ovulatory and mono-ovulatory species, and reproductive maturation. A large variety and abundance of lipids was observed in corpora lutea and follicles, where steroidogenesis is a prominent physiological activity. Additional insight into ovarian physiology was gained with the detection of arachidonic and adrenic acid. The spatial relationship of arachidonic and adrenic acid with the corpora lutea – the former is a known prostaglandin precursor and key signalling molecule in steroidogenesis regulation and the latter is metabolized in the prostaglandin pathway by the same enzymes – suggests the latter may also have a role in steroidogenesis regulation, previously unseen in ovarian physiology. DESI-MS imaging with morphologically-driven statistical analysis proved efficient in relating and interpreting the chemical and morphological features. This methodology can by further applied to unravel complex ovarian-related physiological mechanisms and to other physiological and physiopathological models.

188

DEVELOPMENT OF AN EFFECTIVE WHOLE-OVARY PERFUSION SYSTEM S. MaffeiA, G. GaleatiB, G. PennarossaC, T. A. L. BreviniC, and G. GandolfiC A

Institute for Genetic and Biomedical Research, National Council of Research, Milan, Italy; B Department of Veterinary Medical Science, Universita` di Bologna, Bologna, Italy; C Department of Health, Animal Science and Food Safety, Universita` degli Studi di Milano, Milan, Italy The different structures of a mammalian ovary require complex 3-dimensional interactions to function properly. It is difficult to access the ovary in vivo and to study its physiology in vitro, it is necessary to dissect its different parts and culture them individually. Although informative, this approach prevents the understanding of the role played by their interactions. Perfusion systems are available for ovaries of laboratory animals while organs of larger species have been maintained in culture only for a few hours. This has prompted us to develop a system that can preserve the function of a whole sheep ovary for a few days ex vivo so that it is available for analysis in controlled conditions. Twenty-four sheep ovaries were collected at the local abattoir; 18 were assigned randomly to 3 experimental groups (media A, B, and C) and 6 were immediately fixed in 10% formaldehyde and used as fresh controls. Whole ovaries were cultured for up to 4 days using a semi-open perfusion system. Organs were perfused through the ovarian artery, at a flow rate of 1.5 mL min1 with basal medium (M199, 25 mM HEPES, 2 mM L-glutamine and 100 mg mL1 antibiotic-antimycotic solution) supplemented with 0.4% fatty acid free BSA (medium A); or 0.4% BSA heat shock fraction (medium B); or 10% FBS, 50 ng mL1 IGF-1, and 50 mg bovine insulin (medium C). Ovaries were stimulated with FSH (FolltropinÒ-V, Bioniche Animal Health Inc., Belleville, Ontario, Canada) changing medium in a pulsatile manner (1 mg mL1 for 2 h; 0.5 mg mL1 for 2 h; 0 mg mL1 for 20 h), with the same cycle repeated each day of culture. At every change, aliquots were collected for oestradiol (E2) and progesterone (P4) quantification. After culture, ovaries were examined for follicular morphology, cell proliferation, and apoptotic rate. Statistical analysis was performed using one-way ANOVA (SPSS 20, IBM, Armonk, NY, USA). In media A and B, all morphological parameters showed a small but significant decrease compared to fresh control, only after 3 days of culture. The different BSA in medium B did not affect follicle morphology but significantly increased cell proliferation (medium A, 28.59 3.26%; medium B, 32.04 2.67%) and decreased apoptosis (medium A, 32.51 5.92%; medium B, 24.55 2.55%). In both media, steroid concentration increased after FSH pulses (E2 range 1.95– 10.50 pg mL1; P4 range 0.34–3.08 ng mL1), reaching levels similar to those measurable in peripheral plasma. The presence of FBS, IGF-1, and insulin in medium C allowed extension of the culture period to 4 days with a percentage of intact follicles comparable to that observed after 3 days in media A and B. Moreover, proliferation rates were comparable to fresh controls. Steroid pattern changed with P4 values dropping close to zero (range 0.03–1.18 ng mL1) and E2 level (range 23.59–94.98 pg mL1) increasing 10-fold, achieving a concentration similar to that measured in the ovarian vein around oestrous. Our data indicate that it is possible to support viability of large animal whole ovaries for up to 4 days, providing a physiologically relevant model for studying ovarian functions in vitro. Research was supported by AIRC IG 10376 and by the Carraresi Foundation.

189

THE EFFECT OF VITAMIN D SUPPLEMENTATION ON ANTI-MULLERIAN HORMONE LEVELS IN REPRODUCTIVE-AGE WOMEN M. TaheriA, M. ModarresA, and A. AbdollahiB A

School of Nursing & Midwifery, Tehran University of Medical Sciences, Tehran, Iran; B School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

Vitamin D deficiency has been correlated with the infertility and lower clinical pregnancy following IVF. Anti-Mullerian hormone (AMH) plays a key role during follicle development; it has been recognised as a predictor of regular ovulation and probably IVF success. Considering the critical need for experimental human study to investigate the impact of vitamin D supplementation on ovulatory function, the aim of this study was to demonstrate the effectiveness of the vitamin D supplementation on AMH serum levels among reproductive-age women with vitamin D deficiency. 195 reproductive women (18–35 year-old) with confirmed vitamin D deficiency [serum 25(OH)D ,75 nmol L1] and without

186


Gene Expression

diagnosed polycystic ovary syndrome (PCOS) were enrolled to this controlled clinical trial. Participants were randomly assigned to a control group (n ¼ 96) or an intervention group (n ¼ 99). Women in the intervention group used 2000 IU day1 vitamin D drops for 15 weeks. 19 participants were missed during the follow-up; finally the numbers of women in the intervention and control groups were 91 and 85, respectively. At the beginning of the study and after the intervention, 25-hydroxyvitamin D and AMH serum levels were quantified using enzyme immunoassay (EIA; Immunodiagnostic Systems, Boldon, UK) and ELISA (Beckman-Coulter Inc., Fullerton, CA, USA) methods respectively. The post-intervention AMH measurement was performed after 2–5 weeks in the same day-of-cycle on which basal AMH measurement was done. Paired t-test, independent t-test, and Pearson correlation were used as appropriate and a P-value of less than 0.05 was considered significant. Significantly low AMH levels were seen in the vitamin D deficient women of this study (14.46 11.92 pmol L1 in control group and 14.09 11.52 pmol L1 in intervention group). After the intake of vitamin D supplementation in intervention group, AMH levels were increased to 24.89 12.47 pmol L1, which were significantly different from the 15.43 13.03 pmol L1 in control group (P , 0.001). Correlation coefficients for AMH with pre-intervention and post-intervention vitamin D were r ¼ 0.489 and r ¼ 0.599 respectively (P , 0.001). Treatment of vitamin D deficiency increases AMH to the optimum levels. Vitamin D deficient women had low levels of AMH. These findings support other studies which found a correlation of poor IVF outcomes with low vitamin D levels. Vitamin D supplementation could be useful in the improvement of controlled ovarian hyper-stimulation/IVF outcomes in case of vitamin D deficiency.

Gene Expression 190

EXPRESSION OF GENES ASSOCIATED WITH WINGLESS-RELATED MOUSE MAMMARY TUMOUR VIRUS SIGNALING IN THE PRE-IMPLANTATION BOVINE EMBRYO P. Tribulo, J. I. Moss, and P. J. Hansen University of Florida, Gainesville, FL, USA

Wingless-related mouse mammary tumour virus (WNT) signalling participates in early embryonic development to maintain pluripotency, controls cell–cell communication, and modulates cell polarization and migration. To gain an understanding of the regulation of WNT signalling during embryonic development, expression patterns of a variety of molecules involved in WNT signal transduction were evaluated. Specific genes were DKK1, an endogenous inhibitor of canonical WNT signalling, the WNT co-receptors LRP5 and LRP6, WNT-responsive transcription factors, LEF1 and TCF7, and two repressors of WNT-regulated genes, the bovine orthologue of GROUCHO (LOC505120) and AES. Embryos were produced in vitro from oocytes obtained from ovaries collected at a local abattoir. Following oocyte maturation, fertilization was performed with sperm pooled from three randomly selected bulls; a different pool of bulls was used for each replicate. Groups of 30 matured oocytes or embryos at the 2-cell [28–32 h post-insemination (hpi)], 3–4 cell (44–48 hpi), 5–8 cell (50–55 hpi), 9–16 cell (72–75 hpi), morula (120–123 hpi), and blastocyst (168–171 hpi) stages were collected. The zona pellucida was removed with proteinase, RNA was purified, cDNA synthesised using random hexamer primers and real-time qPCR performed. Data analysed were DCT values, which were calculated by subtracting the CT value of the geometric mean of the three housekeeping genes (GAPDH, YWHAZ, and SDHA) from the CT value of the sample. The relative transcript abundance was calculated as the 2DCT. Data were analysed by least-squares ANOVA using the Proc GLM procedure of SAS (SAS Institute Inc., Cary, NC, USA). A total of 5 replicates were analysed for each developmental stage. Results show significant effects of stage of development for each gene that ranged from P ¼ 0.004 for LRP5 to P # 0.0001 for AES, DKK1, LEF, LOC505120, LRP6, and TCF7. In all cases, expression declined as development advanced. Except for AES, lowest expression occurred at the blastocyst stage. Lowest expression for AES was at the morula stage; expression remained low at the blastocyst stage. For two genes, DKK1 and LEF1, there was no detectable expression at the blastocyst stage. The timing of decline in expression varied between genes, first occurring at the 9–16cell stage (AES, LEF1, and LOC505120) or morula stage (DKK1, LRP5, LRP6, or TCF7). For DKK1, LEF1, and LRP6, there was also a slight increase in expression from the oocyte to two-cell stage. Results suggest that canonical WNT signalling is reduced at the morula and blastocyst stages relative to earlier stages in development. Research was supported by USDA-NIFA 2011-67015-30688.

191

IN VITRO CULTURE DURING OOCYTE MATURATION AND FERTILIZATION INFLUENCES THE TRANSCRIPTOME PROFILES OF BOVINE BLASTOCYSTS A. GadA,D, U. BesenfelderB, V. HavlicekB, M. Ho¨lkerA, F. RingsA, I. DufortC, M. A. Sirard C, K. SchellanderA, and D. TesfayeA A

Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn, Bonn, Germany; B Institute of Animal Breeding and Genetics, University of Veterinary Medicine, Vienna, Austria; C Centre de Recherche en Biologie de la Reproduction, Universite´ Laval, Que´bec, Canada; D Department of Animal Production, Faculty of Agriculture, Cairo University, Giza, Egypt

Early embryonic development, the period from oocyte maturation until blastocyst formation, is the most critical period of mammalian development. It is well known that in vitro maturation, fertilization, and culture of bovine embryos is highly affected by culture conditions. However, the stagespecific effect of culture environment is poorly understood. Therefore, we aimed to examine the effect of in vitro culture conditions during oocyte

Gene Expression


187

maturation and fertilization on the transcriptome profile of the resulting blastocysts. Bovine oocytes were matured in vitro and then either directly transferred to synchronized recipients, fertilized, and cultured in vivo (Vitro_M), or transferred after in vitro fertilization (Vitro_F), or at zygote stage (Vitro_Z) and blastocysts were collected at Day 7 by uterine flushing. For in vivo or in vitro fertilization, the same frozen-thawed commercial bull semen has been used. Complete in vitro (IVP) and in vivo produced blastocysts were used as controls. Gene expression patterns between each blastocyst group and in vivo produced blastocyst group were compared using EmbryoGENE’s bovine microarray (EmbryoGENE, Que´bec, QC, Canada) over six replicates of each group (10 blastocyst/replicate). Microarray data were statistically analysed using the Linear Models for Microarray Data Analysis (LIMMA) package under the R program (The R Project for Statistical Computing, Vienna, Austria). Results showed that, the longer the embryos spent under in vitro conditions, the higher was the number of differentially expressed genes (DEG, fold-change ¼ 2 with adjusted P-value ¼ 0.05) compared with in vivo control group. The Vitro_M group showed the lowest number of DEG (149); in contrast IVP group represented 841, DEG, respectively compared to in vivo control group. Ontological classification of DEG showed that lipid metabolism was the most significant function influenced by in vitro maturation conditions. More than 55% of DEG in the Vitro_M group were involved in the lipid metabolism process and most of them showed down-regulation compared to in vivo control group. On the other hand, Vitro_F and Vitro_Z groups showed nearly similar numbers of DEG (584 and 532, respectively) and the majority of these genes in both groups were involved in cell-death- and cell-cycle-related functions. Pathway analysis revealed that retinoic acid receptor activation pathways were the common ones in the Vitro_M and Vitro_F groups. However, different signalling pathways were commonly dominant in the Vitro_F and Vitro_Z groups. This study provides the transcriptome elasticity of bovine embryos exposed to different environments during maturation, fertilization, and culture periods of development.

192

EXPRESSION OF SELECTED ANTIOXIDANT ENZYMES IN BOVINE OVIDUCT EPITHELIAL CELL (BOEC) IN RESPONSE TO ELEVATED TEMPERATURES IN VITRO L. RapalaA, R. R. StarzynskiB, P. Z. TrzeciakA, S. DabrowskiA, and A. M. DuszewskaA A

B

Warsaw University of Life Sciences, Warsaw, Poland; Institute of Genetics and Animal Breeding of the Polish Academy of Sciences, Jastrzebiec, Poland

Elevated temperatures have a negative impact on bovine reproduction. One of its effects is an increased concentration of reactive oxygen species (ROS) which may lead to female infertility. Oxidative stress impairs oocyte maturation, fertilization, and embryo development, and it also influences the reproductive tract. One of the defence mechanisms against the increase of ROS is the synthesis of antioxidants. Thus, the aim of this study was to analyse the expression of antioxidant enzymes (superoxide dismutase 1, SOD1; catalase, CAT; and glutathione peroxidase 1, GPX1) in bovine oviduct epithelial cells (BOEC) cultured with or without embryos at elevated temperatures. Ovaries and oviducts were collected from a slaughterhouse. BOECs were mechanically isolated from the oviducts. The oocytes were isolated from ovaries and then maturated and fertilized in vitro. BOEC, after formation of aggregates, were cultured (variant I) in 40-mL droplets of cultured medium (TCM199 25 mM HEPES medium supplemented with 10% FBS, 10 mg mL1 gentamicin, and 50 mg mL1 streptomycin) overlaid with mineral oil. Twenty aggregates per droplet were cultured at control (38.58C) and elevated (418C) temperatures for 168 h in 5% CO2 in air. Analogously, in variant II, BOEC aggregates were co-cultured with 15 bovine embryos per droplet. Subsequently, the SOD1, CAT, and GPX1 mRNA levels were analysed in BOEC by real-time RT–PCR (Light Cycler, Roche Diagnostics, Warsaw, Poland) and normalized to S18/H2A gene expression. Relative quantification was determined with LightCycler software version 3.5 (Roche Diagnostics) by the second derivative maximum method. Statistical analyses were performed by Portable Statgraphics 5.0 Centurion (Statpoint Technologies Inc., Warrenton, VA). Mean values of SOD1, CAT, and GPX1 expression in BOEC in RT-qPCR analysis were compared using Tukey’s HSD test (a ¼ 0.01). Elevated temperature leads to an up-regulation of SOD1 in BOEC cultured (388C: 0.76 0.12 a.u., n ¼ 44; 418C: 1.07 0.21 a.u., n ¼ 48) and co-cultured with bovine embryos (388C: 0.71 0.11 a.u., n ¼ 36; 418C: 1.04 0.2 a.u., n ¼ 36) and the difference was statistically significant (P , 0.01). The CAT gene expression in BOEC was constant in variant I (388C: 0.56 0.22 a.u., n ¼ 56; 418C: 0.58 0.27 a.u., n ¼ 56) and variant II (388C: 0.48 0.27 a.u., n ¼ 32; 418C: 0.59 0.29 a.u., n ¼ 24). Also, GPX1 gene expression in BOEC was constant in variant I (388C: 0.66 0.23 a.u., n ¼ 60; 418C: 0.61 0.19 a.u., n ¼ 56) and in variant II (388C: 0.59 0.19 a.u., n ¼ 36; 418C: 0.64 0.22 a.u., n ¼ 36). In conclusion, elevated temperature leads to an activation of the BOEC’s defence mechanisms which are based on SOD1 expression, and which may protect cells against oxidative stress. Elevated temperature doesn’t affect the cat and GPX1 expression in BOEC. The presence of embryos does not affect the expression of antioxidant enzymes in BOEC. Research was supported by COST DPN/DWM/MZ/5670/08/09.

193

PROGESTERONE CONCENTRATIONS AND MESSENGER RNA EXPRESSION OF PROGESTERONE RECEPTORS IN ENDOMETRIAL TISSUE OF BOVINE UTERINE HORN IPSILATERAL AND CONTRALATERAL TO CORPUS LUTEUM H. TakahashiA,B, S. HanedaB, and M. MatsuiB B

A The United Graduate of Veterinary Sciences Gifu University, Gifu-City, Gifu, Japan; Obihiro University of Agriculture and Veterinary Medicine, Obihiro-City, Hokkaido, Japan

Generally, conception is established in the uterine horn ipsilateral to the corpus luteum (CL) in cattle. When a bovine embryo is transferred into the uterine horn contralateral to CL, conception rate is low. Since progesterone (P4) is essential for the establishment of pregnancy in cattle, locational effects of P4 released from CL at the uterus may cause the differences in fertility. The aim of this study was to determine the endometrial tissue P4 concentrations (EndP4) and the mRNA expression of nuclear progesterone receptor (PGR), and progesterone receptor component-1 (PGRMC-1) and -2 (PGRMC-2) in the endometrial tissues from the ipsi- and contralateral horn. The uteruses of Holstein cows were obtained at a local abattoir.

188


Gene Expression

Endometrial tissues were collected from both horns. Based on ovarian morphology, the oestrus cycle of the cow was estimated as follows: early luteal phase (ELP, Day 5–6, Day 0 ¼ oestrus), mid luteal phase (MLP, Day 8–12), late luteal phase (LLP, Day 15–17), and follicular phase (FP, Day 18–20). EndP4 was measured by enzyme immunoassay. Expressions of mRNA were analysed by real-time RT–PCR. Two-way factorial ANOVA and the Steel-Dwass test were applied for a multiple comparison of means. The interrelations between both parameters were expressed by Spearman correlation coefficient. At ELP and MLP, EndP4 in ipsi-horn were higher than that in contra-horn (P , 0.05, see Table 1). Higher mRNA expression of PGRMC-1 in ipsi-horn was observed at ELP compared with contra-horn (P , 0.05). Expressions of mRNA for PGR and PGRMC-2 were similar in both horns. In ipsi-horn at ELP, EndP4 was positively correlated with PGRMC-1 mRNA (r ¼ 0.87, P , 0.05), but was negatively correlated with PGR mRNA (r ¼ 0.76, P , 0.05). However, in contra-horn, EndP4 has no correlation to mRNA expression of P4 receptors. In conclusion, EndP4 was influenced by the location of CL and stage of oestrus cycle. Higher expression of PGRMC-1 mRNA in endometrial tissue of ipsi-horn at ELP might be up-regulated by higher EndP4. These locational effects of CL on uterus may provide an intrauterine environment suitable for embryo development. Table 1. End P4 and expression of mRNA for P4 receptors in bovine uterine horn1 Location

Stage (n)

End P4 (ng g1)

PGR2

PGRMC-12

PGRMC-22

Ipsi-horn

ELP (7) MLP (6) LLP (6) FP (6) ELP (7) MLP (6) LLP (6) FP (6)

32.2 3.1a,x 28.6 3.0a,x 16.5 3.0b 5.9 1.6b 16.9 1.9a,y 16.3 3.4a,y 14.8 4.4a 5.5 1.6b

0.96 0.27 0.27 0.13 0.13 0.07 0.89 0.39 1.12 0.44 0.14 0.09 0.04 0.02 0.68 0.48

0.69 0.11a,x 0.36 0.09a,b 0.27 0.07b 0.12 0.06b 0.31 0.06y 0.24 0.08 0.18 0.08 0.19 0.09

0.06 0.02 0.36 0.17 0.09 0.08 0.12 0.06 0.11 0.04 0.21 0.12 0.06 0.03 0.16 0.05

Contra-horn

Different superscripts within each column represent significant differences (P , 0.05). Different superscripts between ipsi- and contra-horn represent significant differences (P , 0.05). 1 Values are expressed as means s.e.m. 2 Values are relative expressions. a,b

x,y

194

EFFECT OF MATERNAL AGE ON THE GRANULOSA CELL TRANSCRIPTOME OF PREOVULATORY FOLLICLES IN CATTLE M. I. R. KhanA,B, F. C. F. DiasA, M. A. Sirard C, G. P. AdamsA, and J. SinghA

A

Department of Veterinary Biomedical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, SK, Canada; B Department of Theriogenology, Faculty of Veterinary Sciences, University of Veterinary and Animal Sciences, Lahore, Punjab, Pakistan; C Centre de Recherche en Biologie de la Reproduction, INAF, Universite´ Laval, Que´bec, QC, Canada

The objective was to determine how maternal age influences the transcriptome of the dominant follicle during the preovulatory period. We tested the hypotheses that delayed ovulation in aged cows is associated with 1) altered gene expression of granulosa cells of the preovulatory follicle and 2) decreased synthesis of progesterone by granulosa cells of the preovulatory follicle. Granulosa cells of preovulatory follicles were obtained 24 h after LH treatment from aged Hereford cows (17.0 2.5 years; n ¼ 6) and their daughters (9.0 0.6 years; n ¼ 6), and compared using bovine specific microarrays (EMBV3, EmbryoGENE, Que´bec, QC, Canada). Results were confirmed by RT-qPCR. A total of 1340 genes or gene isoforms were expressed differentially ($2-fold change; P # 0.05) in aged cows v. their younger daughters. Differentially expressed up- and down-regulated genes were related to 1) LH response (mRGS2, mSERPINE2, mPTGS2), 2) cellular differentiation and luteinization (mTNFAIP6, mGADD45B, kVNN1), and 3) progesterone synthesis (mSTAR, mHSD3B2, mNR5A2, mNR4A1). Intra-follicular concentration of progesterone was lower (P , 0.05) in aged v. young cows. Pathway analysis of the dataset revealed that mechanisms of delayed ovulation in aged cows may involve 1) postreceptor desensitization of G-coupled protein receptors, 2) inactivation of tissue plasminogen activator, and 3) delayed production of prostaglandin E2. In conclusion, transcriptome analysis of granulosa cells from aged cows revealed a delayed or suboptimal response to the preovulatory LH stimulus, represented by delayed cellular differentiation, luteinization, and progesterone synthesis. This study was supported by grants from the National Science and Engineering Research Council of Canada, and the EmbryoGene Network, Canada. M.I.R. Khan was supported by graduate assistant scholarship from the Higher Education Commission of Pakistan.

195 SUPPRESSION OF SETDB1 DURING BOVINE EMBRYONIC DEVELOPMENT RESULTS IN PREIMPLANTATION MORTALITY AND DECREASED TRANSCRIPTION OF TRANSPOSABLE ELEMENTS M. D. Snyder, J. H. Pryor, K. J. Veazey, M. D. Peoples, G. L. Williamson, M. C. Golding, M. E. Westhusin, and C. R. Long Department of Veterinary Physiology and Pharmacology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Organization of chromatin structure by the combinatorial patterns of DNA methylation and post-translational histone modification is essential for the establishment and maintenance of proper transcriptional programs that result in the coordination of embryonic development. We previously observed

Gene Expression


189

that suppression of transcripts encoding SET domain, bifurcated 1 (SETDB1) using small interfering RNAs (siRNA) is embryonic lethal, with SETDB1-suppressed embryos (n ¼ 361) arresting immediately before the blastocyst stage (blastocyst rate: Control 44.9 4.9% and NULL injected 25.7 6.0%). Studies in rodents indicate SETDB1 is a crucial regulator of transposable elements and that the precise epigenetic regulation of these elements is a key aspect of transcriptional programs controlling pluripotency and placentation. To better characterise the molecular basis of the observed mortality, we analysed expression of the bovine Long Interspersed Nuclear Element 1 family (LINE1) of transposable elements via quantitative real-time reverse-transcription polymerase chain reaction (RT-qPCR). Mature bovine oocytes were obtained from a commercial supplier (De Soto Biosciences, Seymour, TN, USA) and IVF performed by standard laboratory protocol. Eighteen hours after IVF, cumulus cells were removed and presumptive zygotes divided into 3 different treatment groups: non-injected control (CNTL), non-targeting siRNA injected control (siNULL), and zygotes injected with siRNAs targeting SETDB1 (siSETDB1). Each embryo was injected with ,100 pL of siRNAs (10 mM) in fluorescent dextran solution. All zygotes were verified as injected by fluorescent microscopy and then cultured in Bovine Evolve (Zenith Biotech, Guilford, CT, USA) medium supplemented with 4 mg mL of BSA (Probumin, EMD Millipore, Darmstadt, Germany). Groups of embryos (15–20) from each treatment were lysed at the 4-cell, 8-cell, and morula stages, RNA extracted, and analysed by RT-qPCR using GAPDH and YWHAZ as reference genes. A two-way ANOVA and a Student’s t-test were used to analyse the results from the RT-qPCR. As expected, siSETDB1-injected morulae displayed dramatic reduction in the level of Setdb1 transcripts as compared to siNULL control (96%; P , 0.05). Preliminary analysis of LINE1 transcripts at the morula stage indicated siSETDB1-injected embryos displayed a 75% reduction compared to the siNULL. Whether alteration in LINE1 regulation contributes to the developmental arrest and embryonic mortality of siSETDB1-injected embryos is under investigation.

196

CHANGES IN METABOLIC EXPRESSION PROFILES IN PLACENTA AND FETAL LIVER FROM BOVINE CLONED CONCEPTI V. H. V. Rodrigues, K. C. S. Tavares, C. Lazzarotto, J. P. M. Alves, S. G. Neto, R. P. da C. Gerger, F. Forell, L. R. Bertolini, and M. Bertolini University of Fortaleza (UNIFOR), Fortaleza, Ceara´, Brazil

Accelerated fetal growth may be observed in pregnancies from IVP embryos, which can be associated with increased concentration of sugar moieties (glucose, fructose) in the fetal plasma and related fluids (Bertolini et al. 2004 Reproduction 128, 341–354). The aim of this study was to compare the gene expression profiles of 14 key enzymes from seven metabolic pathways, four sugar transporters and nine bioactive molecules in liver and placental tissues obtained from Day-225 bovine concepti. Day-7 bovine in vivo- (control) and in vitro-derived [IVF or NT] blastocysts, produced by established procedures (Ribeiro et al. 2009 Cloning Stem Cells 11, 377–386), were transferred to synchronous recipients. Four control, 4 IVF, and 6 NT pregnancies were terminated on Day 225 of gestation for the comparison of maternal, fetal, and placental traits, and for the collection of tissue samples for molecular analyses by RT-qPCR for transcripts related to fructogenesis (AR, SORD), fructolysis (KHK, DAK, ALDOB), glycolysis (GAPDH, LDHA, LDHB), gluconeogenesis (Pepck, Fbp, G6PC), pentose phosphate pathway or PPP (G6PD), cholesterol (HMGCR) and fatty acid syntheses (ACACA), sugar transporters (SLC2A1, SLC2A2, SLC2A3, SLC2A5), components of the IGF system (IGF1, IGF2, IGF1R, IGF2R), markers for placental function (PL, PAG-1, LOC503858), and apoptotic activity (BAX, BCL2). RNA from placentome and fetal liver samples was extracted using TrizolÒ reagent (Invitrogen, Carlsbad, CA, USA), and cDNA synthesis from total RNA were done with the SuperScriptÒ III FirstStrand Synthesis System (Invitrogen). For the RT-qPCR, 1 mL of cDNA, 300 nM of each primer and 1X Power SYBR Green PCR Mastermix (Applied Biosystems, Foster City, CA, USA) were used in the StepOnePlus real-time PCR system (Applied Biosystems), with results normalized using 2DDCT method with ribosomal protein S9 (RPS9) as the housekeeping gene. Data were analysed by the GLM procedure (LSM s.e.m.), with pairwise comparisons by the Tukey test (Minitab software, Minitab Inc., State College, PA, USA). Placental, fetal liver, and fetal weights were higher in NT concepti (6.9 0.8 kg, 769.9 93.8 g, and 27.2 3.7 kg) than controls (3.2 0.1 kg, 290.3 3.6 g, and 12.5 0.5 kg) and IVF (3.2 0.4 kg, 345.8 30.5 g, and 13.7 1.0 kg) counterparts, respectively. In general, IVF-derived conceptus traits were similar to controls for most parameters evaluated in this study. When compared with controls, gene expression levels in the placenta indicated 2- to 5-fold increased activity in fructogenic, gluconeogenic, and pentose phosphate pathways, sugar transport (SLC2A1, -3 and -5), and bioactive markers (IGF1 and -2, and PL), whereas the gluconeogenic, fructolytic, and fatty acid pathways and SLC2A2 expressions were 3- to 35-fold up-regulated in the fetal liver of clones. These data indicated that a significant difference exists in activity in metabolic pathways and placental function in cloned concepti, suggesting an active glucose synthesis, an increase in fructose synthesis by the placenta, and in fructose catabolism by the fetus, which may be a reflection of an association between changes in metabolic fetal programming and excessive prenatal growth after cloning.

197

INFLUENCE OF PLASMID CONSTRUCTION AND CELL TYPE ON THE GENERATION OF GENETICALLY MODIFIED CELL LINES IN CATTLE A. G. CurcioA, F. F. BressanB, K. S. VianaA, A. F. L. RiosA, F. V. MeirellesB, and A. J. B. DiasA A

Universidade Estadual do Norte Fluminense, Campos dos Goytacazes, Rio de Janeiro, Brazil; B Universidade de Saõ Paulo, Pirassununga, Saõ Paulo, Brazil

Several factors may influence transgenic animal production efficiency, and among them gene construction and the cell type used are of great importance. For a long time, fetal fibroblasts were largely used in generation of transgenic cattle production by nuclear transfer, however adult cells are very useful for cloning once the genotype of the donor nuclei is known, and derivation of such cells is technically simple, efficient, and reproducible. Thus, this study aimed to evaluate the effect of cell type on the percentage of GFPþ cells and fluorescence intensity, using two plasmids constructs encoding for green fluorescent protein (GFP). Transfections were performed in bovine fetal fibroblasts (FF), adult fibroblasts (AF), and cumulus cells (CC) transfected by use of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) for the internalization of FUGW or pEGFPN2 plasmid. Fortyeight hours after transfection, the number and the fluorescence intensity (arbitrary units) of GFPþ cells was measured by flow cytometry (FACSAria, FACSDiva Software, BD Biosciences, Franklin Lakes, NJ). Non-transfected cells were used as controls. Means were compared by

190


Gene Expression

the Student–Newman–Keuls test (SNK; P , 0.05). The FUGW plasmid promoted a higher rate of transfection and fluorescence intensity than pEGFPN2 in all cell types evaluated. When the FUGW plasmid was used, higher transfection rates were obtained with fetal fibroblasts (FF: 17.8 2.82; AF: 10.66 0.65, CC: 3.9 1.97), while higher fluorescence intensity was observed in adult fibroblasts (FF: 4542 497.09; AF: 9367.5 3490.9, CC: 3496 2638.92). The pEGFPN2 plasmid showed percentage of transfected cells and fluorescence intensity significantly higher than the control only in cumulus cells (pEGFPN2 – FF: 4.9 0.14 and 206.47 755; AF: 760 and 2.4 0.70 330.92; CC: 3.9 1.97, and 1418 36.06, respectively; control – FF: 0.15 0.07 and 249 6 : 36; AF: 0.15 0.07 588 213.54, and CC 0.05 0 214 0.07, respectively). We conclude that the plasmid construction may influence the overall efficiency in transfected cells; however, the transfection percentage and fluorescence intensity is greatly influenced by the cell type. We suggest that transgenesis of a specific cell type may be enhanced by the proper choice of the expression vector.

198

AGE EFFECT ON RELATIVE GENE EXPRESSION OF BOVINE SPERMATOGONIA

M. I. GiassettiA, P. V. MoreiraA, M. D. GoissisA, F. R. Oliveira de BarrosB, J. C. DelgadoA, C. M. MendesA, P. de A. MonkeyA, M. E. O. d’A´. AssumpçaõA, and J. A. VisintinA A

Laboratories of In Vitro Fertilization, Cloning, and Animal Transgenesis, Department of Animal Sciences, School of Veterinary Medicine at the University of Sao Paulo, Saõ Paulo, Saõ Paulo, Brazil; B The Hospital of Sick Children, Toronto, Ontario, Canada

Spermatogonial stem cells (SSCs) have important applications in treatments for infertility and animal transgenesis. However, the isolation of bovine SSCs is less efficient than for other species and it is lower for adult bulls. The goal of this study was to verify whether the relative gene expression of spermatogonia is affected by age after the laminin differential plating. Ten grams of parenchyma of testicles from pre-pubertal animals (5 months of age, n ¼ 5) and bulls (3–4 years of age, n ¼ 5) were minced and digested: colagenase (1 mg mL1) for 30 min at 378C and trypsin (2.5 mg mL1) for 5 min at 378C. Cells were plated (3 106 viable cells) in 60-mm culture dish covered with laminin (20 ng mL1) and they were cultured for 15 min in high-humidity atmosphere with 5% of CO2 at 378C. The adherent cells were recovered by enzymatic digestion with 0.1% trypsin for 1 min at 378C. Viable cells were selected by the Trypan exclusion method, RNA was extracted from ,200.000 viable cells (Ilustra RNAspin Mini RNA, GE Healthcare, Waukesha, WI, USA) and cDNA synthesis was performed (SuperScriptÒ VILOTM, Invitrogen, Carlsbad, CA, USA). ITGA6 (integrin, a 6), SELP (Selectin P) and ICAM (Intercellular Adhesion Molecule 1) relative gene expression were determined by real-time RT-PCR (Mastercycler ep Realplex, Eppendorf International, Hamburg, Germany); GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) and ACTB (actin b) were used as housekeeping genes. The statistical analysis was performed by QPCR_MIXED (SASÒ, SAS Institute Inc., Cary, NC, USA). An a level at 0.05 was always adopted. ITGA6 and ICAM1 relative expression weren’t effected by age; respectively, P ¼ 0.2367 and P ¼ 0.3583. However, SELP was highly expressed in adult bulls (P ¼ 0.0022). Previously, ICAM1 and SELP have also been shown to mark aging haematopoietic stem cells and were more highly expressed in spermatogonia from adult mice than younger. However, SELP is expressed in more differentiated spermatogenic cells such as human sperm. The expression levels of ITGA6 did not seem to be significantly altered by age, indicating that age affects only certain SSC properties. Financial support was provided by FAPESP (CEUA/FMVZ/USP 2509/2011).

199

IN VITRO-DEVELOPED BOVINE BLASTOCYSTS ARE MARKED WITH ABERRANT HYPER- AND HYPO-METHYLATED GENOMIC REGIONS D. Salilew-WondimA, M. HoelkerA, U. BesenfelderB, V. HavlicekB, F. RingsA, D. GagneĆ, E. FournierC, M. A. Sirard C, E. TholenA, C. LooftA, C. Neuhoff A, K. SchellanderA, and D. TesfayeA A

Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn, Bonn, Germany; B Institute of Animal Breeding and Genetics, University of Veterinary Medicine Vienna, Vienna, Austria; C Centre de Recherche en Biologie de la Reproduction, Faculte´ des Sciences de l’Agriculture et de l’Alimentation, INAF, Pavillon des Services, Universite´ Laval, Que´bec, Canada Most often, in vitro produced embryos display poor quality and altered gene expression patterns compared to their in vivo counterparts. Aberrant DNA methylation occurring during in vitro embryo development is believed to be one of the multifaceted factors which may cause altered gene expression and poor embryo quality. Here, we investigated the genome-wide DNA methylation patterns of in vitro derived embryos using the recently developed Bovine EmbryoGENE Methylation Platform (BEGMP) array (Shojaei Saadi et al. BMC Genomics 2014 15, 451. doi: 10.1186/14712164-15-451) to unravel the aberrantly methylated genomic region in in vitro developed embryos. For this, in vitro and in vivo produced blastocysts were produced and used for genome-wide DNA methylation analysis. In vitro blastocysts were produced from oocytes retrieved from ovaries collected from the local abattoir and matured, fertilized, and cultured in vitro using SOF media. The in vivo blastocysts were produced by superovulation and AI of Simmental heifers followed by uterine flushing. Genomic DNA (gDNA) was then isolated from four replicates (each 10 blastocysts) of in vivo and in vitro derived blastocysts using Allprep DNA/RNA micro kit (Qiagen, Valencia, CA, USA) and the gDNA was then fragmented using the MseI enzyme. Following this, MseLig21 and MseLig were ligated to the MseI-digested genomic fragments in the presence of Ligase enzyme. Methyl-sensitive enzymes, HpaII, AciI, and Hinp1I, were used to cleave unmethlayted genomic regions within the MseI-MseI region of the fragmented DNA. The gDNA was subjected to two rounds of ligation-mediated polymerase chain reaction (LM-PCR) amplification. After removal of the adapters, the amplified gDNA samples from in vivo or in vitro groups were labelled either Cy-3 or Cy-5 dyes in dye-swap design using ULS Fluorescent gDNA labelling kit (Kreatech Biotechnology BV, Amsterdam, The Netherlands). Hybridization was performed for 40 h at 658C. Slides were scanned using Agilent’s High-Resolution C Scanner (Agilent Technologies Inc., Santa Clara, CA, USA) and features were extracted with Agilent’s Feature Extraction software (Agilent Technologies Inc.). The results have shown that from a total of 414 566 probes harboured by the BEGMP array, 248 453 and 253 147 probes were detected in in vitro and in vivo derived blastocysts, respectively. Data analysis using the linear

Gene Expression


191

modelling for microarray (LIMMA) package and R software (The R Project for Statistical Computing, Vienna, Austria) revealed a total of 3434 differentially methylated regions (DMRs; Fold change $1.5, P-value ,0.05), of which 42 and 58% were hyper- and hypo-methylated, respectively, in in vitro derived blastocysts compared to their in vivo counterparts. The DMRs were found to be localised in the intronic, exonic, promoter, proximal promoter, and distal promoter, and some of the probes did not have nearby genes. In addition, 10.8% of the DMRs were found to be stretched in short, long, or intermediate CpG islands. Thus, this study demonstrated genome-wide dysregulation in the epigenome landscape of in vitro-derived embryos by the time they reach to the blastocysts stage.

200

STAGE-SPECIFIC EXPRESSION PATTERNS OF THE INSULIN-LIKE GROWTH FACTOR 1 RECEPTOR DURING BOVINE PRE-IMPLANTATION EMBRYONIC DEVELOPMENT F. Poppicht, H. Stinshoff, and C. Wrenzycki Clinic for Veterinary Obstetrics, Gynecology and Andrology, Justus-Liebig-University, Giessen, Germany

Insulin-like growth factor 1 (IGF1) is a key regulator in early embryonic development, influencing physiological processes and stimulating growth and development (Fowden et al. 2003). Supplementing IGF1 during in vitro culture of bovine embryos improved cleavage and developmental rates while it reduced apoptosis (Byrne et al. 2002). The signal transduction of IGF1 is performed by its binding to the insulin-like growth factor 1 receptor (IGF1R). At the mRNA level, IGF1R is expressed throughout pre-implantation embryonic development and was identified as a potential marker of good quality embryos (Yaseen et al. 2001). However, information on protein level is rare. Therefore, protein expression of the IGF1R during early embryonic development in vitro was analysed in the present study by immunofluorescence staining. Furthermore, the mRNA expression of the IGF1R was investigated by RT-qPCR. In vitro derived embryos of different stages (2-cell, 4-cell, 8-cell, 16-cell stage, morula, blastocyst, and expanded blastocyst) were either directly subjected to immunofluorescence staining or frozen at 808C for use in RT-qPCR. Staining was performed with a peptide antibody against two peptide sequences of the bovine IGF1R a unit, which was specifically produced. Pixel intensity of immunofluorescence was measured and a mean grey value was calculated using the cellsensÒ software (Olympus, Hamburg, Germany). Data were analysed by one-way ANOVA followed by a Tukey’s test using SigmaStat 3.5 Software (Systat Software GmbH, Erkrath, Germany). The detection of the IGF1R mRNA and protein was possible in all stages of embryonic development beginning at the 2-cell stage up to the expanded blastocyst. The maximal mRNA expression could be observed in 2- and 4-cell embryos. It significantly decreased to the 8-cell stage, followed by an increase up to the expanded blastocyst. The IGF1R protein was mainly localised in the plasma membrane of single blastomeres and also weakly in the cytoplasm. Mean grey values are highest in the 2-cell stage, showing a significant decline up to the 16-cell stage and an increase again until the expanded blastocyst. The mRNA and protein expression showed similar patterns during early embryonic development. IGF1R expression started to increase at the 8-cell stage (mRNA) and 16-cell stage (protein) indicating a link to the maternal-embryonic transition. For the first time, these results show that in bovine embryos, the IGF1R expression is related to the activation of the embryonic genome. We gratefully acknowledge the financial support of the H. Wilhelm Schaumann Foundation (Hamburg, Germany).

201

USING THE TRANSCRIPTOME SIGNATURE TO PREDICT PREGNANCY SUCCESS IN BEEF COWS AT 6 DAYS AFTER ARTIFICIAL INSEMINATION

S. ScolariA, G. PugliesiA, S. C. S. AndradeB, F. D’AlexandriA, G. GasparinB, A. M. Gonella-DiazaA, L. L. CoutinhoB, and M. BinelliA A

Department of Animal Reproduction, University of Sao Paulo, Sao Paulo, Brazil; B Escola Superior de Agricultura, University of Sao Paulo, Sao Paulo, Brazil

Pregnancy success is critical to the profitability of cattle operations. Attempts to reduce high rates of early embryonic loss mainly focus on the critical phase of embryo recognition by maternal tissue. However, the molecular events driving the uterine tissue toward a favourable stage, facilitating the maternal receptivity, are poorly understood. This study aimed to characterise the endometrial transcriptome profiles of pregnant versus nonpregnant beef cows during early pregnancy and attempted to define a potential set of marker genes that can be valuable for predicting pregnancy outcome. Therefore, pluriparous, cyclic Nellore (Bos indicus) cows were synchronized (n ¼ 51) and artificially inseminated (n ¼ 36) at detected oestrus using semen from a single high-fertility bull. Six days after AI (Day 6), jugular blood samples and an endometrial biopsy from the uterine horn contralateral to the ovary containing the CL were collected. Pregnancy diagnosis was performed by ultrasonography on Days 22 and 30. Based on pregnancy outcome, samples were retrospectively allocated to the following groups: pregnant (P; n ¼ 6) and nonpregnant (NP; n ¼ 5). Both groups had similar plasma progesterone concentrations on Day 6 (less than 1 ng mL1 between lowest and greatest concentrations). Endometrial biopsies were submitted to RNA-Seq analysis in an Illumina single flow cell line (Illumina Inc., San Diego, CA). The 272 685 768 million filtered reads were mapped to the Bos taurus UMD3.1 reference genome and 14 654 genes were effectively analysed for differential expression between groups. Transcriptome data showed that 216 genes are differently expressed when comparing P v. NP endometrial tissue (adjusted P , 0.1). More specifically, 36 genes showed a significantly up-regulated expression for pregnant cows and 180 are up-regulated for non-pregant cows. Functional enrichment and pathway analyses revealed enriched expression of genes associated with extracellular matrix remodelling in NP cows and nucleotide binding, microsome, and vesicular fraction in P cows. From the 40 top-ranked genes, six that were down- and three that were up-regulated in pregnant cows were further analysed by qRT–PCR in an additional 26 cows. Subsequent quantitative expression data were evaluated using multivariate statistics. Both principal component analysis (PCA; R2 ¼ 0.82 and Q2 ¼ 0.40) and orthogonal projections to latent structures analysis (OPLS), using pregnancy as the dependent variable (R2Y ¼ 0.95 and Q2 ¼ 0.86), efficiently separated P from NP animals. In conclusion, this study characterizes a unique set of genes, expressed in the endometrium as early as 6 days after AI, that indicate a receptive state leading to pregnancy success. Furthermore, expression of such genes can be used as potential markers to efficiently predict pregnancy success.

192


202

Gene Expression

ASSOCIATION BETWEEN BMP4 GENE POLYMORPHISM AND OVUM PICK-UP IN VITRO PRODUCTION TRAITS IN BRAZILIAN GYR COWS C. R. Quirino, W. H. O. Vega, A. Pacheco, A. S. Azevedo, and A. J. B. Dias Universidade Estadual do Norte Fluminense, Campos dos Goytacazes, Rio de Janeiro, Brazil

In Bos taurus taurus, previous studies have reported an association between single nucleotide polymorphism (SNP) in BMP4 gene and the blastocyst rate in cows evaluated for in vitro embryo production efficacy. The aim of this study was to evaluate the degree of association between a polymorphism in the BMP4 gene and characteristics related to in vitro embryo production as well as pregnancies thereof in Bos taurus indicus cattle (Gyr breed). Data from 212 ovum pick-up in vitro (OPU-IPV) sessions were collected of 50 Gyr cows in the Rio de Janeiro state, Brazil. The OPU-IVP procedures were performed and associated with marker SNP. The OPU-IVP traits were number and proportion of viable cumulus-oocyte complexes, number and proportion of cleaved embryos at Day 4 of culture, number and ratio of transferable embryos at Day 7 of culture, number and proportion of pregnancies at Day 30 after transfer, and number and proportion of pregnancies at Day 60 after transfer. DNA was extracted from hair follicles. BMP4 polymorphism, the segment of the BMP4 gene (exon 2, SNP rs109778173) was amplified by PCR with a specific primer. PCR-restriction fragment length polymorphism (RFLP) was used for genotyping. HinfI restriction enzyme that recognises and cleaves the sequence 50 G ? ANTC 30 was used. The samples were submitted to capillary electrophoresis Fragment AnalyzerTM (Advanced Analytical Technologies Inc., Ames, IA) for allelic discrimination by size and polymorphism identification. Genotypic frequency, allele frequency, Hardy–Weinberg equilibrium probability, gene homozygosity, gene heterozygosity, effective allele number, and polymorphism information content were statistically analysed in the software PowerMarker v.3.25 (North Carolina State University, Raleigh, NC, USA). The association between DNA marker and the OPU-IVP traits and pregnancy rates was make by analysis of variance of repeated data PROC GLIMMIX of SAS 2009 (SAS Institute Inc., Cary, NC, USA). The domain of the protein coding of BMP4 gene is located in exon 2. A fragment of the sequence of DNA in exon 2 was amplified, where the mutation SNP rs109778173 was identified (G . T) in Gyr cows using PCR-RFLP and capillary electrophoresis methods. Three genotypes were identified (GG, TT, and GT) with genotypic frequencies of 0.64, 0.32, and 0.04 respectively; allelic frequency and Hardy–Weinberg equilibrium. The polymorphism was significantly associated with the number of viable oocyte complexes, ratio of viable oocyte complex, and ratio of pregnancies at 30 days (P . 0.01). The GT genotype affects negatively the number and proportion of viable cumulus-oocyte complexes and the proportion of pregnancies at Day 30 after transfer. This finding is an indication of a genetic effect of these characteristics.

203

PI3-K PATHWAY IS ONE OF THE KEY REGULATORS OF STEROIDOGENESIS OF CUMULUS CELLS OF BOVINE CUMULUS-OOCYTE COMPLEXES MATURATED IN DEFINED MEDIUM IN THE PRESENCE OF FSH D. Kaiser de SouzaA,D, L. P. SallesA,B, R. CamargoA,C, B. Dolabela de LimaA,C, F. A. G. TorresA,B, and A. A. M. Rosa e SilvaA,D A

B

University of Brasilia, Brasilia, DF, Brazil; Laboratory of Molecular Biology, Department of Cellular Biology, Brasilia, DF, Brazil; C Laboratory of Microbiology, Department of Cellular Biology, Brasilia, DF, Brazil; D Laboratory of Biotechnology of Reproduction, Brasilia, DF, Brazil

The aim of the present study was to access the function of PI3-K pathway tested by the use of its inhibitor, LY294002, in maturation medium of bovine cumulus-oocyte complexes (COC) in steroid concentration in the medium, key enzymes of steroidogenic pathway and gonadotrophin receptors of cumulus cells. This study was performed in defined medium without serum and albumin (MIV B) in absence or presence of 10 ng mL1 of FSH. Androstenedione 107 M was used as a precursor of steroidogenesis. Bovine COC (n ¼ 35–40/well) collected from ovaries obtained at abattoirs of Brasilia (DF, Brazil) were cultivated in 400 mL of medium MIV B; MIV B þ 100 mmol mL1 of LY294002; MIV B added to 10 ng mL1 of FSH; or MIV B added to 10 ng mL1 of FSH þ 100 mmol mL1 of LY294002 for 22 to 24 h. After culture, COC were mechanically denuded and cumulus cells from 20 COC were isolated by centrifugation to determine the gene expression of LHR, FSHR, CYP11A1, CYP19A1, and HSD17B1 by PCR real time. Cumulus cells of immature COC were also collected and analysed as the calibrator group. Student–Newman–Keuls was performed as statistical test. The culture medium was collected after culture to determine progesterone and 17b-oestradiol concentration by quimioluminescence method and to calculate E2/P4 ratio. Two-way ANOVA, followed by Bonferroni test, and t-test were performed to determine the statistical significance. The MIVB enhanced LHR, FSHR, CYP11A1, CYP19A1, and HSD17B1 and LY294002 inhibited the expression of all genes (P , 0.05). MIVB þ FSH decreased the expression of all genes (P , 0.05) except CYP11A1. LY294002 in the presence of 10 ng mL1 of FSH did not affect the gene expression of FSHR, CYP11A1, and HSD17B1; however, it increased expression of LHR and CYP19A1. Oestradiol and progesterone production was increased by supplementation of FSH in MIVB (P , 0.05), but the E2/P4 ratio did not differ between treatments. LY294002 decreased oestradiol and E2/P4 ratio in absence or presence of FSH (P , 0.05), but did not alter progesterone concentration in MIVBþFSH. The inhibitor of PI3-K decreased the expression of steroidogenic proteins and steroid production in absence of FSH. The supplementation of FSH increased steroid production and decreased gene expression of steroidogenic enzymes, except CYP11A1. The inhibition of PI3-K in presence of FSH increases LHR and CYP19A1 expression. This fact suggests a strong role of the PI3-K pathway in the regulation of LHR and CYP19A1 expression. The authors thank FAP-DF (193.000.577/2009), CNPq, CAPES, Sabin, and Ponte Alta abattoir, Brasilia.

Gene Expression

204


193

A COMPARATIVE ANALYSIS OF CALCIUM TRANSPORT GENES EXPRESSION IN HOLSTEIN AND HANWOO (KOREAN CATTLE) IN THE DUODENUM AND KIDNEY H. Cho and E.-B. Jeung College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, South Korea

Transmembranous calcium (Ca2þ) channels such as Trpv5/6,Ncx1,Pmca1b are known to play an important role in maintaining homeostasis and metabolizing Ca2þ ions. Transient receptor potential cation channel subfamily V members 5 and 6 (Trpv5/6) play an important role in Ca2þ absorption. Naþ/Ca2þ exchanger 1 (Ncx1) and plasma membrane Ca2þ-transporting ATPase1 (Pmca1b) play a role in Ca2þ excretion. Holstein cattle are known to provide higher milk production than other cattle breeds. In this respect, a higher susceptibility to hypocalcaemia that is a risk factor for many of calcium-related diseases such as milk fever has been observed. In contrary, Hanwoo cattle are relatively resistant to the calcium-related diseases. The aim of this study was to evaluate the expression of calcium transport genes in the duodenum and kidney of Hanwoo (Korean cattle) and Holstein cattle. All samples were obtained from Holstein and Hanwoo cattle from 36 to 60 months of age at a local slaughterhouse. The collected duodenum and kidney were rapidly excised and washed in cold sterile saline (0.9% NaCl). Total RNA was prepared from duodenum and kidney tissues using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol. Protein was extracted using Pro-prep (iNtRON Bio), according to the manufacturer’s protocol. Expression of Trpv5/6, Ncx1 and Pmca1b was analysed by real-time RT–PCR, Western blot analysis, and immunohistochemistry. In dairy cattle’s kidney (Holstein), the level of Trpv5 mRNA was ,3-fold more than Hanwoo’s kidney while Pmca1b mRNA was one-fifth less than Hanwoo’s kidney. However, no difference in Trpv6 and Ncx1 mRNA expression was observed in the kidney of Holstein compared with Hanwoo. Duodenal Trpv5 and Trpv6 mRNA were scarcely expressed in both Hanwoo and Holstein cattle. In addition, the mRNA expression of Pmca1b and Ncx1 were also not different between Hanwoo and Holstein. The protein expression of calcium transport genes were similar to the mRNA levels of calcium transport genes in both Hanwoo and Holstein. Localization of calcium transporter genes were identified, the glomerulus, and proximal and distal convoluted tubules expressed TRPV5, 6, Pmca1b, and Ncx1 in the kidney. These four calcium transport genes may play an important role in the bovine duodenum and kidney. The difference between Holstein and Hanwoo animals which express different gene expression patterns may be helpful in studying diseases associated with calcium metabolism, e.g. milk fever.

205

SITE OF OVULATION ALTERS GENE PROFILE IN THE OVIDUCT FROM NELORE (BOS TAURUS INDICUS) AND ANGUS HEIFERS (BOS TAURUS TAURUS)

P. K. Fontes, A. C. S. Castilho, R. F. P. Pinto, L. A. Trinca, R. F. Carvalho, R. L. Ereno, and C. M. Barros Institute of Biosciences, UNESP, Univ Estadual Paulista, Botucatu, Saõ Paulo, Brazil The oviduct plays a key role promoting a favourable microenvironment to gametes transport, fertilization and early embryo development. Numerous differences in reproductive physiology are known among animals of Zebu and European breeds. Reports indicate that female Zebu cattle have a higher number of follicles per wave than female European cattle and individual distinctions in the number of follicles recruited are present in both breeds, namely animals with high follicular count (HFC) and low follicular count (LFC). Furthermore, the follicular count is related to animal fertility and is greatly influenced by the activity of FSH, oestradiol, and androgens. However, little is known about the effects of follicular count differences between Zebu and European cattle, and between breeds in the oviduct molecular profile. Based in these information, we hypothesised that differences in bovine breed (Nelore and Aberdeen Angus), differences in the follicular count (FC), and differences in the antimere related to ovulation (ipsilateral and contralateral) alter the molecular profile of genes involved in oviducal functions during the initial period after ovulation. To do so, oviducts from Nelore heifers (HFC, n ¼ 4; LFC, n ¼ 4) and oviducts from Aberdeen Angus heifers (HFC, n ¼ 4; LFC, n ¼ 4) were isolated and oviducal segments were divided (infundibulum, ampulla, isthmus) from ipsilateral and contralateral antimere. Total RNA was extracted using Illustra TriplePrep Kit (GE Healthcare, Waukesha, WI, USA) and then reverse transcription was performed using a high-capacity cDNA kit (Life Technologies, Carlsbad, CA, USA), according to the manufacturer’s protocols. Relative RT-qPCR analysis was performed with TaqManÒ Low Density Array (TLDA, Life Technologies). The mRNA abundance of the target was tested by ANOVA analysis, using PROC GLM procedure of SAS (SAS, 9.2, SAS Institute Inc., Cary, NC, USA). Individual differences were analysed through pair-wise comparisons (SAS). All the comparisons were performed in each segment (ampulla, infundibulum, and isthmus); no comparisons were performed between segments. The differences were considered significant when P , 0.05. In the ampulla, the mRNA abundance of COX2, OVGP1, GPR78, FUCA1, and ANXA4 showed higher levels in ipsilateral antimere compared to contralateral. Similarly, in the infundibulum the mRNA abundance of GRP78, PGTER4, FUCA2, and FUCA1 was higher in ipsilateral antimere. No difference was found in the isthmus. In conclusion, the breed and the follicular count have no effect on the molecular profile of bovine oviduct, suggesting the site of ovulation has the main effect in gene expression related to gametes transport, fertilization, and early embryo development. Research supported by FAPESP 2012/09498-9 and 2012/50514-8.

194


206

Gene Expression

GENOME-WIDE ASSOCIATIONS FOR REPRODUCTIVE TRAITS IN RUSSIAN HOLSTEIN POPULATION

A. S. KramarenkoA, A. A. LopukchovA, E. A. GladyrA, G. N. SinginaA, A. N. ErmilovB, I. N. YanchukovB, G. BremA,C, and N. A. ZinovievaA A

All-Russian Research Institute of Animal Breeding, Dubrovicy, Moscow Region, Russian Federation; B Regional Breeding Analytical Center, Noginsk, Moscow Region, Russian Federation; C Institute of Animal Breeding and Genetics, Vienna, Austria

Reproductive health is an important trait in selection of dairy cattle. A genome-wide association study (GWAS) is a powerful tool for annotating phenotypic effects on the genome and to get knowledge of genes and chromosomal regions associated with reproductive performance (Cole et al. 2011). Combining GWAS and genetic profiling of embryos before implantation enables to develop new strategies to select elite breeding genotypes before transfer (Humblot et al. 2010; Ponsart et al. 2013). The aim of the current study was to evaluate the association between single nucleotide polymorphisms (SNP) and estimated breeding values (EBV) for reproductive traits [interval to insemination (EBVII) and interval between calving (EBVIC)] for Russian Holstein cattle and to evaluate the effect of the biopsy procedure on the viability of bovine embryos produced in vitro as a basis for pre-implantation genetic diagnosis (PGD). Ninty-six progeny-tested sires of artificial insemination station Moscowskoe were selected based on the reliability for EBVII and EBVIC. Estimations of breeding values of sires were performed by best linear unbiased prediction (BLUP) mixed model equations. DNA was extracted from sire semen samples. SNP genotyping was performed using the Illumina BovineSNP50 BeadChip (Illumina Inc., San Diego, CA, USA) containing 54609 SNPs. Quality control information was carried out in PLINK (v. 1.07; Purcell et al. 2007 Am. J. Hum. Genet. 81). Based on the quality control information, 41442 SNPs were selected for subsequent GWAS. We have identified 3270 SNPs having significant effect (P , 0.05) on studied traits. The most significant associations with EBVII were found for SNPs Hapmap38548-BTA-97184 and ARS-BFGLBAC-11821 with coefficient of determination (R2) of 0.2189 and 0.1937, and P-values 2.27 106 and 1.01 106, respectively. The most significant effect on EBVIC was detected for SNPs ARS-BFGL-NGS-59769 and ARS-BFGL-NGS-38020 with coefficient of determination (R2) of 0.236 and 0.2421, and P-values 1.49 108 and 7.24 108, respectively. The highest number of significant associations was found on BTA5, BTA12, BTA19, and BTA14. Bovine embryos were produced in vitro using a standard procedure. Six to 8 cell biopsies were carried out at Day 6.5 after fertilization. The viability of biopsied embryos was evaluated comparing the hatching rates to non-manipulated embryos. The study of embryos viability after biopsy showed that the hatching rate of biopsied embryos (the number of hatched embryos from the number of embryos in stages of late morula and early blastocyte) was 48% comparing to 67% for non-manipulated embryos. Embryo biopsy is not dramatically decreasing embryo viability. Combining our results of association studies, performed on Russian Holstein population, and technique of embryo biopsy will provide us a powerful tool for selection progress. This research was supported by the Russian Ministry of Education and Science, project No. 2014-14-576-0057-175.

208 CLONING AND CHARACTERIZATION OF BUFFALO INTERFERON-TAU AND EFFICACY OF RECOMBINANT BUFFALO INTERFERON-TAU FOR IN VITRO EMBRYO DEVELOPMENT S. Saugandhika, H. N. Malik, S. Saini, V. Sharma, S. Bag, S. Kumar, A. K. Mohanty, J. K. Kaushik, and D. Malakar Animal Biotechnology Center, National Dairy Research Institute, Karnal, Haryana, India Interferon tau (IFN-tau) is known as maternal pregnancy recognition factor in ruminants. IFN-tau not only acts as a signalling molecule of pregnancy recognition but also performs various functions for successful implantation and pregnancy establishment. The aim of the present study was to produce recombinant buffalo interferon-tau (BuIFN-Tau) and observe if it has any effect on in vitro embryo development. The BuIFN-Tau gene was obtained through polymerase chain reaction (PCR) from hatched buffalo blastocysts and was cloned into pJET cloning vector. Screening of the recombinant colonies gave 8 distinct buffalo IFN-tau isoforms, out of which the predominant buffalo IFN-t tau1 isoform (gene bank accession number JX481984), was subcloned into expression vector pET22b without signal sequence. The recombinant plasmid was induced to express the recombinant protein by isopropyl b-D-1-thiogalactopyranoside. Analysis of the products of recombinant BuIFN-tau without signal sequence by SDS–PAGE revealed a new 20-kDa protein coinciding with the molecular weight of IFN-tau as reported earlier in literature. The purified recombinant BuIFN-tau was confirmed by Western blot using anti-HIS antibody and was subjected to three steps of large-scale purification using HIS affinity chromatography, anion exchange chromatography, and gel filtration chromatography. Finally, a relatively pure histidine-tagged recombinant protein, which had a purity of at least 90%, was generated as confirmed through SDS. The concentration of recombinant BuIFN-tau was 1 mg mL1 by Bradford assay. The purified recombinant BuIFN-tau was used as supplement of the culture medium for IVF early buffalo embryos at the following concentrations: control, 1, 2, and 4 mg mL1. Sixty oocytes each in 4 groups (with 20 oocytes/drop in three replicates for each group) were used for in vitro maturation. After 24 h, the matured oocytes were incubated with in vitro capacitated sperm cells for 18 h; thereafter, the presumptive zygotes were cultured in IVC medium supplemented with 0, 1, 2, or 4 mg mL1 of the purified recombinant BuIFN-tau. The experiment was repeated 3 times. The data were analysed using SYSTAT 7.0 (SPSS Inc., Chicago, IL, USA) after arcsin transformation of percentage values. The differences were analysed by one-way ANOVA followed by Fisher’s least significant difference test. Out of 3 concentrations of recombinant BuIFN-tau, the 2 mg mL1 concentration significantly promoted the rate of blastocyst development, 45.55% against 31.1% (control; P , 0.01). Blastocyst development rate for low and high concentrations was 29.97% and 10.18% respectively. It is concluded that the addition of 2 mg mL1 of recombinant BuIFN-tau enhances the blastocyst development rate in buffalo, and hence there is some evidence that BuIFN-tau has not only a role in maternal recognition of pregnancy but also in embryonic development.

Gene Expression

209


195

CLONED EMBRYONIC DEVELOPMENT AND GENE EXPRESSION OF SPONTANEOUSLY IMMORTALIZED PORCINE SKIN FIBROBLASTS K. Song, G. Jang, and B. C. Lee

Department of Theriogenology and Biotechnology, College of Veterinary Medicine, Seoul National University, Seoul, Korea Immortalization of somatic cells by oncogenes is effective for evaluation of gene targeting tools or molecular cell pathway because of relatively longer life span than normal cells. The BMI1 gene has been used to immortalize human and murine somatic cells, and we confirmed that BMI1 increased cell-life span of porcine skin fibroblasts and had no detrimental effect on pre-implantational development after somatic-cell nuclear transfer (SCNT; unpublished data). Here, we report a primary cell-line which was spontaneously immortalized without transduction of any additional gene. The minipig skin fibroblasts (passage 3 after primary culture) were divided into two parts, one group was electroporetically transfected with pCAGBMI1-T2A-RFP plasmids (BC1) and the other had no treatment (CC1). To establish the single-cell-originated cell-lines, cells of each group were plated in 100-mm dishes at 100 cells/dish and well-formed colonies were picked up after 2 weeks. These colonies were expanded until they were fully confluent in 100-mm dishes (designated Passage 0) and then, the cell were maintained with DMEM (20% FBS) at 3 105 cells/60 mm dish. Population doubling time was checked every 5 passages until Passage 45 (sub-cultured during ,160 days) by calculation of cells that had been plated in 12-well plates at 4 104 cells/well. The expressions of p16, p21, and DNMT3b genes were determined by RT-qPCR at early (Passage 5) and late (Passage 45) stage. Also, SCNT (Song et al. 2009 Mol. Reprod. Dev. 76, 611–619) embryos using cells of early and middle (Passage 35) stage were evaluated in terms of reprograming efficiency. Data were analysed by t-test (Prism version 5.01, GraphPad Software, La Jolla, CA, USA). While the mean doubling time of BC1 was 25.3 h until Passage 40 and drastically increased at Passage 45 (81.7 h), that of CC1 was maintained until Passage 45 (mean 38.3 h). Expression of p16 in CC1 was significantly higher than that in BC1 at all stages. However, in late stage CC1, p21 expression was significantly lower than other groups and DNMT3b expression was increased. In SCNT embryos, the rate of blastocysts with early stage CC1 (18.3%) was not different from that of early stage BC1 (19.9%). And, although the rates of SCNT blastocyst derived from middle stage cells were decreased than those of early stage cells, there was no difference between BC1 and CC1 (6.6% and 5.4%, respectively). In karyotyping, while BC1 was trisomy of chromosome 14 only in late stage, CC1 had an isochromosome in chromosome 17 from early stage and an additional part was attached in chromosome 11 at late stage CC1. In summary, spontaneously immortalized skin fibroblasts could maintain the cell-life span by down-regulating the p21 expression and the pre-implantational development after SCNT was not different from that of BMI1-immortalized cells. And, additional studies are needed to confirm whether the chromosomal abnormality influences the expression of other genes related with cell cycle or senescence. This study was supported by NRF-2013R1A1A2010766, IPET (#311011-05-3-SB010), the Research Institute for Veterinary Science, and the BK21 plus program.

210

DNA METHYLATION AND HYDROXYMETHYLATION ANALYSIS IN A MODEL OF OOCYTE DIFFERENTIAL DEVELOPMENTAL COMPETENCE IN SHEEP

L. MasalaA, D. BebbereA, G. P. BurraiA, F. AriuA, L. BoglioloA, L. F. CrocomoB, O. MurroneA, L. FalchiA, and S. LeddaA A Section of Obstetrics and Gynecology, Department of Veterinary Medicine, University of Sassari, Sassari, Italy; Universidade Estadual Paulista, UNESP, Campus de Botucatu, Faculdade de Medicina Veteriaria e Zootecnia, Botucatu, SP, Brazil

B

DNA methylation is an important epigenetic mark that plays a role in gene regulation by the addition of a methyl group to CpG islands in the DNA. Despite being relatively stable in somatic cells, DNA methylation is subject to reprogramming during embryo development and gametogenesis. The aim of this work was to evaluate different aspects of DNA methylation in relation to oocyte quality in the ovine species. A model of differential developmental competence consisting in ovine oocytes and in vitro produced (IVP) blastocysts derived from adult (AD) and prepubertal (PR) donors, was used. The methylation was analysed in terms of: expression of a panel of genes involved in DNA methylation [DNA methyltransferases (DNMTs)] and demethylation [ten-eleven translocation dioxygenases (TET)] in oocytes and blastocysts; global methylation and hydroxymethylation by direct immunofluorescence; locus-specific methylation of 2 imprinted genes by pyrosequencing. Gene relative quantification was performed by RNA reverse transcription followed by real-time PCR. Pools of 10 immature (GV) and in vitro-matured (MII) oocytes and (IVP) blastocysts derived from AD and PR donors (4 replicates per class) were analysed. Lower expression of TET1, TET2, and TET3 was observed in PR GV oocytes (ANOVA; P , 0.05), while no significant differences were found for the enzymes involved in methylation (DNMT1, DNMT3A, DNMT3B; ANOVA; P . 0.05). The levels of all the genes studied showed no significant differences in embryos at blastocyst stage (ANOVA; P . 0.05). Methylation and hydroxymethylation immunostaining were performed in GV and MII oocytes using anti-5-methylcytosine mouse mAb and 5-hydroxymethylcytosine rabbit pAB. High levels of DNA methylation were observed in both AD and PR GV and MII oocytes, while hydroxymethylation immunopositivity was scattered evident throughout the gamete chromatin. Pyrosequencing of bisulfite converted DNA was used to determine the methylation status within differentially methylated regions (DMR) of maternally imprinted H19 (CTCF binding site IV; 11 CpG sites) and paternally imprinted IGF2R (17CpG sites within intron 2). No differences were observed between classes of oocytes for each gene (pools of 40 oocytes per replicate, 3 replicates per class; ANOVA; P . 0.05). Our work shows no differences in the expression of the enzymes involved in methylation, in accordance with the results of global and locus specific methylation analysis. Conversely, we observed lower expression of the TET genes in PR GV oocytes (ANOVA; P . 0.05). TET1, TET2, and TET3, whose expression has never been studied in ovine, generate 5-hydroxymethlcytosine (5hmC) by oxidation of 5-methylcytosine (5mC), and are involved in active DNA demethylation during early embryo development. Our observation of lower expression of the TET genes in lower competence PR GV oocytes suggests that epigenetic mechanisms may affect oocyte quality and paves the way to better understand methylation dynamics during sheep pre-implantation development.

196


211

Gene Expression

TRANSCRIPTS EXPRESSION RELATED TO MAPK/SMAD2 PATHWAY IN OVIDUCT CELL, CUMULUS CELL, AND OOCYTE DERIVED FROM DIESTRUS BITCHES S. H. Lee, M. J. Kim, H. J. Oh, G. A. Kim, E. M. N. Setyawan, Y. Kwang Jo, Y. B. Choi, and B. C. Lee

Department of Theriogenology and Biotechnology, College of Veterinary Medicine, Seoul National University, Seoul, Republic of Korea Growth differentiation factor 9 (GDF9) and bone morphogenetic protein 15 (BMP15) are known to play an essential role in regulating ovarian follicular development and ovulation rate via SMAD pathway in several species and have different functions depending on the species. However, their expression and function have not yet been reported in dogs. Therefore, the aim of present study is to analyse expressions of transcripts related to the MAPK/SMAD2 pathway in oviduct cell, cumulus cell, and oocyte derived from diestrus bitches. Ovariohysterectomy was performed in 5 large, mixed breed dogs 3 days after serum progesterone reached 5–10 ng mL1. Oviduct cells were obtained by scraping the superficial oviduct tissue and oocytes were obtained by mincing the ovary. Both cumulus cells derived from non-ovulated oocytes (IM-cumulus) and ovulated oocytes (M-cumulus) were obtained. Oviduct, IM-cumulus, and M-cumulus cells were cultured using RCMEP media and cryopreserved using FBS containing 10% DMSO. Total RNA was extracted from Oviduct, IM-cumulus, and M-cumulus cells and oocytes. After cDNA synthesis, transcript expression of b-actin, GDF9, MAPK1, BMP6, and SMAD2 genes were analysed. The data was analysed by one-way ANOVA using GraphPad Prism 5.0 (GraphPad Software, La Jolla, CA, USA). The threshold for statistical significance was set at P , 0.05. In results, mRNA expression of MAPK1 was not significantly different among the cells. However, expressions of BMP6, GDF9, and SMAD2 were significantly higher in oocytes compared to oviduct, IM-cumulus, and M-cumulus cells. Although oviduct cells showed increased GDF9 and SMAD2 transcripts similar to that of oocytes, there was no significant difference between them. In conclusion, MAPK/SMAD2 pathway may have important roles in growth of immature oocytes in dogs and oviduct cells may help the maturation of ovulated immature oocytes. Further studies will be conducted to analyse MAPK/SMAD2 pathway in anestrus, proestrus, and oestrus periods. This research was supported by RDA (#PJ008975022014), IPET (#311062-04-3SB010), Research Institute for Veterinary Science, the BK21 plus program, and global PhD Fellowship Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2014H1A2A1021187).

212

INTERESPECIFIC CLONING AND EMBRYO AGGREGATION INFLUENCE THE EXPRESSION OF OCT4, NANOG, SOX2, AND CDX2 IN CHEETAH AND DOMESTIC CAT BLASTOCYSTS

L. N. MoroA, D. VeraguasB, L. Rodriguez-AlvarezB, M. I. HiriartA, C. BuemoA, A. SesteloC, and D. SalamoneA A Laboratory of Animal Biotechnology, Buenos Aires University, Buenos Aires, Argentina; Department of Animal Science, Facultad de Ciencias Veterinarias, Universidad de Concepcioń, Chillan, Chile; C Laboratory of Reproductive Biotechnology, Zoological Garden of Buenos Aires, Buenos Aires, Argentina

B

The cheetah (Ch, Acinonyx jubatus) is a species considered globally endangered and cloning is one of the assisted reproductive techniques that can help to preserve it and to study early embryo development. However, the production of cloned felid embryos remains inefficient, probably because of the difficulty to control the process of nuclear reprogramming and obtain adequate gene expression. Embryo aggregation has been demonstrated to improve the cloning efficiency in several species and to normalise cdx2 in the mouse by lowering its expression (Balbach et al. 2010), but it has not been evaluated in felids before. To better understand the effect of interspecific somatic-cell nuclear transfer (iSCNT) and embryo aggregation in nuclear reprogramming, we analysed the expression of oct4, sox2, nanog, and cdx2 in cheetah blastocysts generated by iSCNT, domestic cat blastocysts (Dc) generated by SCNT, and IVF blastocysts as control. To achieve this, domestic cat oocytes were in vitro matured and zona-free SCNT or iSCNT was performed, as previously described (Moro et al. 2014, Reprod. Fertil. Dev.). Zona-free reconstructed embryos were then cultured individually (1X) or two embryo were cultured together (2X) in microwells, in synthetic oviductal fluid (SOF) medium. The experimental groups were Dc1X, Dc2X, Ch1X, Ch2X, and IVF. After 8 days of in vitro culture the blastocysts obtained were stored in RNA-later at 208C. For gene expression analysis, blastocysts were pooled as follows: Dc1X, 4 replicates of 3 blastocysts each; Dc2X, 4 replicates of 3 blastocysts each; Ch1X, 2 replicates of 2 blastocysts and 1 replicate of 1 blastocyst; Ch2X, 4 replicates of 3 blastocysts each; IVF 3 replicates of 3 blastocysts each. Embryos were treated with a Cells-to-cDNA TM II kit (Life Technologies, Carlsbad, CA, USA) lyses buffer and treated with DNase I (0.04 U mL1) for genomic DNA digestion. Gene expression analysis was performed by real-time qPCR using the standard curve method. In all qPCRs, GAPDH was used as an internal control. The statistical analysis was performed using a non-parametric Kruskal–Wallis test (P , 0.05). We observed that Dc1X blastocysts overexpressed the 4 genes evaluated respect to the IVF control. However, the gene expression of the aggregated group (Dc2X) was lower for all the genes, achieving the same levels of nanog and sox2 as the IVF blastocysts. The expression of oct4 and cdx2 were also closer to the expression levels of the control in the Dc2X group than in the Dc1X group. With respect to interspecific embryos, the amount of oct4 and cdx2 was also significantly reduced in the Ch2X blastocysts respect to Ch1X blastocysts. Both cheetah groups showed significantly lower expression of oct4, cdx2, and nanog than the IVF control. In conclusion, transcription of pluripotent and early differentiation factors in cheetah embryos was not as efficient as in the domestic cat embryos, probably caused by interspecific transfer. Our study demonstrated for the first time that defects in gene expression of domestic cat embryos can be corrected by embryo aggregation, providing a simple strategy to improve felid cloning.

Gene Expression

213


197

DIOXIN SIGNIFICANTLY ENHANCED THE TUMOR MASS FORMATION IN A XENOGRAFTED MOUSE MODEL TRANSPLANTED WITH BG-1 OVARIAN CANCER CELLS R.-E. Go and K.-C. Choi Laboratory of Biochemistry and Immunology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea

Previous studies suggest that environmental factors, such as high levels of meat consumption, caffeine, cigarette smoking, and endocrine disrupting chemicals (EDC), may enhance a high risk of ovarian cancer. Cytochrome P450 (CYP) 1A1 may play a major role in metabolic activation of procarcinogens to carcinogens. For example, polycyclic aromatic hydrocarbons (PAHs) and halogenated aromatic hydrocarbons (HAHs) occur by pyrolysis of fossil fuels and flow into the body by organic matter, such as tobacco leaves and contaminated water by pesticides. 2,3,7,8-tetrachlorodibenzo-r-dioxin (TCDD) is a commonplace pollutant and promoter of carcinogenesis as the most potent substance. In this study, we examined the effects of 17b-oestradiol (E2), TCDD, and TCDD in the presence of E2 on the expressions of CYP1A1, CYP1B1, and aryl hydrocarbon receptor (AhR) by RT–PCR analysis and Western blot analysis. In addition, the cell viability by TCDD and E2 were examined in BG1 human ovarian cancer cells by MTT assay. To evaluate the cell viability, BG-1 cells were cultured with a negative control (0.1% DMSO), E2 (1 109 M) or TCDD (106–108 M). E2 markedly increased BG-1 cell viability ,5 times, and TCDD also induced BG-1 cell viability highest at the concentration of 1 108 M compared to a control (0.1% DMSO) (P , 0.05). When respective treatment was co-treated with ICI 182 780, an ER antagonist, BG-1 cell viability was reversed to the level of a negative control. Although the mRNA expression of CYP1B1 was not altered by E2, TCDD, or TCDD plus E2, the transcriptional level of CYP1A1 appeared to be increased by E2 and TCDD in a time-dependent manner. When the cells were treated with TCDD plus E2, the mRNA level of CYP1A1 was more greatly increased than by only TCDD or E2 treatment. In xenograft mouse models transplanted with BG-1 cells, E2 treatment significantly increased the tumour mass formation ,6 times, and TCDD also induced tumour formation ,4 times compared to a vehicle (0.1% DMSO in PBS) during 8 weeks in this xenograted mouse model. In addition, TCDD plus E2 treatment also greatly induced ovarian tumour formation compared to only E2 treatment in this mouse model. Taken together, these results indicate that TCDD may induce ovarian cancer cell growth via CYP1A1 gene expression and have disruptive effect in oestrogen receptor (ER) expressing cells or tissues.

214 TRICLOSAN-INDUCED CELL CYCLE RELATED AND APOPTOTIC RELATED GENES WERE REVERSED BY KAEMPFEROL IN IN VITRO BREAST CANCER AND XENOGRATED MOUSE MODELS S.-H. Kim and K.-C. Choi Laboratory of Biochemistry and Immunology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea Triclosan (Tri) is one of many endocrine-disrupting chemicals (EDCs) that are scattered with environment agents, such as toothpastes, deodorants, and cleaning supplies. As a phytoestrogen, kaempferol (Kae) is one of bioflavonoids, which has been found in a variety of vegetables including broccoli, tea, and tomatoes. Although Kae may have anti-cancer activity, its exact mechanism is under investigation, and might be the induction of apoptosis and inhibition of cell proliferation or angiogenesis. In this study, we examined the anti-proliferative effects of Kae in Tri-induced cell growth in MCF-7 breast cancer cells. A proper concentration and co-treatment effect of Tri and Kae were determined by MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay to measure cell viability in vitro. MCF-7 cells were cultured with a negative control (0.1% DMSO), E2 (1 109 M), Tri (105–108 M) and Kae (50, 70, and 90 mM). In this study, treatment with Tri (106 M) increased the cell viability of MCF-7 cells, while Kae (50 mM) significantly reduced the cell viability compared to the negative control (P , 0.05). In addition, Kae significantly reversed Tri-induced MCF-7 cell growth at 50 mM compared with a higher concentration (100 mM; P , 0.05). To confirm that Kae inhibited Tri-induced cell growth, we examined the transcriptional levels of cell growth and apoptosis-related markers, i.e. cyclin D, p21, cyclin E, p27 and bcl-2, and bax genes, using reverse transcription (RT)-PCR. The expression levels of cyclin D, cyclin E, and bax/bcl-2 ratio were increased, while those of p21 and p27 mRNAs were decreased by Tri in MCF-7 cells. In addition, Kae treatment significantly reversed Tri-induced gene expressions in an opposite manner. In parallel with its mRNA level, the protein level of cyclin E, p-ERK and p-MEK1/2 were induced by Tri while it was reversed by Kae as shown by Western blot analysis. The expression levels of p21 and bax genes were altered by Tri and reversed by Kae treatment in this study. As an in vivo model, a xenografted mouse model was generated following injection with MCF-7 breast cancer cells in 6 weeks. In parallel with in vitro results, tumour volumes following treatment with E2 and Tri were continually increased compared to a vehicle (corn oil). It was of interest that treatment of the mice with combination of E2 plus Kae or Tri plus Kae showed less tumour formation rather than that of singly treated mice with E2 or Tri. Taken together, these results indicate that Kae may inhibit the growth of MCF-7 cells via regulating of cell cycle and apoptosis-related genes. In addition, EDC-induced progression of breast cancer may be suppressed by a phytoestrogen, i.e. Kae, in a specific manner.

198


Gene Expression

215 SNAIL AND SLUG, MARKERS OF EPITHELIAL MESENCHYMAL TRANSITION, APPEARED TO BE ALTERED BY ALKYL-PHENOLS, BISPHENOL A AND NONYL-PHENOL, IN OVARIAN CANCER CELLS EXPRESSING ESTROGEN RECEPTORS Y.-S. Kim and K.-C. Choi Laboratory of Biochemistry and Immunology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea The ovary is the important organ to produce oocytes. Any disorder will affect embryo production. Ovarian cancer is one of gynecologic cancers in women which can affect ovarian functions. Oestradiol (E2) may be involved in ovarian cell growth and epithelial-mesenchymal transition (EMT) for diverse functions. EMT is an important process in embryo development and tumour migration or progression. Bis-phenol A (BPA) and nonyl-phenol (NP) have an estrogenic property, which can be suspected as endocrine disrupting chemicals (EDC). In this study, it has been examined whether BPA and NP can cause EMT process and migration in BG-1 ovarian cancer cells. To confirm the effect of these EDCs, BG-1 ovarian cancer cells were cultured and treated with DMSO (0.1%), E2 (107 M), BPA (106 M) and NP (106 M) for 0, 6, and 24 h. The mRNAs were extracted to perform reverse-transcription (RT)-PCR and the changes in the mRNA expressions were analysed by ANOVA test. Following treatments with BPA and NP, alterations of EMT markers; that is, vimentin and E-cadherin, were examined at mRNA levels by RT-PCR. The levels of vimentin were up-regulated by E2, BPA, or NP in a time-dependent manner. In addition, transcriptional factors of EMT response, i.e. snail and slug, were enhanced by these treatments more than 2 times. BG-1 cells were exposed to these EDCs for 0, 24, and 48 h. Vimentin and snail proteins were induced by E2, BPA, or NP, while the expression of E-cadherin was decreased by them. To reveal that this EMT response is affected by oestrogen receptor (ER), the cells were treated with these EDCs in the presence of an ER antagonist, ICI 182 780 (106 M). Treatment with ICI 182 780 reversed EDC-induced alteration of these EMT markers, E-cadherin, vimentin, and snail. Since EMT response can cause metastasis, a scratch assay was performed to show migration caused by BPA or NP. BPA or E2 enhanced migratory capability of these BG-1 cells. Taken together, these results indicate that BPA and NP, potential EDC, may have an ability to influence ovarian cancer metastasis via regulating snail and slug genes in ER-positive ovarian cancers. In a future study, their effects in inducing EMT and migration will be tested in a xenograft mouse model. This work was supported by a grant from the Next-Generation BioGreen 21 Program (no. PJ009599), Rural Development Administration, Republic of Korea.

216

HORMONAL REGULATION OF CLAUDIN-4 TIGHT JUNCTION MOLECULE IN MOUSE PLACENTA C. Ahn, D. Lee, and E.-B. Jeung College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, South Korea

Tight junctions (TJ) are composed of a branching network of sealing strands. TJ regulate paracellular conductance and ionic selectivity. TJ components include the peripheral protein ZO-1, junctional adhesion molecules (JAM) and the integral proteins such as occludin and claudin. Claudins are a family of proteins that are the most important components in the tight junctions. The established paracellular transport barriers that control transportation of molecules within intercellular space. The present study focused on the expression of claudin, suggesting as major working molecules in the paracellular transport system. To study the regulation and roles of claudin family, we examined expression of mouse placental claudin family. Fifteen pregnant C57/BL6 mice were used in this study and TJ proteins including Claudin-1 to Claudin-24 expressions by real-time RT–PCR and Western blotting. The mice were divided into 3 groups depending on the gestational day (on Days 12, 16, and 20 of gestation).The localization of TJ proteins were examined by immunohistochemistry. After we identified the fluctuation of claudin expression during pregnancy, we assumed that the hormones are one regulator for claudin family. Therefore, we performed an in vivo study with hormone receptor antagonists (ICI 182, 780, and RU-486) for examining hormonal effect on claudin expression in the placenta. Forty-nine mice were divided into 7 groups. The changes of claudin expression were examined with real-time RT-PCR and Western blotting. In the transcription levels, Claudin-1, claudin-2, claudin4, and Claudin-5 expression levels were relatively high compared to others in the claudin family in all periods of the pregnancy. The claudin-4 expression, which reduces permeability of ions, increased over a period of time. However, caludin-5 expression that is the responsive protein for a decrease in paracellular conductance, were decreased. Claudin-1 and -4 have been known as responsive genes for a decrease in paracellular conductance. On the other hand, claudin 2 and 5 have been known as increasing paracellular conductance. In addition, immunohistochemistry was performed to identify their localization for inferring permeability in placenta. In summary, we analysed the claudin expressions and presented possible important claudins among its family. Furthermore, their localization was also examined in the mouse placenta. In addition, the regulation of critically expressed claudins by pregnancy-associated hormones, E2 and P4, was examined. These results may provide functional and structural roles of claudins and their involvement in the maternal-fetal interaction and in the transportation of placental materials.

217

THE EXPRESSION OF b-OXIDATION RELATING GENES UNDER HYPOXIC STRESS IN HUMAN PLACENTAL CHORIOCARCINOMA CELL (BEWO) E.-K. Shin and E.-B. Jeung College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, South Korea

Preeclampsia (PE) is thought in many cases to be caused by a shallowly implanted placenta that becomes hypoxic. Hypoxia can result from a failure at any stage in the delivery of oxygen to the cells. In peripheral tissues, oxygen diffuses down a pressure gradient into cells and moves into their mitochondria, where it is used to produce energy in conjunction with the breakdown of glucose, fats, and some amino acids. The aim of the study was

Gene Expression


199

to investigate the question of whether hypoxic stress is involved in b-oxidation of human placental BeWo cells. One of the b-oxidation related genes, ACADVL was detected by gene-fishing technology using the preeclamptic placenta of human. We conducted in vitro experiments to confirm a preliminary study by inducing hypoxic stress in the human placental BeWo cell. BeWo cells were cultured at 378C in a 20% O2, 5% CO2 humidified tissue culture incubator. And then we induced hypoxic stress in BeWo cell cultured under 1% O2, 5% CO2, and balanced with N2. The BeWo cells were divided into three groups: normoxia, hypoxia 24 h, and hypoxia 48 h. The expression of b-oxidation related genes (ACADVL, EHHADH, HADH, ACAA) were observed under hypoxic condition in BeWo cells by using real-time RT-PCR. Relative quantification with HPRT1 was based on the comparison of CT at a constant fluorescent intensity. The amount of transcript is inversely related to the observed CT, and for every 2-fold dilution in the transcript, CT is expected to increase by 1. Relative expression was calculated using the equation R ¼ 2(CTsample CTcontrol). Data were analysed with a nonparametric one-way ANOVA, followed by Tukey’s test for multiple comparisons. All statistical analyses were performed using GraphPad Prism software (v 4.0, GraphPad Software, La Jolla, CA, USA). P-values ,0.05 were considered statistically significant. The expression of a gene known as a biomarker for hypoxia, HIF-1a, was significantly increased in BeWo cells which induced preeclampsia. The elevated level of HIF-1a indicates that our experimental conditions closely mimicked preeclampsia. The b-oxidation related genes, ACADVL, EHHADH, and HADH expressions were significantly increased under hypoxic condition in BeWo compared with normoxic control. These results indicate that changes of b-oxidation related genes observed under hypoxic BeWo cells are similar to ones associated with preeclampsia, and the expression of b-oxidation related genes were up-regulated by hypoxic stress. They might be involved in pathogenesis of preeclampsia during gestation. Taken together, increase of b-oxidation-related genes under hypoxic stress may cause a compensation of energy metabolism deficiency through lipid metabolism.

218

DISTINCT EXPRESSION OF CALCIUM TRANSPORT CHANNELS, TRPV5, TRPV6, PMCA1, NCKX3, AND CABP-9K IN THE DUODENUM, KIDNEY, AND PLACENTA DURING PREGNANCY H. Yang, C. Ahn, and E.-B. Jeung College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, South Korea

Preeclampsia is a pregnancy-specific disease characterised by concurrent development of hypertension, proteinuria, and oxidative stress in the placenta. Preeclampsia-like genetic models were also developed by modification of preeclampsia-related genes, such as catechol-O-methyltranferase (COMT). In the current study, we hypothesised that inhibition of COMT alters the expression of calcium transport genes and contributes to induction of a preeclampsia-like condition, and the treatment regimen such as calcium supplementation ameliorates the imbalanced calcium metabolism and preeclamptic symptoms. In this study, we induced COMT inhibition in mice during pregnancy to reproduce physiological conditions associated with preeclampsia. The expression of genes known as hypoxia biomarker, HIF-1a, was highly induced in the placenta of this model. The overexpression of HIF-1a demonstrates that our experimental conditions closely were similar with preeclampsia. We measured the expression of several calcium transporters (TRPV5, TRPV6, PMCA1, and CaBP-9k) in the placenta, duodenum, and kidney after COMT inhibition on gestation day 17.5 (GD 17.5). Twenty-eight mice were divided into 4 groups [Vehicle, calcium, RO41–0960, and RO41–0960 and calcium (2% of calcium carbonate)]. In addition, we evaluated the calcium transporters in the kidney and duodenum of nonpregnant female mice. The placental TRPV5,6, PMCA1, and CaBP-9k were investigated by real-time RT-PCR. All experimental data was presented mean standard error of the mean (s.e.m.); P-values were calculated using one-way ANOVA. Placental TRPV5, TRPV6 and PMCA1 expressions were significantly down-regulated by COMT inhibitor (ro41–0960). In addition, the reduced PMCA1 expression in the placenta was reversed by calcium supplementation. Duodenal expressions of TRPV5, TRPV6, and PMCA1 were significantly decreased in the COMT-inhibited mice, and slightly recovered after calcium supplementation. Renal expression of TRPV5, TRPV6, and PMCA1 was also decreased by COMT inhibition, while it was reversed by calcium supplementation to the level of control. Duodenal- and renal calcium transporting genes, TRPV5, TPRV6, PMCA1, and CaBP-9k, were down-regulated by COMT treatment in female mice. Taken together, these results indicate that physiological changes observed in COMT inhibition showed similar symptoms as in preeclampsia, which may be related with disturbance of calcium metabolism during pregnancy.

219

EFFECT OF THE ENDOCRINE DISRUPTING CHEMICALS ON PLACENTAL TRANSPORT IN BEWO CELLS AS AN IN VITRO MODEL J.-H. Lee and E.-B. Jeung College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, South Korea

The placenta exchanges vital factors, including oxygen, carbon dioxide, copper, iron, calcium cations, and glucose, which are essential to fetal growth. Each molecule is transferred by specific receptors that are located at the cell membrane or in the cytoplasm. Copper, iron, calcium cations, and glucose transfer genes are regulated by estrogens, vitamin D, and human placental lactogen. Regulations of these receptors depend on pregnancy time length and maternal and fetal nutrient environment with various pathways. Some synthetic plastics known as endocrine disrupting chemicals (EDC) have a similar structure to reproductive hormones such as estrogens. Thus, these substances have a potential effect on the expression of genes which are regulated by estrogens or progesterone by interfering their pathways. Having an estrogenic property, EDC interact with oestrogen receptors and elevate or decrease the expression of target genes which are responsible for transporting essential molecules such as copper, iron, and calcium. To examine the effects of EDC exposure during pregnancy, we conducted an in vitro model study using the BeWo human trophoblast cell line. The BeWo cell was treated with well-known EDC, octyl-phenol (OP), nonyl-phenol (NP), and bisphenol A (BPA) in a dose-dependent manner (107, 106, and 105 M) for 24 h. The expression of copper (CTR1, ATP7A), iron (IREG1, HEPH), and calcium transporting genes (PMCA1, TRPV6), were measured by realtime RT–PCR and Western blot. The expression of copper, iron, and calcium transporting genes were elevated in a dose-dependent manner by all wellknown EDC, including OP, NP, and BPA, as well as E2. To unveil the mechanism of these elevations of ionic transporting genes, an ERE promoter study will be needed. Taken together, essential cation transporting genes in placenta are modulated by EDC.

200


220

Gene Expression

THE ESTROGEN-LIKE EFFECT OF 2-METHOXYESTRADIOL (2-ME) IN IN VITRO AND IN VIVO MODELS J.-S. Lee and E.-B. Jeung

College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, South Korea 2-Methoxyestradiol (2-ME), an endogenous metabolite of 17b-oestradiol, interacts with oestrogen receptors and microtubules and has a low affinity for oestrogen receptors (ER). It has attracted considerable interest due to its potential anti-cancer therapeutic effects. 2-ME is also recognised for its unique and profound actions on various tumour cell lines and cancer independent of the hormone receptor status. Regardless of differences in function, 2-ME has an affinity for ER, however, the exact mechanisms of 2-ME action via the ER are not fully understood. In the current study, we examined the estrogenic effect of 2-ME on mRNA levels of CaBP-9k, ER, and progesterone receptor (PR) in the absence or presence of the 17b-oestradiol (E2) and progesterone (P4) in both in vivo and in vitro models by real-time RT–PCR. In vitro, cells (n ¼ 3 per group) were exposed to a single dose of E2 (109 M), P4 (106 M), 2-ME (108 M, 107 M, 106 M). The mechanism of CaBP-9k induction by these chemicals pre-treated with 107 M ICI 182, 780 and 106 M RU 486 for 30 min before exposure to E2 and 2-ME were analysed. In vivo, 35 female ICR mice (PND 14 days) were divided into 7 groups (n ¼ 5 per group), and each group was administered subcutaneously with 24% DMSO, 38% ethanol, and 38% sterile saline as a vehicle, E2 [40 mg kg1 of body weight (BW)] a physiological dose level), 2-ME (4, 40, and 80 mg kg1 of BW) for 3 days. The mice were killed 24 h after the final injection. To investigate the effect of antagonism, 10 mice were injected SC with ICI 182 780 (10 mg kg1 of BW) and RU 486 (10 mg kg1 of BW) at 30 min before injection with 2-ME (40 mg kg1 of BW) for 3 days and killed 24 h after the final injection. Results are presented as mean s.e.m.; P-values were calculated using one-way ANOVA. In GH3 cells, the mRNA level of CaBP-9k was induced in the E2 (109 M) treatment group, and expression of CaBP-9k was also up-regulated in the 2-ME (107 M)-treated group. Uterine lactoferrin (Ltf) mRNA expression was also increased in the 2-ME (40 mg kg1 of BW) group, similar to the response with E2 (40 mg kg1 of BW) in mice. As a blocker for ER and PR activity, ICI 182 780 and RU 486 reversed the E2 or 2-ME mediated increase of CaBP-9k and Ltf mRNA expression. We found that 2-ME significantly increased the levels of ERa and PR transcripts. In parallel with in vitro results, the mRNA levels of ERa and PR were induced by treatment with E2 and 2-ME. Taken together, our findings demonstrated that expression of estrogenic markers, CaBP-9k and Ltf, was regulated by 2-ME in both in vitro and in vivo, which may increase their estrogenic activities in female during the cycle through ER and/or PR-mediated pathway.

221

HOXB9 IS DIFFERENTIALLY EXPRESSED IN THE TWO FIRST CELL LINES OF THE MAMMALIAN EMBRYO C. Sauvegarde, R. Rezso¨hazy, and I. Donnay Universite´ Catholique de Louvain, Louvain-la-Neuve, Belgium

Hox proteins are transcription factors known to be essential for embryo patterning. The detection of some Hox transcripts in oocytes and early embryos suggests that they could play a role before gastrulation. We previously demonstrated Hoxb9 expression in oocytes and from the zygote to the blastocyst stage in the mouse and the bovine (Paul et al. 2011 Mol. Reprod. Dev. 78, 436). The protein is present at all stages and in all cells with a strong nuclear staining in both species. The objective of this study was to perform an in-depth study at the blastocyst stage to compare the level of the nuclear protein between the inner cell mass (ICM) and the trophectoderm (TE) from the early to the expanded blastocyst stage. In vitro produced bovine blastocysts were collected at Day 6, Day 7.5, and Day 8 post-insemination. Hoxb9 proteins were detected by whole-mount immunofluorescence. TE nuclei were strongly stained at all stages while from D6 but especially from D7.5, the level of HOXB9 seemed to decrease in ICM nuclei with an increasing heterogeneity of staining between ICM nuclei. A light and apparently stable staining was also observed in the cytoplasm. Confocal images were quantified (Nis-element 3.1, Nikon). For each cell of TE or ICM, the ratio between the mean intensity of the nucleus and the mean intensity of the corresponding total cytoplasm was calculated. Whatever the stages, TE ratios were significantly (Mann–Whitney test; P , 0.0001) higher than ICM ratios, suggesting that HOXB9 is present in higher amounts in TE than in ICM cells. This observation could be correlated with the reduced HOXB9 relative expression observed in blastocysts. Moreover, the proportion of blastocysts showing a reduction of HOXB9 staining in at least one nucleus significantly increased from Day 6 to Day 7.5 blastocysts and Day 8 blastocysts (from 26% to 74% or 85%, chi-squared test; P , 0.001). Mouse zygotes, collected from superovulated mice, were cultured in vitro and embryos were collected 72 h, 80 h, 92 h and 100 h post-hCG injection. A similar nuclear staining was observed in all cells until 80 h post-hCG injection, while heterogeneity of staining appeared in ICM cells 92 h post-hCG, but especially in 100 h post-hCG embryos. The quantitative study was performed only on this latest stage and confirmed the stronger staining in TE than in ICM nuclei (Mann–Whitney test; P , 0.0001) observed in the bovine. At this stage, 82% of blastocysts presented a reduced Hoxb9 staining in some or all ICM nuclei. In conclusion, Hoxb9 protein is detected in all blastocyst nuclei both in the mouse and in the bovine. However, the protein seems globally less abundant in the ICM than in the TE cells. Moreover, the percentage of bovine blastocysts showing a reduction in HOXB9 staining intensity in ICM nuclei increases with blastocyst expansion. These results suggest an involvement of Hoxb9 in cell lineage differentiation in mammals. C. S. holds a FRIA PhD grant from the FRS-FNRS (Belgium). This study is supported by the FRS-FNRS and by an Action de Recherche Concerteé.

Gene Expression


201

222 ANTIFUNGAL AGENTS AS AGRICULTURAL PRODUCTS, FENHEXAMID, FLUDIOXONIL, AND CYPRODINIL, INDUCED THE EXPRESSION OF CYTOCHROME P450 FAMILY AND CELL CYCLERELATED GENES IN ESTROGEN RECEPTOR EXPRESSING BG-1 OVARIAN CANCER CELLS R.-E. Go and K.-C. Choi Laboratory of Biochemistry and Immunology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea Fenhexamid, fludioxonil, and cyprodinil are antifungal agents used in agricultural applications, which are present at measurable amounts in fruits and vegetables. The induction of CYP gene expression including CYP1A1 and CYP1B1 is mediated by the transformation of polycyclic aromatic hydrocarbons (PAHs), and modulated by aryl hydrocarbon receptor (AhR). CYP1A1 is expressed in the liver, pancreas, thymus, uterus, and small intestine. CYP1B1 is abundant in the prostate, breast, and uterus. Expression levels of CYP1A1 and CYP1B1 indicate PAH-induced immunotoxicity, oxidative stress, and activation of environmental carcinogens. In this study, the ability of cell viability was examined as MTT assay by pesticides; fenhexamid, fludioxonil and cyprodinil. In addition, expression levels of mRNA and protein of AhR, CYP1A1, and Cyclin D1 were analysed by RTPCR and Western blot analysis in BG-1 ovarian cancer cells with oestrogen receptors (ER). To evaluate the ability of cell viability, BG-1 cells were cultured with a negative control (0.1% DMSO), 17b-oestradiol (E2; 1 109 M), fenhexamid, fludioxonil or cyprodinil (105–108 M). To evaluate the expression levels of mRNA and protein, BG-1 cells were cultured with a negative control (0.1% DMSO), 17b-oestradiol (E2; 109 M) and these pesticides (105 M). As results, E2 as a positive control markedly increased BG-1 cell viability ,5 times compared to a negative control (P , 0.05). In addition, treatments with these pesticides increased BG-1 cell viability at the concentrations of 108 and 105 M about from 1.5 to 2 times, respectively (P , 0.05). When respective treatment co-treated with ICI 182 780, an ER antagonist, BG-1 cell viability was reversed to the level of a negative control. The mRNA expression of CYP1A1 was increased by E2, fenhexamid, and cyprodinil in a time-dependent manner but not by fludioxonil, while its level was reversed in the presence of ICI 182 780. In parallel with their transcriptional levels, protein levels of CYP1A1 and cyclin D1 were induced by E2 and these pesticides, while the level of AhR was not altered by E2 and these pesticides. Taken together, these results imply that the pesticides, fenhexamid, fludioxonil, and cyprodinil, may have disruptive effects on ER expressing cells or tissues by alteration of CYP1A1 and cyclin D1 via an ER-dependent pathway.

223 PROGRESSION OF BREAST CANCER WAS CAUSED BY TREATMENT WITH BENZOPHENONE-1 AND NONYL-PHENOL VIA ALTERATION OF CELL CYCLE AND METASTASIS-RELATED GENES IN A CELLULAR MODEL S.-J. In, K.-A. Hwang, S.-H. Kim, and K.-C. Choi Laboratory of Biochemistry and Immunology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea Endocrine disrupting chemicals (EDC) are defined as environmental compounds that may result in adverse health problems such as cancer proliferaition and metastasis in humans. Benzophenone-1 (2,4-dihydroxybenzophenone, BP-1) and nonyl-phenol (NP) are known as typical EDCs. They are discharged from numerous industrial products including plastics, pesticides, drugs, detergents, and cosmetics. In this study, we examined the effect of BP-1 and NP on the growth of MCF-7 human breast cancer cells expressing oestrogen receptors (ER) in comparison with E2 to assess their risk in cancer progression. In cell viability assay, BP-1 (105, 106, and 107 M) and NP (106 and 107 M) were determined to induce the proliferation of MCF-7 cells as well as E2 (109 M) was compared to a negative control treated with DMSO (P , 0.05). Next, to confirm that BP-1 and NP increase growth and metastasis of MCF-7 cells, the alterations in transcriptional and translational levels of related markers, i.e. cyclin D1, p21, and cathepsin D, were examined by reverse-transcription (RT)-PCR and Western blot assay. Cyclin D1 is a factor responsible for G1/S cell cycle transition and p21 is a potent cyclin-dependent kinase (CDK) inhibitor that arrests cell cycle in G1 phase. Cathepsin D is one of the proteases that are responsible for cancer progression and metastasis. Treatment of MCF-7 breast cancer cells with BP-1 (105 M) or NP (106 M) resulted in up-regulation of cyclin D1 and cathepsin D and down-regulation of p21 at transcriptional and translational levels as well as E2 (109 M) compared to a negative control treated with DMSO (P , 0.05). In addition, E2, BP-1, or NP-induced alterations of these genes were reversed by the presence of ICI 182 780 (108 M), an ER antagonist, suggesting that the changes in these gene expressions may be regulated by ER-dependent signalling pathway. In conclusion, these results suggest that BP-1 and NP, like E2, may accelerate the growth of MCF-7 breast cancer cells by regulating cell-cycle-related genes through ER-mediated signalling pathway. Furthermore, these EDCs can adversely affect human health by promoting cancer metastasis through the amplification of cathepsin D via ER-dependent signalling pathway.

224

A GROWTH OF HUMAN BG-1 CANCER CELLS EXPRESSING ESTROGEN RECEPTORS WAS ENHANCED BY SYNTHETIC PYRETHROIDS, LAMBDA-CYHALOTHRINM AND CYPERMETHRIN, VIA AN ESTROGEN RECEPTOR-DEPENDENT SIGNALING PATHWAY C.-W. Kim, R.-E. Go, and K.-C. Choi

Laboratory of Biochemistry and Immunology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea Synthetic pyrethroids (SP) are the most common pesticides in recent use, which are used as indoor pest control. The widespread use of SPs has resulted in extensive exposure to wildlife and human. Recently some SPs are suspected as endocrine disrupting chemicals (EDC) and have been assessed for their potential estrogenicity by various assays. In this study, we examined the estrogenic effects of lambda-cyhalothrin (LCT) and cypermethrin (CP), the most commonly used pyrethroid insecticides in Korea, using BG-1 ovarian cancer cells expressing oestrogen receptors (ER). To evaluate the estrogenic activities of two SPs, LCT and CP, we employed MTT assay and reverse-transcription polymerase chain reaction

202


IVF/IVP

(RT–PCR). In MTT assay, LCT (106 M) and CP (105 M) significantly induced the growth of BG-1 cancer cells, 1.61 0.1 and 1.45 0.06 times, respectively, as 17b-oestradiol (E2, 109 M, 2.73 0.25 times) did. LCT or CP-induced cell growth was reversed to a control level (DMSO) by addition of ICI 182 720 (108 M), an ER antagonist, suggesting that this effect appears to be mediated by an ER-dependent manner. Moreover, RT–PCR results showed that transcriptional level of ERa expression was significantly down-regulated by LCT and CP as in case of E2. Taken together, these results indicate that LCT and CP may possess estrogenic potentials to stimulate ovarian cancer cells expressing ERs via an ER-dependent manner, and these collective results confirm the carcinogenicity of these SP, LCT and CP, in ER-positive cells or tissues.

225

VALIDATION OF REFERENCE MICRORNAS FOR NORMALIZING EXPRESSION DATA GENERATED BY QUANTITATIVE PCR M. MahdipourA, H. T. A. Van TolA, T. A. E. StoutA,B, and B. A. J. RoelenA,B A

Department of Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands; B Department of Equine Sciences, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands

Small noncoding RNAs such as microRNAs (miRNA) act as posttranscriptional regulators of numerous gene targets. The level of expression of these epigenetic factors can regulate the stability and translation of target mRNA molecules. Quantification of miRNA expression levels can therefore help us understand biological processes such as those regulating oocyte and pre-implantation embryo development. To date, most studies that have examined miRNA expression levels have used expression of either reference mRNAs or U6 spliceosomal RNA or miRNA Let-7a for normalization. We analysed the suitability of several miRNAs as potential expression normalizers in bovine oocytes and early embryos. Bovine oocytes at the germinal vesicle and metaphase II stages, and zygotes, 2-cell, 4-cell and 8-cell embryos, morulae, and blastocysts were collected during three in vitro fertilization replicates. qPCR was performed to quantify expression of miR-93, miR-103a, miR-26a, miR-191, miR-23b, Let-7a, and U6. The average starting material for each sample was determined with the help of specific standard curves made for each primer set. Subsequently, geNorm software was used to identify a set of stably transcribed miRNAs. Surprisingly, U6 spliceosomal RNA and Let-7a, which are widely used to normalise miRNA expression levels, were not stably expressed and were therefore considered unsuitable for normalization. Stepwise removal to determine the optimal number of reference miRNAs identified miR-93 and miR-103a as the most stably expressed. It is concluded that the combination of miR-93 and miR-103a can be used for normalizing miRNA expression for qPCR experiments on bovine oocytes and pre-implantation embryos.

IVF/IVP 226

IN VITRO PRODUCTION OF BOVINE EMBRYOS USING CHEMICAL PACKETS THAT REGULATE CO2 AND O2 K. Saeki and Y. Fujiki Department of Genetic Engineering, Kinki University, Wakayama, Japan

Bovine embryos are now routinely produced with oocytes collected from slaughterhouse ovaries or by transvaginal ovum pickup. The oocytes are matured, fertilized, and cultured in a water-jacketed CO2/O2 incubator. Gas phase in incubators is usually maintained at 5% CO2 in air for in vitro maturation (IVM) and IVF of oocytes and at 5% CO2, 5% O2, and 90% N2 for in vitro culture (IVC) of embryos. Here we investigated whether two chemical packets that regulate CO2 and O2 for culturing bacteria (Mitsubishi Gas Chemical, Tokyo, Japan) could be used to control the gas phase in vitro production (IVP) of cattle embryos. One packet (Anaero Pack-CO2) was maintained at a CO2 level of ,5% in a 2.5-L container and the other (Anaero Pack-MicroAnaero) was maintained at a CO2 level of 5–8% and an O2 level of 6 to 12%. Bovine cumulus-oocyte complexes (COC, n ¼ 970) were collected from slaughterhouse ovaries, matured in HEPES-buffered TCM-199 (catalog number 12340–030, Invitrogen) supplemented with 10% FCS, 0.02 Armour unit mL1 FSH and 1 mg mL1 E2 for 22 h, and fertilized in medium IVF100 [Research Institute for the Functional Peptides Co. Ltd. (IFP), Yamagata, Japan] with frozen-thawed sperm (4 106 cells mL1) for 6 h. Sperm and cumulus cells were removed from the oocytes. The denuded oocytes were cultured in IVD101 (IFP, 20 to 30 embryos/50 mL) for 8 days (Day 0 ¼ IVF). Culture was carried out at 398C with maximum humidity. Five different combinations of gas conditions were used for incubation (Table 1). Experiments were repeated 3 times. Cleavage and blastocyst rates were assessed on Day 8. Data were analysed by ANOVA followed by Fisher’s PLSD test. In the five conditions, rates of matured oocytes (oocytes at MII, n ¼ 210) were 70 to 73% and rates of normal fertilized oocytes (oocytes with 2 pronuclei, n ¼ 310) were 67 to 75%. Cleavage rates of embryos after 8 days of culture (n ¼ 450) were 68 to 75%, and rates of blastocysts from cleaved embryos were 25 to 40%. None of the above measures were significantly different among the 5 conditions (P . 0.05). These results indicate that gas phase control is not needed for IVM and IVF of bovine oocytes for their subsequent development. Anaero Pack-MicroAnaero (5–8% CO2, 6–12% O2) can be used for IVC of bovine embryos. The CO2-generating and deoxidizing packets can be successfully used to control the gas phase during bovine embryo production. Table 1. Five different combinations of gas conditions used for incubation Group

IVM and IVF

IVC

1 2 3 4 5

5% CO2 5% CO2 100% air Anaero Pack-CO2 Anaero Pack-CO2

5% CO2, 5% O2 Anaero Pack-MicroAnaero Anaero Pack-MicroAnaero 5% CO2, 5% O2 Anaero Pack-MicroAnaero

IVF/IVP


203

227 SUPPLEMENTATION WITH CYSTEINE, CYSTEAMINE, AND CATALASE DURING IN VITRO MATURATION PROTECTS BOVINE PRE-IMPLANTATION EMBRYOS FROM ANTI-DEVELOPMENTAL ACTIONS OF MENADIONE G. Z. Mingoti, N. A. S. Rocha-Frigoni, B. C. S. Leaõ, and P. C. Dall’Acqua Laboratory of Physiology of Reproduction, Faculty of Veterinary Medicine, Universidade Estadual Paulista, UNESP, Araçatuba-SP, Brazil Menadione (MD), a naphthoquinone used as a vitamin K source in animal feed, can generate reactive oxygen species (ROS) and cause apoptosis. Hence, we examined whether MD reduces development of pre-implantation bovine embryos by inducing ROS production and apoptosis and tested the hypothesis that the anti-developmental actions of MD would be reduced by supplementation of the in vitro maturation (IVM) medium with antioxidants (a mixture of 0.6 mM cysteine þ 100 mM cysteamine þ 100 UI mL1 catalase). Cumulus-oocyte complexes (COC; n ¼ 3334; 50 per well in 11 replications) were matured in IVM medium (TCM-199 with bicarbonate, hormones, and 10% FCS) for 22 h. After fertilization, presumptive zygotes were cultured in synthetic oviduct fluid medium (SOF) with 2.5% FCS and 0.5% BSA up to 7 days (Day 0 ¼ IVF). On Day 6, MD was included in the SOF medium (0 mM: Control; or 5.0 mM: MD5) during 24 h. All cultures were conducted at 38.58C in 5% CO2 in air. In a second experiment, COC were matured in TCM-199 supplemented with or without the mixture of antioxidants (Antiox; only during IVM) and with or without MD at Day 6 in a 2 2 factorial design (Control, Control/Antiox, MD5, MD5/Antiox). The cleavage and blastocysts rates were evaluated on Days 3 and 7, respectively. A sample of the blastocysts (n ¼ 1112) was stained for TUNEL (In Situ Cell Death Detection Kit, Roche, Indianapolis, IN, USA) to detect the apoptotic cells or with 5 mM H2DCFDA (Molecular Probes, Canada) to evaluate the ROS levels. Stained embryos were evaluated under an epifluorescence microscope and the images of embryos stained with H2DCFDA were analysed by Q-Capture Pro image software for determining the fluorescent intensity. The means (s.e.m.) were compared by ANOVA followed by Tukey’s test (P , 0.05). In the first experiment, and the cleavage rates were similar (P . 0.05) for Control (80.5% 0.9) and MD5 groups (78.9% 1.2), but the blastocyst rates were lower (P , 0.05) in the MD5 group (25.9% 2.1) when compared with Control (36.4% 1.5). The rate of apoptotic cells in blastocysts was higher (P , 0.05) in the MD5 group (19.2% 0.7) than in Control (10.0% 0.5), as well as the fluorescence intensity for ROS quantification (0.7 0.1 v. 1.1 0.1, respectively, for Control and MD5 groups). In an effort to rescue the impaired embryonic development, a mixture of antioxidants was added to the IVM medium and the results were transitional in response in which MD5/Antiox (28.3% 3.5) was intermediate (P . 0.05) between the Controls [Control (38.2% 2.5) and Control/ Antiox (34.7% 1.9) groups] and the MD5 (21.4% 2.9) group. Principal effects evaluated were the presence of MD (without: 35.9% 2.3 v. with: 24.8% 2.3; P , 0.05) or Antiox (without: 28.4% 2.3 v. with: 32.3% 2.3; P . 0.05). In conclusion, addition of MD to embryonic culture reduces the blastocyst development and increases intracellular levels of ROS and the occurrence of apoptosis. Anti-developmental actions of MD on embryonic development can be partially blocked by treating oocytes with a mixture of antioxidants during IVM. Financial support was provided by FAPESP (2012/10083-8 and 2013/07382-6).

228

EFFECT OF INSULIN ON BOVINE OOCYTE MATURATION, CUMULUS CELL APOPTOSIS, AND EARLY EMBRYO DEVELOPMENT IN VITRO I. Lindgren, P. Humblot, D. Laskowski, and Y. Sjunnesson

Swedish University of Agricultural Sciences, Department of Clinical Sciences, Division of Reproduction, Uppsala, Sweden Dairy cow fertility has decreased during the last decades, and much evidence indicates that metabolic disorders are an important part of this decline. Insulin is a key factor in the metabolic challenge during the transition period that coincides with the oocyte maturation and may therefore have an impact on the early embryo development. The aim of this study was to test the effect of insulin during oocyte maturation on early embryo development by adding insulin during the oocyte maturation in vitro. In this study, abattoir-derived bovine ovaries were used and cumulus-oocyte complexes (n ¼ 991) were in vitro matured for 22 h according to standard protocols. Insulin was added during maturation in vitro as follows: H (10 mg mL1 of insulin), L (0.1 mg mL1 of insulin), or Z (0 mg mL1 of insulin). After maturation, oocytes were removed and fixed in paraformaldehyde before staining. Click-it TUNEL assay (Invitrogen, Stockholm, Sweden) was used for apoptotic staining and DRAQ5 (BioNordika, Stockholm, Sweden) for nuclear staining (n ¼ 132). Cumulus-oocyte complexes were evaluated using laser scanning confocal microscope (Zeiss LSM 510, Zeiss, Oberkochen, Germany). Five levels of scans were used to assess oocyte maturation (MII stage) and apoptosis. Because of incomplete penetration of the TUNEL stain (3–5 layers of cumulus cells), only the outer 2 layers of the cumulus complex were investigated regarding apoptosis. Apoptotic index was calculated as apoptotic cells/total cells visualised. Remaining oocytes were fertilized and cultured in vitro until Day 8. Day 7 and Day 8 blastocyst formation was assessed as well as blastocyst stage and grade. Effect of insulin treatment on variables was analysed by ANOVA following arc sin Op transformation. Post-ANOVA comparisons between HþL group v. Z were performed by using the contrast option under GLM (Scheffe´ test). Results are presented as least squares means s.e. P-values # 0.05 were considered as statistically significant. Insulin treatment during oocyte maturation in vitro had no significant effect on oocyte nuclear maturation or apoptotic index of the cumulus cells (Z: 0.052 0.025, L: 0.039 0.016, H: 0.077 0.044, P . 0.05). No effect was seen on cleavage rates (Z: 0.85 0.02, L: 0.85 0.02, H: 0.89 0.03, P . 0.05), but insulin treatment significantly decreased Day 7 rates from fertilized oocytes (Z: 0.19 0.02, L: 0.14 0.02, H: 0.12 0.02, P , 0.05). This study also showed a significantly retarded developmental stage and decreased grade of blastocysts in insulin-treated groups taken together when compared with the control group (P , 0.05). In this study, no effect of insulin supplementation during in vitro maturation was seen on bovine oocyte maturation and apoptosis of cumulus cells, but blastocyst formation and development were negatively affected. Further studies are needed for understanding the relationship between the addition of insulin during maturation in vitro and impaired blastocyst formation. Insulin is a common supplement in the first phase of the first in vitro maturation medium for pig oocytes and is believed to have a beneficial effect on this species. Funding was received from Stiftelsen Nils Lagerlo¨fs Fond H12–0051-NLA.

204


229

IVF/IVP

SHORT-TERM EXPOSURE OF MATURE OOCYTES TO A NITRIC OXIDE DONOR FOR INDUCING OXIDATIVE STRESS RESISTANCE ON IN VITRO-PRODUCED BOVINE EMBRYOS

C. CheuquemańA, P. LorenA, M. AriasA, J. RisopatrońA,B, R. FelmerA,C, J. AlvarezD, T. MogasE, and R. SańchezA,F A

Centro de Biotecnologıá de la Reproduccioń (BIOREN-CEBIOR), Facultad de Medicina, Universidad de La Frontera, Temuco, Chile; B Departamento de Ciencias Ba´sicas, Universidad de La Frontera, Temuco, Chile; C Departamento de Ciencias Agrono´micas y Recursos Naturales, Facultad de Ciencias Agropecuarias y Forestales, Temuco, Chile; D Centro ANDROGEN, La Corunã, Espanã; E Departamento de Medicina i Cirurgia Animals, Universitat Auto`noma de Barcelona, Bellaterra, Espanã; F Departamento de Ciencias Preclıńicas, Facultad de Medicina, Universidad de La Frontera, Temuco, Chile

Recent studies have shown that short-term exposure of oocytes to stressors such as hydrostatic pressure, osmotic stress, and oxidative stress might induce stress tolerance in embryos. In this research we studied the effect of short-term exposure of bovine in vitro-matured cumulus-oocyte complexes (COC) with a nitric oxide donor (SNP) on IVF, embryo development, embryo quality, and relative gene expression related to cell redox state regulation. The COC were selected and matured in TCM 199 supplemented with 10% inactivated FBS, 6 mg mL1 of LH, 6 mg mL1 of FSH, 1 mg mL1 of oestradiol, and 0.2 mmol of pyruvate and then incubated for 22 to 24 h at 38.58C in 5% CO2 in a humidified atmosphere (n ¼ 12). Before IVF, mature COC were incubated during 1 h with different concentration of sodium nitroprusside, SNP (control without SNP, 106 M, 105 M, and 104 M SNP) in maturation media at 38.58C and 5% CO2 in a humidified atmosphere. For IVF procedure, oocytes of each treatment and sperm of one bull were co-incubated for 18 to 20 h at 38.58C and 5% CO2. Presumptive zygotes were separately cultured until Day 7 under mineral oil at 38.58C and 5% CO2, 5%O2, and 90% N2 in a humidified atmosphere. Embryo quality was analysed by staining with CDX2 antibody for trophectoderm cells and compared with total embryo cells stained with Hoechst 33342. Relative gene expression for each treatment were evaluated after RNA extraction and cDNA synthesis in Stratagene MX 3000P real-time equipment with Agilent qPCR software MX pro 4.1 version. Differences between experimental groups (n ¼ 12) were measured using a one-way ANOVA test in the STATGRAPHICS plus 5.1 version software. P , 0.05 was considered statistically significant. Cleavage percentage at 72 h post-insemination was significantly different between the control and 104 M SNP group (82 8.4% v. 77 7.1%, respectively) and between 105 M and 104 M SNP group (84.9 4.1% v. 77 7.1%, respectively). Blastocyst percentage at 7 days of culture was significantly different between control and 104 M SNP group (34.1 7.8% v. 26.2 4.9%, respectively). Embryo development between control group and treatments was similar within early, expanded, and hatched blastocyst percentage. Embryo quality of expanded blastocyst was similar between control group and treatments (ICM: TE). No significant differences in gene expression after SNP exposure was observed (iNOS, eNOS, nNOS, PRDX5, HSP70, HSP90, HIF1A, BCL2A). Oocytes incubated with a high concentration of SNP showed lower cleavage and blastocyst rates, showing that this treatment was deleterious for in vitro embryo production in bovine. However, there were no significant differences on embryo quality assessed by ICM : TE ratio and/or in gene expression pattern of 7-day cultured expanded blastocysts.

230

ROLE OF PITUITARY HORMONES AND CUMULUS CELLS IN MODULATING THE DEVELOPMENTAL CAPACITY OF AGING BOVINE OOCYTES G. Singina, I. Lebedeva, T. Taradajnic, and N. Zinovieva Russian Research Institute of Animal Husbandry, Dubrovitsy-Podolsk, Russia

The competence for embryonic development acquired during the oocyte maturation attenuates during the subsequent oocyte aging both in vivo and in vitro. Thus, the successful control of the female fertility requires information regarding factors responsible for the oocyte protection from early aging. The aim of the present research was to study the pattern and pathways of actions of two closely related pituitary hormones, prolactin (PRL), and growth hormone (GH), on the developmental potential of bovine oocytes during their aging in vitro. Therefore, we analysed (1) effects of PRL and GH during the prolonged culture of bovine oocytes on their subsequent development up to the blastocyst stage and (2) the role of cumulus cells (CC) and tyrosine kinases, the well-known mediators of PRL and GH signalling, in these effects. Bovine cumulus-enclosed oocytes (CEO) were cultured for 22 h in the following maturation medium: TCM 199 containing 10% fetal calf serum (FCS), 10 mg mL1 of porcine FSH, and 10 mg mL1 of ovine LH. After IVM, CEO or denuded oocytes (DO) were transferred to the aging medium consisting of TCM 199 supplemented with 10% FCS and cultured for 10 h in the absence (Control) or presence of 50 ng mL1 bovine PRL or 10 ng mL1 recombinant bovine GH and/or 10 mg mL1 genistein (a non-selective inhibitor of tyrosine kinases). Genistein was not applied in the case of aging DO, since their developmental potential was not affected by both hormones. Following the prolonged culture, oocytes underwent IVF and IVC. Embryos were cultured in CR1aa medium until Day 5 postinsemination and then transferred to the same medium supplemented with 5% FCS and cultured up to Day 8. The embryo development was evaluated at Days 2 and 8 for cleavage and blastocyst formation. The data from 5 to 6 replicates using 135–184 oocytes per treatment were analysed by ANOVA. Aging of oocytes in the control medium had no effect on the cleavage rate, but caused the blastocyst yield to decline (P , 0.001) from 31.1 2.3% (CEO fertilized immediately after maturation) to 10.5 2.4% (aged CEO) and 7.9 1.9% (aged DO). Cleavage rates of aging CEO and DO were unaffected by both PRL and GH. In the case of CEO, the addition of PRL (but not GH) to the aging medium raised the blastocyst yield from 8.2 0.9% to 15.2 2.1% (P , 0.05), whereas the removal of CC abolished this effect, reducing the yield up to 9.1 2.7% (P , 0.05). At the same time, genistein did not influence the blastocyst yield in the PRL-treated group. The findings demonstrate that PRL can inhibit the attenuation of the developmental competence of bovine oocytes aging in vitro, with this effect being achieved via cumulus cells. Tyrosine kinases are unlikely to mediate the beneficial action of PRL on the CEO capacity for embryonic development. Meanwhile, closely related GH does not affect the developmental competence of aging bovine oocytes. This research was supported by RFBR (project No. 13-04-01888).

IVF/IVP


205

231 EFFECTS OF DIETARY PROPYLENE GLYCOL ON FOLLICULAR FLUID AND OVUM PICK UP IN VITRO EMBRYO PRODUCTION IN GROWTH-RESTRICTED HEIFERS WITH ¨ LLERIAN HORMONE TWO PROFILES OF ANTI-MU G. GamarraA,B, C. PonsartC, S. LacazeB, B. Le GuienneA, P. HumblotD, M-C. DelocheA, D. MonniauxE, and A. A. PonterF,G A

UNCEIA De´partement Recherche et De´veloppement, Maisons Alfort, France; B MIDATEST, Denguin, France; C ANSES, Animal Health Laboratory, Maisons Alfort, France; D Division of Reproduction, Department of Clinical Sciences, Faculty of Veterinary Medicine and Animal Science, Uppsala, Sweden; E INRA, UMR85 Physiologie de la Reproduction et des Comportements, Nouzilly, France; F Universite´ Paris Est, Ecole Nationale Ve´te´rinaire d’Alfort, UMR 1198 Biologie du De´veloppement et Reproduction, Maisons Alfort, France; G Biologie du De´veloppement et Reproduction, Jouy en Josas, France Fertility and embryo quality can be improved in cattle by using diets that induce a programmed modulation of circulating insulin concentrations. The aim of this study was to test whether the daily oral administration of propylene glycol (PG) could modify metabolite and hormone plasma and follicular fluid concentrations and improve in vitro embryo production in superovulated growth-restricted heifers (600 g day1). Sixteen Holstein heifers were grouped according to their pre-experimental anti-Mu¨llerian hormone (AMH) plasma concentrations: low (L ¼ 1–80 pg mL1; n ¼ 7) or high (H: .150 pg mL1; n ¼ 9). Heifers received a single daily drench from Day 1 to Day 9 of an oestrous cycle [first cycle, 400 mL of water (control) and second cycle, 400 mL of PG]. Serial jugular blood samples were collected on Day 7 of each cycle to monitor plasma insulin, glucose, and b-hydroxybutyrate (BHB) concentrations in relation to the drench. Blood samples were also collected to measure insulin-like growth factor-1 (IGF1) and progesterone (P4) concentrations on Days 0, 2, 5, 7, and 9 of the oestrous cycle. Follicular fluid was collected on Day 9 to measure insulin and IGF1 concentrations. Ovarian ultrasonography was performed on Days 2 and 5 to count follicles between 2 and 8 mm in diameter and estimate their size. After ovum pickup (OPU) performed following superovulation on Day 5 of the oestrous cycle, oocytes were matured and fertilized in vitro, then embryos were cultured for 7 days. Propylene glycol increased plasma concentrations of insulin and glucose and reduced BHB in both groups of heifers compared with control. It also increased IGF1 concentrations on Days 5 and 7 in AMH L heifers and on Days 2, 5, and 7 in AMH H heifers, and reduced P4 concentrations on Days 5 and 9 of the oestrous cycle in all heifers. In follicular fluid, there was no difference in insulin concentrations between groups, but PG increased IGF1 concentrations in all heifers. In ovaries, PG increased the number of small follicles (2–3 mm) and total follicles on Day 2 of the cycle in all heifers, and medium follicles (4–8 mm) and total follicles on Day 5 in AMH H heifers. Propylene glycol improved the in vitro embryo development rate (total number of embryos/number of fertilized oocytes) in all heifers (AMH L: control, 37.9% v. PG, 50.0%; P , 0.05; AMH H: control, 36.4% v. PG, 48.3%; P , 0.05). In AMH H, the number of grade 1 blastocysts was increased by PG (control, 5.2 1.0 v. PG, 8.9 1.0; P , 0.01), whereas there was no difference between treatments in AMH L heifers (control, 1.9 1.1 v. PG, 3.2 1.1; P . 0.05). These results indicate that short-term oral PG supplementation affects the concentrations of metabolites and metabolic hormones in blood and IGF1 concentrations in follicular fluid. PG administration is effective in improving in vitro embryo production more markedly in heifers with high AMH compared with low AMH endocrine levels.

232

ADDITION OF VERY LOW AMOUNTS OF SERUM (ESTRUS COW SERUM) IMPROVES IN VITRO EMBRYO PRODUCTION IN DAIRY CATTLE E. MullaartA, F. DotingaA, C. PonsartB, H. KnijnA, and J. SchoutenA A

CRV, CRV BV, Arnhem, The Netherlands; B UNCEIA, UNCEIA, Paris, France

Improving the efficiency of the in vitro production (IVP) process is very important because it results in more embryos to be used in breeding programs or as commercial service. At CRV, a culture medium consisting of SOF with amino acids and BSA is used. In the past, richer culture media were used with 10% fetal calf serum combined with BRL cell co-culture. Although the efficiency of the IVP process of these media was good, these rather high serum concentrations were quite often related to large offspring syndrome (LOS). The switch to a culture system without serum resulted in a significant reduction in LOS but also in a reduction of embryo yield. The aim of the present study was to investigate the effect of adding low amounts of serum to the culture medium on efficiency of embryo production. Immature cumulus-oocyte complexes (COC) were recovered from ovaries 6 to 8 h upon slaughter. The COC were matured in vitro in TCM199/FCS/LH/FSH supplemented with cysteamine (0.1 mM). Subsequently, matured oocytes were fertilised with frozen-thawed gradient-separated semen and further cultured for 7 days in SOFaaBSA. The SOF medium contained either 0 (control), 0.1, 0.5, or 1.0% oestrus cow serum (ECS). Embryos development was scored at Day 7. Three replicates were performed and results were analysed by chi-square analyses. The results clearly show that adding ECS significantly improved embryo production (Table 1). Interestingly, already very low amounts (0.1%) of serum gave a significant increase in embryo percentage. In conclusion, addition of very low amounts of ECS (0.1%) is beneficial for embryo production, resulting in significantly higher embryo production (from 19 to 27%). In a subsequent field trial with OPU-derived embryos, the effect of addition of 0.1% ECS on birth weight (LOS) of the calves has to be investigated.

206


IVF/IVP

Table 1. Percentage of blastocysts at Day 7 after culture in SOF medium with different amounts of serum Group Control 0.1% ECS 0.5% ECS 1.0% ECS

Number of oocytes

% of blastocysts at Day 7 of culture

421 425 425 426

19a 27b 25b 28b

Values in columns with different superscript are significantly different, P , 0.05.

a,b

233 HIGH NUMBERS OF ANTRAL FOLLICLES INFLUENCE THE IN VITRO EMBRYO PRODUCTION, BUT NOT THE CONCEPTION RATE OF FIXED-TIME ARTIFICIAL INSEMINATION IN NELORE CATTLE G. M. G. SantosA, K. C. Silva-SantosA, T. R. R. BarreirosB, F. MorottiA, B. V. SanchesA, F. L. Z. MoraesA, W. BlaschiB, and M. M. SenedaA A

B

Uel, Universidade Estadual de Londrina, Londrina, Parana´, Brazil; Uenp, Universidade Estadual do Norte do Parana´, Bandeirantes, Parana´, Brazil

The aim of this study was to compare the conception rates to fixed-time artificial insemination (FTAI) and in vitro embryo production between Nelore cows with high or low antral follicle counts (AFC). First, multiparous Nelore cows (Bos indicus, n ¼ 547, 40–60 days postpartum) were subjected to synchronization of ovulation. Randomly during their oestrous cycle (Day 0), cows received an intravaginal device containing 1.9 g of P4 (CIDRÒ) and 2 mg of oestradiol benzoate (EstroginÒ), intramuscularly. At device removal (Day 8), cows received 500 mg of PGF2a (CiosinÒ), 300 IU of eCG (NovormonÒ), and 1 mg of oestradiol cipionate (ECPÒ), intramusculary. All cows were inseminated 48 h after P4 device removal. Antral follicles ¼ 3 mm were counted using an intravaginal microconvex transducer (Day 0), and cows were assigned to groups of high (G-High, ¼ 25 follicles, n ¼ 183), intermediate (G-Intermediate, 16–20 follicles, n ¼ 183), or low AFC (G-Low, ¼ 10 follicles, n ¼ 181). In another study to compared the in vitro embryo production, Nelore cows (n ¼ 66, 72–96 months) were subjected to ultrasound-guided follicular aspiration using an intravaginal microconvex array transducer (7.5 MHz). The COC were selected and cows were assigned to groups according to the oocyte production: G-High (n ¼ 22, ¼ 40 oocytes), G-Intermediate (n ¼ 25, 18–25 oocytes), or G-Low (n ¼ 19, ¼ 7 oocytes). Previously tested semen from a single bull was used for IVF using a previously described protocol (Silva-Santos et al. 2014 Reprod. Domest. Anim. 49, 228–232). The oocyte and embryo production (viable embryo: grade I, II, III; vitrifiable embryo: grade I, II) were evaluated. The number of follicles was evaluated by Kruskal-Wallis, and the chisquare test was used for data on oocyte and embryo production (P ¼ 0.05). The average follicular population was 30.7 5.7 (G-High), 18.6 1.64 (G-Intermediate), and 7.8 2.4 follicles (G-Low; P , 0.05), but there were no differences in the conception rates among groups (51.9 v. 48.6 v. 58.6%, respectively; P . 0.05). The total number of oocytes recovered were 1109 (G-High), 534 (G-Intermediate), and 101 (G-Low; P , 0.05). The mean number of viable oocytes was 40.4 10.6 (G-High), 14.8 3.0 (G-Intermediate), and 3.8 1.1 (G-Low; P , 0.05) and the percentage of viable oocytes was 80% (G-High), 69% (371/534, G-Intermediate), and 71% (G-Low; P , 0.05). Cleavage rate was 79% (G-High), 74% (348/472, G-Intermediate), and 71% (G-Low; P , 0.05), and blastocyst rate was 42% (G-High), 32% (153/472, G-Intermediate), and 13% (G-Low; P , 0.05). The number of viable embryos was 18.4 6.7 (G-High), 6.1 3.6 (G-Intermediate), and 0.6 0.7 (G-Low; P , 0.05) and the percentage of vitrifiable embryos was 81% (G-High), 77% (118/153, G-Intermediate), and 58% (G-Low; P , 0.05). Therefore, Nelore cows with high oocyte production had ,10-fold higher oocyte production and produced ,30-fold more embryos compared with the low AFC group. In conclusion, AFC had no influence on the conception rates to FTAI; however, Nelore cows with high oocyte production exhibited higher in vitro embryo production.

234

NEW CULTURE MEDIA AFFECTS BLASTOCYST DEVELOPMENT AND GENE EXPRESSION LEVELS IN IN VITRO-PRODUCED BOVINE EMBRYOS J. M. K. NielsenA, C. WrenzyckiB, P. HyttelA, F. PoppichtB, and L. StrøbechC A

Department of Veterinary Clinical and Animal Sciences, University of Copenhagen, Copenhagen, Denmark; B Clinic for Veterinary Obstetrics, Gynecology and Andrology, Giessen, Germany; C EmbryoTrans Biotech ApS, Frederiksberg, Denmark

The purpose was to examine effects of different media for bovine in vitro oocyte maturation (IVM) and in vitro embryo culture (IVC) on blastocyst rates, morpho-kinetics, and relative abundance of mRNA of 8 genes associated with critical processes and developmental competence in the embryo. Abattoir-derived cumulus-oocyte complexes (COC) were in vitro matured (IVM) in either TCM199 [þ0.5% BSA and gonadotropins (Suigonan Vet 150 I.E. mL1)] or in a novel commercially available media (Bo-IVM), and a total of 1196 presumptive zygotes, from 4 replicates, were submitted to in vitro culture (IVC) and cultured in either SOF (þ0.5% BSA) or in a novel commercially available media (Bo-IVC). Blastocyst rates and morphokinetics were assessed on Day 8 after fertilization. The high-quality blastocysts from each group were analysed by RT-qPCR, on single blastocysts using earlier verified primers, for BAX, BCL2L1, DNMT3A, FASN, G6PD, HSPA1A, SLC2A1, and SLC2A3. Data on blastocyst rates were analysed for statistical differences using a linear regression model, using a binary reproach and general estimating equations. One-way ANOVA was used to detect differences in the relative abundance of mRNA between groups, whereas differences between maturation and culture media were analysed by a 2-way ANOVA. Blastocyst rates in the Bo-IVM/Bo-IVC (37%), TCM199/Bo-IVC (33%), Bo-IVM/SOF (26%), and TCM199/SOF (28%) groups were significantly different from each other (P , 0.0001). Specifically, the Bo-IVM/Bo-IVC group differed significantly from both

IVF/IVP


207

SOF-cultured groups (P , 0.01). Subjectively, this group also had embryos of the highest quality and most advanced development. Significantly increased levels of mRNA transcripts were found for embryos cultured in Bo-IVC for all genes (P , 0.05) except BCL2L1. In conclusion, the developmental rates and gene expression of in vitro-produced bovine blastocysts were affected by the use of different culture media. Increased blastocyst rates, apparently superior embryo quality, and more abundant gene expression were achieved when blastocysts were cultured in Bo-IVC culture media compared with SOF. The project was supported by The Danish Council for Strategic Research.

235

DEVELOPMENT OF IN VIVO-MATURED OOCYTES COLLECTED FROM JAPANESE BLACK CATTLE STIMULATED WITH DIFFERENT DURATIONS OF FOLLICULAR GROWTH T. YamanouchiA, H. MatsudaA, M. OhtakeA, Y. AikawaA, S. KobayashiA, K. ImaiB, and Y. HashiyadaA A

National Live Stock Breeding Center, Nishigo, Fukushima, Japan; B Rakuno Gakuen University, Ebetsu, Hokkaido, Japan

We demonstrated that in vivo-matured oocytes (mOC) collected by ovum-pick up (OPU) from cows after stimulation of follicular growth (FG) are suitable for producing good quality blastocysts (BL). However, it is not known whether duration of FG affects developmental competence of mOC. The purpose of this study was to examine development of mOC after stimulation with different duration of FG. Japanese black donor cows (n ¼ 4 per each group), were treated with a CIDR at Day 0. Follicle of diameter .8 mm were removed on Day 5. A total 20 AU of FSH was administrated to cows twice daily with decreasing doses from the evening of Day 6 to the morning of Day 10. In the conventional group (48PG), a administration of PGF2a (0.75 mg of cloprostenol), CIDR withdrawal, and administration of GnRH (0.2 mg of fertirelin acetate) were performed on the evening of Day 8, morning of Day 9, and morning of Day 10, respectively. In the experimental group (72PG), administration of PGF2a, CIDR withdrawal, and administration of GnRH were performed on the evening of Day 9, the morning of Day 10, and the morning of Day 11, respectively. The mOC were collected from follicles .5 mm by OPU at 25 to 26 h following GnRH administration. Collected mOC were inseminated with 3 106 sperm mL1 in BO solution on 30 h after GnRH. After 6 h of IVF, presumptive zygotes were cultured for 168 h in 5% CS þ CR1aa, using a micro-well culture dish (Dai-Nippon-Print) and time-lapse cinematography (CCM-1.4MZS; Astec) for individual embryo observation. The kinetics of early embryo was analysis by CCM-1.4 software. To assess the quality of BL, prognostic factors were used as follows: (1) less than 27 hpi (hours post-insemination) at the first cleavage (1st CD), (2) 2 blastomeres at the end of 1st CD, and (3) absence of multiple fragments at the end of the 1st CD (Sugimura et al. 2012 PLoS ONE 7, e36627; Imai et al. 2014 Reprod. Fertil. Dev. 26, 182). Data were analysed by Student’s t-test or chi-square test. The number of mOC were 12.5 4.7 and 10.3 2.7 (means s.e.) oocytes per session in 48PG and 72PG. There was no significant difference in cleavage rate or BL formation rate (97.5 1.5 v. 98.2 1.8%, 66.3 8.2 v. 66.8 3.5%, respectively). The time for 1st CD was shorter in 48PG (26.1 0.3 v. 27.8 0.4; P , 0.01), and the rate of 1st CD less than 27 hpi was superior in 48PG compared with 72PG (74.3 v. 42.9%; P , 0.05). However, the rate of 2 blastomeres and absence of multiple fragments were not different between 48PG and 72PG. The number of BL tended to decrease in 72PG compared with 48PG (28.6 v. 48.6%; P ¼ 0.087). These results indicate that duration of FG did not affect the rate of cleavage and BL formation. However, extension of duration of FG might reduce the quality of BL.

236

EFFECT OF CYCLIC ADENOSINE MONOPHOSPHATE MODULATOR REGULATORS IN ASSOCIATION WITH BMP15 ON BOVINE EMBRYO DEVELOPMENT IN VITRO

M. F. MachadoA, M. F. G. NogueiraB, R. B. GilchristD, M. L. Sutton-McDowall C, D. G. MottersheadE, M. A. WhiteC, and J. G. ThompsonC A

UNESP, Botucatu, Sao Paulo, Brazil; B UNESP, Assis, Sao Paulo, Brazil; C University of Adelaide, Adelaide, South Australia, Australia; D University of New South Wales, Sydney, New South Wales, Australia; E University of Helsinki, Helsinki, Finland BMP15 is a promising peptide to improve oocyte competence; also, addition of cyclic adenosine monophosphate modulator (cAMP) regulators prevents spontaneous maturation in vitro and promotes embryo development. We aimed to assess embryo development after prematuration [prein vitro maturation (IVM)] with IBMX and Forskolin (FSK) and maturation in the presence or absence of a purified pro mature region of BMP15. Immature cumulus-oocyte complexes (COC) were cultured in vitroMat (IVF Vet Solutions, Adelaide, Australia) plus 4 mg mL1 fatty acid free-BSA and rhFSH (0.1 IU mL1), then divided into the following treatment groups: 1) spontaneous IVM: 24 h of IVM; 2) spontaneous IVM þ BMP15: 24 h of IVM in the presence of BMP15 (100 ng mL1); 3) Pre 2 h: pretreatment with IBMX (500 mM; Sigma-Aldrich) and FSK (100 mM; Sigma-Aldrich) for 2 h following 24 h maturation; and 4) Pre 2 h þ BMP15: pretreatment with IBMX and FSK for 2 h following 24 h maturation in the presence of BMP15 (100 ng mL1). After maturation, oocytes were inseminated and zygotes were cultured for 5 days in VitroCleave (IVF Vet Solutions, Adelaide, Australia) and transferred into VitroBlast (IVF Vet Solutions, Adelaide, Australia) until blastocyst assessment (Days 7 and 8). Zona-intact embryos were retrieved to assess differential staining of trophectoderm and inner cell mass. Data were transformed into a logarithm and analysed by 1-way ANOVA and post hoc least significant difference using SigmaStat software (SPSS Inc., San Jose, CA, USA; P , 0.05). There was no difference among groups on cleavage rates or blastocyst rates at Day 7; however, both Pre 2 h treatments increase hatched blastocyst rates at Day 8 of embryo development (Table 1). Supplementation with BMP15 increased total blastocyst rates at Day 8, regardless of pretreatment with IBMXþFSK (Table 1). Our data demonstrate that embryos from oocytes matured in the presence

208


IVF/IVP

of BMP15 or pretreated with IBMXþFSK increase trophectoderm and total cell numbers; however, no differences were observed for inner cell mass. We conclude that Pre 2 h treatment or BMP15 increase embryo development; however, no effect of cAMP regulators in association with BMP15 on embryo development was observed. Table 1. Embryo development Treatment Control (BMP15) Control (þBMP15) Pre 2 h (BMP15) Pre 2 h (þBMP15)

% Cleavage rate

% Blastocyst/cleaved (Day 7)

% Blastocyst/cleaved (Day 8)

% Hatching/blastocyst (Day 8)

72.3 10.8 78.8 13.21 81.6 5.60 80.8 11.16

20.8 5.88 27.1 6.59 23.2 6.22 20.2 2.24

21.4 3.03 27.5 1.41 25.5 2.26 28.1 2.68

7.2 6.62 19.6 6.26 30.2 11.1 33.1 13.58

Supported by FAPESP (project numbers: 2012/1073-8; 2013/12960-9; 2013/05083-1; 2012/50533-2).

237 THE EFFECTS OF BULLS AND X-SORTING OF SPERM ON THE ACCURACY OF NONINVASIVE CRITERIA TO PREDICT BLASTOCYST FORMATION OF IN VITRO-PRODUCED BOVINE EMBRYOS S. MatobaA, T. SomfaiA, T. NagaiA,B, and M. GeshiA A

NARO Institute of Livestock and Grassland Science, Tsukuba, Ibaraki, Japan; B Food and Fertilizer Technology Center (FFTC), Taipei, Taiwan

Previously, an early first cleavage and a second cleavage after IVF with a normal cleavage pattern defined by even blastomeres without fragments or protrusions was found to be a potent marker for the selection of embryos with high developmental competence (Sugimura et al. 2012 PLoS ONE 7, e36627). The aim of this study was to investigate the effects of bulls and X-sorting of sperm on the ability of these simple noninvasive markers to predict the potency of bovine IVF embryos to develop to the blastocyst stage in vitro. Immature oocytes were matured in TCM199 supplemented with 0.02 armour unit mL1 FSH and 5% calf serum at 38.58C in 5% CO2 and 95% air for 22 to 23 h. After maturation, oocytes were inseminated with either of non-sorted frozen-thawed sperm from 3 bulls (A–C) or X-sorted sperm of bull A. Putative zygotes were cultured (IVC) in CR1aa medium supplemented with 5% calf serum and 0.25 mg mL1 linoleic acid albumin at 38.58C in 5% CO2, 5% O2, and 90% N2 for 216 h. Embryo kinetics were observed individually by time-lapse cinematography (CCM-1.3Z; Astec, Fukuoka, Japan; Sugimura et al. 2010 Biol. Reprod. 83, 970–978). First and second cleavage kinetics and pattern were categorized according to Sugimura et al. (2012). For each bull, blastocyst development from embryos possessing the following 3 selection markers was compared: (marker 1) the first cleavage within 28 h after IVF, (marker 2) marker 1 combined with 2 even blastomeres without fragments or protrusions, and (marker 3) marker 2 combined with the second cleavage within 50 h after IVF with $6 even blastomeres without fragments or protrusions, respectively. Data were analysed by the Yates’ corrected chi-square test. A total of 823 oocytes were used in at least 3 replications. When non-sorted sperm was used for IVF, there was not difference (P . 0.05) in total blastocyst formation rates on Day 8 (Day 0 ¼ IVF) among bulls (ranging between 49.5 and 60.8%); however, blastocyst formation rate of embryos generated from X-sorted sperm of bull A (39.5%) was lower (P , 0.05) compared with other groups despite of similar cleavage rates. Embryos having marker 3 criteria developed to the blastocysts stage at significantly higher rates than those having marker 1 criteria in case of non-sorted sperm of bulls A, B, C, and X-sorted sperm of bull A (75.9, 87.0, 90.0, and 75.0% v. 59.5, 62.2, 63.6, and 46.3%, respectively). In groups produced from non-sorted sperm of bulls A, B, C, and X-sorted sperm of bull A, blastocyst development rates of embryos with marker 2 criteria (73.7, 75.0, 90.0, and 65.8%, respectively) were higher (P , 0.05) than those of embryos having marker 1 criteria but did not differ significantly from those with marker 3 criteria. Our results reveal that a first cleavage within 28 h after IVF to 2 even blastomeres without fragments or protrusions are potent predictive markers of the developmental competence of bovine embryos to the blastocyst stage regardless of bulls and sperm sorting. Research was partly supported by JSPS KAKENHI (26450388).

238 THE ROLE OF PHOSPHODIESTERASE (PDE) 5A AS MEDIATOR OF LIPOLYSIS IN BOVINE OOCYTES AND ITS EFFECT ON THE DEVELOPMENT AND LIPID CONTENT OF EMBRYOS PRODUCED IN VITRO K. R. L. SchwarzA, P. R. AdonaC, R. C. BotigelliA, M. Del ColladoA, C. EliasA, M. R. ChiarattiB, F. C. CastroA, M. C. R. V. CunhaA, and C. L. V. LealA A

Faculdade de Zootecnia e Engenharia de Alimentos, Faculdade de Zootecnia e Engenharia de Alimentos, Pirassununga/SP, Brazil; B Universidade Federal de Saõ Carlos, Universidade Federal de Saõ Carlos, Saõ Carlos/SP, Brazil; C Universidade do Norte do Parana´, Universidade do Norte do Parana´, Londrina/PR, Brazil

Intracellular levels of cyclic adenosine monophosphate modulators (cAMP) and cGMP, in adipocytes, are important for the regulation of the lipolysis rate. The phosphodiesterases (PDE) control cGMP and cAMP levels by degradation. Different PDE isoforms are expressed in bovine oocytes and cumulus cells. Previously, we found that using an inhibitor of PDE5A (sildenafil, SILD) increased cGMP levels in bovine oocytes during in vitro

IVF/IVP


209

maturation (IVM). In the current study we investigated if inhibition of PDE5A during maturation reduces the lipid content in IVF embryos. For this, oocytes were cultured for 24 h in maturation medium with 10% FCS and 107 M SILD (treatment I), 10% FCS (treatment II) and 0.4% BSA (control; N 160 COC/groups submit to IVF). After COC were in vitro fertilized, cleavage (Day 4) and blastocyst rates (Day 7) were measured. Blastocysts were stained with Nile Red (1 mg mL1) for lipid content quantification, by mean fluorescence intensity per mm2, measured in the ImageJ program (fluorescence intensity, f.i.). Four replicates were transformed to log10 and subjected to statistical analysis using the SAS system (SAS Institute Inc., Cary, NC, USA) by ANOVA followed by Tukey test with a significance level of 5%. No difference in cleavage (Day 4) and blastocyst (Day 7) rates were observed in all groups (82 and 41.9%, respectively), showing that presence of FCS, SILD, or both in IVM medium did not affect embryo development. Treatment I had higher lipid content (40.35 f.i.) than treatment II (31.12 f.i.), which in turn was also superior to control (22.31 f.i.). According to the results, the presence of FCS in IVM media generates embryos with higher lipid content, and association of FCS and SIL further increased lipid content. Although inhibition of PDE5 increases cGMP levels and leads to higher lipolysis, such an effect was not observed when SIL was used as the PDE5 inhibitor. Reasons for such findings are still unclear, but a possibility would be the activation of a negative feedback mechanism by the increased cGMP generated by SIL, because this nucleotide activates PKG, which in turn inhibits cGMP synthesis by guanylate cyclase. During development the lower cGMP levels could reduce lipolysis, resulting in increased lipid accumulation in embryos. Further studies are needed to address this possibility.

239

USE OF CYCLIC ADENOSINE MONOPHOSPHATE MODULATORS IN IN VITRO PRODUCTION OF BOVINE EMBRYOS T. Fanti, N. M. Ortega, R. Garaguso, M. J. Franco, C. Herrera, and A. A. Mutto Instituto de Investigaciones Biotecnolo´gicas (IIB-INTECH), San Martıń, Buenos Aires, Argentina

In vitro embryo production systems (IVP) try to emulate and enhance molecular events that occur in in vivo reproductive systems in order to increase, not only the number of embryos generated, but also their quality. Despite advances, IVP processes are still inefficient compared with in vivo systems. Several studies have attributed this deficiency to a lack of oocyte competence due to spontaneous premature resumption of meiotic maturation in the oocyte following the removal from its follicular environment. Therefore, our objective was to increase oocyte competence avoiding premature resumption of meiosis by using cyclic adenosine monophosphate modulators. Cumulus-oocyte complexes (COC) were obtained from ovaries of slaughterhouses, washed, and randomly allocated in 2 culture systems. Oocytes in the control group (IVM) were cultured for a period of 24 h in basal medium TCM-199 with EGF (1 mg mL1) supplemented with rhFSH (25 mIU mL1). Oocytes in the biphasic in vitro maturation (b-IVM) group were cultured for 2 h in a basal medium supplemented with a phosphodiesterase inhibitor, 3-isobutyl-1-methylxanthine (IBMX, 500 mM), and an activator of adenylate cyclase (forskolin, 100 mM). Subsequently, COC were washed and cultured in basal medium supplemented with cilostamide (20 mM) and rhFSH (25 mIU mL1) for 24 h. Maturation rates were analysed and IVF was performed with a dose of 1 106 sperm cells mL1 in IVF-SOF medium. The presumptive zygotes were cultured in continuous-single-culture medium (Irvine) supplemented with 8 mg mL1 of BSA until they reached the blastocyst stage. No significant differences in maturation, cleavage, and cryotolerance were observed between b-IVM and IVM groups (P . 0.05; Table 1). This study showed that b-IVM produced a significant increase in IVP compared with the control (IVM) at Days 7 and 8 (P , 0.01). Blastocyst hatching rate was significant (P , 0.05) for both treatment and day of analysis. The b-IVM group yielded an increase of 10 and 7.5% at Days 7 and 8, respectively, of IVP. The biphasic maturation showed an improvement in quality regarding the control group, in the timing analysis of production, and hatching percentages, and these results show that the use of cyclic adenosine monophosphate modulators in the oocyte maturation process enhances oocyte competence, which is reflected in increased productivity and embryo quality. We propose this treatment as an alternative to the standard protocols currently used in IVP of bovine embryos. Table 1. Effect of treatment on maturation, cleavage, and cryotolerance Treatment

IVM (control) b-IVM

Maturation

Day 2

Mll oocytes (%)

Cleavage (%)

Blastocysts (%)

Hatched blastocysts (%)

Blastocysts (%)

Hatched blastocysts (%)

24 h

48 h

192/255 (76.50) 187/250 (74.80)

254/321 (79.55) 209/289 (72.00)

53/254 (21.0) 65/209 (31.0)

4/53 (7.0) 13/65 (20.0)

60/246 (24.50) 67/209 (32.05)

16/60 (27.00) 27/67 (40.00)

27/35 (77.15) 12/16 (75.00)

16/35 (45.70) 12/16 (75.00)

240

Day 7

Day 8

Cryotolerance (%)

OVUM-PICK UP IN HOLSTEIN-FRIESIAN COWS AT 9 TO 10 MONTHS OF AGE E. Mullaart, F. Dotinga, H. Flapper, A. van de Brink, N. Pietersma, and J. Schouten CRV, CRV BV, Arnhem, the Netherlands

Rate of genetic gain can be improved by increasing selection intensity, increasing selection accuracy, creating a higher amount of variation, or shortening the generation interval. A reduction in the generation interval can be realised by collecting embryos from animals at a young age. At CRV it is currently routine practice to start embryo collection (by flushing) at 12 to 15 months of age. The aim of this study was to investigate if the

210


IVF/IVP

collection of embryos at a younger age by means of ovum pickup (OPU) is beneficial for our breeding program. Healthy 9- to 10-month-old HolsteinFriesian animals were selected at young age based on their maturity, (i.e. OPU could be performed by normal standard procedure/equipment). Animals were not stimulated with hormones. Oocytes were collected by OPU once every week during a period of ,8 weeks. Collected oocytes were matured, fertilized, and cultured for 7 days in SOF culture medium according to standard procedures (Merton et al. 2002). Embryo development was scored at Day 7. Results were analysed by Student’s t-test. On average 11.7 oocytes were collected from animals as young as 9 months of age. However, embryo development of the oocytes from young animals was only 0.4 embryo per session at Day 7 (3% embryo development). When only the results of the first OPU session were taken into account, 18.2 oocytes and 0.8 embryo could be collected per animal per session. Whether an animal was observed in oestrus before the first OPU session affected results. Animals that had shown clear signs of oestrus before the first OPU session produced significantly more embryos than animals that did not (Table 1). It is concluded that OPU is possible on animals at 9 to 10 months of age but only when animals have been in oestrus before the first OPU session. Best results were obtained for the first OPU session. Table 1. Effect of first oestrus before OPU on embryo production Oestrus No Yes

No. of animals

No. of embryos (total)

Mean no. of embryos per animal

24 11

5 23

0.2a 2.1b

Values in columns with different superscripts are significantly different, P , 0.05.

a,b

241

EFFECT OF PRODUCTION EFFICIENCY IN THE LIKELIHOOD OF PREGNANCY OF IN VITRO-DERIVED BOVINE EMBRYOS L. F. FeresA, L. S. A. CamargoB, M. P. PalhaoC, F. Z. BrandaoA, and J. H. M. VianaB,C A

Universidade Federal Fluminense, Niteroi, RJ, Brazil; B Embrapa, Juiz de Fora, MG, Brazil; C Universidade de Alfenas, Alfenas, MG, Brazil

Improving in vitro culture systems to optimize embryo yield has been a major research goal. The relationship between the efficiency of embryo production systems and the pregnancy outcomes, however, remain controversial. The aim of the present study was to evaluate the likelihood of pregnancy of in vitro-produced embryos derived from batches with different relative efficiency indexes. Data of 702 ovum pick-up (OPU) and in vitro embryo production (IVEP) sessions, and of 2456 embryo transfers, recorded from 2008 to 2012, were evaluated. All donors were from the same herd, and were of the same breed (Gir, Bos indicus), as well as the semen used for IVF. The cumulus-oocycte complex (COC) recovery and IVEP were performed by the same team, in a single IVF laboratory, and using standard medium and procedures. Only data from embryos transferred as fresh were used, and records from 97 OPU/IVEP sessions in which no embryo was produced, or embryos were frozen or discharged due to lack of recipients, were discharged. The remaining 605 sessions were stratified in quartiles (I to IV, each one corresponding to 25% of total data) according to COC production of the donors, or stratified in ranges (0–25%, 26–50%, 51–75%, and 76–100%) according to COC quality (percentage of viable COC or of grade I COC) and to embryo production efficiency endpoints (cleavage rate, blastocyst rate). Pregnancy rates were compared among quartiles or ranges by the chi-square method. On average, the Gir donors produced 24.8 0.6 COC per OPU, from which 14.4 0.4 were classified as viable (57.8%), and 3.2 0.1 as grade I (12.9%). On average 6.1 0.2 embryos (morulas and blastocysts) were produced per OPU per donor, and mean pregnancy rate was 30.9%. As expected, donors with greater total COC yield (quartile I) also produced more viable oocytes (25.5 0.7 v. 15.7 0.3, 10.5 0.2 and 5.8 0.2), more COC grade I (4.8 0.4 v. 3.9 0.3, 2.6 0.2 and 1.6 0.1), and more embryos (9.0 0.4 v. 6.9 0.3, 5.0 0.2 and 3.3 0.1) than donors from quartiles II, III, or IV, respectively (P , 0.0001). Nevertheless, there was no difference (P . 0.05) in pregnancy rates for embryos produced from donors ranked in the different quartiles (30.9 v. 29.3, 31.5, and 30.5% for quartiles I to IV, respectively). Similarly, there was no difference (P . 0.05) in the pregnancy rate of embryos derived from OPU sessions in which there was a high or low percentage of viable or grade I COC. In vitro production efficiency (cleavage and blastocyst rates) also had no effect (P . 0.05) on further pregnancy rates. In conclusion, these results suggest that there is no relationship among the average number or quality of the COC recovered by OPU, the efficiency of IVEP, and the likelihood of pregnancy of in vitro-derived embryos. Research was supported by Fazendas do Basa, CNPq, and Fapemig.

242 PROMISING TWO-STEP EVALUATION SYSTEM FOR SELECTING HIGH DEVELOPMENTAL COMPETENCE IN VITRO FERTILIZED EMBRYOS IN CATTLE USING WELL-OF-THE-WELL DISH M. Taniai, M. Takayama, O. Dochi, and K. Imai Department of Dairy Science, Rakuno Gakuen University, Ebetsu, Hokkaido, Japan Bovine IVF embryos are evaluated morphologically using light microscopy just before transfer. However, this evaluation method is subjective, and an objective method with more certainty is needed. Sugimura et al. (PLoS ONE 2012 7, e36627) reported a promising system for selecting healthy IVF bovine embryo by using time-lapse cinematography and 5 prognostic factors. This study was to investigate the efficacy of a 2-step evaluation system of IVF embryos using microscopy for selecting high developmental competence IVF embryos. Cumulus-oocyte complexes (COC) were

IVF/IVP


211

collected by ovarian follicular aspiration (2 to 5 mm diameter) obtained from a local abattoir. The COC (n ¼ 488) were matured in TCM-199 medium supplemented with 5% calf serum (CS) and 0.02 IU mL1 of FSH at 38.58C for 20 h in an atmosphere of 5% CO2 (20 COC 100 mL1 droplets). After 10 h of gametes co-culture (5.0 106 sperm cells mL1), the presumptive zygotes were cultured in 125 mL of CR1 aa medium supplemented with 5% CS in well of-the-well culture dishes (AS ONE, Japan; 25 zygotes well1) at 38.58C in an atmosphere of 5% CO2, 5% O2, and 90% N2 for 9 days. Twostep evaluations of embryos were done at 27 and 55 h post-IVF (hpi). In the first step of evaluation, cleavage patterns at 27 hpi were categorized as mono-cell, 2-cell with even blastomeres and without fragments (normal cleavage), 2-cell with uneven blastomeres, and $3 blastomeres. During the second step of evaluation, embryos were classified by their number of blastomeres (2 to 5 cells, 6 to 8 cells, and .8 cells) and the absence or presence of multiple fragments (,20 or .20%) at 55 hpi. The data were analysed by chi-square test. The blastocyst rate (BL%) of embryos cleaved before 27 hpi (56.6%, n ¼ 106) was higher (P , 0.01) than those of embryos cleaved after 27 hpi (37.0%, n ¼ 235). A greater percentage (P , 0.05) of 2-cell embryos with normal cleavage (68.0%, n ¼ 50) developed to blastocysts than from with =3 blastomeres at 27 hpi (40.6%, n ¼ 32). Superior BL% (P , 0.01) was obtained from embryos categorized as 6- to 8-cell stage (58.6%, n ¼ 140) and .8 cell stage (70.6%, n ¼ 25) compared with those embryos at the 2- to 5-cell stage at 55 hpi (26.1%, n ¼ 176). Embryos with no fragments (58.0%, n ¼ 467) had higher BL% (P , 0.01) compared with those with ,20% fragments (30.7%, n ¼ 127) and having with .20% fragments (17.5%, n ¼ 25) at 55 hpi. The highest of BL% was observed in embryos showing a normal cleavage to 2-cells with at 27 hpi and having .6 cells with no fragments at 55 hpi (95.2%, n ¼ 21, P , 0.01). These results demonstrate that the 2-step evaluation system at 27 and 55 hpi using microscopy is an effective method for selecting IVF embryos with high developmental competence.

243

THE SEX OF THE BOVINE EMBRYO AFFECTS APOPTOTIC RATES AT THE BLASTOCYST STAGE E. Ghys, D. De Troy, and I. Donnay Universite´ Catholique de Louvain, Louvain-la-Neuve, Belgium

Male and female pre-implantation bovine embryos may differ in several aspects such as kinetics of development, metabolism, or gene expression. These differences vary between culture conditions and may lead to shifts in sex ratio. In a previous study, we showed that female Day 7 blastocysts display a higher apoptotic rate than male ones when cultured in the presence of 5% FCS (Ghys et al. 2013 Reprod. Fertil. Dev. 25, 194). The difference was less important in the presence of BSA. This previous study was performed on in vitro-produced embryos produced with sexed semen and analysed using confocal microscopy. The objective of the present work is to confirm these differences using a) first, the unsexed semen of the same bull (bull 1) as the one used in the previous study in order to exclude any potential bias induced by the use of sexed semen and b) second, the unsexed semen of another bull (bull 2) in order to generalise our findings to the Bos taurus species. Levels of apoptosis were assessed in Day 7 blastocysts using immunohistochemical staining of cleaved caspase-3 and detection of fragmented DNA by TUNEL reaction on Day-7 blastocysts cultured with 5% FCS. Quantification of the number of stained cells was achieved with a fluorescence microscope. After cell counting, embryos were recovered and sexed by PCR. In both experiments, a higher proportion of cells showing caspase staining was observed in female (n ¼ 145) than in male (n ¼ 215) embryos (Bull 1: male: 11.8 0.6%; female: 17.6 1.1%, 2-way ANOVA, P # 0.0001; bull 2: male: 9.5 0.4%; female: 13.3 0.6%, P # 0.0001), whereas the proportion of TUNEL-stained cells was only significantly higher in female embryos produced with the semen of bull 2 (bull 1: male: 10.8 0.4%; female: 11.4 0.6%, P ¼ 0.12; bull 2: male: 7.2 0.3%; female: 9.1 0.4%, P ¼ 0.0009). A significant difference in cell number was observed between male and female blastocysts produced with the semen of bull 2 (male: 172 5; female: 154 5, P ¼ 0.02) and the same tendency was observed for embryos generated with the semen of bull 1 (male: 143 4; female: 132 4, P ¼ 0.07). In conclusion, our study demonstrated that the use of sexed semen does not interfere with the pattern of caspase and TUNEL staining previously observed. Moreover, a similar pattern was observed with 2 different bulls. We can thus conclude that the level of apoptosis of bovine Day 7 blastocysts produced in the presence of FCS is higher in female than male embryos. This could be related to the tendency towards a lower cell number in female blastocysts and to the shift in sex ratio in favour of male embryos often observed in the presence of serum.

244

IN VITRO EMBRYO PRODUCTION WITH CONVENTIONAL OR Y-SEXED SEMEN IN BEEF CATTLE H. E. TribuloA,C, J. CarcedoA,C, R. J. TribuloA,C, B. BernalA,C, J. GarzonA,C, A. TribuloA,C, and G. A. BoÁ,B A Facultad de Ciencias Agropecuarias, Universidad Nacional de Cordoba, Argentina; Instituto A.P. de Ciencias Basicas y Aplicadas, Universidad Nacional de Villa Maria, Cordoba, Argentina; C Instituto de Reproduccion Animal Cordoba (IRAC), Cordoba, Argentina

B

An experiment was designed to evaluate in vitro embryo production following the use of frozen-thawed conventional or Y-sexed semen from a single Brangus and a single Braford bull of proven fertility. Semen was obtained by splitting the same ejaculate to be frozen directly or sex-sorted and then frozen. Oocytes were obtained from 69 ultrasound-guided follicle aspiration (ovum pickup) sessions performed at random stages of the oestrous cycle without superstimulation in 24 Brangus and 10 Braford cows and heifers. Viable oocytes (n ¼ 1120) were matured in TCM-199 medium with NaHCO3 and supplemented with 1% fetal bovine serum. Frozen-thawed sperm from the Brangus and Braford bulls were selected with Percoll for IVF, capacitated in Fert Medium, and used at a final concentration of sperm per milliliter for conventional (non-sexed) semen and 2 106 sperm mL1 for Y-sexed semen. After 16 h (sexed) or 18 h (conventional) of co-incubation with oocytes in Fert Medium, presumptive zygotes were denuded and cultured in SOF supplemented with 0.4% BSA under oil at 378C, 5% CO2, and saturated humidity for 7 days. The total number of oocytes matured and fertilized from the Brangus donors was 538 and 318 for conventional and sexed semen, respectively. The total numbers of oocytes matured and fertilized from the Braford donors were 139 and 125 for conventional and sexed semen, respectively. Data were compared by ANOVA for mixed models, using breed and type of semen as fixed variables and cow (i.d.) as a random variable. Cleavage and blastocyst rates were first transformed by square root and then analysed by ANOVA for mixed models. Mean ( s.e.m.) number of total viable

212


IVF/IVP

oocytes collected, cleaved zygotes, and blastocysts produced per ovum pickup session did not differ (P ¼ 0.18) between breeds (Brangus: 17.1 1.6, 10.0 0.9, and 6.2 0.7 v. Braford: 13.9 2.8, 7.6 1.5, and 4.0 0.8), and there was no breed semen interaction on the mean number of cleaved zygotes and blastocysts produced. However, the mean ( s.e.m.) number of cleaved zygotes and blastocysts produced was significantly higher (P , 0.05) when the oocytes were fertilized with conventional semen (10.7 1.2 and 6.5 0.8) than with sexed semen (7.7 0.7 and 4.3 0.6). The mean cleavage rate was also significantly higher (P , 0.05) when the oocytes were fertilized with conventional semen (76.8 3.9) than with sexed semen (54.1 4.2). Blastocyst rate tended to be higher (P ¼ 0.1) with conventional semen (40.5 3.3) than with sexed semen (33.6 4.2). Although in vitro production may be the preferred alternative for the production of embryos of a known sex, the number of blastocysts produced might be reduced as compared with the use of non-sexed semen from the same bull.

245

EFFECTS OF GYR (BOS TAURUS INDICUS) DONOR MITOCHONDRIAL DNA AND OVUM PICKUP ORDER ON IN VITRO EMBRYO PRODUCTION T. L. C. PintoA, B. C. LopesB, M. B. D. FerreiraB, T. M. GoncalvesA, J. C. SouzaA, and J. M. GarciaC A UFLA, Lavras, MG, Brazil; EPAMIG, Uberaba, MG, Brazil; C UNESP, Jaboticabal, SP, Brazil

B

Ovum pick (OPU) up is a technique upon which in vitro embryo production (IVP) depends. It permits donor cow maternal ancestry to be assessed by mtDNA analysis. Repetitive ablation of follicles is thought to interfere with the donor cow endocrine profile and influence embryo yield. The objective was to evaluate the effects of mtDNA and OPU order on IVP fertility traits. Gyr donors (85) were submitted to 363 OPU sessions (5 OPU sessions/ donor). Donor mtDNA was extracted from leukocytes and sorted by the presence of the HindIII restriction site within the amplified region, indicative of Bos taurus taurus mtDNA (Paneto et al. 2008 Genet. Mol. Res. 7, 592). All animals in the donor pedigree were classified, and the population was divided into two groups according to their maternal genetic grouping: Bos taurus indicus and Bos taurus taurus. For statistical analyses, data from 5 OPU sessions per each donor were submitted to the mixed model procedure of SASÒ (SAS Institute Inc., Cary, NC, USA), using the lowest Akaike value to determine the best covariance structure between repeated OPU session results. The model included the effect of OPU session order (1–5) and mtDNA-based maternal grouping (Bos taurus v. Bos indicus) as independent variables. Total and viable oocytes, as well as blastocyst yield per OPU session, were the dependent variables studied. The means of total and viable oocytes and blastocysts produced per donor per OPU were compared by the Tukey test, at 5% significance. The combined OPU sessions resulted in 6084 oocytes, 2537 embryos, which produced 1105 pregnancies. Mean numbers (n ¼ 42 donors/OPU session) of total and viable oocytes between OPU sessions 1 (31.9 4.6 and 19.2 2.9), 2 (35.3 3.5 and 21.2 2.2), 3 (28.9 3.7 and 19.3 2.4), 4 (25.0 5.2 and 18.9 33), and 5 (20.5 6.3 and 13.8 4.0) did not differ. Mean blastocyst production after IVP between OPU sessions 1 (6.5 1.4), 2 (5.15 1.04), 3 (5.5 1.1), 4 (5.8 1.6), and 5 (5.2 1.9) was similar. Mean viable oocyte number was greater (P , 0.0001) for B. t. taurus (21.7 1.4, n ¼ 192 OPU sessions) compared with B. t. indicus (16.1 0.9, n ¼ 138 OPU sessions) maternal genetic groupings. However, in vitro blastocyst yields were similar (P ¼ 0.23) between maternal genetic groupings (7.3 1.6 and 6.2 1.4 for B. taurus and B. indicus, respectively). In conclusion, repeated OPU sessions did not reduce oocyte and embryo yields as expected. Maternal B. taurus genetic origin was associated with higher oocyte quality, although it was not translated into higher embryo yields after in vitro culture. Results warrant further research, which may result in additional selection criteria for OPU Gyr donors considering their maternal genetic background.

246

USE OF IONOPHORE A23187 ON BOVINE FROZEN SPERM INCREASES HYPERACTIVATED MOTILITY R. Garaguso, M. J. Franco, N. M. Ortega, T. Fanti, and A. A. Mutto

Instituto de Investigaciones Biotecnolo´gicas, IIB-INTECH-CONICET, Universidad Nacional de General San Martıń, Buenos Aires, Argentina Sperm capacitation is critical for oocyte fertilization in mammals. The capacitated state is acquired by the spermatozoon during its passage through the female reproductive tract and can be induced in vitro. At a functional level, sperm capacitation is associated with changes in the motility pattern – the hyperactivated state (HA) – and terminates with the acrosome reaction (AR). These events are characteristically regulated by different Ca2þ-signalling pathways. For this reason, Ca2þ ionophores, such as A23187, are commonly used in sperm capacitation studies. The induction of AR and IVF, as well as the assessment of protein phosporylation of tyrosine substrates are useful methods for the evaluation of the capacitation state of spermatozoa. Although the increase of protein tyrosine phosphorylation via PKA is associated with sperm capacitation, in the mouse, A23187 capacitates the spermatozoa, thus bypassing this pathway. The aim of the present work was to test the effect of the ionophore A23187 on acquisition of the capacitated state by evaluation of HA motility and protein phosphorylation pattern in frozen bovine spermatozoa. Motile bovine spermatozoa were isolated by gradient centrifugation (Percoll) from frozen/thawed samples and treated with different concentrations of A23187 (0.05, 0.1, 0.2, and 0.3 mM) in H-TYH medium without BSA. After 10 min of treatment, spermatozoa were washed in medium with BSA (11.2%) and incubated in H-TYH with BSA (6%) for 30 min. For control groups, sperm were incubated in H-TYH medium and DMSO. The motility pattern was visually identified and quantified using a computer-assisted sperm analysis system. The motile/immotile spermatozoa and the HA motility patterns of each group were statistically analysed by applying Fisher’s tests. The protein tyrosine phosphorylation pattern was evaluated by a Western immunoblotting assay using heparin as a positive control of sperm capacitation. Our results showed that spermatozoa treated with A23187 had a significant increase in HA motility. The proportions of HA spermatozoa were 10.92, 31.27, and 75.4% for 0.1, 0.2, and 0.3 mM A23187, respectively (P , 0.05). On the other hand, the pattern of PKA-tyrosine phoshorylation characteristic of capacitated spermatozoa was absent after incubation with A23187, similar to the response seen in mouse spermatozoa. The percentage of motile spermatozoa in the control groups (H-TYH medium: 36% and DMSO: 27.95%; P , 0.05) was reduced as compared with that of the basal sperm suspension (65.4%, P , 0.05) after 30 to 40 min of incubation.

IVF/IVP


213

Motility in the spermatozoa treated with 0.1 and 0.2 mM ionophore was similar – 65.9 and 68.1%, respectively, but it was reduced in the 0.3 group – 57.5% (P , 0.05). Thus, treatment with A23187 increased the percentage of spermatozoa with HA motility, probably suggesting an improvement in fertilizing capacity. Nevertheless, these promising results remain to be confirmed by IVF assay.

247 EFFECTS OF SILDENAFIL OR SNAP SUPPLEMENTATION, OR BOTH, DURING IN VITRO MATURATION ON LIPID AND REACTIVE OXYGEN SPECIES ACCUMULATION IN BOVINE OOCYTES AND EMBRYOS M. Del ColladoA, R. C. BotigelliA, K. R. L. SchwarzA, C. EliasA, C. L. V. LealA, A. F. C. AndradeB, and F. PerecinA A

Faculdade de Zootecnia e Engenharia de Alimentos–FZEA/USP, Pirassununga, SP, Brazil; B Faculdade de Medicina Veterina´ria e Zootecnia–FMVZ/USP, Pirassununga, SP, Brazil

Previous studies have demonstrated that a nitric oxide (NO) donor (S-nitroso-N-acetylpenicillmaine, SNAP) and a phosphodiesterase inhibitor (Sildenafil, SILD) delay the meiotic resumption of oocytes removed from the follicular environment, and therefore could be used to improve the quality of in vitro-matured (IVM) oocytes. However, it has been reported that SILD-treated cells have increased lipid metabolism and that NO supplementation can modulate the oxidative stress. This study aims to determine the effects of SNAP or SILD supplementation, or both, during IVM on embryo developmental rates, on lipid accumulation of IVM oocytes and on reactive oxygen species (ROS) and lipid accumulation of embryos derived from IVM oocytes. Bovine oocytes were cultured in TCM199 containing 1.0 mg mL1 of FSH, 50 mg mL1 of hCG, 1.0 mg mL1 of oestradiol, 0.2 mM pyruvate, 83.4 mg mL1 of amikacin, 10% FBS (control group; GCONT), supplemented with 10 mM SILD (GSILD), 0.1 mM SNAP (GSNAP) or both (GSþS). After 24 h of IVM, matured oocytes were assessed for lipid quantification (approximately 49 per group) or used for in vitro embryo production (IVP; approximately 340 oocytes per group). For lipid quantification, denuded oocytes were fixed with 5% triton in 4% paraformaldehyde (PFA) for 30 min and stained with 1 ng mL1 of Nile Red for 30 min. Embryo lipid analyses (approximately 55 per group) were performed as described for oocytes. For ROS assessment (approximately 58 per group), IVP embryos were stained with 10 mM of H2DFFDA for 1 h and fixed for 30 min in 4% PFA. Stained oocyte and embryo assessments were performed on epifluorescence microscopy, and captured images were analysed on ImageJ (NIH, Bethesda, MD, USA) to quantify the fluorescence intensity (f.i). Statistical analyses were performed with data from 3 replicates for oocytes and 4 for embryos: statistical differences were assessed for lipid and ROS quantity and development rates by split-plot ANOVA. Variables considered in the model were SNAP (presence/absence) and SILD (presence/absence). Means were compared by Student’s t at P , 0.05. Regarding oocyte lipid accumulation, groups with SILD (GSILD and GSþS) presented higher lipid quantity (f.i: 52.11 and 47.24, respectively) compared with GCONT and GSNAP (f.i: 38.86 and 41.86, respectively). Supplementation during IVM did not affect development rates (cleavage of 88.1, 88.2, 88.8, and 89.5% and blastocyst rates of 41.2, 38.6, 40, and 41.2% for GCONT, GSNAP, GSILD, and GSþS, respectively). Regarding embryo lipid quantity, similar to oocyte results, SILD groups (GSILD and GSþS) presented higher lipid accumulation (f.i: 68.9 and 68.5, respectively) compared with GCONT (f.i: 55.8) and GSNAP (f.i: 58.9). Considering embryo ROS quantity, GCONT (f.i: 35.9) and GSþS (f.i: 34.2) had the highest levels; however, GSþS did not differ from GSNAP (f.i: 32.85), which was similar to GSILD (f.i: 30.4). In conclusion, SILD had a negative effect on lipid accumulation, which could be due to increased lipid synthesis without increasing lipid oxidation because no increase of embryo ROS levels was observed.

248

IN VITRO EMBRYO PRODUCTION USING IN VIVO-MATURED OOCYTES COLLECTED TRANSVAGINALLY FROM WOOD BISON (BISON BISON ATHABASCAE )

M. P. CervantesA, J. M. PalominoA, M. AnzarA,B, R. J. MapletoftA, G. MastromonacoC, and G. P. AdamsA B

A University of Saskatchewan, Saskatoon, Canada; Agriculture and Agri-Food Canada, Saskatoon, SK, Canada; C Toronto Zoo, Ontario, Canada

Reproductive technologies are being developed to help conserve the genetic diversity of wood bison, a threatened species. To date, the efficiency of in vitro embryo production in bison is very low and appears to be related to inadequate in vitro conditions for oocyte maturation. Recently, we have attempted to circumvent the problem by inducing oocyte maturation in vivo and found that more than one-third of superstimulated oocytes collected 30 h after administration of hCG were at metaphase II (Cervantes et al. 2013 Reprod. Fertil. Dev. 25, 283; Cervantes et al. 2014 Reprod. Fertil. Dev. 26, 199). We hypothesise that additional maturation time in vitro, after in vivo maturation, will allow the remaining oocytes to reach the MII stage, and thus improve in vitro embryo production in wood bison. The objective of this study was to determine the effect of an additional 4 h of in vitro maturation on the developmental competence of oocytes collected 30 h after hCG treatment. Wood bison cows (n ¼ 24) were superstimulated by the administration of 300 mg of FSH (Folltropin-V) diluted in 0.05% hyaluronan on the day of follicular wave emergence and 100 mg of FSH in hyaluronan 2 days later. Bison were administered 2500 IU of hCG (Chorulon) IM 2 days after the last dose of FSH. Transvaginal ultrasound-guided follicle aspiration was performed 30 h after hCG treatment to collect cumulus-oocyte complexes (COC). Expanded COC (with no evidence of degeneration) were selected and assigned randomly to 2 groups (n ¼ 38 COC/group) in which IVF was done immediately, or after 4 h of in vitro maturation in TCM 199 with 5% calf serum, 5 mg mL1 pLH, 0.5 mg mL1 pFSH, and 0.05 mg mL1 gentamicin, at 38.58C, 5% CO2 and high humidity. In vitro fertilization (Day 0) was done with frozen-thawed wood bison semen (dose 5 106 sperm mL1) in Brackett-Oliphant medium at 38.58C, 5% CO2, and high humidity. Presumptive zygotes were cultured in CR1aa plus 5% calf serum, at 38.58C and in 5% CO2, 5% O2, and 90% N2 and high humidity. Cleavage was recorded on Day 3, and blastocyst formation was recorded on Days 7 and 8. Cleavage and blastocyst rates (calculated from the total number of oocytes submitted to IVF) were compared between groups by chi-square analysis. No difference was detected between groups (immediate fertilization v. after an additional 4 h in vitro) in cleavage rate on Day 3 (55.3 v. 60.5%, respectively, P ¼ 0.82),

214


IVF/IVP

or blastocyst rate on Day 7 (13.2 v. 23.7%, respectively, P ¼ 0.37). However, the blastocyst rate on Day 8 was higher in the COC group exposed to an additional 4 h of in vitro maturation (18.4 v. 44.7%, respectively, P ¼ 0.03). Results support the hypothesis that an additional short period of in vitro maturation improves the developmental competence of oocytes collected after 30 h of in vivo maturation. We thank Bioniche Animal Health for providing FSH (Folltropin-V) and hyaluronan (MAP-5), and Merck Animal Health for hCG (Chorulon).

249

AN EFFICIENT AND REPEATABLE IN VITRO FERTILIZATION TECHNIQUE IN THE EQUINE FOR PRESERVATION OF ENDANGERED SPECIES C. DouetA, O. ParodiA, F. ReignerB, P. Barrie`reB, and G. GoudetA

A

INRA, UMR85, Physiologie de la Reproduction et des Comportements, CNRS, Universite´ François Rabelais, IFCE, 37380 Nouzilly, France; B INRA, UEPAO, Unite´ Expe´rimentale Equine, 37380 Nouzilly, France

Most wild equids are currently endangered or threatened, as mentioned in the International Union for the Conservation of Nature Red List, and several domestic horse breeds are at risk of extinction. Genome resource banking requires cryoconservation of semen, oocytes, and/or embryos. Embryo production in equids is limited in vivo because routine induction of multiple ovulation is still ineffective. Embryo production in vitro allows the production of several embryos per cycle that could easily be frozen because of their small size. Intracytoplasmic sperm injection has been widely adopted to generate horse embryos in vitro; however, intracytoplasmic sperm injection is time-consuming and requires expensive equipment and expertise in micromanipulation. Several attempts to establish an efficient IVF technique in the equine were performed, but reported IVF rates remain quite low and no repeatable equine IVF technique was available. Our objective was to develop an efficient and repeatable IVF technique in the equine. Immature cumulus-oocyte complexes (COC) were collected either from slaughtered mares in a local slaughterhouse or from our experimental mares by ovum pick up (OPU). The COC were cultured for 26 h in an in vitro maturation (IVM) medium or in preovulatory follicular fluid (FF) collected by OPU, pre-incubated for 30 min in oviducal fluid collected from slaughtered females, co-incubated for 18 h with fresh spermatozoa treated with procain, and cultured in SOF for 30 h. They were fixed and analysed either after 18 h IVF (experiment 1) or after 30 h in vitro development (experiment 2). In experiment 1, COC were collected from slaughtered mares and analysed after 18 h IVF. Zygotes with 2 pronuclei were observed. The IVF rate was similar for oocytes matured in IVM medium (22/33, 67%) or FF (24/42, 57%; chi-square test, P . 0.05). In experiment 2, COC were collected from slaughtered mares and from experimental mares and analysed after 30 h of in vitro development. We observed zygotes with 2 highly decondensed pronuclei, pronuclei decondensation being the first step of embryo development. For oocytes collected from slaughtered mares, the percentage of zygotes was similar for oocytes matured in IVM medium (8/11, 73%) or FF (10/15, 67%). For oocytes collected by ovum pickup, the percentage was similar for IVM medium (3/5, 60%) or FF (6/8, 75%). We also observed some embryonic structures with several nuclei, but the quality of these embryos was poor. In conclusion, we have established an efficient IVM-IVF technique that allows the first step of embryo development. Because we obtained similar results for 4 years, we consider that this efficient technique is repeatable. Further experiments are in progress to improve the quality of the embryos.

250

EFFICIENCY COMPARISON BETWEEN FOLLICULAR ASPIRATION AND SCRAPING FOR EX VIVO RECOVERY OF EQUINE CUMULUS ENCLOSED OOCYTES J. Walter, S. Jaeger, and U. Bleul Clinic of Reproductive Medicine, Vetsuisse Faculty, University of Zurich, Zurich, Switzerland

Collection of cumulus enclosed oocytes from excised ovaries has become an ambitious task in recent years as a result of a decrease in slaughtering of horses because of ethical and political reasons. This increases the demand for highly efficient procedures to collect the maximum amount of oocytes out of these ovaries. The main objective of this study was to compare the efficiency of 2 oocyte recovery procedures. Oocyte aspiration is a quick and easy-to-perform technique with one potential limitation: the loss of the cumulus oophorus through suction forces. Recovery by follicular scraping is a more laborious procedure, but seems to be superior with regard to collection of cumulus-enclosed oocytes. This study was conducted to figure out the most efficient technique to collect high-quality equine cumulus-enclosed oocytes. The study was performed with ovaries of 32 slaughtered mares on 9 experimental days. All follicles of both ovaries from each mare were randomly allocated either to oocyte recovery by aspiration (15 mares) or by scraping (17 mares). Follicular scraping was performed with a bone curette after incision of the follicle with a scalpel blade, and follicular fluid was evacuated in watch glasses. After scraping, the follicles were flushed with PBS. Aspiration was performed using an 18-gauge needle with Tuohy bevel on a syringe. In a first step, follicular fluid was aspirated using scraping movements with the needle on the follicular wall. The empty follicular cavity was flushed once with the follicular fluid, the aspiration fluid was transferred to Falcon tubes and the aspirate settled for 10 min. Sediment of aspirated follicles was transferred to culture dishes, oocytes were searched under the stereomicroscope, and scraped follicles were searched directly in the watch glasses. Oocytes were classified in oocytes with compact cumulus oophorus, oocytes with expanded cumulus oophorus, oocytes with corona radiata only, denuded oocytes, and degenerated oocytes. Recovery rates were analysed for the 2 methods with special regard to oocyte classification. The overall recovery rates were similar for scraped (53.74%) and aspirated (52.70%) follicles. The 2 methods performed differently with respect to oocyte qualities. Significantly more of the oocytes recovered by scraping were collected with compact cumulus oophorus (72.16%) than in the aspiration group (33.77%; P ¼ 0.004). Both methods collected similar amounts of oocytes with expanded cumulus oophorus (10.12% by scraping, 7.79% by aspiration). Using the aspiration more oocytes presented denuded (24.67 v. 6.33%, P ¼ 0.08). The results of the presented study confirm that the scraping procedure is superior with regard to collection of cumulus-enclosed oocytes. These results prioritize follicle scraping for ex vivo collection of oocytes for research purposes because cumulus cells may support oocytal well-being during maturation and represent a unique biomarker source for the developmental competence of their corresponding oocytes.

IVF/IVP


251

215

IS THERE A GAP BETWEEN NUCLEAR AND CYTOPLASMIC MATURATION IN IN VITRO-MATURED EQUINE OOCYTES?

E. ClaesA, K. SmitsA, C. De SchauwerA, B. LeemansA, E. WydoogheA, H. FavoreelB, and A. Van SoomA A

B

Department of Reproduction, Obstetrics and Herd Health; Department of Virology, Parasitology and Immunology, Faculty of Veterinary Medicine, Ghent University, Merelbeke, Oost-Vlaanderen, Belgium

It is a general belief that as soon as the oocyte is recovered from the follicular environment, the nuclear maturation starts spontaneously in vitro, while specific stimulation for the cytoplasmic maturation is lacking (Gilchrist and Thompson 2007 Theriogenology 67, 6–15; Albuz et al. 2010 Hum. Reprod. 25, 2999–3011). As both nuclear and cytoplasmic maturation are required to prepare the oocyte for successful fertilization and embryonic development, a defective cytoplasmic maturation might be an important cause of low blastocyst rates in vitro (Albuz et al. 2010 Hum. Reprod. 25, 2999–3011). Nuclear and cytoplasmic maturation can be evaluated using fluorescent dyes. Assessment of nuclear maturation is typically based on the visualisation of chromatin, whereas cytoplasmic maturation is evaluated by the localization of cytoplasmic organelles [i.e. the cortical granules (CG)]. Equine oocytes were recovered from ovaries of slaughtered mares. After in vitro maturation (IVM; Smits et al. 2010 Vlaams Diergen. Tijds. 79, 134–138), oocytes were fixed and permeabilized. Subsequently, CG were labelled by incubation in 10 mg mL1 FITC-labelled lens culinaris agglutinin during 15 min at RT. Chromatin was counterstained to verify the nuclear status with 20 mg mL1 Hoechst 33342 during 15 min at RT. Stained oocytes with no or dispersed chromatin were classified as degenerated. Based on the absence or presence of the first polar body (PB), non-degenerated oocytes were either classified as nuclear immature (MI, no PB present) or nuclear mature (MII, PB present). The non-degenerated oocytes were further subdivided in 3 categories based on the migration of the CG: 1) cytoplasmic immature oocytes with (clusters of) CG randomly distributed throughout the ooplasm, 2) oocytes in transition stage with progressing CG migration to the oocyte cortex, and 3) cytoplasmic mature oocytes with a clearly visible CG monolayer just underneath the oolemma. The mean and standard deviation of nuclear and cytoplasmic parameters were calculated using Excel (Excel 2007, Microsoft Corp., Redmond, WA, USA). In 3 replicates, 86.6 2.75% of all oocytes (131/151) demonstrated a corresponding nuclear and cytoplasmic maturation pattern (MI corresponding to CG1 and 2; MII corresponding to CG3). Only 12.0 2.82% of the oocytes (16/133) revealed a cytoplasmic maturation pattern (CG 1 or 2) that lagged behind the nuclear maturation (MII). On the other hand, 22.2 9.8% of the oocytes (4/18) were already cytoplasmic (CG3) but not yet nuclear matured (MI). Since most of the equine in vitro matured oocytes exhibited, surprisingly, a corresponding nuclear and cytoplasmic maturation pattern, it can be concluded that the gap between the nuclear and cytoplasmic maturation in vitro is less important than is generally believed. Consequently, the IVM step is not the main obstacle to increase the efficiency of the in vitro production process in horses.

252

BIOCHEMICAL SERUM PROFILE AND LAPAROSCOPIC OVUM PICKUP CORRELATION IN ANGLO NUBIAN GOATS FED WITH DIFFERENT FAT SOURCES R. P. Nociti, R. A. R. Uscategui, L. C. Padilha, F. F. P. C. Barros, G. A. Motta, R. S. G. Mariano, L. C. Rola, C. M. M. Coelho, V. J. C. Santos, M. A. R. Feliciano, W. R. R. Vicente, M. E. F. Oliveira, and V. F. M. Hossepian de Lima FCAV-UNESP, Jaboticabal, Saõ Paulo, Brazil

The aim of the present study was to evaluate the correlations between biochemical serum profile with total number of aspirated follicles (AF), oocytes recovered (OR), number of corpus lutea (CL), oocyte morphology quality, and oocyte in vitro maturation (IVM) rate. Eighteen goats were randomly divided into 3 groups based on treatment diets, with different fat sources [soy oil (SG, n ¼ 6), linseed (LG, n ¼ 6), and MegalacÒ (MG, n ¼ 6)], formulated with 40% concentrate, 60% corn silage, of which 4% was ether extract from fat sources. The animals were submitted to a 15-day adaptation period and then a 70-day experimental period. The laparoscopic ovum pickup (LOPU) was performed after 36 h of an ovarian superstimulation protocol [FSH (80 mg) þ eCG (300 IU)] on Day 42 (LOPU1) and Day 70 (LOPU2) of the trial. The number of AF, and the presence and number of CL were evaluated during the LOPU procedure. Blood samples were taken at 14 days, 7 days, and just before each LOPU, and grouped as P1 (mean of blood samples results obtained before LOPU1) and P2 (LOPU2); serum metabolites analysed were total cholesterol, triglycerides, aspartate aminotransferase (AST), creatine kinase, and plasma glucose. The recovered oocytes were classified by morphological appearance, and only G1 (homogenous ooplasma and at least 3 layers of cumulus cells), G2 (homogenous ooplasma and at least 1 complete layers of cumulus cells), and G3 (homogenous ooplasma and incomplete layers or no cumulus cells) were submitted to IVM. The oocytes were incubated in maturation media (TCM 199 supplemented with 10% heat inactivated goat serum) at 38.58C and 5% CO2 for 27 h. Then, oocytes were subsequently fixed and stained on Hoechst 33342 and analysed using a fluorescent microscope for nuclear maturation. The IVM and analysis were performed for each individual. Pearson correlation test (P , 0.05) was applied in RÒ software between serum metabolites and LOPU variables. The triglycerides, creatine kinase, and glucose were not correlated with any LOPU variables. The total cholesterol was negatively correlated with G1, G2, and CL, and positively correlated with OR and G3 with determination coefficients (R) of 0.28, 0.38, 0.24, 0.25, and 0.44, respectively. The AST were negatively correlated with AF, G1, G2, and IVM, with R of 0.11, 0.43, 0.13, and 0.16, respectively. In conclusion, these results are suggestive that high serum levels of cholesterol and AST may interfere with oocyte quality, indicating a negative hyperlipidemia effect on reproductive efficiency as reported in cows. Financial support was provided by CNPq and FAPESP.

216


IVF/IVP

253 EFFECTS OF ADDITION OF ALPHA-LINOLENIC ACID INTO MATURATION MEDIUM ON IN VITRO DEVELOPMENT AND EXPRESSION OF APOPTOSIS-RELATED GENES OF GOAT EMBRYOS A. VeshkiniA, M. KhajenabiB, and A. Mohammadi-SangcheshmehA A

Department of Animal and Poultry Science, College of Aburaihan, University of Tehran, Pakdasht, Tehran, Iran; B Department of Transgenic Animal Science, Stem Cell Technology Research Center, Tehran, Iran

Fatty acids are important sources of energy for oocytes and embryos. In bovine, an increased level of rumen-inert fatty acids in the diet improved the developmental competence of oocytes to the blastocyst stage and also embryo quality. As described in our previous report, providing appropriate levels of a-linolenic acid (ALA) in maturation medium had beneficial effects on nuclear maturation and embryonic development in the goat. Considering these beneficial effects, here we have conducted experiments to evaluate whether addition of ALA to goat oocyte maturation medium can affect the quality of blastocyst and the transcription of apoptosis-related Bax, Bcl-2, and p53 genes. Ovaries were collected from goats, and cumulus-oocyte complexes (COC) were recovered by the slicing method. The COC were placed in maturation medium supplemented with 50 mM ALA. Oocytes in the control group were incubated in the same maturation medium without ALA. In vitro maturation (IVM) was performed in a humidified atmosphere containing 5% CO2, 5% O2, and 90% N2 at 38.58C for 24 h. After IVM, oocytes from both the treatment (n ¼ 113) and control (n ¼ 104) groups were subjected to IVF followed by culture in CR1aa medium for 8 days under the conditions stated above. The cleavage and blastocyst rates were recorded at Days 3 and 8 of culture, respectively. To examine the effect of ALA on total cell number and apoptosis of the blastocyst cells, the blastocysts from 50 mM ALA-treated and control oocytes were stained with 40 ,6-diamidino-2-phenylindole to count total cell number, and apoptotic cells in these blastocysts were detected with TUNEL assay. Blastocysts derived either from 50 mM ALA-treated oocytes or control oocytes were also evaluated for the expression of Bax, Bcl-2, and p53 genes. The cleavage and blastocyst rates were compared by chi-square analysis. Differentially expressed genes were analysed by 1-way ANOVA. A P-value of less than 0.05 was considered significant. Although cleavage rates after IVF were similar (P . 0.05) between 50 mM ALA-treated (68.1%) and control (55.8%) groups, 50 mM ALA-treated oocytes produced more (25.7%) blastocysts than the control group (13.5%; P , 0.05). Blastocysts derived from oocytes supplemented with 50 mM ALA not only had a greater (P , 0.05) total cell number (115.2), but also a lower (P , 0.05) number of apoptotic cells (3.1) compared with the control blastocysts (110.8 and 4.2, respectively). The relative transcript abundance of Bax and p53 was decreased (P , 0.05) in blastocysts that originated from the 50 mM ALA group compared with control blastocysts. Furthermore, there was an increased (P , 0.05) expression of Bcl-2 transcripts in blastocysts derived from the 50 mM ALA-treated oocytes compared with the control. In conclusion, our findings revealed that ALA-treated medium led to an improvement in blastocyst rate and quality as determined by greater total cell number, lower number of apoptotic cells, and altered expression of apoptosis-related genes.

254

IN VITRO BLASTOCYST PRODUCTION FROM PREPUBERTAL GOAT OOCYTES ACCORDING TO SEASON M. G. Catala´, M. Roura, S. Hammami, M. Rodriguez, D. Izquierdo, and M. T. Paramio Dep. CAA, Fac. Vet., Universitat Auto`noma de Barcelona, Barcelona, Spain

In our laboratory, we have been working for more than 20 years on in vitro embryo production from prepubertal goat oocytes. We have observed significant differences on blastocyst production according to the season of year. The present study is aimed to asses these differences in summer, autumn, winter, and spring. Oocytes with more than 3 compact cumulus layers (cumulus-oocyte complex, COC) and homogeneous cytoplasm were obtained after slicing prepubertal goat ovaries (45-day-old Murciano-Granadina rearing animals) recovered from slaughterhouse. Groups of 30 COC were matured in 100-mL drops of TCM199 medium (10% FBS) for 24 h with 5% CO2 and humidified atmosphere. Fresh buck semen (pool of 3 males) was selected by swim-up and capacitated with 0.05 mg mL1 of heparin for 45 min. The IVF was performed by transferring 20 oocytes to 100-mL drops of Tyrode’s medium with 4 106 capacitated sperm with 5% CO2 and humidity. After 17 h of IVF, a sample of oocytes was fixed in ethanol: acetic (3 : 1) for staining (1% lacmoid) to assess nuclear stage (Table 1). At 20 h post-insemination (pi), groups of 10 presumptive zygotes were transferred to 10-mL drops of SOF medium (10% FBS) under paraffin oil in a humidified atmosphere with 90% N2 for 8 days. Cleavage rate was evaluated at 48 h pi, and blastocyst rate was recorded at Day 8 pi (Table 1). Table 1 shows a decrease in normal pronuclear formation during winter (43%) and spring (47%). However, winter (16%) and spring (16%) produced significantly more blastocysts than summer (10%) and autumn (5%). Similar results were found by Sousa et al. (2014 Theriogenology 82, 1149–1162) in adult goats producing significantly higher blastocysts in the anoestrus season. We hypothesise that prepubertal goat oocytes in winter and spring may have a better cytoplasmic quality, producing more blastocyst even though the penetration rate is significantly lower than in autumn. In conclusion, under in vitro conditions and using fresh semen, the rate of penetration, cleavage, and blastocysts in prepubertal goats is influenced by season. Further studies in oocyte and sperm quality should be done to clarify this result.

IVF/IVP


217

Table 1. Nuclear stage of prepubertal goat oocytes according to season (3 replicates; top) and in vitro blastocyst production of prepubertal goat oocytes according to season at Day 8 postinsemination (7 replicates; bottom)1 Season

Penetrated, n (% s.e.)

Total oocytes, n 1PN

Summer Autumn Winter Spring

72 82 90 125

Summer Autumn Winter Spring

510 506 538 518

2PN

3PN

43 (59.8 1.7) 45 (54.9 2.1)a 39 (43.3 2.7)b 87 (47.2 3.5)ab a

2 (2.4 0.5)

Cleavage, n (% s.e.)

Blastocyst, n (% s.e.)

255 (50.0 7.0) 172 (34.0 2.3)B 284 (52.7 4.4)A 382 (73.7 4.6)A

53 (10.4 1.4)A 24 (4.7 0.5)B 85 (15.8 1.8)C 84 (16.2 1.8)C

A

6 (8.3 0.9)a 5 (6.1 0.5)a 3 (3.4 0.5)a 28 (22.4 2.2)b

Different superscript letters in same column differ significantly by Fisher’s test (P , 0.05). 1PN ¼ 1 pronucleus, 2PN ¼ normal 2 pronuclei, 3PN ¼ polyspermic.

a,b or A–C 1

SONIC HEDGEHOG PROMOTES IN VITRO OOCYTE MATURATION AND EMBRYO DEVELOPMENT IN GOATS

255

W. De-ChiA,B, H. Jan-ChiB, L. Neng-WenC, C. Hsin-IA, C. Lih-RenD, M. PascalE, and J. Jyh-CherngA,F A Department of Animal Science, National Chung Hsing University, Taichung, Taiwan, ROC; Hengchun Branch, Livestock Research Institute, Council of Agriculture, Hengchun, Pingtung, Taiwan, ROC; C Department of Animal Science and Biotechnology, Tunghai University, Taichung, Taiwan, ROC; D Physiology Division, Livestock Research Institute, Council of Agriculture, Hsinhua, Tainan, Taiwan, ROC; E INRA, UMR7247, Physiologie de la Reproduction et des Comportements, INRA, CNRS, Universite´ de Tours, Haras Nationaux, Nouzilly, France; F Graduate Institute of Basic Medical Science, China Medical University, Taichung, Taiwan, ROC B

The signalling of the Hh family peptides is mediated through a cell surface receptor system consisting of 2 proteins: patched (Ptc) and smoothened (Smo). In the absence of Hh ligand, the Hh receptor Ptc represses Smo, whereas in the presence of Hh, the suppression of Smo is lifted, leading to the activation of downstream transcriptional factors (Gli1, Gli2, and Gli3) in vertebrates. Previous studies have examined Sonic hedgehog (Shh) signalling pathways in developing and adult mouse ovaries and concluded that the Shh signalling pathway may be involved in granulosa cell proliferation and oocyte maturation. We investigated the effects of Shh protein on caprine oocyte maturation, embryo development, and embryo survival rate after transfer of vitrified/thawed in vitro-produced (IVP) embryos to recipients. Cumulus-oocyte complexes (COC) were collected by slicing ovarian follicles (1–5 mm in diameter). On average, 40 to 50 oocytes were randomly allocated to each well containing 500 mL of IVM medium and supplemented with 0 (control), 0.125, 0.25, 0.5, or 1.0 mg mL1 recombinant mouse Shh protein. After 24 h of IVM, cumulus cells were partially removed. Oocytes were washed and transferred into a droplet of 80 mL of fertilization medium and were fertilized with frozen-thawed sperm for 18 h at 38.88C. After IVF, presumptive zygotes were cultured on goat oviduct epithelial monolayers in M199 for 9 days. The 2 frozen-thawed selected embryos were transferred to one recipient. All data were subjected to ANOVA, using the general linear model procedure in SAS (version 9), followed by Tukey’s test. Embryo survival rates were compared by using the chi-square test. The RT-PCR analyses showed that the expressions of Shh, SMO, Ptch1, and Gli1 were detected in whole ovaries, granulosa cells, COC, cumulus cells, oocytes, and oviduct epithelia except for Ptch1 in cumulus cells. Supplementation of Shh (0.25 or 0.5 mg mL1) enhanced oocyte maturation as opposed to the control group (92.4%, n ¼ 67 and 95.0%, n ¼ 62 v. 86.2%, n ¼ 64, respectively, P , 0.05). This effect could be reversed by the simultaneous addition of cyclopamine (0.5–1.0 mm), a Shh inhibitor. Similar to intact COC, denuded oocytes showed enhanced maturation (72.0%, n ¼ 94 v. 60.5%, n ¼ 126) with Shh supplementation. For subsequent embryo development, an improved blastocyst rate (P , 0.05) was 66.3 10.9 (n ¼ 135) when embryos were derived from the oocytes matured in the presence of 0.5 mg mL1 Shh rather than 41.4 12.9 (n ¼ 137) of the control group. After embryo transfer, the kidding and embryo survival rates of vitrified embryos derived from the Shh-supplemented group were 56 (16 recipients) and 31% (48 embryos) higher than that 38 (16 recipients) and 15% (54 embryos) without Shh supplementation (P , 0.05). The present study suggests that Shh signalling is active in caprine ovaries during folliculogenesis and beneficial to oocyte maturation and subsequent embryo development to the blastocyst stage (in vitro) and to term.

256

EFFECT OF SPERM SELECTION ON THE RATE OF IN VITRO FERTILIZATION IN ALPACA (VICUGNA PACOS) E. MellishoA, V. RivasB, J. RuizC, and G. MamaniA A

Facultad de Zootecnia, Universidad Nacional Agraria La Molina, La Molina, Lima, Peru; Recursos Geneticos, Instito Nacional de Investigacion Agraria, LA Molina, Lima, Peru; C Universidad Nacional de Huancavelica, Huancavelica, Peru

B

In alpacas, improvement of reproductive efficiency of male camelids is limited by the small size of the testes, extended period of ejaculation, and low quality of semen. This study was designed to determine the effect of 2 sperm preparation treatments before IVF on the cleavage rate. The sperm was obtained by slicing the head of the epididymis of slaughtered male alpacas (n ¼ 8), diluting in Tris-yolk-glycerol, and freezing with the slow-cooling method. Frozen semen straws per each male were thawed in a water bath at 378C for 15 s and evaluated for percentage of progressive motility

218


IVF/IVP

(32 8.6%) and concentration (66.5 24 106 sperm mL1) post-thawing. Sperm selection by the swim-up method was performed by centrifugation at 1077 g for 5 min with washing sperm medium eliminating the supernatant; sperm were settled in inclined tube with fertilization medium (without capacitating agent) for 60 min, after which 100 mL from the surface was recovered for use in IVF. The washing method consisted in repeated washing (twice) of sperm in washing sperm medium and fertilization medium by centrifugation at 1077 g for 5 and 3 min, respectively, and recovery of 50 mL from the bottom of the tube for use in IVF. Sperm selected by swim-up or washing methods had similar characteristics of progressive motility (18 and 23%); however, the concentration was higher for the washing v. swim-up method (52 v. 14 106 sperm mL1, respectively). Cumulus-oocyte complexes (COC) were recovered from 278 ovaries of alpacas killed at abattoirs and classified (Grade 1 and 2) for in vitro maturation (38.58C at 5% CO2 in air for 27 h in 50 mL of 10 COC per drop). A total of 839 oocytes cultured for 27 h in maturation medium were partially stripped out of cumulus cells by gentle aspiration with a pipette. Sperm suspensions in Fert TALP medium (5 mL) from each treatment group were added to each fertilization drop with 10 oocytes per drop of 45 mL obtaining a final concentration of 10 106 sperm mL1 and cultivated for 72 h until their evaluation. The data for the 13 repetitions of the rate of cleavage (2 to 8 cells) were converted to angular values (angle ¼ arcsin O%) with the object of normalizing the distribution of the data; the analysis of variance was performed (complete randomised design with sub-sampling, P , 0.05) using SASÒ version 8.0 for Windows. The rate of cleavage (cell division) did not show statistical differences (P ¼ 0.67) for the swim-up method (37%; 155/421) v. washing method (35%; 147/418). The methods of sperm selection (swim-up and washing) did not affect the rate of IVF.

257

IN VITRO YAK EMBRYO PRODUCTION THROUGH CONVENTIONAL AND OVUM PICKUP METHODS

P. ChakravartyA, M. HussainA, M. S. ChauhanB,C, R. S. ManikB,D, D. BaishyaC,D, S. BhuyanB,D, S. SorenB,C, S. DeoriA, V. PaulA, P. J. DasA, J. DoleyA, B. K. D. BorahA, G. KrishnanA, D. J. DuttaC, and S. M. DebA A

NRC on Yak, ICAR, Dirang, Arunachal Pradesh, India; B NDRI, Karnal, Haryana, India; C CVSc, Assam Agricultural University, Guwahati, Assam, India; D Animal Husbandry and Veterinary Department, Guwahati, Assam, India Yak is one of the most important economically useful animals for highlanders. The decline in the yak population demands effective measures for conservation and multiplication of elite germplasm. In vitro production of embryos and their cryopreservation and transfer to suitable recipients for production of elite calves may contribute to fulfill the objectives. The work was conducted at the National Research Center on Yak over a period of 3 years. The ovaries of slaughtered animals were used for collecting oocytes through aspiration of follicles followed by slicing of ovaries in the conventional method. Trials were conducted using 7 cyclic parous yaks for ultrasound-guided ovum pickup (OPU) at Nyukmadung farm (2700 m above mean sea level). The technique followed was similar to that in buffaloes with slight modification. Categories of oocytes classified A (2–3 layers of cumulus) and B (at least one layer of cumulus) obtained through the processes were subjected to in vitro maturation using standardized maturation medium (TCM-199 þ 10% follicular fluid þ sodium pyruvate þ L-glutamine þ 10% heat inactivated oestrus cow serum þ pFSH þ 17b oestradiol). The frozen-thawed yak sperm were capacitated using the swing-up method before their incubation with matured oocytes using BO medium. Oocytes matured for 24 h were washed 5 to 6 times with BO medium and then co-incubated with in vitro capacitated spermatozoa (0.1 to 0.25 million) for fertilization (8–10 oocytes per group) in 100-mL droplets of BO medium under mineral oil in 35-mm Petri dishes and placed in a CO2 incubator (5% CO2, 90% RH) at 38.58C for 16 to 18 h. The presumed zygotes were washed several times in mCR2aa (modified Charles Rosenkrans) washing medium and then cultured in culture medium for 7 days on original beds of granulosa cells. The rates of maturation and fertilization of oocytes collected by conventional and OPU technique were comparable (Table 1). This may be attributed to greater numbers of good quality oocytes recovered in the conventional method. Embryos developed up to the stage of compact morula and blastocysts (24.66% through conventional and 22.73% through OPU) were cryopreserved using the vitrification method for further study. Thirteen embryos were transferred non-surgically to one each of 13 yak recipients; 5 became pregnant and only 1 recipient transferred with a cryopreserved-thawed embryo, developed through OPU, delivered one male calf, leading to the first successful production of an IVF yak calf in the world. The present findings are suggestive of using the OPU technique for in vitro embryo production, though resulting in lower numbers of transferable embryos (Table 1), because availability of ovaries for conventional IVF is a major constraint in yak. Table 1. Comparative in vitro yak embryo production rate with recovery of oocytes by conventional or ovum pickup (OPU) method Year of operation Conventional method 1st 2nd 3rd Total OPU method 2nd 3rd 4th Total

No. of A & B category oocytes

Maturation rate (%)

Fertilization and cleavage rate (%)

P-value

65 89 83 237

92.31 89.89 100.00 96.20

46.66 72.5 78.31 67.71

P . 0.05

23 85 30 138

78.26 81.18 76.66 72.41

44.44 53.63 73.91 56.36

IVF/IVP

258


219

THE PRELIMINARY RESULTS OF IN VITRO PRODUCTION OF THE WISENT HYBRID EMBRYOS A. M. DuszewskaA, W. OlechB, P. TrzeciakA, M. KrzysiakC, L. RapalaA, Z. NowakB, and S. DabrowskiA B

A Division of Histology and Embryology, Faculty of Veterinary Medicine, Warsaw, Poland; Division of Genetics and Animal BreedingFaculty of Animal Science, Warsaw University of Life Science, Warsaw, Poland; C Breeding Centre of European Bison, Bialowieza, Poland

Wisent (Bison bonasus), also called the European bison, is listed as vulnerable on the International Union for the Conservation of Nature Red List of Threatened Species. In Poland, a program for protection in situ and ex situ is being implemented. One new approach is the use of the in vitro embryo production (IVP) procedures to obtain wisent offspring. In contrast to previous successes with cattle IVP, use of IVP with wisent is limited by the small size of the population (only ,5000 individuals in more than 200 herds in Europe) and seasonal reproduction. The aim of this preliminary study was to obtain hybrid embryos (Bison bonasus Bos taurus) in vitro. Ovaries were isolated from wisent females outside the reproductive season and eliminated from breeding for reasons other than infertility. Cumulus-oocytes complexes (COC) were isolated from all follicles above 2 mm in diameter. All COC were matured in TCM 199 supplemented with 10% fetal bovine serum, 0.02 IU mL1 of porcine FSH, 17 b-oestradiol, 0.2 mM Na pyruvate, and antibiotics. The COC were cultured for 24 h at 38.58C and 5% CO2 in humidified air. The matured COC (Bison bonasus) were fertilized in vitro with sperm from Jersey bulls (Bos taurus) in TALP supplemented with 6 mg mL1 of fatty acid free BSA (BSA FAF), 0.2 mM Na pyruvate, 20 mM penicillamine,10 mM hypotaurine, 1 mM epinephrine, 2 mg mL1 heparin, and antibiotics. Spermatozoa were used at a final concentration of 1 105 per oocyte and were co-cultured for 18 h at 38.58C and 5% CO2 in humidified air. The hybrid zygotes were cultured in KSOM supplemented with 5 mg mL1 of MEM Nonessential Amino Acid Solution (100), 3 mg mL1 of BSA FAF, and antibiotic for 192 h at 38.58C and 5% CO2 in humidified air. The medium was partly replaced by fresh medium after 48 and 144 h of culture. Development was evaluated every day. From 25 COC isolated from wisent ovaries, only 18 COC were qualified for in vitro maturation (60%). Of these, 15 COC (83.3%) matured. The percentage of hybrid embryos that cleaved was 80% after 48 h of culture, and the percentage of embryos that developed up to the 8-cell stage was 33% after 96 h of culture. The morula/blastocyst rate was 26.6% after 192 h of culture, as represented by 1 early blastocyst, 2 compact morulae, and 1 morula. The use of the cattle IVP procedure allowed to receive hybrid embryos (Bison bonasus 3 Bos taurus), but they developed slower than cattle embryos under the same conditions, based on our previous studies. This research will be continued and may make a contribution to the protection of this threatened species.

259

DOES THE SENSITIVITY TO OXIDATIVE STRESS DEPEND ON THE SEX OF THE EMBRYO? M. Dallemagne, E. Ghys, D. De Troy, and I. Donnay Universite´ Catholique de Louvain, Louvain-la-Neuve, Belgium

Male and female bovine embryos show several differences as early as the blastocyst stage. For example, differences are observed in metabolism, developmental kinetics, or gene expression that can lead to a shift in the sex ratio. Interestingly, the culture medium differentially affects male and female embryos. We previously showed that male Day 7 blastocysts present lower apoptotic rates than females (Ghys et al. 2013 Reprod. Fertil. Dev. 25, 194). The objective of the present study was to determine if such difference might be related to a differential sensitivity to oxidative stress, known to increase apoptosis in bovine blastocysts. In vitro-produced embryos were cultured in a SOF-based medium containing 0.4% BSA. At Day 5 post-insemination (pi) all the embryos were transferred in drops containing the same culture medium supplemented or not with 1 mM 2,20 -azobis (2-amidinopropane) dihydrochloride, an inducer of reactive oxygen species. Blastocysts were collected at Day 7, and apoptosis was evaluated by an immunofluorescent staining of cleaved caspase-3 (8 replicates, n ¼ 175). Total and apoptotic cells were counted using an epifluorescence microscope. As expected, embryos cultured under stress conditions from Day 5 pi presented a lower blastocyst rate at Day 7 (10.9 1.0% v. 23.1 1.9% for the control group; standard least squares, P , 0.0001). The stressed blastocysts also showed fewer cells (113 3 v. 139 4; P , 0.0001) and higher apoptotic rates (15.3 0.9% v. 9.4 0.6%; P , 0.0001). As previously observed, the mean total cell number of the blastocysts was higher for males than females, whatever the culture condition (stress: males: 119 4, females: 108 4; control: males: 144 5, females: 131 6; sex effect: P ¼ 0.005; interaction of sex condition: P ¼ 0.9). Interestingly, the sex ratio of the blastocysts was significantly different between control and stress conditions (x2, P ¼ 0.02); whereas a deviation in favour of the male embryos was observed in the control group (males: n ¼ 57, 61%, females: n ¼ 37, 39%; P ¼ 0.04), it disappeared when embryos were submitted to oxidative stress (males: n ¼ 35, 43%, females: n ¼ 46, 57%; P ¼ 0.22). However, oxidative stress had a similar impact on male and female blastocysts regarding the apoptotic rates (stress: males: 15.3 1.3%, females: 15.4 1.3%; control: males: 8.9 0.7%, females: 10.2 1.1%; standard least squares, sex effect: P ¼ 0.99; interaction of sex condition: P ¼ 0.3). In conclusion, female embryos seem more resistant to oxidative stress than male ones when the stress is induced from Day 5 pi. Oxidative stress has a similar impact on the apoptotic rates in male and female blastocysts. The higher rate of apoptosis previously observed in female blastocysts can thus not be explained by a higher sensitivity of female embryos to oxidative stress. This is in accordance with the higher level of expression of several X-linked genes related to antioxidant pathways in female blastocysts.

260

EVALUATION OF PORCINE IN VITRO PRODUCTION WITH THE ADDITION OF CHITOSAN TO CULTURE MEDIA

F. GarcıáA, Y. DucolombB, S. P. Miranda-CastroA, J. F. De la Torre-SańchezC, and S. RomoA A

Facultad de Estudios Superiores Cuautitlań, UNAM, Cuautitlań, Estado de Me´xico, Me´xico; B Divisioń de CBS, Universidad Autońoma Metropolitana-Iztapalapa, Me´xico DF, Me´xico; C Centro Nacional de Recursos Gene´ticos. INIFAP, Tepatitlań, Jalisco, Me´xico

Chitosan is a partially deacetylated polymer obtained from the alkaline deacetylation of chitin, which is a glucose-based unbranched polysaccharide widely distributed in nature as the main component of exoskeletons of crustaceans and insects. Chitosan has a variety of physicochemical and biological properties resulting in numerous applications. In addition to its lack of toxicity and allergenicity, its biocompatibility, biodegradability, and

220


Male Physiology

bioactivity make it a very attractive substance for diverse applications as a biomaterial in pharmaceutical and medical fields. Chitosan stimulates cell growth and it has been used in fibroblast culture, increasing cell proliferation. For these reasons, it is important to evaluate if this polymer has a positive effect on embryo production. The aim of this study was to evaluate porcine oocyte maturation and embryo development, comparing the effect of supplementing different concentrations of chitosan to the maturation (MM) and development media (DM). Cumulus-oocyte complexes (COC) were aspirated from ovarian follicles of slaughtered sows. The COC were matured in supplemented TCM-199 (MM) and incubated for 44 h. All incubations were performed at 38.58C, with 5% CO2 in air and humidity at saturation. After maturation IVF was performed, frozen-thawed semen from the same boar was used and gametes were co-incubated in MTBM for 7 h. Then, putative zygotes were cultured in NCSU-23 (DM) for 144 h. The following experiments were performed: 1) addition of 0 (control), 35, 50, 100, and 150 ppm chitosan to the MM (n ¼ 1353), 2) addition of 0, 50, 100, and 150 ppm chitosan to the DM (n ¼ 739), 3) addition of 0, 50, 100, and 150 ppm of chitosan to the MM first and then the same concentrations to the DM (n ¼ 702). When chitosan was added to the MM, the highest percentage of matured oocytes (metaphase II) was obtained in the 50 ppm treatment (87%, P , 0.05) when compared with the control, 100, and 150 ppm groups (78, 78, and 82%, respectively). Regarding the percentage of blastocysts, there were no differences when comparing the treatment and the control groups (ranging from 12 to 13%). After addition of chitosan to the putative zygotes in the DM, the percentage of morulae in the 150 ppm treatment was significantly increased with regard to the other groups (54 v. 46%, respectively, P , 0.05). When adding chitosan to both MM and DM, there was no effect on embryo development. It is concluded that the addition of chitosan to the MM at a concentration of 50 ppm significantly improved oocyte maturation and a concentration of 150 ppm in the DM increased the percentage of morulae. Chitosan had a positive effect on oocyte maturation and embryo development. These results justify further investigations to find out if chitosan can be useful as a supplement for chemically defined media.

Male Physiology 261

HIGH NUTRITION DURING EARLY LIFE IMPROVES REPRODUCTIVE POTENTIAL OF HOLSTEIN BULLS A. DanceA, J. ThundathilA, R. WildeB, P. BlondinC, and J. KastelicA B

A University of Calgary, Calgary, AB, Canada; Agriculture and Agri-Food Canada, Lethbridge, AB, Canada; C L’Alliance Boviteq Inc., Saint-Hyacinthe, QC, Canada

The objective was to determine effects of early-life nutrition on reproductive potential of Holstein bulls. Twenty-six bull calves were randomly allotted to 3 groups and fed ,70, 100, or 130% of National Research Council recommendations for both energy and protein from 2 to 31 wk; thereafter, all were fed a 100% diet (adequate vitamins and minerals were constantly available) until slaughter (72 wk). Growth rate, scrotal circumference, and paired testis volume were determined every 4 wk during the differential feeding period. Once scrotal circumference reached 26 cm, semen collection was attempted (to confirm puberty). Post-pubertal semen quality was monitored; once bulls were producing 70% morphologically normal sperm, semen was cryopreserved (programmable freezer). These semen samples (3 bulls per group and 3 ejaculates per bull) were used in an IVF system to determine the fertilizing ability of sperm and developmental competence of resulting embryos. In the low-, medium-, and high-nutrition groups, respectively, bulls were 369.3 14.1, 327.4 9.5, and 324.3 11.7 days at puberty; their paired testes weights were 561.6 23.1, 611.1 59.1, and 727 33.0 g; cleavage rates were 68.0 8.7, 77.1 3.5, and 68.7 4.5%; and blastocyst rates were 31.5 5.6, 41.4 4.9, and 33.7 4.6% (no significant differences among the 3 nutrition groups for rates of cleavage or blastocyst formation). We concluded that early-life supplementation of energy and protein hastened puberty (P , 0.05) and increased testicular size (P , 0.05), without compromising sperm fertilizing ability. Therefore, feeding dairy bull calves a high plane of nutrition early in life is recommended as a management strategy to improve their reproductive potential.

262

EFFECT OF SYSTEMIC ANTIOXIDANT TREATMENT IN BOS TAURUS TAURUS BULLS UNDER HEAT STRESS AND SUPPLEMENTED WITH POLYUNSATURATED FATTY ACIDS

E. Gualtieri de Andrade PerezA, J. Diego di Agostini LosanoB, A. DalmazzoB, M. NichiB, and V. Hyppolito BarnabeB A

B

Convet–Reproduçaõ e Sau´de Animal, Brotas, SP, Brazil; Faculty of Veterinary Medicine and Zootecny of Saõ Paulo, Saõ Paulo, SP, Brazil

One reason for lower fertility of European bulls in tropical regions is a higher rate of oxidative stress caused by increased production of reactive oxygen species (ROS) not compensated by antioxidant protection. In that regard, sperm are extremely susceptible to oxidative stress due to a high concentration of polyunsaturated fatty acids (PUFA) in their plasma membranes. However, the presence of these PUFA is fundamental for sperm to be fertile and resistant to cold shock. Thus, treatments that suppress oxidation may increase productivity of these animals. This study aimed to evaluate the most damaging ROS for European bulls subjected to heat stress and to determine a possible antioxidant-targeted treatment. In a second step, we sought to verify the efficiency of the interaction between a diet rich in PUFA and a targeted antioxidant treatment on the quality of ejaculated and epididymal sperm in European bulls subjected to testicular heat stress. Four Bos taurus bulls were subjected to scrotal insulation for 5 days, with semen collection (electroejaculation) 60 days after insulation. Semen from each bull was divided into 4 aliquots and subjected to 4 ROS-generating systems: superoxide anion (xanthine/xanthine oxidase), hydrogen peroxide, hydroxyl radical (ascorbate þ ferrous sulfate), and malondialdehyde (MDA; lipid peroxidation product). Samples were incubated for 1 h and assessed by computerized sperm analysis (CASA); eosin/nigrosin (membrane integrity); fast-green/Bengal rose (acrosome integrity); 3,30 diaminobenzidine (mitochondrial activity); sperm chromatin structure assay (DNA fragmentation); and thiobarbituric acid reactive substances (lipid peroxidation). Overall, MDA had the most deleterious effects on semen

Male Physiology


221

quality of Bos taurus bulls subjected to acute heat stress. Thereafter, 16 bulls were subjected to testicular insulation and allocated into 4 groups: control (n ¼ 4; given mineral oil; placebo); vitamin E (n ¼ 4, given 5 mL of MonovinÒ every 13 days); PUFA (n ¼ 4; given 4 kg day1 MegalacÒ); and PUFAþvitamin E (n ¼ 4; combination of PUFA and vitamin E treatment groups). Semen was collected on the day of installation of the insulation, on the day it was removed, and 30 and 60 days later. Overall, vitamin E reduced heat stress-induced damage to sperm DNA and mitochondria, but only in samples collected from the epididymis. Similarly, the combination of vitamin E and PUFA supplementation improved sperm motility patterns. Therefore, a combined antioxidant treatment (vitamin E and PUFA) may reduce damage to sperm caused by acute heat stress in European bulls. However, this treatment may be more effective if instituted before heat stress.

263

ADDING RESVERATROL TO THE EXTENDER AFFECTS PROTEIN TYROSINE PHOSPHORYLATION IN BUFFALO SPERM

V. Longobardi, G. Bifulco, G. Albero, A. Salzano, G. Zullo, D. Vecchio, and B. Gasparrini Department of Veterinary Medicine and Animal Production, Federico II University, Naples, Italy Cryopreservation induces remarkable capacitation- like changes in buffalo sperm (Kadirvel et al. 2011 Theriogenology 75, 1630–1639; Elkhawagah et al. 2014 J. Buffalo Sci. 3, 3–11). The aim of this study was to evaluate the effect of resveratrol, a natural phytoalexin with antioxidant properties, on capacitation status of frozen-thawed buffalo sperm, assessed by protein tyrosine phosphorylation assay. Three ejaculates from four bulls were used for the trial. Each ejaculate was split into two equal aliquots and diluted at 378C with BioXcell extender containing no supplement (control) or 50 mM resveratrol, to a final concentration of 30 106 spermatozoa per mL. After 4 h at 48C, straws were frozen in an automated system. Immediately after thawing, sperm motility was evaluated by phase-contrast microscopy, sperm viability by Trypan Blue/Giemsa staining and localization of phosphotyrosine proteins by indirect immunofluorescence, as described Kadirvel et al. (2011 Theriogenology 75, 1630–1639). Briefly, after thawing, semen was centrifuged (300 g, 10 min), fixed in 2% formaldehyde for 1 h at 48C, and sperm pellets were incubated overnight at 48C in modified phosphate buffer saline containing 2% BSA. After centrifugation, sperm pellets were resuspended, diluted 1 : 10 in mPBS, smeared onto slides, air-dried, and permeabilized with absolute ethanol for 5 min. Then, spermatozoa were incubated with rabbit anti-phosphotyrosine primary antibody for 1 h at room temperature in a humid chamber. Slides were incubated with secondary antibody, FITC conjugated goat anti-rabbit IgG, for 1 h in a dark humid chamber at room temperature and mounted with 90% glycerol. A total of 100 spermatozoa were screened per slide and classified as described (Lunõ et al. 2013 Reproduction 146, 315–324): pattern A: uniform fluorescence over the entire acrosome (low capacitation level); pattern E: signal in the equatorial segment (medium capacitation level); and pattern EA: fluorescence at both equatorial and acrosomal areas (high capacitation level). Data were analysed by chi-square. There were no significant differences between control and treated groups for sperm motility (50.0 and 55.0%, respectively) or viability (77.4 and 72.9%). The percentage of sperm cells that did not exhibit fluorescence was very low (2.4 and 4.3% in the control and resveratrol groups, respectively). In resveratrol-treated group, pattern E was higher than the control (4.9 and 2.0%; P , 0.01). More interestingly, in the resveratroltreated group, an increased percentage of sperm with pattern A (79.6 and 52.5%) and a decreased percentage of sperm with pattern EA (12.2 and 43.1%) were recorded. Based on decreased sperm with a high capacitation level (EA pattern) and increased sperm with low capacitation level (A pattern) at thawing, we concluded that adding resveratrol to semen extender before cryopreservation of buffalo was beneficial.

264

EFFECT OF SEASON ON CRYOCAPACITATION OF BUFFALO (BUBALUS BUBALIS) SEMEN G. Albero, G. Zullo, A. Salzano, R. Brun, V. Longobardi, G. Bifulco, and B. Gasparrini Department of Veterinary Medicine and Animal Production, Federico II University, Naples, Italy

Buffalo are short-day breeders; at our latitudes, reproductive activity improves during autumn. Although extensive studies have been conducted on the female, seasonal variations were also reported on post-thaw motility and membrane integrity of buffalo sperm (Andrabi 2009 Reprod. Domest. Anim. 44, 552–569). It was reported that cryopreservation induces capacitation-like changes in buffalo spermatozoa, assessed by both chlortetracycline (CTC) fluorescent and protein tyrosine phosphorylation assays (Kadirvel et al. 2011 Theriogenology 75, 1630–1639; Elkhawagah et al. 2014 J. Buffalo Sci. 3, 3–11). The aim of this study was to evaluate the effect of season on cryocapacitation of buffalo semen. At least two ejaculates were collected from 4 bulls during 2 seasons with different daylength: spring (low season) and autumn (peak season). Each ejaculate was diluted at 378C with BioXcell extender to a final concentration of 30 106 spermatozoa per mL. After 4 h at 48C, straws were frozen in an automated system. Immediately after thawing, sperm motility was evaluated by phase-contrast microscopy and viability, as well as capacitation status, were assessed by CTC fluorescent staining, as reported (Kadirvel et al. 2011 Theriogenology 75, 1630–1639). Briefly, sperm suspensions were first stained with 0.1 mg mL1 Hoechst 33258 for 2 min. Then, equal volumes of sperm suspension and CTC solution (750 mM CTC, 5 mM cysteine in 130 mM NaCl, and 20 mM Tris-HCl) were mixed at room temperature, and glutaraldehyde (12.5%) was added. Sperm suspensions were mounted on slides and stored at 48C overnight (in the dark). Each sample was assessed twice under a microscope equipped with phase contrast and epifluorescent optics. At least 100 spermatozoa per slide were evaluated and classified into 3 CTC staining patterns: 1) uniform bright fluorescence over the entire head (uncapacitated spermatozoa, pattern F); 2) fluorescence-free band in the post-acrosomal region (capacitated spermatozoa, pattern B); and 3) dull fluorescence over the entire head, except for a thin punctuate band of fluorescence along the equatorial segment (acrosome-reacted spermatozoa, pattern AR). Data were analysed by chi-square. There were no differences in sperm viability between seasons (78.4 and 76.4%, respectively, in autumn and spring). However, post-thaw motility increased (P , 0.05) in autumn (60.0%) compared with spring (50.0%). The percentage of sperm displaying CTC pattern F increased in autumn compared with spring (40.5 and 27.3%, respectively; P , 0.01), whereas the percentage of sperm with both pattern B (57.9 and 66.6%, respectively; P , 0.01) and AR (1.6 and 6.1%, respectively; P , 0.01) decreased. The number of bulls and ejaculates used in this study was too low to draw definitive conclusions. However, these findings suggested that capacitation-like changes after sperm cryopreservation may be reduced during the favourable season in buffalo.

222


265

Male Physiology

TESTICULAR DEGENERATION AFFECTED PLASMA, ACROSOMAL AND MITOCHONDRIAL MEMBRANE INTEGRITY, AND DNA FRAGMENTATION IN RAM SPERMATOZOA

M. Bianchi Rodrigues Alves, A. Furugen Cesar de Andrade, R. Paes de Arruda, L. Batissaco, R. Lançoni, M. Andrade Torres, G. Mouro Ravagnani, S. A. Florez-Rodriguez, B. Marcelle Martins de Oliveira, V. Vellone, and E. Carla Carvalho Celeghini Center of Biotechnology in Animal Reproduction, Department of Animal Reproduction, Faculty of Veterinary and Animal Science, Pirassununga, SP, Brazil Testicular degeneration, an important cause of male infertility, adversely affects sperm motility and morphology. However, few studies describe effects on integrity of plasma and acrosomal membranes, mitochondrial membrane potential, and DNA fragmentation; therefore, they were evaluated in the present study. Testicular degeneration was induced in 17 White Dorper rams (scrotal insulation for 72 h). Semen was collected (artificial vagina) twice before insulation and twice thereafter (15-day intervals between post-insulation collections). Sperm motility and morphology were analysed by SCA software (Sperm Class AnalyserÒ, MICROPTICÒ, Barcelona, Spain) and differential interference contrast microscopy (DIC, model 80i, Nikon, Tokyo, Japan), respectively. Membrane integrity and potential were assessed with fluorescent probes: Hoescht 33342, propidium iodide, FITC-PSA, and JC-1 (Celeghini et al. 2010 Arq. Bras. Med. Vet. Zootec. 62, 536–543) and imaged with fluorescence microscopy (Nikon Model 80i, Nikon, Tokyo, Japan). Fragmentation of DNA was evaluated with a HalomaxÒ kit (HalotechÒ DNA, Madrid, Spain). Data were analysed with Statview software (Stat View 1998, SAS Institute Inc., Cary, NC, USA). Data obtained from the periods (before after insulation) were evaluated by analysis of variance (ANOVA) and means were compared using Tukey’s test. Total motility (before: 87.53 1.21%; after: 46.53 4.46%) and progressive motility (before: 58.64 2.00%; after: 31.33 3.82%) were reduced (P , 0.01) by scrotal insulation, as were sperm major defects (before: 10.64 1.65%; after: 54.30 3.67%) and total defects (before: 20.50 2.40%; after: 63.85 3.41%; P , 0.0001). Sperm with intact plasma and acrosomal membranes and high mitochondrial potential (PIAIH) decreased (P , 0.0001) after insulation. In that regard, 53.19 2.20 and 28.48 3.48% of sperm were classified as PIAIH before v. after insulation, respectively. Furthermore, plasma membrane integrity, acrosome membrane integrity, and high mitochondrial potential were assessed independently. The quantity of plasma membrane integrity cells (before: 62.01 2.07%; after: 33.92 3.94%), acrosome membrane integrity cells (before: 57.17 2.30%; after: 31.47 3.77%), and high mitochondrial potential cells (before: 85.72 1.42%; after: 57.28 3.12%) were also reduced (P , 0.0001) after insulation. Likewise, DNA integrity decreased (P ¼ 0.002) from 98.87 0.26% before insulation to 91.88 2.6% afterward. In conclusion, sperm plasma and acrosomal membrane integrity, mitochondrial membrane potential, and DNA fragmentation were adversely affected by testicular degeneration in rams induced by scrotal insulation. Research was supported by FAPESP process 2012/00040-0 and 2011/16744-3.

266

BIOCOMPATIBILITY OF NANOCERIA IN RAM SPERM DURING 24 HOURS OF INCUBATION L. FalchiA, L. BoglioloA, G. GalleriB, G. VlachopoulouA, O. MurroneA, G. EpifaniC, A. PinnaD, P. InnocenziD, and S. LeddaA A

Section of Obstetrics and Gynecology, Department of Veterinary Medicine, University of Sassari, Sassari, Italy; B Department of Clinical and Experimental Medicine, University of Sassari, Sassari, Italy; C Agenzia Regionale per la Ricerca in Agricoltura (Agris), Bonassai, Italy; D Laboratory of Materials Science and Nanotechnologies, CR-INSTM, University of Sassari, Alghero, Italy

In recent years, there has been increasing interest in nanoparticles, especially those widely present in our environment. Several studies have been performed to evaluate their potential toxic effect and their possible use for biomedical applications. Among others, cerium dioxide nanoparticles (nanoceria, CeO2 ENPs) have been recently investigated for their use in biomedicine, based on their potential antioxidant function, due to the presence of oxygen vacancies and redox transformations (Ce4þ/Ce3þ) occurring at the surface. However, little is known about the potential toxicity of nanoceria in the reproductive system and on gametes, and no information is available with regard to its biocompatibility and potential toxicity on male gametes. The aim of the present study was to investigate effects of increasing doses of CeO2 ENPs on ram spermatozoa during 24 h storage at 48C, based on assessment of main kinematic parameters, membranes and DNA integrity, ROS production, mitochondrial activity, and CeO2 intracellular uptake. The ejaculates of 3 rams of proven fertility were pooled and incubated with increasing doses of nanoceria (0, 22, 44, and 220 mg mL1) up to 24 h at 48C. The experiment was conducted in 4 replicates. At 0, 2, and 24 h of incubation, the 4 groups were submitted to the following analyses: i) main kinematic parameters (total motility and progressive motility) through CASA (computer-assisted sperm analysis); ii) acrosome and membrane integrity (propidium iodide þ Pisum sativum agglutinin staining, PIþPSA); iii) flow cytometry for sperm chromatin structure assay (SCSA, acridine orange staining), mitochondrial activity (Mitotracker Orange), and ROS production (H2DCFDA). Moreover, an aliquot of semen from each group in each time step was fixed and processed for transmission electron microscopy to assess intracellular uptake of CeO2 nanoparticles by spermatozoa. Increasing concentrations of nanoceria did not affect the main kinematic parameters of ram semen; there were no differences in total and progressive motility among groups at any time point during the 24 h of incubation (P . 0.05). Integrity of the acrosome and cytoplasmic membranes, assessed through PIþPSA staining, was not affected by nanoceria in any group (P . 0.05). Moreover, exposure to nanoparticles did not increase DNA fragmentation (P . 0.05), and there was no difference in the amount of ROS produced and mitochondrial activity within the 24 h of incubation with nanoceria (P . 0.05). Absence of internalization of the nanoparticles by spermatozoa and occasional interaction between the sperm surface and nanoceria were observed by transmission electron microscopy analysis. In the present study, exposure of ram spermatozoa to increasing doses of nanoceria was not cytotoxic; furthermore, high concentrations of these nanoparticles were well tolerated. These data open new perspectives on the biomedical use of nanoceria and provide more information about their impact on male gametes.

Male Physiology


267

223

EFFECT OF SEMINAL PLASMA IN LAMA GLAMA SPERM

M. Carretero, F. Fumuso, M. Miragaya, C. Herrera, and S. Giuliano Instituto de Investigacioń y Tecnologıá en Reproduccioń Animal, Facultad de Ciencias Veterinarias, UBA, Buenos Aires, Argentina In South American camelids, raw semen only presents sperm with oscillatory movements. Therefore, it is necessary to treat these cells to enable them to acquire progressive motility. The effects of raw seminal plasma (SP) on sperm movement patterns (oscillatory, progressive, and hyperactive) have apparently not yet been reported. The objective of this study was to determine effects of raw seminal plasma on sperm motility, viability, and acrosomal status in fresh llama semen. A total of 15 ejaculates were collected (electroejaculation) from 5 llamas (n ¼ 5, r ¼ 3). Each ejaculate was diluted 4 : 1 in 0.1% collagenase in HEPES-TALP (HT) medium and incubated 4 min at 378C, with the objective of separating spermatozoa from SP. Immediately after incubation, each ejaculate was divided into 2 and centrifuged for 8 min at 800 g. Pellets were resuspended in either HT or raw SP and maintained at 378C until evaluation (at 0, 1.5, and 3 h). Sperm motility was evaluated using a phase contrast microscope and a warm stage. Propidium iodide and carboxyfluorescein diacetate were used for assessing membrane integrity (viability). Acrosomal status was evaluated with the Coomassie blue stain. A split-plot design was used with treatment as a factor, with 2 levels (HT and SP) and time as the other factor, with 3 levels (0, 1.5, and 3 h), and blocked by males. There was no significant interaction between treatments (HT and SP) and times (0, 1.5, and 3 h) for each of the seminal characteristics evaluated. Progressive sperm motility was observed after collagenase treatment in all samples. Progressive motility disappeared immediately after the addition of raw SP and showed only oscillatory movements. In contrast, samples incubated in HT maintained progressive motility and became hyperactive. There were no differences (P . 0.05) in total motility of sperm incubated in HT among incubation times (0 h: 30.8 18.9%; 1.5 h: 26.5 11.5%; and 3 h: 21.5 13.5%). However, in samples incubated with SP, a decrease (P , 0.05) in total sperm motility was detected after 3 h of incubation (0 h: 16.5 12.6%, 3 h: 2.3 3.2%). Sperm viability was not different (P . 0.05) between treatments (HT and SP); samples incubated in HT retained 78.4% of the initial viability (32.8/41.8, 3 h/0 h), and samples incubated in SP retained 69.7% of their initial viability (24.4/35.0, 3 h/0 h). The percentage of spermatozoa with intact acrosomes was not different (P . 0.05) between treatments (HT and SP); however, the percentage of sperm with intact acrosomes decreased after 3 h of incubation in both samples (HT and SP). Due to the presence of a high percentage of progressive and hyperactive motile sperm in samples incubated in HT and their absence in samples incubated in SP, we concluded that raw seminal plasma preserved oscillatory sperm motility. Further studies are needed to understand the effects of SP on South American camelid spermatozoa.

268

ROLE OF ATPASE MOTOR CYTOPLASMIC DYNEIN AND PRIMARY CILIA IN TESTICULAR MORPHOGENESIS C. Dores and I. Dobrinski

Department of Comparative Biology & Experimental Medicine, Faculty of Veterinary Medicine, University of Calgary, Calgary, Alberta, Canada In vertebrates, the primary cilium is a nearly ubiquitous organelle present in somatic cells, but little is known about its function in the male gonad. We investigated the role of primary cilia in testis cells using in vitro formation of seminiferous tubules and in vitro culture of testicular somatic cells by inhibiting the primary cilium with CiliobrevinD, a cell-permeable, reversible chemical modulator that inhibits the major component of the organelle: ATPase motor cytoplasmic dynein. We analysed in vitro cultures for the presence of primary cilia and the activation of hedgehog signalling through translocation of Gli2 to the nuclei; in vitro tubule formation was evaluated by length and width of tubules formed. Methods: testicular cells were harvested from neonatal pigs by 2-step enzymatic digestion. Cells (50 106 mL1) were plated on 100 mm Petri dishes in 15 mL of DMEM þ 5% FBS þ 50 U of penicillin and incubated at 378C in 5% CO2 in air overnight, cells remaining in suspension and those slightly attached were removed and the somatic cells attached were trypsinized to obtain a single cell suspension, and then submitted to two different protocols: in vitro culture (A) or in vitro tubule formation (B), n ¼ 5 replicates each. For A, somatic cells were replated on coverslips in 24-well plates and cultured in serum free media for 48 h, then for the treated group, 10 mM of CiliobrevinD was added for 24 h, attached cells from control and treated groups were fixed in 4% PFA and characterised by immunocytochemistry for ARL13B, Vimentin, and Gli2. For B: 1 106 cells were added to 24-well plates coated with 1 : 1 diluted Matrigel, the control group was kept in serum free media and to the treated group was added 20 mM CiliobrevinD at Day 0. Results: A) primary cilia were present in 89.3 2.3% of cells cultured in serum-free media for the control group and Gli2 was located in the nuclei of 90.2 1.2% of cells; in the CiliobrevinD-treated group the percentage of primary cilia decreased (P , 0.05) to 3.1 2.5% and nuclear Gli2 to 3.9 0.7; B) tubules formed in the control group were significantly longer and wider than the ones formed when CiliobrevinD was added (9.91 0.35 v. 5.540 1.08 mm and 339.8 55.78 v. 127.2 11.9 mm, respectively, P , 0.05 by Student’s t-test). In conclusion, the inhibition of ATPase motor cytoplasmic dynein perturbs formation of primary cilia in testicular somatic cells, blocks Hedgehog signalling, and impairs in vitro tubule formation. Therefore, primary cilia on testicular somatic cells appear to be essential for testicular morphogenesis. Research was supported by 5 R01 OD016575-13.

269

EFFECT OF DIFFERENT COLLECTION FREQUENCY INTERVALS ON THE QUALITY OF SEMEN OF FRENCH BULLDOGS C. B. Deorce, F. L. G. Leite, and B. Loureiro Universidade Vila Velha, Vila Velha, Espirito Santo, Brazil

Dogs produce fewer sperm than other species. Furthermore, for French Bulldogs, anatomical peculiarities, low libido, and increased sensitivity to stress could cause further reductions in sperm count. The objective was to compare effects of semen collection at 24- versus 48-h intervals on semen quality of French Bulldogs. Five purebred French Bulldogs, 19 to 48 months old, were subjected to 5 semen collections (24 h apart). After a 30-day

224


Male Physiology

rest, collections were repeated, but the interval between collections was 48 h. Semen was collected (all 3 fractions) by digital manipulation without female stimuli. Volume was measured in a 20-mL syringe. Sperm concentration was determined with a Neubauer counting chamber. Motility and vigor were evaluated with a coverslipped drop of semen on a slide (preheated to 378C). Motility was expressed as a percentage of motile sperm, and vigor was classified on a scale of 1 to 5. Morphology was evaluated by the panoptic method; 100 cells were counted and results expressed as the percentage of normal or defective cells. Effects of collection interval were analysed using PROC MIXED of SAS (animal as subject and collection as a repeated measure), with collections 2 to 5 compared with collection 1 (using the DIFF option). For collection every 24 h, the third, fourth, and fifth sperm collections were lower than the first collection for volume (10.4 1.1, 8.3 1.1, 5.6 1.1, 3.5 1.1, 2.4 1.1 mL), concentration (437 24, 448 24, 370 24, 322 27, 258 31 106 sperm mL1), vigor (4.6 0.2, 4.2 0.2, 3.6 0.2, 3.7 0.2, 3 0.2), and morphologically normal sperm (82 2.2, 83 2.2, 72 2.2, 68 2.5, 66 2.9%). However, when the interval was increased to 48 h, only the fourth and fifth collections were lower (P , 0.05) than the first for volume (11.8 1.1, 10.2 1.1, 8.8 1.1, 6.6 1.1, 2.5 1.1 mL), concentration (447 24, 410 24, 407 24, 322 24, 241 31 106 sperm mL1), vigor (5 0.2, 4.8 0.2, 4.4 0.2, 4.2 0.2, 4 0.2), and sperm with normal morphology (92 2.2, 90 2.2, 87 2.2, 80 2.2, 81 2.9%). Motility decreased (P , 0.05) following the fourth collection at 24-h intervals and decreased (P , 0.05) after the third collection at 48-h intervals. With a 24-h interval, 4 dogs had ,60% motility lower at the fifth collection, whereas only 2 dogs had motility ,60% on the fifth collection at 48-h intervals. In conclusion, semen collected at 48-h intervals was of better quality than semen collected at 24-h intervals.

270

PROGRESSIVE INCORPORATION OF CENEXIN IS RELATED TO SPERM MATURATION DURING EPIDIDYMAL TRANSIT IN THE DOMESTIC CAT T. RowlisonA,B, M. A. OttingerC, and P. ComizzoliB A

Department of Animal Sciences, University of Maryland, College Park, MD, USA; Department of Reproductive Sciences, Smithsonian’s National Zoological Park, Washington, DC, USA; C Department of Research & Intellectual Property Management, University of Houston–Central, Houston, TX, USA B

The sperm centrosome is an essential organelle playing a key role just after penetration into the oocyte. It serves to organise the sperm aster, which is required for syngamy and formation of the first mitotic spindle. It is also associated with acquisition of motility during epididymal transit. Previously, we demonstrated that testicular spermatozoa exhibit reduced developmental potential after oocyte injection due to the presence of an immature centrosome [Comizzoli et al. 2006 Biol. Reprod. 75, 252–260]. Centrosome and flagellum maturation naturally occur during epididymal transit where secreted proteins impart changes on the sperm to acquire its functional properties. The objective of this study was to better understand centrosome and flagellum maturation and identify key proteins that could be used to artificially mature testicular spermatozoa. Specifically, we focused our effort on cenexin, a protein that has been reported to aid in maturation of the flagellum and somatic cell centrosome. Epididymides were dissected from adult cat testes (.1 yr old). Spermatozoa were then extracted from the different regions (caput, corpus, cauda, and vas deferens) by slicing with a scalpel blade in phosphate buffered saline at 378C and processed separately. Control samples were also collected from the rete testis. After recording sperm motility and forward progressive movement (FPM, from 0 ¼ immotile to 5 ¼ fast and straight), cells were fixed in 4% paraformaldehyde and immunostained with anti-cenexin antibodies labelled with a fluorescent probe. The proportion of cells with cenexin at the location of the centrosome and the intensity of immunofluorescence were quantified (n ¼ 8 and 4 testes, respectively). The same methods were followed for detection of cenexin in the tail portion (n ¼ 4 testes). Statistical analyses were conducted using repeated-measures and treatments were further compared using either a protected Tukey’s or F-test for orthogonal contrasts. The proportion of sperm with cenexin localised at the centrosome progressively increased along the tract with the lowest percentage of stained cells in the testis and highest proportion in the cauda (45 v. 81%, T28 ¼ 4.65, P , 0.0001). Among the labelled sperm, the intensity of immunofluorescence also significantly increased from the testis to vas deferens (4.33 v. 8.57 mean grey value; T12 ¼ 3.29, P , 0.0065). Both motility and FPM increased from the testis to cauda segment (0 v. 93%, F4,15 ¼ 13.53, P , 0.0001 and 0 v. 3.8 FPM, F4,15 ¼ 26.67, P , 0.0001); however, the proportion with cenexin in the tail (range, 20 to 36%) as well as the labelling intensity (range, 3.14 to 5.26 mean grey value) did not change (P . 0.05) along the tract. These results clearly indicate that cenexin may be associated with centrosome but not flagellum maturation. Epididymal epithelial cells and luminal fluid from each segment are being examined to better understand the source of cenexin secretion and its incorporation into spermatozoa. Results from these studies will aid in further understanding the physiology of sperm maturation during epididymal transit and increase male fertility preservation options.

271

INDUCTION OF OVULATION IN RABBIT DOES USING PURIFIED NERVE GROWTH FACTOR AND CAMEL SEMINAL PLASMA

M. MasdeuA, R. M. Garcia-GarciaA, R. CardinaliB, P. MillanA, M. Arias AlvarezA, C. CastelliniB, P. L. LorenzoA, and P. G. RebollarC A

Complutense University, Madrid, Spain; B University of Perugia, Perugia, Italy; C Polytechnic University, Madrid, Spain

The presence of an ovulation-inducing factor (OIF) in the seminal plasma (SP) of several species with spontaneous and induced ovulation, including the rabbit, has been documented. Recent studies have demonstrated that the OIF in the SP of camels (SPCAM) is a nerve growth factor (b-NGF). The aim of this study was to determine if purified b-NGF from mouse submandibular glands or SPCAM could provoke ovulation induction in the rabbit doe. A total of 35 females were synchronized with 25 IU of equine chorionic gonadotropin (Serigan, Laboratorios Ovejero, Spain) and allocated into 4 groups. Fortyeight hours later (Day 0), does were given a single dose (IM) of 1 mL of saline solution (SS; n ¼ 8); 1 mL of gonadorelin (GnRH; Inducel, Laboratorios Ovejero, Spain; n ¼ 9); 24 mg of b-NGF (2.5S-NGF; Promega, USA; n ¼ 10); or 1 mL of centrifuged raw camel SP (SPCAM; 127 pg mL1 NGF; n ¼ 8). After treatment, an empty catheter was introduced through the vagina to simulate the nervous/mechanical stimulus of coitus (4 animals per group). Plasma

Oocyte Activation


225

LH concentrations were determined in blood samples taken 30 min before treatment and at 0, 30, 60, 90, and 120 min after injection. Progesterone concentrations were assessed at 0 and 120 min and every 2 days until Day 6 after treatment. Concentrations of b-NGF in camel SP and hormone determinations were made by enzyme immunoassay. Ovulation rate (OR) was determined after euthanasia on Day 7. Statistical analyses using CATMOD and MIXED procedures of the SAS program to compare OR data and hormone concentrations, respectively, were performed. Ovulation occurred in 100% of GnRH (9/9), 33% (3/10) of NGF, 25% (2/8) of SS, and 0% (0/8) of SPCAM groups. Both NGF and SS ovulated females had significantly lower LH concentration than GnRH group throughout all preovulatory surge (P , 0.001). When does were not stimulated with catheter introduction, only those from the GnRH (5/5) and NGF (1/6) groups ovulated. Total number of corpora lutea in ovulated does was similar (15.9 1.9, 17.0 4.2, and 14.3 3.1 CL in GnRH, SS, and NGF groups, respectively). Plasma P4 concentrations were normally increased from Day 2 to 6 in ovulated rabbits of all groups, but were lower at 120 min (P , 0.001) for the NGF and SS does, reaching similar levels than GnRH does at 6 days post-treatment. In the present study, b-NGF from mouse submandibular glands, but not from raw camel SP, induced ovulation in rabbit females, independently of nervous stimulus. Nonetheless, the possible low dose of b-NGF used and the origin could have been responsible for the lack of a more acute effect. We acknowledge CM, FSE, and AGL2011-23822 for funding.

272

EFFECT OF DIETARY RESTRICTION ON SPERM CHARACTERISTICS AND OXIDATIVE STATUS ON TESTICULAR TISSUE IN YOUNG RATS EXPOSED TO LONG-TERM HEAT STRESS N. AydilekA,B, O. VarisliB, M. S. KayaA, A. KocyigitB, and A. TaskinB A

Dicle University, Diyarbakir, Turkey; Harran University, Sanliurfa, Turkey

B

The objective was to evaluate effects of dietary restriction on oxidative status and sperm parameters in rats exposed to long-term heat stress. Forty healthy Sprague-Dawley rats (2.5 months old) were equally allocated into 4 groups (with respect to diet and temperature): room temperature (228C)-ad libitum; room temperature-dietary restriction (40%); high temperature (388C)-ad libitum; and high temperature-dietary restriction. At the end of the 9th week, some oxidants (lipid hydroperoxide, total oxidant status, oxidative stress index) and some antioxidants (total antioxidant status, sulfhydryl groups, ceruloplasmin, paraoxonase and arylesterase activities) were measured in testicular tissues. In addition, concentration, motility, volume, abnormal sperm count, acrosome and membrane integrity of epididymal sperm were also evaluated. All data were analysed by 2-way ANOVA (P , 0.05). High temperature did not significantly affect most oxidative and antioxidative parameters (except for sulfhydryl groups and ceruloplasmin), yet it impaired all sperm values. Neither sperm values nor oxidative status, with the exception of sulfhydryl groups, ceruloplasmin and arylesterase in the testis tissue, were significantly affected by dietary restriction. We concluded that long-term heat stress did not significantly affect testicular oxidative status in young rats, although sperm were sensitive to heat stress. Furthermore, dietary restriction failed to improve sperm quality and oxidative status, except some individual antioxidant parameters in young rats exposed to long-term heat stress.

Oocyte Activation 273

EFFECT OF IONOMYCIN ASSOCIATED WITH ROSCOVITINE, DEHYDROLEUCODINE, CYCLOHEXIMIDE, OR ETHANOL ON HAPLOID ACTIVATION OF BOVINE OOCYTES M. Suva´, N. G. Canel, and D. F. Salamone Facultad de Agronomıá-Universidad de Buenos Aires, Buenos Aires, Argentina

Haploid activation of bovine oocytes after ICSI is a routine procedure. However, embryos frequently contain an abnormal chromosome set as a result of the drugs employed. We compared the efficiency of ionomycin (Io) followed by roscovitine (ROSC), cycloheximide (CHX), ethanol, and dehydroleucodine (DhL) to induce haploid parthenogenetic activation in bovine. Pronuclear (PN) formation, second polar body (2PB) extrusion, embryo development, and ploidy of blastocysts were evaluated. To this aim, COC were aspirated from slaughtered ovaries and IVM for 22 h. Oocytes were activated with 5 mM of Io for 4 min and then randomly allocated into 1 of the following treatments: 25 or 50 mM ROSC or 10 mg mL1 of CHX for 5 h; 15 or 30 mM DhL for 3 h; or 5 min of exposure to 7% ethanol 4 h post-Io. Controls were Io followed by (1) 3 h in TCM-199 and 3 h in 1.9 mM 6-DMAP (Io-3h-DMAP) and (2) 3 h of exposure to 1.9 mM 6-DMAP (Io-DMAP). Oocytes were cultured in SOF medium. The PN formation and 2PB extrusion were assessed by 5 mg mL1 of propidium iodide oocyte staining, 17 h after Io. Cleavage, morulae, and blastocyst stages were evaluated at Days 2, 5, and 8 of in vitro development, respectively. Chromosome number of blastocysts was evaluated by Giemsa staining. Data were analysed by Fisher’s test (P , 0.05). Rates of 2PB extrusion were 75, 61.1, 60, 56.3, 54.6, and 42.9% for 15 mM DhL (n ¼ 23), 50 mM ROSC (n ¼ 22), Io-3hDMAP (n ¼ 9), CHX (n ¼ 17), 25 mM ROSC (n ¼ 22), and ethanol (n ¼ 22), respectively, with no differences between groups. A PN was observed in over 81% of the oocytes activated with ethanol, 25 mM ROSC, CHX, 50 mM ROSC, and 15 mM DhL. Lower percentages of 2PB extrusion and PN formation were observed for 30 mM DhL (n ¼ 22; 6.3 and 0%, respectively). The highest cleavage rates were 83.2% for 25 mM ROSC (n ¼ 185), not differing from 78% in Io-DMAP (n ¼ 159). Cleavage rates for 50 mM ROSC (n ¼ 185), CHX (n ¼ 143), and ethanol (n ¼ 74; 80.5, 80.4 and 67.6%, respectively) were not different from Io-3h-DMAP (n ¼ 78; 71.8%) and Io-DMAP. Cleavage rates for 15 mM DhL (n ¼ 70) and 30 mM DhL (n ¼ 93) were the lowest (48.6 and 25.8%). Blastocyst rates were the highest for CHX and 50 mM ROSC, not differing from Io-3h-DMAP (21.7 and 10.8 v. 18%). Very few or no blastocysts were obtained with ethanol, 25 mM ROSC, 30 mM DhL, and 15 mM DhL (4.1, 3.8, 1.1, and 0%, respectively), although ethanol was not different from Io-3h-DMAP. Chromosome number analysis showed that ethanol (n ¼ 2) and CHX (n ¼ 2) resulted in a higher percentage of haploid embryos (50% each), followed by 50 mM ROSC (n ¼ 8), 25 mM ROSC (n ¼ 3), and Io-3h-DMAP (n ¼ 8; 37.5, 33.3% and 12.5%, respectively), although they were not different. Remaining embryos were diploid, aneuployd, or mixoployd. In conclusion, DhL and ROSC proved to be as effective as CHX or ethanol regarding 2PB extrusion and resulting ploidy, defining features when activating oocytes in ART, suggesting they could be efficiently used in bovine to assist ICSI.

226


Oocyte Maturation

Oocyte Maturation 274

LIPOLYSIS IN CUMULUS CELLS ACCOMPANIES OOCYTE MATURATION IN BOVINE S. Uzbekova, L. Sanchez-Lazo, A. Desmachais, V. Maillard, and S. Elis INRA UMR85 Physiologie de la Reproduction et des Comportements-CNRS UMR7247-Universite´ François Rabelais de Tours-IFCE, Nouzilly, France

Oocyte maturation relies on energy from different nutrients, including fatty acids (FA). Cumulus cells (CC) are metabolically coupled with enclosed oocyte and active FA metabolism occurs in both compartments. Excess of lipids in oocyte environment alters its developmental competence. Lipid droplets (LD), mainly composed of triacylglycerides (TG), are formed inside of CC and in oocyte to store lipids. Liberation of free FA from TG requires lipolysis, which is catalyzed by lipases and involves FA-binding proteins (FABP) and perilipins (PLIN), which interact at the surface of LD as shown in lipogenic tissues. The objective was to elucidate the main factors involved in lipolysis in bovine cumulus-oocyte complex (COC) during oocyte maturation. Gene expression before and after maturation was analysed in CC by microarray hybridization and validated by real time RT-PCR; proteins were detected by Western blot and immunofluorescence. For statistics, ANOVA and Mann-Whitney (M-W) tests were used. In CC, adipose triglyceride lipase PNPLA2, lipoprotein lipase LPL, and monoacylglycerol lipase ABHD6 showed the highest mRNA expression level among 7 detected lipases. Both PLIN5 and PLIN2 were the most abundant perilipins, and among 8 FA-binding proteins, FABP3 and FABP5 were predominant. During in vitro maturation (IVM), expression of most of these genes increased at 6 h of IVM (P , 0.05, ANOVA) in CC. At that time, germinal vesicle breakdown occurred in enclosed oocytes and hyaluronan synthase HAS2, involved in the extra-cellular matrix formation, was upregulated in CC. The most upregulated genes after 18 h of IVM in CC were ABDH6 (48.5-fold as compared to immature, P , 0.01, M-W), FABP3 (16.6-fold, P , 0.01, M-W), and PLIN2 (5.5-fold, P , 0.05, M-W). Expression of all of these lipolysis-related genes was also detected in the oocytes. At the protein level, PLIN2 was mainly localised in the cytoplasmic LD, both in CC and in the oocyte. In CC, FABP3 was detected in the cytoplasm, whereas in oocyte it was also localised to the germinal vesicle of immature oocytes and closely to the chromosomes during the first meiotic division. In addition, active phosphorylated hormone sensitive lipase HSL was always detected in CC and in mature oocytes, but not in immature oocytes. All these data demonstrate that lipolysis occurs both in CC and in the oocyte during maturation. Lipolysis may be necessary to maintain cell energy homeostasis by regulating intracellular concentration of free FA. Moreover, CC were already described to store the excess FA from follicular fluid in order to protect the oocyte. Our data corroborate the essential role of CC in oocyte survival through controlling FA metabolism inside the COC. Active lipolysis may therefore be required to reduce lipid storages as well as to produce energy necessary for oocyte meiosis progression and extracellular matrix secretion by CC in order to prepare COC for further fertilization. This work was supported by INRA, ANR (OSCILE project) and European subvention FP7-KBBE-2012–6 (FECUND project).

275

TEMPORAL PATTERN OF STEROID HORMONE CONCENTRATIONS DURING IN VIVO AND IN VITRO MATURATION OF BOVINE OOCYTES C. Blaschka, H. Stinshoff, F. Poppicht, and C. Wrenzycki Clinic of Veterinary Obstetrics, Gynecology and Andrology, Justus-Liebig-University, Giessen, Germany

Steroid hormone concentration and property can be modulated via different processes. Sulfoconjugation via sulfotransferases (SULT) changes steroids from hydrophobic to hydrophilic, necessitating a transport system such as the sodium-dependent organic anion transporter (SOAT; SLC10A6). Steroid sulfatase (STS) removes the sulfate moiety from conjugated steroids, transforming them to the free active ones. Moreover, present in vitro maturation systems do not completely mimic the in vivo situation resulting in oocytes of reduced quality. The present study investigates the local effects of sulfated steroids during follicular and oocyte development in vivo and in vitro. Follicles of bovine abattoir-derived ovaries were categorized according to their size (3 to 5, 6 to 8, 9 to 14, and .15 mm) after dissection and measurement via a caliper. Only nonatretic follicles were used (Kruip and Dieleman, 1982). Follicular fluid was collected via aspiration and analysed for the presence of steroids and their sulfated counterparts via LC-MS/MS. Moreover, oocytes were in vitro maturated with a standard protocol. The medium was measured via radioimmunoassay after 0, 4, 8, 12, 16, 20, and 24 h to detect 17b-oestradiol (E2) and progesterone (P4). Data were tested using analysis of variance (ANOVA) followed by multiple pairwise comparisons using Tukey’s test. A P-value of #0.05 was considered significant. It was possible to detect 17b-oestradiol, progesterone, testosterone, 17b-oestradiol sulfate, estrone sulfate, pregnenolone sulfate, cholesterol sulfate (Table 1), and furthermore androstendione, estrone, androsterone, and 17OH-pregnenolone. During IVM, P4 significantly increased in the medium (4 h: 3.3 1.0 ng mL1; 24 h: 9.8 1.7 ng mL1), whereas the E2 concentration did not change (4 h: 52.8 12.1 pg mL1; 12 h: 68.4 3.7 pg mL1; 24 h: 66.9 19.7 pg mL1). In addition, preliminary data suggest that transcripts of the steroid metabolizing and transporting enzymes (SULT1E1, STS, SLC10A6) were present in cumulus cells from immature bovine COC. These results indicate for the first time that only small amounts of sulfated steroids are present in bovine follicular fluid. However, the related enzymes are present at the mRNA level. Further studies are underway to analyse the protein level. Table 1. Steroid hormone concentration in follicular fluid Follicle size

E2 (ng mL1)

P4 (ng mL1)

T (ng mL1)

E2S (ng mL1)

E1S (ng mL1)

PREGS (ng mL1)

CHOLS (ng mL1)

3–5 mm 6–8 mm 9–14 mm .15 mm

15.0 9.1a 43.7 19.8ab 144.1 54.8b 94.3 88.5ab

118.8 97.0 118.2 54.5 97.1 54.3 108.4 95.6

16.3 2.0 11.6 8.8 8.8 2.5 8.6 6.8

0.5 0.5b 0.1 0.1b 1.7 0.1a 2.1 0.1a

1.0 0.0a 0.3 0.1b 0.2 0.1b 0.2 0.1b

0.7 0.2 1.0 0.3 1.0 0.2 1.1 0.2

50.2 11.4ac 69.7 12.8a 64.8 12.4a 35.8 14.3bc

We thank Prof. Dr Wudy and A. Sańchez Guijo for the LC-MS/MS analysis. Furthermore, we gratefully acknowledge the financial support of the German Research Foundation (DFG; FOR 1369).

Oocyte Maturation


227

276 PHOSPHOINOSITIDE 3-KINASE REGULATES EXPRESSION OF KEY ENZYMES AND CELLULAR TRANSPORTERS OF GLUCOSE METABOLISM IN CUMULUS CELLS OF BOVINE COCS CULTURED IN VITRO D. Kaiser de SouzaA,D, L. P. SallesA,B, R. CamargoA,C, B. Dolabela de LimaA,C, F. A. G. TorresA,B, and A. A. M. Rosa e SilvaA,D A

University of Brasilia, Brasilia, DF, Brazil; Laboratory of Molecular Biology, Department of Cellular Biology, Brasilia, DF, Brazil; C Laboratory of Microbiology, Department of Cellular Biology, Brasilia, DF, Brazil; D Laboratory of Biotechnology of Reproduction, Brasilia, DF, Brazil

B

The aim was to analyse the function of the PI3K pathway during oocyte maturation in bovine by use of the specific inhibitor, LY294002. Genes studied in cumulus cells (CC) were PDH, G6PDH, GLUT1, and GLUT4. PDH is an important enzyme for oxidative metabolism, G6PDH is related to resumption and progression of oocyte meiosis, and GLUT1 and GLUT4 are glucose transporters. This study was performed in defined medium (MIV B) in absence or presence of 10 ng mL1 of FSH. Polar body extrusion was analysed after culture and correlated with gene expression. Experimental methods were bovine COC (n ¼ 35–40/well, n ¼ 3 replicates) collected from ovaries obtained from abattoirs (DF, Brazil) and cultivated in either 400 mL of medium MIV B, or MIV B þ 100 mM of LY294002, or MIV B þ 10 ng mL1 of FSH; or MIV B þ 10 ng mL1 of FSH þ 100 mM of LY294002 during 22 to 24 h. After culture, COC were mechanically denuded and CC from 20 COC/group were isolated. Gene expression of GLUT1, GLUT4, G6PDH, and PDH were measured by real time PCR. The CC of immature COC were also collected and analysed as the calibrator group. Student-Newman-Keuls was performed as a statistical test. The percentage of oocytes that extruded the polar body was determined. Two-way ANOVA, followed by Bonferroni test, and t-test were performed to determine statistical significance. In MIV B, the polar body extrusion rate was 25.48 7.64%, while FSH increased it up to 74.52 10.58% (P , 0.05). The extrusion of polar body was inhibited by LY294002 in the absence or presence of FSH (67.51 6.13 and 31.02 16.97%, respectively, P , 0.05). Gene expression of PDH was not altered by any culture medium in contrast to GLUT1, GLUT4, and G6PDH expression (Table 1). Only G6PDH expression showed the same pattern as the polar body extrusion, in absence or presence of FSH. In conclusion, PI3-K inhibition affects polar body extrusion and expression of genes related to glucose metabolism in CC. Lower G6PDH expression in CC may be related to low rates of polar body extrusion in treated oocytes. Table 1. Gene expression of GLUT1, GLUT4, and G6PDH in CC of COC after culture Item GLUT1 GLUT4 G6PDH

0FSH 0LY

0FSH 100LY

10FSH 0LY

10FSH 100LY

0.48 0.27a,d 0.68 0.32a 3.76 1.08a

0.35 0.2a 0.34 0.13b 2.46 0.69b

0.59 0.21b,d 0.46 0.28b 2.61 0.67b

0.88 0.34b,d 0.47 0.26b 1.19 0.27c

a–d

Different letters indicate significant difference among groups. Letter d indicates no difference among groups in GLUT1 expression.

The authors thank FAP-DF (193.000.577/2009), CNPq, CAPES and Ponte Alta abattoir, Brasilia.

277

LIPID ACCUMULATION DURING BOVINE OOCYTES GYR/HOLSTEIN MATURATION COLLECTED BY OPU IN SPOM SYSTEM G. R. LealA, C. A. S. MonteiroA, H. F. R. A. SaraivaB, A. J. R. CamargoC, C. O. P. VasconcelosA, A. L. R. RodriguesA, A. G. NogueiraA, R. V. SerapiaõC, and C. S. OliveiraB B

A Universidade Federal Fluminense, Niteroí, RJ, Brazil; Embrapa Dairy Cattle – LRA CESM, Valença, RJ, Brazil; C PESAGRO-RIO, Niteroí, RJ, Brazil

In vitro embryo production (IVP) is an important tool for cattle breeding. Brazilian dairy systems are based on Gyr/Holstein crossbreds, which integrates adaptability to tropical conditions and milk production. Oocyte quality is crucial for IVP, and lipid accumulation is a detrimental factor. The aim of this study was to assess the effect of SPOM maturation system (Albuz et al. 2010 Hum. Reprod. 25) on lipid accumulation in bovine oocytes. Oocytes obtained by ovum pick-up (OPU) from heifers without ovarian stimulation were transferred to control media (TCM 199 þ sodium pyruvate, ITS, penicillin-streptomycin, BSA, FSH, oestrogen, and hCG) or SPOM (2 h pre-IVM: TCM 199 hepes þ sodium pyruvate, ITS, penicillinstreptomycin, BSA, IBMX, and forskolin; followed by 28 h IVM: control media þ cilostamide) in 5% CO2 atmosphere at 388C. Oocytes were collected after 20, 24, and 28 h (groups: C20, C24, C28; S20, S24, S28) and evaluated for nuclear maturation using HOECHST (experiment 1, n ¼ 301, 35–62 per group) and lipid content using Oil Red (experiment 2, n ¼ 163, 14–42 per group). Oocytes from 4 replicates were fixed with PFA and stored at 48C. For Oil Red, all structures were stained and evaluated at the same day. After being washed in 50% ethanol, oocytes were incubated in 0.2% Oil Red O solution for 10 min. Stained area fraction in each oocyte cytoplasm was measured using ImageJ (NIH). Nuclear maturation analysis was performed by Chi-squared test and Lipid analysis by Kruskal-Wallis and Dunn’s post-test (P ¼ 0.05). Distinct superscript letters indicate statistical difference between groups. In experiment 1, we detected a reduction in the percentage of matured (MII) oocytes only in S20 group (C20 ¼ 64.28%a, C24 ¼ 74.28%a, C28 ¼ 60.46%a, S20 ¼ 25.8%b, S24 ¼ 59, 01%a, S28 ¼ 74.13%a). In experiment 2, we detected an increase in lipid content in both control and SPOM groups from 20 to 28 h of IVM (S20 ¼ 5.72a 4.41, S24 ¼ 15.95bd 7.41, S28 ¼ 37.46c 8.68, C20 ¼ 8.65a 2.58,

228


Oocyte Maturation

C24 ¼ 12.14ad 8.08, C28 ¼ 18.50b 8.09). For SPOM groups, the lipid content increased 2.78-fold from S20 to S24, and 6.54-fold from S20 to S28. In the control group, only in C28 wasa lipid increase detected, 2.13-fold higher than C20 content. Comparing control and SPOM groups at each time point, S28 displayed a 2.02-fold increase in lipid content compared to C28. We concluded that despite SPOM system being effective in maintaining meiotic arrest until 20 h of IVM and forskolin being present during pre-IVM in SPOM groups, Gyr/Holstein crossbreed oocytes obtained by OPU presented a significant increase in lipid content when matured in SPOM system, even higher than observed for the control group. During the last 8 h of IVM we observed a huge lipid accumulation in both systems, suggesting this might be a crucial period.

278 INFLUENCE OF NITRIC OXIDE AND PHOSPHODIESTERASE INHIBITORS ON CYCLIC NUCLEOTIDES AND MEIOSIS RESUMPTION IN BOVINE OOCYTES IN VITRO MATURED R. C. Botigelli, K. R. L. Schwarz, F. G. Zaffalon, and C. L. V. Leal Faculdade de Zootecnia e Engenharia de Alimentos/USP, Faculdade de Zootecnia e Engenharia de Alimentos/USP, Pirassununga, SP, Brazil Nitric oxide (NO) is a local action mediator of essential hormones and neurotransmitters that regulate several physiological processes in reproduction. Nitric oxide activates soluble guanylate cyclase (sGC), and results in the production of cyclic guanosine monophosphate (cGMP). This nucleotide is involved in oocyte maturation and, consequently, in the success of fertilization. In addition to cGMP, another cyclic nucleotide, cAMP, is also related to maturation. The levels of these nucleotides are balanced by synthesis and degradation is made by phosphodiesterases (PDE). The aim of this study was to analyse the effect of NO and PDE inhibitors on cyclic nucleotides concentrations and meiosis resumption in bovine oocytes matured in vitro. In experiment 1, cumulus-oocyte complexes (COC) were cultured in maturation medium with a NO donor (0.1 mM S-nitroso-N-acetylpenicillamine; SNAP) associated or not with a PDE5 inhibitor (10 mM sildefanil; SILD) for 1 h; after this period, cGMP levels (40 COC/group) were measured in COC using commercial enzyme immunoassay kits (EIA). Immature (0 h) and control COC (untreated) were measured as well. In experiment 2, COC were cultured for 9 h in maturation medium with an NO donor (0.1 mM SNAP) associated or not with inhibitors the PDE5 (10 mM SILD), PDE3 (20 mM cilostamide; CIL), or PDE8 (50 mM dipyridamole; DIP) and assessed for meiosis resumption (%GVBD; 100 COC/treatment). In experiment 3, COC were cultured as in experiment II and cAMP levels (10 COC/group) were measured after 1 h in culture using commercial EIA kits. Immature COC were also measured. Statistical analyses were performed using the SAS system. Data were tested for normal distribution and were transformed (arcsine; GVBD). The percentages of GVBD were analysed by one-way ANOVA followed by Bonferroni post-hoc test (4 replicates). The cGMP and cAMP levels were analysed by two-way ANOVA followed by Bonferroni post-hoc testing (5 replicates). Differences with probabilities of P , 0.05 were considered significant. In experiment 1, cGMP levels decreased from 0 to 1 h in control and SNAP groups (P , 0.05). When SNAP was associated with SILD, cGMP levels were similar to immature oocytes (P . 0.05%). In experiment 2, all treatments delayed meiosis by decreasing GVBD rates (24.7 2.8 to 56.9 8.6%) when compared to controls (77.1 1.8%, P , 0.05). However, SNAP þ CIL had the lowest GVBD rates (24.7 2.8%, P , 0.05). In experiment 3, cAMP levels declined from imature COC (93 7 fmol/COC) to 1 h in all treatments (21 6 to 10 5 fmol/COC; P , 0.05). The results indicate that NO and PDE inhibitors during maturation were ineffective in preventing the decrease in cyclic nucleotides levels during the first hour of maturation, but were still effective in delaying meiosis resumption, and the effectiveness depends on the PDE isoform which is inhibited (SNAP þ CIL was most effective).

279

CYTOPLASMIC POLYADENYLATION-REGULATED GENE EXPRESSION DURING BOVINE OOCYTE MATURATION J. M. Reyes and P. J. Ross UC Davis, Davis, CA, USA

Using RNA-seq of GV and MII oocytes we have described changes in polyadenylated transcript abundance that occur during in vitro bovine oocyte maturation (Reyes J. M., J. L. Chitwood, and P. J. Ross. 2013. Deciphering regulation of transcript abundance in maturing bovine oocytes. Poster session presented at International Plant & Animal Genome XXI. San Diego, CA). These changes can be attributed to transcript degradation, transcription, or transcript polyadenylation levels. The objectives of the present study were to determine the extent of cytoplasmic polyadenylation (CP) by measuring total and polyadenylated transcript abundance and poly(A) tail length in GV and MII oocytes for 8 (CCNB1, CPEB4, DNMT3B, FBXO43, EZH2, GDF9, PRDX2, and PAIP2) genes selected based on RNA-seq results. Oocytes were obtained by aspiration of abattoir-derived ovaries (GV) and in vitro maturation for 24 h (MII). Four pools of 40 oocytes were collected per stage. Enhanced green fluorescent protein (EGFP) cRNA was spiked into each sample before RNA extraction using the PicoPure RNA Isolation Kit. Extracted RNA was equally divided for cDNA synthesis using either random hexamers or anchored oligo(dT) primers to detect total and polyadenylated transcripts, respectively. Quantitative PCR (qPCR) of target genes, EGFP (exogenous control), and PPIA (endogenous control) was performed in duplicate for each replicate and gene. Relative transcript abundance was calculated using the 2[DDC(T)] method and statistically analysed using the Student’s t-test. Transcript poly(A) tail length was determined for all but 2 genes (DNMT3B and EZH2) at the GV and MII stages using rapid amplification of cDNA ends poly(A) test (RACE-PAT). Two replicates of GV (n ¼ 100) and MII (n ¼ 100) pairs were collected to perform RACE-PAT followed by fragment analysis on a Bioanalyzer DNA 1000 chip. Polyadenylated RNA abundance levels matched those of the RNA-seq study for 7/8 genes using both PPIA and EGFP to normalise qPCR data, demonstrating the validity of RNA-seq results. Furthermore, total transcript levels for 6/8 and 7/8 genes remained unchanged when normalized to an endogenous and exogenous control, respectively. Combined, the results suggest a significant role for CP considering changes in polyadenylated transcript levels occur without changes in total RNA abundance. Also, changes in transcript abundance corresponded to differences in poly(A) tail length at the specific stages as determined by RACE-PAT. In conclusion, CP is the predominant mechanism responsible for changes in transcript abundance during oocyte maturation at least for the majority of the examined genes, though more in-depth studies are required to determine the global extent of CP. This study improved the atlas of CP-regulated genes potentially providing researchers with critical knowledge to improve in silico tools that predict genes regulated by CP based on presence, position, and distribution of motifs within the 30 untranslated region.

Oocyte Maturation

280


229

EFFECTS OF HOT SEASON ON BOVINE OOCYTE QUALITY: HOW TO BYPASS THE POOR OOCYTE QUALITY DURING THIS SEASON? L. Boccia, E. Iacono, B. Rossi, and B. Merlo Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia (BO), Italy

Many authors attribute the decline of reproductive activity in summer to the heat stress, a multifactorial problem in which hyperthermia affects cellular function in various tissues of the female reproductive tract (Hansen et al. 2001; De Rensis et al. 2003). In particular, the combination of high temperatures and high humidity for a long period causes a reduced blood flow to uterus, oviducts, and ovaries, leading to a rise in the concentration of the degradation products of cellular activity. Therefore, the aim of this work was to elucidate the negative effect of the hot season on bovine oocyte quality and evaluate the influence of different factors on the acquisition of meiotic competence. In particular, meiotic competence of bovine oocytes recovered from animals housed at 448280 0000 N, 118260 0000 E during spring (March, 4–138C) and summer (June, 16–278C) was evaluated. Likewise, in summer the effect of an antioxidant, myo-inositol, the use of serum replacement (SR), and the use of oocytes recovered from cycling heifers (16–18 months) as compared to cows (.24 months) were tested. A total of 1346 abattoir-derived oocytes, equally divided for different experimental groups (over 6 replicates), were in vitro matured in TCM 199 supplemented with EGF (25 ng mL1), IGF1 (100 ng mL1), ITS supplement, pFSH-LH (0.1 IU each), and 10% FBS. Myoinositol was added at a concentration of 0, 15, 30, and 50 mM, while 10% SR was used alternatively to FBS. At the end of maturation period (20–22 h), oocytes were denuded and stained with 10 mg mL1 of Hoechst 33342 at room temperature in the dark. After 15 min they were mounted on glass slides for evaluation of nuclear status using a Nikon Eclipse E400 microscope equipped with fluorescence filters. Nuclear configurations were classified as (a) germinal vesicle (GV), (b) germinal vesicle breakdown (GVBD), (c) metaphase I (M-I), (d) metaphase II (M-II), and (e) degenerated (DEG). Data are expressed as mean s.e.m. and were analysed by ANOVA (IBM SPSS Statistics) considering significance at P , 0.05. Oocyte quality of summer oocytes was significantly lower than spring counterparts as result of a higher rate of DEG (8.2 0.6 v. 0.7 0.6) and GV (5.4 0.3 v. 0.4 0.4, respectively; P , 0.05). Myo-inositol supplementation in IVM medium did not significantly affect either oocyte quality or meiotic competence in the hot season, such as the use of SR. When the oocytes were collected from cycling heifers ovaries during summer, the recovery rate of COC/ovary was significantly higher as compared to cows (4.5 v. 2.0), and a lower rate of DEG (1.8 0.2; 8.2 0.6) and GVBD (0.9 0.6; 6.1 0.3) was found (P , 0.05), even if the rate of GV (22.4 0.1 v. 5.4 0.3) was higher (P , 0.05) compared with cow. In conclusion, the hot season negatively affects oocyte quality, myo-inositol does not affect nuclear maturation, and SR can be used alternatively to FBS. The lower age of oocyte donor positively influenced the number of recoverable oocyte and degeneration rate.

281

EMBRYOTOXICITY ANALYSIS OF NANOCAPSULES AND THEIR EFFECTIVENESS IN RELEASING FSH ON THE IN VITRO MATURATION OF BOVINE OOCYTES T. G. B. RodriguesA, E. M. PioltineA, E. M. RazzaB, and M. F. G. NogueiraA,B A

Faculty of Science and Letters, Unesp, Univ Estadual Paulista, Assis, Saõ Paulo, Brazil; B Institute of Biosciences, Unesp, Univ Estadual Paulista, Botucatu, Saõ Paulo, Brazil

Liposomes and nanocapsules (NC) are nanotechnologies that allow for controlled drug-release systems, providing slow release of the incorporated or adsorbed substance in the lipid or polymeric particle. Therefore, slow-release FSH-loaded nanocapsules could be an innovative tool for the improvement of production systems. We aimed to evaluate the embryotoxicity of the NC (the vehicle without any incorporation) and analyse the effectiveness of FSH release through the addition of NC to in vitro maturation (IVM). Cumulus-oocyte complexes (COC, grades I and II) from follicles ranging 3 to 8 mm were obtained from bovine ovaries from abattoir. Ten to 20 COC were washed in TCM199 hepes medium droplets and, subsequently, in droplets through the specific group to which they were allocated. In experiment 1 (E1), 6 groups (G1, G2, G3, G4, G5, and G6; 5 replicates, n ¼ 76 oocytes/group) were defined: G1 ¼ negative control [1 mL of TCM199 bicarbonate, 5 mL of amikacin (16.67 mg mL1), 2 mL of pyruvate (0.011 g mL1)], G2 ¼ experimental control [5 mL of TCM199 bicarbonate, 0.030 g of BSA, 5 mL of FSH (0.1 mg mL1), 25 mL of amikacin (16.67 mg mL1), 10 mL of pyruvate (0.011 g mL1)], G3 ¼ laboratory control [0.9 mL of G2, 100 mL of FCS, 10 mL of LH (50 mg mL1), and 1 mL of oestradiol] and groups G4, G5, and G6 contained 0.9 mL of G2 plus different concentrations of empty NC: 10% (,0.1 g), 1%, and 0.1% vol/vol, respectively. In the second experiment (E2), we used the same groups, but now groups G4 to G6 were supplemented with FSH derived from NC loaded with FSH (5 replicates, n ¼ 98 oocytes/group). The NC was produced by the coacervation method containing grape seed oil, propylene glycol, isopropyl myristate, and Tween 20 in mixture to the aqueous phase with atelocollagen and xanthan gum. The NC were submitted to sonication and produced without any active compounds for the E1 and incorporated with FSH (10 mg mL1) for E2. There was a clear morphological difference (expansion) in cumulus cells after IVM (method according to Ali and Sirard 2002 Biol. Reprod. 66, 901–905). Data were analysed with ANOVA and post-hoc Tukey-Kramer. There was no expansion in G1, but cumulus in G2 and G3 expanded as expected (for both experiments). In both E1 and E2 there was partial expansion in G4 while G5 showed full expansion, similar to G2 and G3. Expansion of G6 was fair in E1, but in E2 the G6 expansion was similar to G1 (not expanded). In E1, cleavage (D3) rates of the highest tested concentration of NC [G4 (36.6%)] was different from G2 (72.1%), G3 (68.7%), G5 (59.3%), and G6 (69.5%; P , 0.001). Also in E2, cleavage rates of G4 (28.5%) differed from G2 (61.8%), G3 (77.2%), and G5 (64.9%). The blastocyst production did not differ between groups in E1 (P . 0.1). In E2, the group with the highest concentration of NC tested [G4 (9.5%)] and the control group [G2 (19.5%)] had different blastocyst rates (P , 0.05). Our results suggest a potential toxic effect for the pre-implantation embryo after using NC on the IVM of bovine oocytes. Authors acknowledge funding from grants #12/50533-2, #13/05083-1, #12/24423-5, #13/07730-4, Saõ Paulo Research Foundation (FAPESP).

230


282

Oocyte Maturation

DIFFERENT CONCENTRATIONS OF FORSKOLIN FOR MEIOSIS BLOCK AND TO IMPROVE IN VITRO PRODUCTION OF BOVINE EMBRYOS D. PaschoalA, R. MazieroA, M. SudanoB, M. GuastaliA, L. CrocomoA, J. Lima-NetoA, L. Magalha˜esA, T. RascadoA, A. Martins Jr.C, C. LealD, and F. Landim-AlvarengaA B

A UNESP, Botucatu, SP, Brazil; Unipampa, Uruguaiana, RS, Brazil; C UNESP, Araçatuba, SP, Brazil; D USP, Pirassununga, SP, Brazil

The inhibition of nuclear maturation allows time for the oocyte to accumulate molecules that are important for embryonic development. It was suggested that the inhibition of spontaneous nuclear IVM might allow for more time to accumulate the molecules important for embryonic development. The objective of this work was to evaluate blocking oocyte meiosis with the addition of forskolin. Slaughterhouse-derived bovine Zebu ovaries were collected and carried to the laboratory. Oocytes (n ¼ 584) with at least 3 intact layers of cumulus cells and homogeneous cytoplasm were selected for IVM. The oocytes were transferred to drops of TCM 199 plus 10% FCS and hormones. The oocytes remained in IVM medium in 3 different concentrations of forskolin (6886), 0.1, 0.05, 0.025 mM, and a control group (withouth forskolin), for 6 h. Then they were maturated for an additional 18 h in forskolin-free medium. The first period above was an attempt to block (Block) and the second to resume (Res) the oocyte meiosis. The oocytes were incubated in a humidified atmosphere with 5% CO2 at 38.58C in an air incubator. The oocytes were assessed for the stage of nuclear maturation, to see if they were in M II. Then oocytes were in vitro fertilized (IVF) with frozen Nelore bull semen (Bos taurus indicus). Presumptive zygotes (20–30/group) were cultured in SOFaa (synthetic oviducal fluid) supplemented with 5 mg mL1 of BSA; the embryos were kept in an incubator with 5% CO2, 5% O2, and 90% N2 at 38.58C and absolute humidity. On Day 7 (Day 0 ¼ IVF) the blastocyst, the number of viable cells, and apoptosis rate (terminal deoxynucleotide transferase uridine nick-end labelling) were observed. Data were analysed with ANOVA using SAS PROC GLM (SAS Inst. Inc., Cary, NC, USA). Sources of variation in the model, including treatment and replication, were respectively considered fixed and random effects. If ANOVA was significant, the contrasts of means were performed using the least-squares difference. Data are presented as the mean and the standard error of least-squares. For all analyses, we used a significance level of 5%. No differences were observed for the stage of nuclear maturation of the oocyte (N ¼ 336; control: 67.7 8.3; F 0.025 mM, Block/Res: 67.7 8.9; F 0.05 mM, Block/Res: 65.9 9.8; F 0.1 mM, Block/Res: 50.2 8.9), the blastocyst rate (N ¼ 584; Control: 36.7 3.7; F0.025 mM, Block/Res: 32.6 3.7; F0.05 mM, Block/Res: 29.2 3.7; F0.1 mM, Block/Res: 25.1 3.7), and total number of intact cells (N ¼ 10–15 embryos/group; Control:140.1 13.0; F0.025 mM, Block/Res: 129.9 13.0; F0.05 mM, Block/Res: 139.0 13.0; F0.1 mM, Block/Res: 104.4 13.0; P . 0.05). However, a higher rate of apoptosis was observed in the blastocysts produced from oocytes blocked for 6 h with the higher concentration of forskolin (N ¼ 10–15 embryos/group): Control: 12.1 2.5a; F 0.025 mM, Block/Res: 12.9 2.5a; F0.05 mM, Block/Res: 13.5 2.5a; F 0.1 mM, Block/Res: 30.2 2.5b (P , 0.05). We conclude that all the experimental groups reached the stage of M II after the addition of forskolin and the highest concentration of forskolin caused cellular degeneration without harming embryo production on the seventh day.

283

ROLE OF INOS/NO/CGMP PATHWAY ON IN VITRO MATURATION OF BOVINE COCS CO-CULTURED WITH HEMI-SECTIONS OF FOLLICULAR WALL N. F. Torres, M. C. C. Bussiere, K. S. Nogueira, D. F. Dubeibe, and C. L. M. Souza Universidade Estadual do Norte Fluminense, Campos dos Goytacazes, Rio de Janeiro, Brazil

Nitric oxide (NO) derived from inducible nitric oxide synthase (iNOS) works by stimulating the activity of the enzyme soluble guanylate cyclase (sGC) to synthesise cGMP, which has action in metabolism of PDE3A. Thus, NO controls the concentration of cAMP in the oocyte. The intraoocyte concentration of these cyclic nucleotides is directly linked to the control of maturation in rodents. The follicular wall hemi-sections (HS) in maturation medium partially inhibit nuclear maturation of oocytes in culture, which allows us to study the mechanism of meiosis resumption in bovines. The aim of this study is to evaluate the effect of iNOS and sGC inhibition in the nuclear maturation. Twenty cumulus-oocytes complexes (COC)/treatment were cultured with 8 HS of follicular wall at 38.58C and 5% CO2 in 200 mL of maturation medium (TCM 199/BSA) supplemented with different concentrations of aminoguanidine (AG), iNOS inhibitor (1,10, 50, 100, and 150 mM; n ¼ 840), and the sGC inhibitor, 1H-[1,2,4] oxadiazole-[4,3-a] quinoxalin-1-one (ODQ; 103, 104, and 105 nM; n ¼ 600). The COC groups cultured in the presence (control ve) or absence of HS (control þ ve) were used as controls. The stage of nuclear maturation of oocytes was assessed by staining with 2% acetic orcein and plasma membrane integrity of cumulus cells assessed with propidium iodite (PI) and hoechst (H33342). Statistical analyses of the 6 replicates were performed by ANOVA followed by Tukey test (P , 0.05) using SAEG software (Fundaçaõ Arthur Bernardes-UFV-Viçosa, Brazil). The integrity of cumulus cells from the group of oocytes cultured without HS (control þ ve; 85.9 2.3%) differed from control ve (71.2 3.7%) and other treatments, 1, 10, 50, 100, and 150 mM AG, (57.8 12.1; 66.3 4.2; 58.2 4.6; 55.3 4.3; 48.3 3.3, respectively; P , 0.05). The same occurred when ODQ was used, the control þ ve showed the highest cellular integrity (81.1 1.6), differing from the control ve (68.1 1.8) and treatment with 105, 104, and 103 mM ODQ (72.0 2.2; 64.6 4.6; 49.6 6.8, respectively; P , 0.05). The presence of HS (control ve) decreased the percentage of oocytes that reached the metaphase II (MII) in both experiments (AG and ODQ; 41.0 4.0; 39.1 1.7, respectively) compared to control þ ve (78.5 3.9; 71.9 16.6, respectively; P , 0.05). The addition of 100 and 150 mM AG inhibited the resumption of meiosis and progression to MII compared with other concentrations of AG and the controls þ ve and ve. The addition of ODQ stimulated resumption of meiosis, but at the concentration 103 nM there was a decrease in the number of COC that reached MII (21.8 3.4) compared to control þ ve (71.9 16.6) and ve (39.1 1.7) and the other treatments (104 and 105 nM; 33.0 1.8; 35.7 2.5, respectively; P , 0,05). Using the model of in vitro maturation

Oocyte Maturation


231

in which partial inhibition of meiosis resumption occurs, the results of this experiment show that (1) the iNOS/NO/cGMP pathway modulates plasma membrane integrity of cumulus cells and (2) that the activity of iNOS/NO pathway is important for the maintenance of the COC at the stage of germinal vesicle (GV) and progression of meiosis to MII. The authors acknowledge FAPERJ E-26/103.080/2011 for financial support.

284

INTRACELLULAR PATHWAYS MEDIATING DIRECT EFFECTS OF PROLACTIN AND GROWTH HORMONE ON BOVINE METAPHASE-II OOCYTES AGING IN VITRO I. Lebedeva, G. Singina, A. Lopukhov, E. Shedova, and N. Zinovieva Russian Research Institute of Animal Husbandry, Dubrovitsy-Podolsk, Russia

Maturation of mammalian oocytes coincides with various aging processes, which negatively affect the oocyte quality. Cellular and molecular changes in matured oocytes aging in vivo and in vitro are very similar, suggesting similarities in the underlying mechanisms. The goal of the present research was to study direct effects of prolactin (PRL) and growth hormone (GH) on bovine metaphase-II (M-II) oocytes aging in vitro and intracellular pathways mediating these effects. Cumulus-enclosed oocytes were matured for 20 h in TCM 199 containing 10% fetal calf serum (FCS), 10 mg mL1 of porcine FSH, and 10 mg mL1 of ovine LH. After IVM, oocytes were set free from cumulus and denuded oocytes (DO) were cultured for 44 h in the aging medium consisting of TCM 199 supplemented with 10% FCS in the absence of PRL and GH (Control), then in the presence of either 50 ng mL1 of bovine PRL or 10 ng mL1 of bovine GH or protein kinase inhibitors. The following inhibitors were added: (1) PP2 (an inhibitor of Src-family tyrosine kinases, 20 mM), (2) U0126 (a MEK inhibitor, 20 mM), and (3) triciribine (an inhibitor of Akt kinase, 50 mM). At the end of culture, the state of the nuclear material of oocytes and embryos was evaluated by the method of Tarkowski. The number of oocytes undergone spontaneous parthenogenetic activation was determined by summarising the numbers of embryos cleaved and oocytes reached anaphase-II to pronucleus stages. The data from 4 replicates were analysed by ANOVA. During aging in the control medium, the rate of M-II oocytes with destructive changes of chromosomes (decondensation, clumping, fragmentation) increased from 20.3 1.7 to 65.1 3.5% (P , 0.001) and was unaffected by PRL and GH. At the same time, the frequency of oocyte parthenogenetic activation (18.7 4.9%) was reduced (P , 0.001) by both PRL and GH (up to 6.0 2.9 and 5.9 2.4%, respectively). The inhibitor of Src-family tyrosine kinases PP2 eliminated (at least P , 0.05) the supporting effects of PRL and GH on the meiotic arrest at M-II. The MEK inhibitor U0126 also abolished the effect of PRL (but not that of GH), increasing the frequency of the oocyte activation from 5.9 2.3 to 21.6 1.9% (P , 0.01). Concurrently, both inhibitors did not affect the meiotic arrest in the control group. The inhibitor of Akt kinase triciribine did not influence the frequency of the oocyte activation in the PRL- and GH-treated groups. Meanwhile, triciribine decreased the rate of M-II oocytes with chromosome abnormalities in the control medium (from 71.2 1.7 to 47.0 2.7%; P , 0.001). When added to the aging medium, PRL enhanced the triciribine effect, while GH suppressed it (P , 0.01). Thus, PRL and GH can directly support the meiotic arrest at M-II in aging oocytes by activating MAP kinases or Src-family tyrosine kinases. Besides, GH may enhance the chromosome destruction in DOs through activation of Akt kinase. The research was supported by RFBR (No. 13-04-01888).

285

REGULATION OF OOCYTE MEIOTIC RESUMPTION USING CAMP MODULATORS IN BOVINE IN VITRO MATURATION S. E. Farmer, J. A. Sarmiento-Guzmań, C. L. Bailey, and K. R. Bondioli School of Animal Sciences, Louisiana State University Agricultural Center, Baton Rouge, LA, USA

In vitro maturation (IVM) is a reproductive technique critical to in vitro embryo production (IVP). Currently, IVP has low efficiency due to an inadequate IVM system where premature meiotic resumption results in low oocyte viability. Meiotic arrest is regulated primarily by 30 ,50 -cyclic adenosine monophosphate (cAMP). Some successful methods of improving IVM have utilised cAMP modulators to maintain high intraoocyte cAMP, delaying the onset of nuclear maturation and allowing cytoplasmic maturation to occur. The current experiment is a follow-up to previous work in which an extended 2-step maturation system was examined. In the previous experiments, we found that meiotic resumption was significantly delayed, but the overall maturation rates of extended IVM were about half those of standard IVM, suggesting that the effects of the modulators on the oocytes were not completely reversible. The current experiment compares cAMP concentrations of oocytes in this extended IVM to standard IVM to determine whether high cAMP is the cause of the low maturation rate. Bovine oocytes (n ¼ 686) were obtained from mixed-breed cattle by transvaginal ultrasound-guided aspiration. Oocytes from each cow were divided into 2 groups: standard IVM and extended IVM. Standard IVM consists of a 23-h maturation composed of TCM-199 supplemented with 10% fetal bovine serum, sodium pyruvate, pen/strep, glutamine, and FSH, and cultured at 398C in 5% CO2. Extended IVM consists of 2 steps: a pre-IVM phase composed of HEPES-TALP supplemented with 100 mM forskolin (FSK) and 500 mM 3-isobutyl-1-methylxanthine (IBMX) for 2 h at 398C, followed by an extended IVM phase composed of standard IVM media supplemented with 20 mM cilostamide for 31 h (398C, 5% CO2). Additionally, oocytes in the extended IVM treatment group where held in HEPES-TALP media with FSK and IBMX during the 2-h oocyte collection period in order to prevent any decrease in cAMP before the oocytes could be placed in the extended IVM media. Oocytes in standard IVM were sampled at 0, 8, and 23 h of maturation, while oocytes in extended IVM were sampled at 0, 8, 18, and 33 h of maturation. Cumulus cells were removed from all oocytes by vortexing in hyaluronidase solution. Oocytes were stored in groups of 10 at 808C. A cAMP enzyme immunoassay (GE Healthcare) was performed to determine cAMP concentrations throughout standard and extended IVM. Assay results were analysed using an ANOVA followed by a Tukey’s pairwise test (Sigma Stat 3.5) to detect significant differences (P , 0.05). Results indicated significantly higher cAMP levels in extended IVM oocytes during the first 3 h after collection using FSK and

232


Oocyte Maturation

IBMX in the holding media (0.505 v. 1.006 fmol/oocyte, P ¼ 0.035) but cAMP levels were not maintained in the cilostamide-only extended IVM medium. This suggests that high cAMP levels were not the cause of low maturation rates in extended IVM, since cAMP concentrations did decrease after 3 h. Possible negative effect of cilostamide on these oocytes may be suggested and need to be analysed.

286

DEVELOPMENTAL CAPACITY OF PREPUBERTAL BOVINE OOCYTES CULTURED WITH CYCLIC AMP MODULATORS S. M. BernalA,B, J. HeinzmannA, D. HerrmannA, U. BaulainA, K.-G. HadelerA, P. AldagA, A. Lucas-HahnA, and H. NiemannA A

Institute of Farm Animal Genetics, Biotechnology, Friedrich-Loeffler-Institut (FLI), Mariensee, Germany; Facultad de Ciencias Agropecuarias, Universidad de Ciencias Aplicadas y Ambientales, Bogota´, Colombia

B

Prepubertal bovine donors are currently used for commercial breeding to accelerate the genetic gain and decrease the generation interval. Nevertheless, it has been reported that their oocyte developmental competence is lower than in adult females. Addition of cAMP regulators during in vitro maturation (IVM) has been suggested to enhance blastocysts rates (Albuz et al. 2010 Hum. Reprod. 25, 2999–3011). Here, we evaluated the effects of the cAMP modulators forskolin, 3-Isobutyl-1-methylxanthine (IBMX), and cilostamide during extended IVM on the developmental capacity of oocytes from prepubertal and adult bovine females. A total of 1851 oocytes from 24 lactating cows (.2 lactations) and 24 prepubertal donors (6–10 mo old) were collected by transvaginal oocyte recovery (OPU) twice per week and divided into 3 experiment groups: (1) TCM24 (OPU medium: PBS; 24 h of IVM; standard protocol/control); (2) cAMP30 [OPU medium: PBS-IBMX (500 mM); 2 h pre-IVM culture using forskolin (100 mM)-IBMX (500 mM) and 30 h of IVM adding cilostamide (20 mM)], and (3) DMSO30 [cAMP modulators are diluted in DMSO)/vehicle control; OPU medium: PBS-DMSO (46.3 mM); 2 h pre-IVM culture (280 mM DMSO) and 30 h IVM (5.6 mM DMSO)]. Following IVM, oocytes were either submitted to in vitro fertilization and embryo culture or fixed in 1% glutaraldehyde at 9, 20, 24, and 30 h after IVM and stained with Hoechst to evaluate their nuclear status. One-way ANOVA was implemented to evaluate recovered oocytes and meiotic stages. The Glimmix procedure from SAS/STAT was performed to compare blastocyst and cleavage rates. Total number of oocytes and IVM-suitable oocytes per donor per OPU session were similar in adult and prepubertal donors (total number/IVM suitable; prepubertal donors: 6.7/4.2, 6.4/4.0, 6.5/3.8; cows: 6.2/4.7, 6.2/4.4, 6.2/4.5 for TCM24, cAMP30 and DMSO30, respectively). At 9 h, cAMP regulators were able to maintain meiotic arrest in prepubertal and adult donors (GV: 80.0 and 40.9%, respectively) compared to standard IVM (GV: 61.1 and 31.2%) and DMSO30 (GV: 40.0 and 26.6%) protocols (P , 0.05). Using the cAMP30 protocol, the percentage of oocytes that reached MII stage at 20 h was lower in adult (4.5%) and prepubertal donors (5.26%) compared to the DMSO30 (50.0 and 42.8%, respectively) and TCM24 (56.2 and 44.4% respectively) protocols. Metaphase II rates after either 24 or 30 h were similar among treatments (prepubertal donors: 88.2, 70.5, and 84.2%; cows: 71.4, 85.7, and 81.2% for TCM24, cAMP30, and DMSO30, respectively; P . 0.05). Cleavage rates (prepubertal donors: 63.4, 54.9, and 52.1%, cows: 56.1, 57.8, and 51.6% for TCM24, cAMP30, and DMSO30, respectively) and blastocysts/presumptive zygotes rates (prepubertal donors: 26.2, 19.6, and 16.2%; cows: 27.5, 28.1, and 21.5% for TCM24, cAMP30, and DMSO30, respectively) did not show significant differences (P . 0.05). Although cAMP modulators delayed the progression through meiosis in adult and prepubertal oocytes, similar blastocysts rates were obtained. Our results suggest so far that oocyte retrieval and competence in prepubertal donors can be similar to that of the adult donors with and without addition of cAMP modulators.

287

EFFECT OF FOLLICULAR AGING ON THE ATP CONTENT AND DISTRIBUTION OF MITOCHONDRIA IN BOVINE OOCYTES D. Dadarwal, F. Dias, G. Adams, and J. Singh

Department of Veterinary Biomedical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, Saskatchewan, Canada Our objective was to determine how follicular aging affects the distribution and content of mitochondrial population and ATP in in vivo-matured bovine oocytes. We hypothesised that in vivo-matured bovine oocytes obtained from aged follicles (84 h of gonadotropin starvation) have altered mitochondrial distribution and decreased cytoplasmic ATP content compared to those obtained immediately at the end of a superstimulatory protocol (no starvation). Follicular waves were synchronized by ablation 5 to 8 d after ovulation and a CIDR device was given. Starting on the day of wave emergence (Day 0), short FSH and FSH starvation groups (n ¼ 5 heifers each) were given 8 doses of FSH im over 4 d and the long FSH group (n ¼ 4) was given 14 doses over 7 d. Two doses of PGF were given on Day 4 (short FSH) or Day 7 (FSH starvation and long FSH groups), the CIDR was removed, and LH was given 24 h after second PGF treatment. The ovaries were removed 24 h later by colpotomy and cumulus-oocytecomplexes (COC) were collected from follicles $8 mm. Denuded oocytes were either stained with Mitotracker Deep Red FM and imaged by confocal microscopy or processed for ATP assay. Mitochondria numbers were assessed by segmentation of 3D datasets. Proportions of COC within each grade were compared using Fischer’s exact test, and ATP and mitochondrial data were compared by analysis of variance. Short and long FSH groups had a greater proportion of Grade 1 expanded COC than the FSH starvation group (P ¼ 0.02). The ATP content of oocytes (from expanded COC) tended to be higher in the long FSH group than short FSH (P ¼ 0.09), and the FSH starvation group was intermediate. The ATP content of oocytes from compact COC did not differ among groups (P ¼ 0.49). The proportion of mitochondrial clusters was highest (P ¼ 0.01) and the proportion of individual mitochondria was lowest (P ¼ 0.01) in the FSH starvation group compared to short and long FSH groups. Mitochondria from the long FSH and FSH starvation groups had twice the relative intensity compared to the short FSH group (P , 0.01). In conclusion, follicular aging (FSH starvation) was associated with a decrease in oocyte morphologic grade and marked clustering of mitochondria, which may be a reflection of oxidative stress and atresia.

Oocyte Maturation

288


233

INFLUENCE OF MELATONIN ON IN VITRO MATURATION OF BOVINE OOCYTES

M. C. R. Valerino da CunhaA, L. G. MesquitaA, P. F. NetoA, F. BressanA, A. S. OliveiraB, F. C. CastroA, K. R. L. SchwarzA, O. Y. WatanabeB, Y. F. WatanabeB, and C. L. V. LealA A

Faculdade de Zootecnia e Engenharia de Alimentos-USP., Pirassununga-SP, Brazil; B WTA Watanabe Tecnologia Aplicada Ltda SS, Cravinhos-SP, Brazil

The present study evaluated the effects of melatonin (MEL) during IVM of bovine cumulus-oocyte complexes (COC). The COC were cultured in droplets (25–30/100 mL) under mineral oil at 38.58C and 5% CO2 in air. Medium (TCM199 þ 0.1% polyvinyl alcohol, 0.25 mM sodium pyruvate, and 25 mg mL1 of gentamycin) was supplemented with FSH (0.5 mg mL1), MEL (109 and 106 M), or no hormones (control). In experiment 1, oocytes were assessed for nuclear maturation rates (6, 12, 18, and 24 h of IVM). In experiment 2, relative abundance of antioxidant enzymes copper, zinc superoxide dismutases (CuZnSOD), manganese superoxide dismutases (MnSOD), and glutathione peroxidase (GPx) was evaluated in oocytes and cumulus cells (0 and 24 h) by real time PCR. The immature group was the reference and endogenous controls were actin b and glyceraldehyde 3-phosphate dehydrogenase. In experiment 3, nuclear fragmentation in cumulus was assessed by TUNEL and flow cytometry (24 h). In experiment 4, embryo development after in vitro fertilization and culture was analysed (cleavage rates D2, blastocysts Day 8, and hatching Day 10). The control group was matured in complete IVM medium (10% FCS, 0.5 mg mL1 of FSH, 50 mg mL1 of LH, and 1 mg mL1 of oestradiol). The MEL and FSH groups were the same. Data (3–4 replicates) were analysed by Chi-square (experiment 1; GraphPad Prism) or ANOVA and Tukey test (SAS, 1995) and 5% significance. At 6 h of IVM, all oocytes were at germinal vesicle stage. At 12 h, hormone groups had similar metaphase I rates (71–81%, P . 0.05) and were superior to control (54%, P , 0.05). At 18 h, metaphase II (MII) rates were similar (57–74%, P . 0.05). After 24 h, MEL (109 and 106 M) was similar to control (51, 67, and 69% MII, respectively, P . 0.05) and FSH had the highest MII rates (90%, P . 0.05). The 106 M MEL was similar to FSH (P . 0.05). Antioxidant enzymes were unaffected in oocytes (P . 0.05%). The CuZnSOD transcripts increased in cumulus after IVM with 106 M MEL compared to immature cells (3.5 and 1.0, respectively, P , 0.05). Control, FSH, and 109 M MEL did not differ (2.1–2.5, P . 0.05) or increased relative to immature cells (P , 0.05), but were inferior to 106 M MEL (P , 0.05). The MnSOD relative abundance was similar for immature, control, and 109 M MEL (1.0–3.0, P . 0.05). The 106 M MEL increased MnSOD relative to immature cells (3.0 and 1.0, respectively, P , 0.05), but was similar to control and 109 M MEL (P . 0.05). The FSH showed the highest levels (9.1, P , 0.05); GPx4 transcripts were not affected (P . 0.05). Nuclear fragmentation in cumulus was not influenced (33.4–41.5/10 000 cells; P . 0.05). Embryo development rates were similar for all groups (cleavage: 82–87%, blastocysts: 49–54, hatching: 91–96%, P . 0.05). In conclusion, MEL during IVM stimulates meiosis resumption at rates similar to FSH and embryo development similar to FSH and complete IVM medium. The MEL increased CuZnSOD expression in cumulus, but no parallel effect was observed on nuclear fragmentation.

289 THE EFFECTS OF MEIOSIS BLOCKING BY CDK INHIBITORS ON THE ACTIVITY OF MATURATION PROMOTING FACTOR, ERK1 AND 2, AND THE DISTRIBUTION OF CYTOPLASMIC ORGANELLES IN IN VITRO-MATURED BOVINE OOCYTES R. R. D. Maziero, C. R. F. Guaitolini, D. M. Paschoal, A. M. Crespilho, and F. C. Landim-Alvarenga Saõ Paulo State University, Botucatu, Saõ Paulo, Brazil Studies have suggested that the prematuration with meiotic blockers can improve oocyte quality promoting embryonic development; however, its exact effects on cytoplasmic characteristics remain unclear. Thus, this study aimed to evaluate the effects of meiosis block of bovine oocytes with the CDK inhibitors roscovitine (ROS) and butyrolactone (BL-I) on nuclear maturation, expression, and localization of ERK 1 and 2, cyclin B1, and p34cdc2 proteins and the ultrastructure of oocytes. Immature oocytes from the slaughterhouse were divided into the following groups: (1) control, in vitro maturated (IVM) in TCM 199 for 24 h; (2) ROS 12.5 mM; (3) BL-I 50 mM; and (4) ROS (6.25 mM) þ BL-I (25 mM) treatment for 6 h followed by IVM in CDK inhibitor-free medium for 18 h. Immature oocytes and IVM oocytes in each group were then fixed stained by immunofluorescence for nuclear visualisation (n ¼ 600), localization, and expression of ERK1 and 2 proteins, cyclin B1 and p34cdc2 protein (n ¼ 350), and prepared for evaluation of the ultrastructure by electron microscopy (n ¼ 100). Data were analysed using the ANOVA test (nuclear visualisation), Student-Newman-Keuls test (expression of ERK1 and 2 proteins, cyclin B1 and p43cdc2) by the PROC GLM procedure of SAS (SAS Inst. Inc., Cary, NC, USA). At 6 h of IVM, a lower (P , 0.05) percentage of oocytes were at the metaphase I (MI) stage in the control group (C ¼ 18.2 5.4%) compared with other groups and a higher percentage of oocytes were degenerated in the ROS group (16.3 5.6%) compared with other groups (C ¼ 13.6 4.6%, BL-I ¼ 10.0 4.5%, BL-IþROS ¼ 8.0 5.6%). At 24 h of IVM, higher (P , 0.05) percentages of oocytes were at the MI stage in the control and ROS group (8.3 5.9% and 6.8 6.4%, respectively). There was no difference (P . 0.05) in percentage of metaphase II (MII) oocytes among the groups. Only the ROS group showed lower fluorescence intensity of ERK1 and 2 proteins in the ooplasma (P , 0.05). Immature oocytes showed higher expression of cyclin B1 and p34cdc2 (P , 0.05). There was no difference in the localization of these proteins in the ooplasm and there was no difference in the oocyte ultrastructure (mitochondria, cortical granules, endoplasmic reticulum, microvilli, zona pellucida, lipid granules) among treatments (P . 0.05). The results suggest that a temporary blocking of oocyte maturation by CDK inhibitors affect neither the expression and distribution of MPF components (cyclin B1/cdc2) nor the distribution of cytoplasmic organelles in IVM oocytes. However, the expression of ERK 1 and 2 in mature oocytes may be reduced by pre-IVM with ROS.

234


290

Oocyte Maturation

3-DIMENSIONAL VISUALIZATION OF BOVINE OOCYTE FERTILIZATION BY CONFOCAL LASER SCANNING MICROSCOPY

E. De MonteA,B, M. ReichenbachC, H. ReichenbachD, E. Wolf B,E, and F. HabermannA A

Chair of Veterinary Anatomy, Histology and Embryology, LMU, Munich, Germany, Munich, Germany; B Chair of Molecular Animal Breeding and Biotechnology, LMU, Oberschleissheim, Germany, Oberschleissheim, Germany; C Bayern-Genetik GmbH, Grub, Germany, Grub, Germany; D Institute for Animal Breeding, Bavarian State Research Center for Agriculture, Grub, Germany, Grub, Germany; E LAFUGA, Gene Center, LMU, Munich, Germany, Munich-Germany Cattle can serve as a model organism to resolve central questions in mammalian reproduction that cannot be clarified in the mouse model due to notable species-specific peculiarities of early mouse embryogenesis. As part of a project on structural, molecular, and functional deficiencies of bovine oocytes, we started to systematically investigate fertilization and the onset of embryo development in vitro by 3-dimensional multicolor fluorescence microscopy. We are using 3D visualisation as key approach to clarify the multiple parallel and sequential processes and events of fertilization as well as to identify and classify errors and failures. Moreover, we aim to gain insights into the mechanisms of aberrations by linking processes at the cellular and the molecular level. We studied class I and II oocytes collected from slaughterhouse ovaries and matured for 23 h in vitro. Oocytes were fixed at different times from 4 to 12 h postinsemination with formaldehyde in a microtubule-stabilising buffer containing taxol in such a way that the 3-dimensional cell architecture was maintained, and were stained for DNA, microtubules, and f-actin microfilaments. In addition, serine 10-phosphorylated histone H3 was used as a marker for chromosome condensation and the spindle midbody. For 3-dimensional imaging of the oocytes in toto, confocal serial sections were captured at 1-mm intervals using a 40 objective (NA ¼ 1.3). For imaging details, we used a high spatial sampling density (pixel size: 50 50 nm, z-step size: 200 nm) close to the Nyquist criterion and image restoration by maximum likelihood estimation (MLE) deconvolution. A series of more than 500 three-dimensional snapshots of fertilized oocytes at different points in time gives a first detailed view on the spatial and temporal course of the sperm entry, the formation of the paternal pronucleus and the sperm aster, completion of oocyte meiosis and the formation of the maternal pronucleus, as well as dynamic changes of the cytoskeleton. Moreover, we can document a spectrum of abnormalities including spontaneous parthenogenetic oocyte activation, polyspermy, and aberrations of meiosis I and II. The latter include irregular spindle formation and chromosome segregation, the occurrence of chromatin bridges and abnormal spindle positioning and rotation (e.g. leading to nonextrusion of a first or a second polar body or the extrusion of two second polar bodies). Our microscopic investigation in the bovine system contributes to unraveling the origins of irregular cleavage, aneuploidy, and mosaicism in mammals. Threedimensional high-speed microscopy of oocytes and zygotes in affordable timeframes could be of great value in improving the differential diagnosis of oocyte and sperm dysfunction, as well as in identifying and dissecting problems, limitations, and potential risks of reproductive technologies (ART). This work is supported by the Deutsche Forschungsgemeinschaft (DFG FOR 1041).

291

NOVEL OOCYTE SHIPPING AND MATURATION MEDIUM WITHOUT CO2 GAS PHASE IMPROVES IN VITRO MATURATION AND PREGNANCY OUTCOME IN CATTLE M. Barcelo-FimbresA, L. F. Campos-ChillonB, N. R. MtangoA, L. BonillaA, and J. VerstegenA A

MOFA Global, LLc, Verona, Wisconsin, USA; California Polytechnic State University, San Luis Obispo, California, USA

B

The aim of the present work was to evaluate embryonic development after shipping and maturation of bovine cumulus oocyte complexes (COC) collected by ovum pick up (OPU) in medium (SMM) that does not require CO2 gas for transport and maturation. Two experiments were conducted, experiment 1 stimulated nonlactating Holstein (n ¼ 4), Jersey (n ¼ 2), Angus (n ¼ 4), and Wagyu (n ¼ 2) donors with 6 pFSH injections (Pluset, MOFA Global LLC, Verona, WI, USA) were used. From each donor, some OPU sessions were delivered the same day (,3 h after collection) for IVM in conventional gas bicarbonate-equilibrated medium system (control), while COC from the other sessions were placed in a portable incubator at 38.58C, delivered the next day allowing 24 h of maturation in SMM (BoviPro, Mofa Global, WI, USA). The COC were fertilized using commercial semen for each breed, and embryos were cultured in BBH7 medium (BoviPro, Mofa Global, WI, USA) at 38.58C in 5% O2, 5% CO2, and 90% N2 atmosphere. Embryonic development was evaluated in this experiment. For experiment 2, Day 7 fresh Holstein and Jersey embryos (n ¼ 610) from SMM (n ¼ 550) and controls (n ¼ 60) were transferred in synchronized virgin heifers and pregnancies were diagnosed by ultrasonography at d 35. Data were analysed by ANOVA using GLM, percentages were transformed using arcsin square root, and pregnancy rates were analysed by GenMod using SAS statistical software (Cary, NC, USA). Similar COC numbers were recovered for maturation treatments (P . 0.1; Table 1). The COC matured in SMM had higher cleavage and blastocyst rates than the control group (P , 0.01; Table 1), and this resulted in more transferable embryos per OPU session (P , 0.05; Table 1). We did not find breeds effects or interactions for any variable (P . 0.1; Table 1). After ET, SMM had similar pregnancy rates than control (53.8 v. 58.3%; P . 0.1); however, as more blastocysts were produced per OPU session in the SMM condition, more pregnancies were obtained per session (4.3 v. 2.1; P , 0.01). We conclude that COC matured in SMM had greater oocyte competence than control in commercial settings. The SMM resulted in greater embryonic development, similar pregnancy rates, but more transferable embryos and pregnancies per OPU session than the conventional maturation system.

Oocyte Maturation


235

Table 1. Least squares means (6 SE) of embryonic development of COC matured in SMM or control Variable

OPU session

COC recovery

Cleavage (%)

Day 7 blastocyst (%)

Transferable embryos per OPU session

32 32

10.4 1.1 9.0 1.2

59.3 5.9a 77.0 3.9b

33.4 5.7a 60.0 4.1b

2.9 0.6c 5.0 0.5d

Maturation Control SMM

Values without common superscripts in the same column differ (a,bP , 0.01, c,dP , 0.05).

292

INHIBITION OF HSP90 AGGRAVATES THE EFFECTS OF HEAT SHOCK ON DEVELOPMENTAL COMPETENCE OF BOVINE OOCYTES

E. D. SouzaB, N. C. RabeloC, T. D. AraujoC, C. M. AssunçaõC, C. C. R. QuintaõA, J. H. M. VianaA, I. D. LouroB, and L. S. A. CamargoA A

Embrapa Dairy Cattle, Juiz de Fora, MG, Brazil; Federal University of Espı´rito Santo, Vitoria, ES, Brazil; C Federal University of Juiz de Fora, Juiz de Fora, MG, Brazil B

The heat shock protein 90kDa (HSP90) is a chaperone involved in protein homeostasis under normal and stress conditions. Its inhibition by 17-(allylamino)-17-demethoxygeldanamycin (17AAG, Sigma, St. Louis, MO, USA) for 12 or 24 h during in vitro maturation reduces the oocyte’s ability to develop after in vitro fertilization (Souza et al. 2014 Reprod. Fert. Dev. 26, 197). This study aimed to evaluate the effect of treatment with 17AAG during the heat shock on oocyte developmental competence. Immature bovine COC were randomly allocated in 4 treatments during IVM: control ¼ no heat shock or 17AAG; HS ¼ heat shock (41.58C) for the first 12 h of IVM; 17AAG ¼ 2 mM 17AAG for the first 12 h of IVM; and 17AAG þ HS ¼ 2 mM 17AAG plus heat shock for the first 12 h of IVM. In vitro maturation was performed in Nunc plate containing 400 mL of TCM199 medium (Invitrogen, Carlsbad, CA, USA) supplemented with porcine FSH (Hertape Calier, Juatuba, Brazil) and 10% oestrus cow serum under 5% CO2 in air, 95% humidity, and 38.58C for 24 h. Semen was processed by Percoll gradient (Nutricell, Campinas, Brazil) and oocytes were in vitro fertilized for 20 h with 2 106 spermatozoa mL1 under the same IVM atmospheric conditions. Presumptive zygotes were completely denuded in a PBS solution with 0.1% hyaluronidase and then cultured in wells with 500 mL of modified CR2aa medium supplemented with 2.5% fetal calf serum (Nutricell) in an incubator at 38.58C under 5% CO2, 5% O2, 90% N2, and saturated humidity. Cleavage rate was evaluated 72 h postfertilization and blastocyst rate was evaluated at Day 7 (D7) and 8 (D8). Data from 7 replicates were submitted to analysis of variance and means were compared by Student Newman Keul’s test. There was no difference (P . 0.05) on cleavage rate among treatments. Heat shock or treatment with 17AAG, both for 12 h of IVM, decreased (P , 0.05) the blastocyst rate at D7 and D8 when compared to control but no significant difference between HS and 17AAG treatments was found (Table 1). However, the lowest (P , 0.05) blastocyst rate at D7 and D8 was achieved when oocytes were submitted simultaneously to 17AAG and heat shock for 12 h of IVM (17AAG þ HS treatment, Table 1). In conclusion, the treatment with 17AAG during IVM worsens the deleterious effect of heat shock on oocyte developmental competence and suggests that HSP90 may also play role on cellular protection during heat shock in bovine oocytes. Table 1. Cleavage and blastocyst (Bl) rates at D7 and D8 for control, 17AAG, Heat Shock (HS), and 17AAG plus HS treatments Treatment Control 17AAG HS 17AAG þ HS a–c

n

Cleavage (%)

Bl D7 (%)

Bl D8 (%)

315 298 281 312

73.35 4.59 60.39 7.85 62.49 5.97 52.46 6.16

32.67 3.76 22.44 2.39b 17.00 1.61b 6.04 2.18c a

33.54 4.08a 23.01 1.94b 17.29 0.96b 5.84 1.75c

Values are shown as mean s.e.m., and those with different superscript letters in the same column differ (P , 0.05).

Financial support comes from CNPq, FAPEMIG, and FAPES.

293

EFFECT OF DIFFERENT CONCENTRATIONS OF LH, FSH, AND E2 ON THE MATURATIONAL RATE OF INDIGENOUS SOUTH AFRICAN CATTLE OOCYTES SELECTED BY BRILLIANT CRESYL BLUE STAINING K. P. M. LekolaA,B, J. W. Ng’ambiB, N. NkadimengA, M. L. MphaphathiA, and T. L. NedambaleA,C A Agricultural Research Council, Animal Production Institute, Irene, South Africa; University of Limpopo, Department of Animal Production and Agricultural Economics, Sovenga, South Africa; C University of the Free State, Department of Animal, Wildlife and Grassland Sciences, Bloemfontein, South Africa B

In vitro maturation of indigenous African cattle oocytes is a major challenge even though different maturation protocols work successfully in other breeds. The objective of this study was to determine the maturation rate of indigenous South African cattle oocytes following in vitro maturation in media supplemented with different concentrations of hormones and selected using brilliant cresyl blue (BCB) staining. Indigenous cattle ovaries were

236


Oocyte Maturation

collected from the slaughterhouse and then oocytes were retrieved by aspiration method. A total of 966 oocytes were exposed to 26 mM BCB stain and 700 oocytes were not exposed to the BCB stain. Thereafter, oocytes exposed to the BCB stain were grouped according to the colour of their cytoplasm BCBþ (oocytes with blue cytoplasm, low G6PDH) and BCB (unstained oocytes, increased G6PDH). The BCB exposed (BCBþ and BCB) and the oocytes not exposed to BCB were then randomly allocated into tissue culture medium (TCM199) þ 10% (vol/vol) fetal bovine serum (FBS) supplemented with 3 different concentrations of hormones as treatments (T). The T1 group was matured in the presence of 0.5 mg mL1 of FSH, 5 mg mL1 of LH, and 2 mg mL1 of E2; the T2 group was matured in the presence of 1 mg mL1 of FSH, 6 mg mL1 of LH, and 2.5 mg mL1 of E2; and the T3 group was matured in the presence of 1.5 mg mL1 of FSH, 7 mg mL1 of LH, and 4.5 mg mL1 of E2. For IVM, 20 to 25 COC were placed in 50-mL droplets of IVM medium containing the 3 different levels of hormones. Maturation rate of oocytes was determined by the extrusion of the first polar body after 24 h of incubation in maturation medium. Data was analysed by ANOVA using SAS with 4 replicates per treatment. Treatment 2 yielded higher maturation rate for both BCBþ (65.6%) and not exposed to BCB (60.3%) oocytes compared to T1 (22, 3.03, and 16% for BCBþ, BCB, and not exposed to BCB, respectively) and T3 (48, 2.2, and 48% for BCBþ, BCB, and not exposed to BCB respectively). However, BCB oocytes had lower polar body extrusion for T1, T2, and T3 (3.03, 8.1, and 2.2%, respectively) compared to BCBþ oocytes (22, 65.6, and 48% for T1, T2, and T3, respectively). In conclusion, immature oocytes that were cultured into TCM199 supplemented with 10% FBS, 1 mg mL1 of FSH, 6 mg mL1 of LH, and 2.5 mg mL1 of E2 showed maturation rate for BCBþ oocytes and those not exposed to BCB. Oocytes selection using BCB staining was a useful test to classify good quality cattle oocytes. Therefore, it is suggested that treatment 2 is a suitable in vitro-maturation medium to mature indigenous South African cattle oocytes.

294

EFFECTS OF FOLLICULAR FLUID OBTAINED FROM REPEAT BREEDER DAIRY HEIFER ON MATURATION OF BOVINE OOCYTES IN VITRO M. Kafi, M. R. Divar, and S. Gharib-Zadeh Dept. of Animal Reproduction, School of Veterinary Medicine, Shiraz University, Shiraz, Iran

The cause of repeat breeding syndrome is often difficult to explain in dairy heifers with no clinical abnormalities. The aim of the present experiment was to determine the effect of follicular fluid obtained from the preovulatory follicle of repeat breeder heifers on maturation of bovine oocytes in vitro. Holstein virgin heifers either with normal fertility (VH, n ¼ 5) or repeat breeder syndrome (RB, n ¼ 5) were used in the present experiment. The RB heifers had a history of at least 5 unsuccessful consequent artificial breeding. The reason for using such RB heifers was to exclude the possibility of the presence of usual causes of infertility in heifers. Oestrus cycles of all heifers were synchronized using 2 injections of PGF2a 11 days apart. Six to 12 h after oestrus detection, clear follicular fluid samples from the ovulatory follicles were collected transrectally using a long fine-needle covered by a hard plastic tube. Follicular fluid samples were pooled, centrifuged, and frozen until used in the maturation medium. A total of 483 good or excellent quality bovine cumulus-oocytes complexes (COC) were obtained from 2 to 6 mm follicles in diameter from slaughterhouse ovaries and randomly allocated in 3 groups; in group 1 (control, n ¼ 180), oocytes were cultured in TCM-199 supplemented with 10% heat-treated fetal calf serum and hormones (5 IU mL1 of hCG plus 0.1 IU mL1 of rFSH); in group 2 (n ¼ 126), oocytes were cultured in TCM-199 supplemented with 10% filtered follicular fluid of VH without hormones; in group 3 (n ¼ 177), oocytes were cultured in TCM-199 supplemented with 10% filtered follicular fluid of RB heifers without hormones. All oocytes were cultured for 24 h at 398C in an atmosphere of 5% CO2 under 90% humidity. At the end of maturation, the degree of cumulus expansion was evaluated and scored under a stereomicroscope. Then, oocytes were mechanically denuded using 3% sodium citrate and repeated pipetting and were fixed in ethanol/acetic acid (3 : 1) for 24 h. The oocytes were subsequently stained with 1% aceto-orcein and evaluated for meiotic resumption. Proportions were statistically analysed using a Chi-squared test (significant at P , 0.05; SPSS program, 11.5). The percentages of fully expanded COC differed among groups (P , 0.001). The maturation rate (MII stage) was 83% (150/180) in oocytes that were cultured in the presence of FCS as the control group. However, a reduction in the maturation rate was observed when oocytes were cultured either in VH follicular fluid (71.4%, 90/126; P , 0.01) or RB follicular fluid (59.3%, 105/177; P , 0.001) compared to the control group. The percentages of matured oocytes were also different between VH and RB follicular fluid (71.4 v. 59.3%; P , 0.01, respectively). In conclusion, the quality of follicular fluid of the preovulatory follicles of repeat breeder heifers is lower than that of the virgin heifers with normal fertility. This may explain the cause of the low fertility in some repeat breeder Holstein heifers.

295

EFFECT OF TREHALOSE DURING IN VITRO MATURATION OF PIG OOCYTES ON OOCYTE MATURATION AND EMBRYONIC DEVELOPMENT AFTER PARTHENOGENESIS

Y. JeonA, B. BaasanjavA, Y. I. JeongA, Y. W. JeongA, Y. W. KimA, S. H. HyunB, I. S. YangA, and W. S. HwangA B

A Sooam Biotech Research Foundation, Seoul, Republic of Korea; Laboratory of Veterinary Embryology and Biotechnology (VETEMBIO), College of Veterinary Medicine, Chungbuk National University, Cheongju, Republic of Korea

Autophagy is a critical process for the maintenance of cellular homeostasis and mammalian early embryogenesis. Autophagy can be regulated by various chemical inducers. However, there are few reports about effect of autophagy inducer in vitro maturation (IVM) of porcine oocyte. The present study investigated the effects of supplementary trehalose, a novel mTOR-independent autophagy enhancer, on oocyte maturation and embryonic development after parthenogenetic activation (PA). Immature oocytes were treated with various concentrations (0, 25, 50, and 100 mM) of trehalose in M-199 (Invitrogen, Carlsbad, CA) supplemented with 10 ng mL1 of epidermal growth factor (EGF; Sigma-Aldrich Corp.), 1 ug mL1 of insulin (Sigma-Aldrich Corp.), 4 IU mL1 of pregnant mare serum gonadotropin (PMSG; Intervet, Boxmeer, Holland), 4 IU mL1 of human chorionic gonadotropin (hCG; Intervet), and 10% (vol/vol) porcine follicular fluid (pFF) for 10 h, and transferred to another IVM medium without trehalose.

Oocyte Maturation


237

Osmolality of each groups (0, 25, 50, and 100 mM trehalose) was in the 290 to 295, 310 to 315, 330 to 335, and 375 to 380 osmol range, respectively. After 44 h of IVM, trehalose treatment during IVM did not improve nuclear maturation rates of oocytes in any group (90.7, 92.1, 92.7, and 90.1%, respectively). The developmental competence of oocytes matured with different trehalose concentrations was evaluated after PA. There were no significant differences in cleavage rates. However, blastocyst (BL) formation was different. Oocytes treated with 25 mM of trehalose during IVM had a significantly higher (P , 0.05) BL formation rate (64.2%) after PA compared with the control (52.0%). The BL quality was also improved in the 25 mM trehalose-treated group. Early BL rate significantly reduced in the 25 mM trehalose-treated group as compared to control (19.6 v. 29.9%, P , 0.05). By contrast, expanded BL rate significantly increased in the 25 mM trehalose-treated group than of control (27.7 v. 11.0%, P , 0.05). Total cell numbers of BL were significantly higher (P , 0.05) in the 25 mM trehalose-treated group compared to those in the control group (52.2 v. 36.8). However, BL rate and quality of oocytes treated with 50 and 100 mM trehalose were similar with control group. In conclusion, these results indicate that 25 mM trehalose during IVM improved the developmental potential of porcine embryos. Trehalose will be useful for large-scale production of BL with good quality in porcine in vitro production. This work was supported by a grant from the Next-Generation Bio Green 21 Program (No. PJ009563032014), Rural Development Administration, Republic of Korea.

296 IMPACT OF CO-CULTURING CUMULUS-ENCLOSED PORCINE OOCYTES WITH DENUDED OOCYTES DURING IN VITRO MATURATION IN A DEFINED MEDIUM ON CUMULUS EXPANSION AND OOCYTE MATURATION R. AppeltantA, T. SomfaiB, M. NakaiC, S. BodoD, D. MaesA, K. KikuchiC, and A. Van SoomA A

B

Ghent University, Merelbeke, Belgium; NARO Institute of Livestock and Grassland Science, Tsukuba, Japan; C National Institute of Agrobiological Sciences, Tsukuba, Japan; D Szent Istvań University, Godollo, Hungary

Recent research has revealed that oocyte-secreted factors (OSF) affect cumulus expansion and play important roles during maturation and embryo development of mammalian oocytes. The use of denuded oocytes (DO) as supplements during in vitro maturation (IVM) in a nondefined medium improved developmental competence of cumulus-enclosed porcine oocytes (COC; Gomez et al. 2012 Zygote 20, 135–145). We investigated the effect of DO on cumulus expansion and nuclear maturation of COC in pigs during IVM using a defined medium. If the DO exert a positive influence on IVM, the defined medium can then be analysed for the presence of OSF. Immature COC were collected in the slaughterhouse from prepubertal gilts. To obtain DO, some COC were completely denuded by pipetting through a narrow-bore glass pipette. The COC used as a source for DO fulfilled the same morphological criteria as the COC used for IVM. The IVM medium was porcine oocyte medium (POM; Yoshioka et al. 2008 J. Reprod. Dev. 54, 208–213) with hormone supplementations applied only during the first 20 h of the IVM period. The COC were fixed to the bottom of 35-mm plastic Petri dishes in 3 3 grids by Cell-Tak (BD Bioscience, Bedford, MA, USA) in 100-mL droplets POM covered by paraffin oil. Culture droplets (each including 1 COC grid) were supplemented with (DOþ group, n ¼ 179) or without 16 DO (DO group, n ¼ 143). After 20 h of IVM, the medium was replaced with a preincubated hormone-free POM and oocytes were cultured for an additional 28 h. At 0, 20, and 48 h of IVM, images of each grid were taken at the same magnification. The size of each COC was measured as a 2-dimensional area in pixels by analysing images with ImageJ software. Relative cumulus expansion was calculated at 20 and 48 h of IVM on the basis of the initial COC size at 0 h, which was assigned as 1. At 48 h of IVM, the COC were denuded and examined for oocyte maturation by orcein staining. The experiment was replicated 5 times. Cumulus expansion ratios at 20 and 48 h of IVM were compared between the DOþ and DO groups by ANOVA. Maturation rates were compared between the DOþ and DO groups by binary logistic regression. No difference in cumulus expansion between DO and DOþ could be observed at 20 h (1.83 0.04 and 1.75 0.03, respectively) and 48 h (1.41 0.03 and 1.47 0.02, respectively) of IVM. Nuclear maturation rates of COC in DO and DOþ groups did not differ significantly (39.0 5.4 and 32.9 8.8%, respectively). In conclusion, addition of DO to the defined IVM medium did not affect the cumulus expansion and oocyte maturation of follicular porcine COC. Further research is needed to assess the effects of DO during IVM on subsequent fertilization. If DO prove to be beneficial for fertilization, the nature of the OSF will be investigated. This study was supported by FCWO of UGent and by FWO-Flanders (grant number FWO11/ASP/276).

297 EFFECT OF CUMULUS CELL REMOVAL DURING IN VITRO MATURATION OF PORCINE CUMULUS-OOCYTE COMPLEXES ON THE APOPTOTIC STATUS AND MEIOTIC PROGRESSION OF THE OOCYTES P. Ferre´ and H. Funahashi Department of Animal Science, Okayama University, Okayama, Japan This study was undertaken to examine the apoptotic status and meiotic progression of oocytes from small (SF) and medium follicles (MF) when the oocytes were denuded from cumulus cells (CC) before, during and after culture for in vitro maturation (IVM). Cumulus-oocyte complexes (COC) were aspirated from SF (0.5–2 mm in diameter) or MF (3–6 mm in diameter) of slaughtered prepubertal gilt ovaries. Only COC with a good morphology of the surrounding cumulus cells were cultured for IVM in modified porcine oocyte medium supplemented with 50 mM b-mercaptoethanol, 1 mM dibutyryl c-AMP, 10 IU mL1 of eCG, and 10 IU mL1 of hCG for 20 h at 398C and 5% CO2 in air and then continued culture in the absence of dibutyryl c-AMP, eCG, and hCG in the same medium for another 24 h. Before and 20 h after the start of IVM culture, some of

238


Oocyte Maturation

the oocytes were denuded of CC and the oocytes continued the IVM culture. After IVM culture, oocyte viability and meiotic progression were examined by the annexin V/PI viability assay and DAPI staining. Statistical analyses of 5 replicate data were performed with a 2-way ANOVA and a Tukey’s multiple comparisons test. Before IVM culture, there was no significant difference between the viability of SF and MF oocytes, but the incidence of oocytes at the GV0 stage was higher in specimens from SF than MF (24.8 v. 3.3%), and that of oocytes at the GVI stage was the opposite (57.8 in MF v. 22.7% in SF). After IVM culture, apoptotic status of oocytes was only affected by the decumulation timing. The percentage of normal live oocytes was significantly higher when CC were removed after 20 and 44 h of IVM in both SF (39.7 and 39.3 v. 17.7%) and MF (45.4 and 37 v. 22.2%). The incidence of early and late apoptotic oocytes was significantly higher when the CC were removed before IVM culture in both SF (74.3 and 7.4%) and MF (69.4 and 6.7%). The incidence of mature live oocytes was significantly affected by both the origin of COC and the decumulation timing. Although the percentage of mature oocytes was higher in MF, maturation rates were significantly higher when oocytes were denuded at 20 h of IVM culture (SF 65.4%, MF 83.1%) as compared at 0 (SF 27.9%, MF 32.3%) and 44 h (SF 41%, MF 68.5%). However, the percentage of oocytes with normal spindle morphology was significantly higher when oocytes were denuded at 44 h of IVM culture (SF 70.6%, MF 91.5%) than 20 h (SF 66.8%, MF 73%). In summary, regardless of COC from SF and MF, removal of CC at 20 h of IVM culture seems to promote meiotic progression of the oocytes to the MII stage, but factor(s) from or communication with CC during the latter half of IVM culture may be needed to obtain a normal spindle morphology in mature oocytes.

298 CYCLIC AMP AND CYCLIC GMP CONTENTS IN PORCINE OOCYTE-CUMULUS COMPLEXES, DENUDED OOCYTES, AND CUMULUS CELLS DERIVED FROM SMALL AND MIDDLE FOLLICLES DURING IN VITRO MATURATION Y. Okudaira and H. Funahashi Department of Animal Science, Okayama University, Okayama, Japan Drastic changes in intracellular cAMP and cGMP levels play a critical role in the regulation of meiotic resumption. The objective of this study was to compare cAMP and cGMP contents in cumulus-oocyte complexes (COC), denuded oocytes (DO), and cumulus cell masses (CC) derived from small (SF) and middle follicles (MF) during in vitro maturation (IVM). The COC were aspirated from SF (1–3 mm in diameter) or MF (3–6 mm in diameter) of prepubertal gilt ovaries. The COC were cultured in modified porcine oocyte medium (mPOM) with eCG, hCG, and dibutyryl cAMP for 20 h and then in fresh mPOM without those supplements for 4 h in an atmosphere of 5% CO2 in air at 398C. At 0, 10, 20, and 24 h of IVM, COC, DO, and CC were collected. The DO were prepared by removal of cumulus cells and zona pellucida. The CC were prepared by puncturing ooplasm by using 18-gauge needle. Intracellular contents of cAMP and cGMP were determined by direct enzyme immunoassay kits. Statistical analyses of 3 to 7 replicated data were performed by ANOVA. There were no significant differences in contents of cAMP and cGMP between DO from SF and MF in all observation points (P . 0.05). Cyclic AMP contents in COC and CC derived from MF were higher than those from SF at 20 h of IVM (MF 33.0 0.5 fmol/COC v. SF 28.4 1.0 fmol/COC, MF 20.9 0.9 fmol/CC v. SF 14.6 0.8 fmol/CC; P , 0.05), whereas there were no significant differences between origins of those (SF v. MF, P . 0.05) at 0, 10, and 24 h of IVM. Furthermore, although cAMP content in CC from MF was not significantly different between 10 and 20 h of IVM (25.4 1.7 and 20.9 0.9 fmol/CC, respectively; P . 0.05), the content in CC from SF significantly decreased between 10 and 20 h (23.1 1.2 , and 14.6 0.8 fmol/CC, respectively; P , 0.05). At 0 and 10 h of IVM, cGMP contents in COC and CC from MF were significantly higher than those from SF (0 h: 81.8 4.5 fmol/COC from MF v. 41.7 10.6 fmol/COC from SF and 82.7 7.5 fmol/CC from MF v. 10.7 2.7 fmol/CC from SF; 10 h: 64.8 8.4 fmol/COC from MF v. 24.8 8.2 fmol/COC from SF, 49.3 14.9 fmol/CC from MF v. 13.5 4.8 fmol/CC from SF; P , 0.05). However, there were no significant differences in cGMP contents in COC and CC between the origins (MF v. SF) at 20 and 24 h of IVM (P . 0.05). From these results, we conclude that cAMP and cGMP contents in cumulus cells are significantly differences between the origins (MF v. SF) during IVM.

299

EFFECT OF ESTRADIOL-17B AND FOLLICLE STIMULATING HORMONE ON THE IN VITRO MATURATION OF PORCINE OOCYTES DERIVED FROM SMALL FOLLICLES Y. LiA, C. MorosA,B, M. J. Izquierdo-RicoA,B, R. RomarC, and H. FunahashiA A

Department of Animal Science, Okayama University, Okayama, Japan; Department of Cell Biology and Histology, University of Murcia, Murcia, Spain; C Department of Physiology, University of Murcia, Murcia, Spain

B

In porcine cumulus-oocyte complexes (COC) from middle follicles (MF: 3–6 mm in diameter), FSH is known to induce the resumption of meiosis and accompanied by transactivate of the EGF receptor and activation of MAPK3/1 in the cumulus cells. The aim of the current study was to examine the effect of oestradiol-17b (E2: 0.1 mg mL1) or FSH on in vitro maturation (IVM) of porcine oocytes derived from small follicles (SF: 1–2 mm in diameter). The COC were aspirated from MF of porcine ovaries obtained at slaughterhouse and cultured for IVM in mPOM (with 1 mM dibutyryl cAMP, 10 IU mL1 of eCG, and 10 IU mL1 of hCG for 20 h and then without those for 24 h in an atmosphere of 5% CO2 in air at 398C) after washing 3 times. The COC from SF, which were aspirated at the same time with COC from MF, were precultured in the absence or presence of E2 or E2 plus FSH for 6 h before IVM culture. After the culture, oocytes were denuded from cumulus cells with 0.1% (vol/vol) hyaluronidase and the meiotic stage was observed. Relative transcript abundance of FSH and EGF receptors of CC was also examined by real-time RT–PCR just after preincubation for 6 h. Statistical analysis of data from 3 to 5 replicates was analysed by ANOVA and Tukey’s multiple comparison tests. Maturation rate of oocytes from SF (40.6 3.1%) was significantly lower than that of oocytes from MF controls (78.8 2.8%, P , 0.01). Preincubation in the presence of E2 alone and E2 plus 0.005 IU of FSH significantly increases the maturation rate of oocytes from SF (56.8 1.5 and 55.7 3.1%, respectively, P , 0.01), although

Oocyte Maturation


239

the rate was still lower than MF controls. However, in the presence of E2 plus a higher concentration of FSH (0.05 and 0.5 IU), oocyte maturation rate was similar (36.3 2.4 and 33.7 1.9%, respectively) to SF controls and lower than those of E2 alone and E2 plus 0.005 IU of FSH groups. Relative transcript abundance of FSH receptor of CC increased (P , 0.01) during preincubation in the presence of E2, but decreased in the presence of 0.05 IU of FSH. There were no significant differences in the transcript abundance of EGF receptors among treatments during preincubation (P ¼ 0.09). In conclusion, preincubation of COC from SF in the presence of E2 alone and E2 plus 0.005 IU of FSH improves the maturation rate of the oocytes, whereas the presence of FSH more than 0.05 IU mL1 concealed the positive effect. These effects may be yielded by change in the relative transcript abundance of FSH receptor of COC through the treatments.

300

GANGLIOSIDE IMPROVES MEIOTIC MATURATION AND PREIMPLANTATION DEVELOPMENT OF PORCINE OOCYTES J.-W. Kim, S.-K. Chae, Y.-H. Lee, J.-H. Ahn, G.-Y. Do, H. Park, and D.-B. Koo Department of Biotechnology, Daegu University, Gyeongsan, Gyeongbuk, Republic of Korea

Gangliosides are sialic acid-conjugated glycosphingolipids that are believed to regulate cell differentiation as well as the signals of several signal molecules, including epidermal growth factor receptor (EGFR). These compounds are localised in a glycosphingolipid-enriched microdomain on the cell surface and regulated by the glycosphingolipid composition. However, the role of gangliosides in porcine embryos is not yet clearly understood. Therefore, in this study, the relationship between ganglioside (GD1a) and EGFR activation was investigated during meiotic maturation and further development in porcine oocytes. Porcine oocytes were cultured in the NCSU-23 medium supplemented with or without EGF and GD1a for 44 h. Assessment of meiotic maturation was performed by using aceto-orcein staining method. Also, protein levels in matured oocytes were evaluated by Western blot analysis. After fertilization, presumptive zygotes were cultured in the PZM-3 medium for 6 days. All experiments were repeated more than 3 times. Data were analysed by using Student’s t-test and Duncan’s multiple range test. The proportion of GV arrested oocytes at 22 h was significantly different between the EGF þ GD1a-treated and untreated group (41.6 1.5 v. 25.0 0.0%; P , 0.05). After completion of meiotic maturation (44 h), the proportion of MII was significantly different between the EGF þ GD1a-treated and untreated group (89.9 3.6 v. 57.4 5.3%; P , 0.05). Also, expression of EGFR protein in matured porcine oocytes was increased in the presence of EGF and GD1a. After IVF, the percentage of penetrated oocytes was significantly higher in the EGF þ GD1a-treated group (89.1 2.3%), resulting in higher than normal pronucleus formation (2PN of 43.1 5.2%). Finally, in result, differences in preimplantation developmental potential were detected between the oocytes that were matured with or without EGF and GD1a (50.4 6.1 v. 27.2 2.7%; P , 0.05). These results suggest that GD1a improves the developmental competence of embryos via enhanced meiotic maturation of porcine oocytes by EGFR activation.

301

ZINC IS INVOLVED IN PORCINE OOCYTE MEIOTIC MATURATION M.-H. ZhaoA, T. KimB, N.-H. KimA, and X.-S. CuiA

A

Department of Animal Science, Chungbuk National University, Cheongju, Chugnbuk, Republic of Korea; B School of Medicine, Catholic University of Daegu, Daegu, Republic of Korea

Zinc is an extremely important trace element that plays important roles in several biological processes. In this study, we investigated the role of zinc during meiotic resumption and metaphase arrest in in vitro-matured porcine oocytes. Oocytes at either germinal vesicle (GV) or MII stage were treated with TPEN, a Zn2þ chelator. Meiotic resumption and activation were assayed. Effect of PMA, a PKC activator, on GV breakdown (GVBD) and oocytes activation after TPEN treatment were checked. Results showed that depletion of zinc with 3 mM TPEN-blocked oocytes at GV stage (60.85 5.15 v. 15.60 0.20%; P , 0.05) after 25 h of maturation. The 10-mM TPEN treatment at MII stage significantly (P , 0.05) increased pronucleus formation (90.61 9.10 v. 5.56 9.62%; P , 0.05) and the second polar body extrusion (93.64 5.53 v. 8.59 8.34%; P , 0.05). The p34cdc2 activity was decreased in both MII and GVBD oocytes that were treated with TPEN as compared to control. Phosphorylated MAPK measured by Western blot was also decreased in GVBD oocytes when zinc was depleted. This might be explained by the low expression of C-mos Cyclin B1 and Cdc2 at this stage. Treatment of the oocytes with PKC agonist PMA (100 nM) rescued the meiotic resumption arrest observed after TPEN treatment (GV stage: 26.91 3.10 v. 83.89 11.94%; P , 0.05). The level of phosphorylation of MAPK and p34cdc2 activity were rescued when PMA were used. Treatment oocytes with 100 nM PMA in the GV stage also increased the signal of zinc indicator, fluozin-3-a.m., by about 4-fold in cytoplasm (P , 0.05). These results showed that zinc regulates meiotic resumption probably through PKC. However, although the TPEN treatment reduced phosphorylation of PKC substrates in both meiotic resumption and the MII stage, rescue of PKC substrates phosphorylation with PMA did not prevent the activation of oocytes caused by zinc depletion. These data demonstrate that zinc regulates meiotic resumption via a PKC-dependent pathway, but independent of that in maintaining of metaphase arrest in porcine oocytes. This work was supported by the Bio-industry Technology Development Program, Ministry of Agriculture, Food and Rural Affairs, Republic of Korea, and by a grant from the Next-Generation BioGreen 21 Program (No. PJ009601 and PJ009098), Rural Development Administration, Republic of Korea.

240


302

Oocyte Maturation

EFFECT OF GROWTH DIFFERENTIATION FACTOR 8 ON PORCINE OOCYTE IN VITRO MATURATION AND SUBSEQUENT EMBRYONIC DEVELOPMENT AFTER PARTHENOGENETIC ACTIVATION AND IN VITRO FERTILIZATION J. D. YoonA, E. LeeB, and S.-H. HyunA

A VETEMBIO, College of Veterinary Medicine, Chungbuk National University, Cheongju, Republic of Korea; Laboratory of Theriogenology, College of Veterinary Medicine, Kangwon National University, Kangwon, Republic of Korea

B

Growth differentiation factor 8 (GDF8) is a member of the transforming growth factor-b that has been identified as a strong physiological regulator. The purpose of this study was to investigate the effects of GDF8 on in vitro porcine oocytes maturation and subsequent embryonic development after pathenogenetic activation (PA) and in vitro fertilization (IVF). We investigated nuclear maturation, intracellular glutathione (GSH), reactive oxygen species (ROS) levels, sperm penetration (SP) analysis, and subsequent embryonic development after PA and IVF. Each concentration (0, 1, 10, and 100 ng mL1) of GDF8 was added in maturation medium during process of in vitro maturation. Data were analysed by ANOVA followed by Duncan using SPSS (Statistical Package for Social Science) mean s.e.m. After 44 h of IVM, no significant difference was observed on nuclear maturation from the different concentration (0, 1, 10, and 100 ng mL1) of GDF8 treatment groups (85.5, 85.9, 89.4, and 87.6%, respectively) compared with the control (P . 0.05). The 10- and 100-ng mL1 GDF8-treated groups showed a significant (P , 0.05) decrease in intracellular ROS levels compared with other groups. The embryonic developmental competence after PA was affected with GDF8 treatment during IVM. The 10- and 100-ng mL1 treatment groups showed significantly (P , 0.05) higher cleavage rates (67.5 and 69.1%, respectively) compared with control group (53.7%). The 10- and 100-ng mL1 treatment groups also showed significantly (P , 0.05) higher blastocyst formation rates (50.5 and 52.7%, respectively) compared with other groups (34.5 and 35.8%). The IVF embryonic developmental competence also was affected with GDF8 treatment during IVM. The 10-ng mL1 treatment group showed a significantly (P , 0.05) higher blastocyst formation rates and total cell number compared with control (21.5 and 131.3 v. 15.0 and 92.6%, respectively). Also, in the sperm penetration assessment, the 10- and 100-ng mL1 treatment groups showed higher mono spermy ratio and fertilization efficiency (32.7 and 27.1, 32.0 and 26.5 v. 22.6 and 19.7%, respectively) than control, which was significant (P , 0.05). In conclusion, the treatment with 10 ng mL1 of GDF8 during IVM improved the PA and IVF porcine embryo developmental competence by decreasing the intracellular ROS levels. This work was supported, in part, by a grant from the Next-Generation BioGreen 21 Program (No. PJ00956901), Rural Development Administration, and the National Research Foundation of Korea Grant funded by the Korean Government (NRF-2013R1A2A2A04008751), Republic of Korea.

303

HUMAN RECOMBINATION GRANULOCYTE-COLONY STIMULATING FACTOR (HRG-CSF) HAVE BENEFICIAL EFFECTS ON PORCINE OOCYTES QUALITY DURING IN VITRO MATURATION AND SUBSEQUENT VIABILITY OF EMBRYONIC DEVELOPMENT L. CaiA, E. LeeB, and S.-H. HyunA A VETEMBIO, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea; Laboratory of Theriogenology, College of Veterinary Medicine, Kangwon National University, Kangwon, Republic of Korea

B

Granulocyte colony-stimulating factor (G-CSF), also known as colony-stimulating factor 3 (CSF3), is required for the proliferation, differentiation, and survival of cells. In humans, G-CSF is a biomarker of human oocyte developmental competence for embryo implantation. Furthermore, G-CSF concentration increases during the menstrual cycle and levels were significantly higher during ovulatory phase than the other phases. In this study, we examined G-CSF and its receptor gene expression in the porcine granulosa cells, corpus luteum, cumulus cells, and oocytes. The cumulus-oocyte complexes (COC) were aspirated from antral follicles 1 to 3 mm (small follicle) and 3 to 6 mm (medium follicle). The COC from 2 kinds of follicles were matured in protein-free maturation medium supplemented with various concentrations of hrG-CSF (0, 10, and 100 ng mL1, respectively). Statistical analyses were done by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range tests. After real time-PCR was performed, the CSF3 and its receptor (CSF3R) were observed all of granulosa cells, corpus luteum, cumulus cells, and oocytes. Interestingly, the CSF3 transcript levels were significantly lower in oocytes compared with other cell types, but the CSF3R transcript levels in oocytes were almost similar with granulosa cells. After 44 h of IVM, the rates of nuclear maturation had no difference, and the intracellular ROS levels of oocytes from both kind of follicle groups matured with 10 ng mL1 were significantly decreased compared to other groups (P , 0.05). After PA, the cleavage and blastocyst formation rates were significantly (P , 0.05) increased for the 100 ng mL1 of small follicle (SF; 63.29 and 31.18%) group compared to control and 10 ng mL1 of SF (38.64, 10.4, and 49.0, 15.6%, respectively) group, and significantly (P , 0.05) increased in the 10 ng mL1 of medium follicle (MF; 76.32 and 45.61%) group compared with control and 100 ng mL1 of MF (52.1, 32.8 and 61.3, 33.9%, respectively). The total cell numbers of blastocyst from SF and MF groups were significantly increased in the 10 ng mL1 (73.67 and 106.52) groups. At IVF, the blastocysts formation rates were significantly increased in the 10 ng mL1 of MF group compared to control, 100 ng mL1 of SF, and control of MF (21.1, 22.8, and 27.8%, respectively). We also examined the Bcl2 and ERK2 transcript levels, which were significantly increased at 100 ng mL1 of SF and 10 ng mL1 of MF. These results suggest that hrG-CSF improved the quality of porcine oocyte and embryonic viability. This was supported, in part, by a grant from the National Research Foundation of Korea Grant Government (NRF-2012R1A1A4A01004885, NRF-2013R1A2A2A04008751), Republic of Korea.

Oocyte Maturation

304


241

EFFECT OF THE SEASONAL INFERTILITY PERIOD ON OOCYTE COMPETENCE IN PIGS A. M. GiraldoA, D. HylanA, R. R. PaytonB, and J. L. EdwardsB

B

A DeSoto Biosciences Inc., Seymour, TN, USA; Department of Animal Science, Institute of Agriculture, UT AgResearch, The University of Tennessee, Knoxville, TN, USA

Photoperiod is the principal regulator of seasonal breeding; however, effects of photoperiod on the fertility of the domestic sow are inconclusive. Some evidence indicates that the modern sow exhibits a period of impaired reproductive performance during the late summer and early fall. Seasonal variation in oocyte developmental competence has been described as a contributing factor. Alterations in oocyte quality, along with reductions in blastocyst rates and cell numbers in embryos from summer-sourced oocytes, may be attributed to an alteration in follicular fluid (FF) composition. The objectives of this study were to determine whether seasonal variations in blastocyst development rates are associated with changes in cumulusoocyte complex (COC) morphology and oocyte developmental competence in sows. This study also compared the effect of FF collected in spring v. summer during in vitro maturation (IVM) on oocyte competence. In experiment 1, oocytes from 3- to 8-mm follicles were aspirated from sow ovaries during 1 calendar year for a total of 77 replicates. Only oocytes with homogeneous dark cytoplasm and at least 2 layers of cumulus cells underwent IVM. Mature oocytes were electrically activated and the resulting embryos were cultured for 6 days. In experiment 2, a total of 1256 good quality COC were divided into 2 groups and cultured in IVM medium containing 10% FF collected in either spring or late summer. Metaphase II oocytes were electrically activated and cultured to generate diploid embryos. Differences between experimental groups were assessed using Student’s t-test or X2. The percentage of ovaries exhibiting good-quality follicles and the number of COC per ovary remained constant during the entire calendar year (60% and 6.2 COC/ovary, respectively). However, oocyte quality decreased significantly from 3.6 to 3.2 during late August throughout early October in a 1 to 4 scale. The percentage of good-quality COC decreased significantly during late summer and early fall compared with the rest of the year (54.5 v. 65.5%). However, maturation, cleavage, and blastocyst rates did not show significant differences between the summer and the other seasons (85.5 v. 87.6, 87.8 v. 87.7, and 27.8 v. 27.0%, respectively). The presence of FF collected in either spring or summer in the IVM medium did not affect maturation, cleavage, or blastocyst rates (88.9 v. 87.7, 90.7 v. 90.5, and 42.1 v. 43.7%, respectively). Blastocyst cell numbers (Day 6) did not differ when FF from spring and summer antral follicles was used for supplementing IVM medium (43.6 v. 46.1 cells, respectively). In summary, impaired reproductive performance of domestic sows during late summer and early fall is coincident with a decreased in the number and quality of COC. However, efforts to use strict selection criteria for COC during this time period may result in maturation and development rates comparable to the rest of the seasons. Additionally, the presence of FF collected in either spring or summer in the IVM medium does not seem to affect oocyte maturation and subsequent embryo development.

305

ROYAL JELLY TREATMENT DURING OOCYTE MATURATION IMPROVES IN VITRO MEIOTIC COMPETENCE OF GOAT OOCYTES BY INFLUENCING INTRACELLULAR GLUTATHIONE SYNTHESIS AND APOPTOSIS GENE EXPRESSION H. R. MazangiA, H. DeldarB, N. E. KashanA, and A. Mohammadi-SangcheshmehC,D A

Department of Animal Science, Science and Research branch, Islamic Azad University, Tehran, Iran; Department of Animal Science, College of Animal Science and Fisheries, Sari Agricultural Science and Natural Resources University, Sari, Iran; C Department of Transgenic Animal Science, Stem Cell Technology Research Center, Tehran, Iran; D Department of Animal and Poultry Science, College of Aburaihan, University of Tehran, Pakdasht, Tehran, Iran B

Royal jelly (RJ) is a secretion product from the cephalic glands of nurse bees that has extraordinary properties and remarkable health effects. Over the years, antioxidative and antiapoptotic properties of RJ have been experimentally investigated. Here we hypothesised that supplementary RJ in in vitro maturation (IVM) medium would (i) improve cumulus expansion (ii) oocyte nuclear maturation, (iii) glutathione (GSH) content, and (iv) mitochondrial activity, and (v) also affect the mRNA abundance of the (Bax, Bcl-2, and p53) transcripts involved in oocyte apoptosis. To test these hypotheses, goat ovaries were collected from a local abattoir and transported to the laboratory. Cumulus-oocyte complexes (COC) with multilayered compact cumulus investment and evenly granulated cytoplasm were selected and randomly allocated to the experiments. To evaluate the effects of RJ on meiotic competence after maturation in vitro, IVM medium was supplemented with concentration of 0.0 (RJ-0), 2.5 (RJ-2.5), 5.0 (RJ-5), and 10.0 (RJ-10) mg mL1 of RJ. After IVM, oocytes of each group were evaluated for cumulus expansion (visual assessment), stage of nuclear maturation (Hoechst staining), intracellular level of GSH (Cell Tracker blue staining), mitochondrial activity (MitoTracker Deep Red staining), and relative expression of Bax, Bcl-2, and p53 genes (qRT-PCR assay). Differences were analysed for significance by one-way ANOVA using SAS version 8.0 (SAS Institute Inc., Cary, NC, USA), considering P , 0.05 to be significant. Supplementation of the maturation media with RJ did not appear to affect cumulus expansion (P . 0.05). Our results revealed that maturation rate was higher (88.0%) in the RJ-10 group when compared with the RJ-2.5 (71.5%) and control (RJ-0) groups (60.0%; P , 0.05), but similar with the RJ-5 group (81%; P . 0.05). A higher (P , 0.05) GSH content was detected when comparisons were made between each concentration of RJ-treated (i.e. RJ-2.5, RJ-5, and RJ-10) oocytes and the control (RJ-0) oocytes; however the differences were not significant when RJ groups were compared. No difference (P . 0.05) was observed among RJ-treated and untreated oocytes regarding their mitochondrial activity after IVM. Based on these results, the concentration of 10 mg mL1 (RJ-10) was selected for evaluation of Bax, Bcl-2, and p53 transcripts abundance. Our results revealed that the expression of Bax mRNA was decreased (P , 0.05) in RJ-10 group when compared with control (RJ-0) group. Furthermore, there was an increased (P , 0.05) expression of Bcl-2 transcripts in RJ-10 group when compared to the control (RJ-0) group. The p53 transcript also tended to be higher in RJ-10 group than in the control (RJ-0) group, although this difference was not statistically significant (P . 0.05). In conclusion, results of this study showed that adding RJ to maturation medium at optimum concentration increased the nuclear maturation and GSH synthesis, but not activity of the mitochondria; this improvement was associated with expression of apoptosis-related genes in goat oocytes.

242


306

Oocyte Maturation

EFFECT OF DIFFERENT IN VITRO MATURATION MEDIA ON DEVELOPMENTAL POTENTIAL OF GOAT OOCYTES ALREADY FOUND DENUDED AT COLLECTION J. M. G. Souza-FabjanA,B, E. CorbinA, Y. LocatelliA,C, N. DuffardA, C. PerreauA, V. J. F. FreitasB, and P. MermillodA A

PRC, INRA, Nouzilly, France; LFCR, UECE/FAVET, Fortaleza, Brazil; C Re´serve de la Haute Touche, Obterre, France B

A grade classification (I, II, and III) based on the number of cumulus layers and oocyte morphology is currently used by many laboratories. Oocytes found denuded at collection (grade III) are considered not suitable and routinely discarded. Thus, if a particular strategy could be applied to their use in labour-intensive processes, such as ovum pickup, it would be a benefit. This experiment was performed to examine the effect of IVM medium composition to produce goat embryos in vitro using oocytes already found denuded at collection (DOC). In total, 411 DOC and 141 intact COC (control treatment) obtained by slaughterhouse ovaries were analysed in 4 replicates. The maturation medium consisted in TCM199 supplemented either with (1) 10 ng mL1 of EGF and 100 mM cysteamine (simplified); (2) 10 ng mL1 of EGF, 5 IU mL1 of hCG, 10 IU mL1 of eCG, 19 ng mL1 of IGF-1, 2.2 ng mL1 of FGF, 5 mg mL1 of ITS, 90 mg mL1 of L-cystein, 0.1 mM b-mercaptoethanol, 75 mg mL1 of vitamin C, 720 mg mL1 of glycine, 0.1 mg mL1 of glutamine, and 110 mg mL1 of pyruvate (semidefined); or (3) 10% fetal calf serum (FCS), 100 mM cysteamine, and 50 ng mL1 of oFSH (complex). Both DOC and COC were subjected to IVM, IVF, and IVD as previously described (Souza-Fabjan et al. 2014, Theriogenology 81, 1021–31). The COC were matured only in simplified medium. On Day 8, all expanded blastocysts were fixed and stained with Hoechst for cell counting. Statistical analysis was performed using all tests with a significant interval of 95%. All variables were compared among treatments using ANOVA and SNK test. The results are described as mean per replicate s.e.m. No significant differences were found in simplified, semidefined, or complex medium, respectively, in cleavage rate (52 7.5, 60 9.4, or 51 15.0%), blastocyst from cleaved (36 3.9, 39 9.3, or 41 4.8%), blastocyst from initial DOC (19 5.0, 23 8.1, or 21 3.3%), hatching rate (55 22.9, 55 15.9, or 52 14.8%), or total blastomeres number (184 12.6, 179 12.4, or 190 13.8). The control COC showed no significant differences to any DOC treatment on cleavage (77 3.4%) and blastocyst from cleaved (60 2.2%). However, the blastocyst rate from initial COC was higher (46 0.5%; P , 0.05) than all DOC treatments. Even though the blastocyst yield was lower than COC (,21 v. 46%), it is reasonable to affirm that it is possible to produce embryos from oocytes that would not be utilised, which may represent additional number of embryos. The blastocyst cell numbers in COC (192 13.7) were similar (P . 0.05) to DOC, indicating that the goat embryos produced were of good quality. In conclusion, the inclusion of more complex substances in IVM media did not increase the development rate of DOC and, therefore, more simple IVM media could be used for this purpose. Finally, the goat embryos produced had satisfactorily number of blastomeres, demonstrating that the in vitro development step is able to generate good quality embryos from grade III oocytes. Therefore, some oocytes that in general would be discarded will develop to blastocysts and may represent benefits, especially after ovum pick-up from genetically valuable goats.

307

MATURATION RATE AND GENE EXPRESSION ANALYSIS OF GOAT OOCYTES SELECTED BY FOLLICLE SIZE AND BRILLIANT CRESYL BLUE STAINING M. Yang, S. Hu, L. Cox, M. Regouski, H. Rutigliano, C. Isom, and I. Polejaeva Department of Animal, Dairy and Veterinary Sciences, Utah State University, Logan, UT, USA

Oocyte quality plays a critical role in determining the success of embryo development. Studies on cattle and goats indicate that oocytes derived from large follicles (LFO) have greater developmental competence than those derived from small follicles (SFO). Brilliant cresyl blue (BCB) staining determines the activity of glucose-6-phosphate dehydrogenase and is a commonly used noninvasive marker of oocyte competence. Studies in pigs, goats, cows, mice, and dogs showed that the maturation and blastocyst developmental rate of BCBþ oocytes is significantly higher than BCB oocytes. The aim of this study was to evaluate the maturation rate of goat oocytes selected based on follicular size and BCB staining and compare their relative patterns of gene expression. Maturation rate and gene expression profile were expected to be different in these oocyte groups. Cumulusoocyte complexes were recovered from abattoir-derived ovaries using a slicing technique. Eleven rounds of oocyte maturation and 4 rounds of BCB staining were carried out. During each replicate, oocytes from large ($3 mm) and small (,3 mm) follicles were collected separately from the same group of ovaries. Oocyte maturation rates were 54.3 5.4% for LFO (n ¼ 378) and only 33.5 3.7% for SFO (n ¼ 981; P , 0.01). The BCBþ (n ¼ 223) oocytes yielded a significantly higher maturation rate than the BCB (n ¼ 194) oocytes (56.1 1.8 v. 20.6 3.8%, respectively; P , 0.001). Gene expression analysis was conducted on individual MII oocytes (21 oocytes per group). Specific target amplification was performed on a single oocyte directly by using the CellsDirect One-Step qRT–PCR Kit (Invitrogen). Quantitative real-time PCR was then performed using the 48.48 BioMark platform from Fluidigm. Forty two genes were selected from the following categories: growth factors, transcription factors, metabolism, pluripotency, cell cycle, apoptosis, and oocyte-specific genes. Relative expression values were calculated using the DDCT (fold change) method and analysed by ANOVA. The significance was assigned at P , 0.05. The relative expression of CCNA2, CDK2, CCNB1, POU5F1, SOX2, EGF, FGF2, GDF9, ZP3, BCL2, GJA1, DDR1, PFKFB3, IGF2R, and GRB10 was significantly greater (P , 0.05) in both LFO and BCBþ oocytes compared to SFO and BCB oocytes, respectively. The proapoptotic gene BAX, the ACSL3 gene involved in fatty acid oxidation, and the growth factor IGF1 were expressed significantly higher (P , 0.05) in SFO compared to LFO. By investigating these differentially expressed transcripts, we will better understand pathways involved in oocyte developmental competence and potentially use them as markers of oocyte quality. We expect that the ability to select oocytes of better quality based on BCB staining will improve outcomes of IVF and SCNT.

Oocyte Maturation

308


243

VERBASCOSIDE TREATMENT DURING IN VITRO MATURATION IMPROVES THE EMBRYO DEVELOPMENT OF PREPUBERTAL OVINE OOCYTES

M. E. Dell’AquilaA, F. AriuB, N. A. MartinoA, F. MinerviniC, A. CardinaliC, and L. BoglioloB A

Dept. Emergency & Organ Transplantation, Veterinary Clinics & Animal Productions Unit, University of Bari Aldo Moro, Valenzano, Bari, Italy; B Dept. Veterinary Medicine, Obstetric & Gynecological Section, Sassari, Italy; C Inst. Sciences of Food Production (ISPA), National Research Council (CNR), Bari, Italy

Verbascoside (VB), a bioactive polyphenol from olive mill wastewater with known antioxidant activity, was shown to act as a pro-oxidant molecule, by impairing energy/redox status and embryo developmental competence of prepubertal ovine oocytes when added at micromolar concentrations in a continuative 24-h in vitro maturation (IVM) exposure protocol (1). The aim of the present study was to determine whether a lower (nanomolar) VB concentration and a shorter exposure time (2 v. 24 h) during IVM may improve the maturation rates of prepubertal ovine oocytes and their subsequent embryonic development in vitro. Cumulus-oocyte complexes derived from the ovaries of slaughtered 1-mo-old prepubertal sheep oocytes underwent IVM in TCM 199 with 10% oestrus sheep serum, 0.1 IU mL1 of FSH/LH, and 100 mM cysteamine, in 5% CO2 in air at 38.58C for 24 h. Based on our previous results (Dell’Aquila et al. 2014 Biomed. Res. Int. 2014, 878062), VB was added in the IVM medium at 1.03 nM, and 2 incubation times (24 and 2 h) were tested. In the 2-h exposure group, after 2 h of exposure to VB, oocytes were washed and cultured up to 24 h without VB. A group of oocytes were cultured in absence of VB, as controls. Matured oocytes were fertilized with frozen-thawed ram semen in SOF medium for 22 h and zygotes were cultured in vitro for 8 days. Metaphase II (MII) cleavage and blastocyst rates were analysed by Chi-squared test. Embryo quality was evaluated by staining and total cell count of the blastocyst and analysis of variance (ANOVA) was applied. Differences were considered to be significant when P , 0.05. Compared to controls, VB treatment at the concentration of 1.03 nM and 24 h of exposure had no effect on MII rates (196/268, 73% v. 226/323, 70% MII/cultured oocytes; P . 0.05). However, this treatment allowed to obtain significantly higher rates of cleaved embryos/MII oocytes (156/196, 80% v. 165/226, 73%; respectively; P , 0.05), blastocyst yield/cleaved embryos (59/156, 38% v. 45/165, 27%, respectively; P , 0.05), and total blastocyst cell numbers (108.62 19.87 v. 89.61 26.32, respectively; P , 0.05) compared to control oocytes. The VB treatment at the same concentration but for 2 h induced only significantly higher cleavage rate (196/210, 93% v. 165/226, 73%; P , 0.05). In conclusion, our results showed that VB treatment at 1.03 nM during 24 h of IVM exerted a positive effect on in vitro embryo development of prepubertal ovine oocytes by increasing the blastocyst yield and their quality. The hypothesis that VB at nanomolar concentrations may improve cumulus-oocyte energy/redox status is under investigation. The authors acknowledge support by the Regione Autonoma della Sardegna (LR 7, Agosto 2007, no. 7, CRP-17602). The authors thank Dr D. Bebbere and L. Falchi, Dept. Veterinary Medicine, Sassari, for statistical analysis.

309 ADDITION OF BRAIN-DERIVED NEUROTROPHIC FACTOR IN MATURATION MEDIUM IMPROVED IN VITRO MEIOTIC COMPETENCE OF OVINE OOCYTES AND SUBSEQUENT PARTHENOGENETIC DEVELOPMENT A. H. Abazari-kiaA, A. Mohammadi-SangcheshmehB, M. SalehiC, and M. ZhandiD A Department of Transgenic Animal Science, Stem Cell Technology Research Center, Tehran, Iran; Department of Animal and Poultry Science, College of Aburaihan, University of Tehran, Pakdasht, Tehran, Iran; C Department of Biotechnology, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran; D Department of Animal Science, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran B

Overall efficiency of in vitro embryo production has remained low despite extensive effort to understand the effects of culture conditions, media composition, and supplementation. Brain-derived neurotrophic factor (BDNF), which is a physiologically important neurotrophin, has been used to enhance oocyte maturation in some previous studies (Lee et al. 2007; Zhang et al. 2010). However, the efficacy of BDNF to improve oocyte competence has not been fully established especially in ovine. Therefore, the present study aimed to evaluate the effect of BDNF during in vitro maturation (IVM) on maturation rate, intracellular glutathione (GSH) content, and embryonic development in sheep oocytes. Cumulus-oocyte complexes (COC) were obtained from ovaries of ewes. The COC were placed in maturation medium supplemented with either 10 (IVM-B10) or 100 (IVM-B100) ng mL1 of BDNF (PeproTech, London, UK). Oocytes in control group were incubated in the same maturation medium without BDNF. The IVM was performed in a humidified atmosphere containing 5% CO2, 5% O2, and 90% N2 at 38.58C for 24 h. After IVM, several oocytes from the IVM-B10 (n ¼ 110), IVM-B100 (n ¼ 124), and control (n ¼ 110) groups were stained with Hoechst and were evaluated in relation to their metaphaseII rate. To measure GSH content, several oocytes from the IVM-B10 (n ¼ 28), IVM-B100 (n ¼ 33), and control (n ¼ 37) groups were incubated in tyrodes medium containing 10 mM Cell Tracker blue for 30 min and transferred under fluorescence microscope, with digital images analysed by image J software. To evaluate the embryonic development, several oocytes from IVM-B10 (n ¼ 145), IVM-B100 (n ¼ 137), and control (n ¼ 143) groups were subjected to parthenogenetic activation by applying 1 min of exposure to 2.5 mM ionomycin followed by 2 mM 6-DMAP treatment for 3 h. After stimulation, oocytes were cultured in CR1aa medium for 7 days under the conditions stated previously. Four replications were performed. The metaphase-II rate, cleavage, and blastocyst rates were compared by x2 analysis. The GSH content was analysed by one-way ANOVA. A P-value of less than 0.05 was considered significant. The results showed that metaphase-II rate was higher in the IVM-B100 group (88.7%), as compared with the control group (77.3%), but not significant as compared with that in the IVM-B10 group (84.5%). No difference was also found between the IVMB10 group and control group in terms of the metaphase-II rate. Oocytes in the IVM-B10 group revealed a higher (96.8%) GSH content than both of the IVM-B100 (86.9%) and control (86.3%) groups. There was, however, no difference in the GSH content between the IVM-B100 group and control group. The proportion of cleaved embryos was not different between the groups; however, the blastocyst rate was higher in both the IVM-B10 (37.9%) and IVM-B100 (39.3%) groups compared with the control group (22.4%). Collectively, the results of this study showed that supplementation of IVM media with BDNF promoted nuclear maturation, increased GSH content, and stimulated in vitro embryonic development in ovine.

244


310

Oocyte Maturation

COBALAMIN SUPPLEMENTATION DURING IN VITRO MATURATION IMPROVES PREIMPLANTATION DEVELOPMENT OF SHEEP EMBRYOS F. ZacchiniA, P. ToschiA, P. LoiA, and G. E. PtakA,B A

B

University of Teramo, Teramo, Italy; Institute of Genetics and Animal Breeding PAS, Jastrzebiec, Poland

Oocyte maturation process includes the establishment of proper epigenetics marks, fundamental to ensure successful pregnancy. Epigenetic maturation of the oocyte depends on one-carbon-metabolism (OCM), whose key elements (cobalamin, folate) are crucial cofactors for the transfer of methyl groups onto chromatin. Commercially available IVM-media only partially supports oocyte metabolic requirements, and thus may negatively affect epigenetic maturation. Of relevance, cobalamin, one of the OCM cofactors normally present in follicular fluid, is missing in IVM-media. We investigated if cobalamin supplementation of IVM media affects sheep oocyte developmental competence in term of subsequent embryo development, epigenetic pattern, and fetal survival. Briefly, sheep oocytes were isolated from ovaries and divided into 2 groups: an untreated control (in vitro CTR group) and oocytes in vitro matured in medium containing cobalamin at 200 p.m. (Cobalamin group). Following maturation, MII oocytes were in vitro fertilized and cultured until blastocyst stage. A cohort of blastocysts was surgically transferred to recipient ewes and then conceptuses were collected at 20 days of pregnancy. Naturally mated conceptuses were also collected (in vivo CTR group). In vitro-matured oocytes and -derived blastocysts were analysed (i) by immunofluorescence anti-5-methylcitydine and (ii) by qRT-PCR for the expression of a panel of genes (MATb, ACHY, CBS, MTHFR, DNMT1) involved in OCM pathway. Immunofluorescence results were analysed by Image J software. Decimal variables were analysed using the Mann-Whitney test, while variables were expressed as percentage with the Fisher exact test. Cobalamin exposure during IVM significantly increased (i) cleavage rate (cobalamin 130/220 v. in vitro CTR 134/191, P , 0.02) following in vitro fertilization and (ii) global DNA methylation in blastocyst-stage embryos (P , 0.05). Then, qRT-PCR analysis of a select panel of OCM genes following IVM supplemented with cobalamin revealed a downregulation of MATb, ACHY, and DNMT1 in cobalamin-treated oocytes v. in vitro CTR group (P , 0.05), while no differences were observed at blastocyst stage. Finally, we found that the survival rate at 20 days of pregnancy was comparable in in vitro-produced (IVP) embryos from cobalamin and in vitro CTR oocytes, but reduced compared to in vivo CTR (cobalamin 60%, in vitro CTR 72%, and in vivo CTR 100%). Altogether, our results showed that cobalamin supplementation in IVM medium positively affects competence of oocytes and methylation profile at the blastocyst stage, presumably through the OCM pathway. Moreover, postimplantation survival of IVP conceptus, derived from untreated and treated oocytes, was reduced compared to naturally mated ones. Further investigation will clarify whether cobalamin supplementation influences fetal and placental development of IVP conceptus.

311 TEMPERATURE DURING OVERNIGHT HOLDING IN MEIOSIS INHIBITOR-FREE MEDIUM AFFECTS CHROMATIN CONFIGURATION AND MEIOTIC RESUMPTION IN EQUINE OOCYTES N. A. MartinoA, M. E. Dell’AquilaA, M. F. UranioA, R. LampignanoA, G. M. LacalandraA, and K. HinrichsB A

Veterinary Clinics & Animal Productions Unit, Dept. Emergency & Organ Transplantation, University of Bari Aldo Moro, Valenzano, Bari, Italy; B Depts. Veterinary Physiology & Pharmacology & Large Animal Clinical Sciences, Texas A&M University, College Station, Texas, USA

Immature equine oocytes may be held overnight in an Earle’s/Hanks’ M199-based medium in the absence of meiotic inhibitors (EH medium) to schedule the onset of in vitro maturation. Holding in EH has been shown not to affect meiotic or developmental competence of equine oocytes (Choi et al. 2006 Theriogenology 66, 955–963). However, no studies have been performed to identify the mode by which this medium suppresses meiosis. We hypothesised that holding temperature may affect oocyte meiotic arrest. The effect of 3 holding temperatures (25, 30, 388C) on chromatin status was investigated after Hoechst 33258 staining (Hinrichs et al. 2005 Biol. Reprod. 72, 1142–1150). Oocytes were recovered by scraping of follicles from slaughterhouse-derived ovaries. Data were analysed by Chi-squared test and one-way ANOVA followed by Dunn’s or Holm-Sidak Multiple Comparison methods. A level of P , 0.05 was considered significant. There were no significant differences in chromatin configuration between oocytes held overnight at 258C (258C-held) and controls (immediately-fixed oocytes); the proportion of oocytes showing meiotic resumption was 1/27, 4% and 0/26, 0%, respectively (not significant, NS). In contrast, holding at higher temperature significantly increased meiosis resumption (14/ 38, 37% and 14/28, 50%, at 30 and 388C, respectively; P , 0.01) and reduced the proportion of oocytes showing the most meiotically-competent germinal-vesicle (GV) configuration (condensed chromatin, CC; 24 to 29% v. 65 to 70% for control and 258C-held, respectively; P , 0.05). Based on these results, a subsequent experiment was performed in which oocyte meiotic stage and mitochondrial (mt) potential of 258C-held (n ¼ 29) and control (n ¼ 36) oocytes was evaluated. Nuclear chromatin, mt activity (MitoTracker orange), intracellular reactive oxygen species (ROS) levels (20 ,70 -dichlorodihydrofluorescein diacetate, DCDHFDA), and mt/ROS colocalization (Pearson’s coefficient) were analysed by epifluoscence and confocal microscopy (Martino et al. 2012 Fertil. Steril. 97, 720–728). Meiotic arrest after EH treatment at 258C was confirmed (0/29, 0% v. 5/36, 14% for meiotic resumption in 258C-held and controls, respectively; NS). At any GV stage, 258C-held treatment had no effect on mt activity, ROS levels, or mt/ROS colocalization. For example, in CC oocytes, values for control and 258C-held, respectively, were: MitoTracker, 547.8 499.5 v. 722.9 390.3; DCF fluorescence intensity, 278.5 179.3 v. 378 185, and mt/ROS colocalization, 0.5 0.1 v. 0.5 0.2; these were not significantly different (NS). In conclusion, EH holding at 258C maintains meiotic arrest, viability, and mt potential of equine oocytes.

Oocyte Maturation

312


245

EFFECTS OF TRANSFORMING GROWTH FACTOR ALPHA AND INSULIN-LIKE GROWTH FACTOR 1 SUPPLEMENTATION ON IN VITRO MATURATION OF CANINE OOCYTES A. SatoA, B. SarentonglagaA,B, K. OgataA,C, M. YamaguchiA,C, A. HaraA,C, J. IshiiC,D, M. WakabayashiE, K. NishiharaE, R. FukumoriA, and Y. NagaoA,C B

A University Farm, Faculty of Agriculture, Utsunomiya University, Tochigi, Japan; Collaboration Center for Research and Development of Utsunomiya University, Tochigi, Japan; C Department of Animal Production Science, United Graduate School of Agricultural Science, Tokyo University of Agriculture and Technology, Tokyo, Japan; D Nippon Formula Feed Manufacturing Company Limited, Kanagawa, Japan; E East Japan Guide Dog Association, Tochigi, Japan

Although in vitro maturation (IVM) of oocytes has been successfully established for many species, the efficiency of IVM in canine oocytes is still very low. As growth factors have been shown to promote oocyte maturation in some species, we investigated whether use of transforming growth factor a (TGF-a) and insulin-like growth factor 1 (IGF-1) might overcome the difficulties of achieving meiotic maturation in cultured canine cumulus-oocyte complexes (COC). Ovaries were obtained from bitches at 6 months to 7 years of age by ovariohysterectomy and were sliced repeatedly to release COC. In the first experiment, the COC were cultured at 38.88C for 48 h in 5% CO2 in air in medium 199 supplemented with either TGF-a (0, 1, 10, or 100 ng mL1) or IGF-1 (0, 0.5, 5, 10, or 50 mg mL1). In the second experiment, the synergistic effect of TGF-a and IGF-1 was investigated by culturing COC in medium 199 supplemented with both TGF-a (0, 1, 10, or 100 ng mL1) and IGF-1 (0, 0.5, 5, 10, or 50 mg mL1). At the end of the culture period, the oocytes were denuded of cumulus cells by pipetting with a fine bore glass pipette; the denuded oocytes were then fixed in Carnoy’s solution and stained with Hoechst 33342. The nuclear configuration and chromatin morphology of the oocytes were evaluated under confocal laser scanning microscopy. The cells were assigned to 1 of the following meiotic stages: germinal vesicle (GV), germinal vesicle breakdown (GVBD), metaphase I (MI), or metaphase II (MII). Data were analysed by ANOVA with Fisher’s PLSD test. In experiment 1, no significant difference were observed in the rates of cells maturing to the MI and MII stages, but that in the 10 ng mL1 of TGF-a group (56.3%) were larger than in the other treatment groups (38.8–51.0%). The frequencies of MII stage cells in the 5, 10, and 50 mg mL1 of IGF-1 treatment groups (9.8, 13.3, and 12.2%, respectively) were significantly higher than in the 0.5 mg mL1 of IGF-1 group and the control group (5.3 and 2.2%, respectively). In experiment 2, the frequency of MI and MII cells in the control, 1 ng mL1 of TGF-a plus 0.5 mg mL1 of IGF-1, 10 ng mL1 of TGF-a plus 5 mg mL1 of IGF-1, 10 ng mL1 of TGF-a plus 10 mg mL1 of IGF-1, and 100 ng mL1 of TGF-a plus 50 mg mL1 of IGF-1 group were 44.1, 36.1, 63.5, 70.8, and 50.8%, respectively. The frequency of MII cells in the control group and the same treatment groups were 2.8, 7.2, 10.4, 15.3, and 10.8%, respectively. Both frequencies in the 10 ng mL1 of TGF-a plus 10 mg mL1 of IGF-1 group were significantly higher than in the control group. The TGF-a may act in a paracrine fashion on the surrounding granulosa cells, and IGF-1 may play multiple roles in cellular metabolism, proliferation, growth, and differentiation in canine oocyte maturation, as has been reported for many other species. In conclusion, these results demonstrate that a synergistic effect between TGF-a and IGF-1 produces an increased rate of in vitro maturation to the MI and MII stages in canine oocytes.

313

PRE-IN VITRO MATURATION WITH CYCLIC AMP AND CYCLIC GMP MODULATORS IMPROVES DEVELOPMENTAL COMPETENCE OF MOUSE OOCYTES N. W. Santiquet, A. F. Greene, W. B. Schoolcraft, and R. L. Krisher National Foundation for Fertility Research, Lone Tree, Colorado, USA

In vitro maturation (IVM) of cumulus-oocyte complexes (COC) results in oocytes with reduced quality and is still not as efficient as in vivo maturation in most species. One hypothesis that could explain the low developmental competence of oocytes following IVM is that the oocytes resume meiosis too quickly after being retrieved from the follicles. Studies in mice and bovine have shown that a short period of prematuration in the presence of cAMP modulators, before IVM, enhances oocyte developmental competence. Moreover, other studies have recently demonstrated that cGMP is also a crucial molecule involved in meiotic resumption. Here, our objective was to examine the effect of a cGMP modulator in combination with a cAMP modulator during a short period of prematuration on mouse oocyte nuclear maturation and subsequent embryo development following IVF. The COC were collected (6 replicates) from 2-month-old outbred CF1 mice 48 h after PMSG (5 IU) injection in the presence (pre-IVM) or absence (control) of cGMP and cAMP modulators. Pre-IVM COC (n ¼ 184) were then placed in prematuration medium that also contained these cGMP and cAMP modulators. After 2 h, pre-IVM COC were washed and transferred to our in-house prepared, completely defined IVM medium (Paczkowski et al. 2014 Reprod.) for the remaining 16 h of culture; 10 oocytes per 50 mL drop under oil, at 378C in 7.5% CO2 and 6.5% O2 due to the increased altitude at our location. Control COC (n ¼ 161) were matured in the same IVM medium under identical conditions for 18 h, without prematuration. After IVM, oocytes were fixed for assessment of nuclear maturation, or fertilized and cultured in vitro and subsequent development (96 and 112 h) was recorded (Paczkowski et al. 2014 Reprod.). Results were analysed by ANOVA. A short 2-h prematuration period in the presence of cGMP and cAMP modulators had no impact on oocyte nuclear maturation to metaphase II after IVM or on embryo cleavage after IVF. However, pre-IVM treatment improved the developmental competence of the oocyte, as demonstrated by increased embryo development. More (P , 0.02) blastocysts (96 h of culture) and hatched blastocysts (112 h of culture) developed in the pre-IVM treatment compared to control (31.0 3.4 v. 19.9 3.2%; 31.5 3.4 v. 19.9 3.2%, respectively). In conclusion, a combination of cGMP and cAMP modulators during oocyte collection and a subsequent short pre-IVM improves oocyte developmental competence and could therefore be a potential tool to improve embryo yield following IVM.

246


314

Sexing

MELATONIN ON IN VIVO AND IN VITRO MATURATION OF MOUSE OOCYTES H. FernandesA, L. ScheferB, F. C. CastroA, and C. L. V. LealA A

Departamento de Medicina Veterina´ria, Faculdade de Zootecnia e Engenharia de Alimentos – FZEA, Universidade de Saõ Paulo, Pirassununga, SP, Brazil; B Universidade Federal de Saõ Carlos, Araras, SP, Brazil

Melatonin is a pineal hormone related to the control of the circadian cycle, besides the reproductive seasonality of some animal species, and has shown positive effects on oocyte maturation and embryo development. The aim of this study was to assess the effects of melatonin on in vivo and in vitro maturation of mouse oocytes. Female F1 hybrids (C57BL/6 CBA; n ¼ 8 per group/treatment) were used in 3 different treatments (trt) groups: (I) in vivo trt: mice received 2 different doses of melatonin injections, 10 and 20 mg kg1 per IP including a saline control dose (0 mg kg1 per IP) for 4 days along with ovarian stimulation trt of 5 IU of eCG IP, followed by 5 IU of hCG IP 48 h later, and cumulus-oocyte complexes (COC) were collected 16 h after hCG; (II) mice received a similar in vivo melatonin trt, but ovarian stimulation trt was only 5 IU of eCG, no hCG, and COC were collected after 48 h and subsequently matured in vitro with 0.5 mg mL1 of FSH for 16 h; (III) in vitro maturation of oocytes: COC were collected 48 h after 5 IU of eCG and maturated in the presence of 3 different doses of melatonin (109, 106, and 103 M) or 0.5 mg mL1 of FSH (control) for 16 h. In vitro-maturing oocytes were in incubated at 378C, 5% CO2, and 95% humidity. Maturation rates were evaluated according to the presence of the first polar body under an inverted microscope. Statistical analyses were performed by ANOVA followed by Tukey’s test (4 replicates). In the first treatment, 20 mg kg1 of melatonin showed the highest in vivo maturation rate, 80.3% (61/76), while 10 mg kg1 of melatonin was 62.4% (53/85) and the saline control group was 69.4% (77/111), but differences were not significant (P . 0.05). For in vitro maturation of oocytes from animals previously treated with melatonin, the 10 mg kg1 of melatonin group had the highest maturation rate, 53.2% (99/186), in comparison with the saline and 20 mg kg1 of melatonin groups, which showed 46.6 (88/189) and 39.0% (85/218), respectively; again, no differences were detected (P . 0.05). In the last treatment, the maturation rates increased from 48.9 (43/88) to 53.7 (51/95) and 56.0% (56/100) as the melatonin concentrations decreased from 103, 106, and 109 M, respectively. The control group had the highest rate of 57.3% (55/96), but no statistical differences were observed (P ¼ 0.706). In conclusion, under the conditions studied, melatonin was unable to improve the maturation rate neither after in vivo nor in vitro treatment. However, during in vitro maturation, melatonin alone was as efficient as FSH in promoting maturation in murine oocytes, indicating its potential effect on stimulating meiosis. Therefore, the role of melatonin in stimulating meiosis needs further investigation. Acknowledgments to FAPESP for fellowship (HF) and funding (CLVL).

Sexing 315

IVF-DERIVED CROSSBRED EMBRYOS PRODUCED WITH SEXED SEMEN AND TRANSFERRED IN PAIRS TO BOS TAURUS 3 BOS INDICUS COWS AND HEIFERS S. RomoA, S. Castan˜edaB, C. A. HernandezB, J. H. MendozaC, F. J. TrejoC, J. ZamoraC, J. E. FernandezC, Y. DucolombD, and M. E. KjellandE A

Facultad de Estudios Superiores Cuautitlan, UNAM, Cuautitlan, Estado de Mexico, Mexico; B Genemex Internacional, La Trinitaria, Chiapas, Mexico; C Private Practice, Ciudad Victoria, Soto la Marina and Tampico, Tamaulipas, Mexico; D Division de CBS, Universidad Autonoma Metropolitana-Iztapalapa, Mexico DF, Mexico; E Conservation, Genetics & Biotech LLC, Valley City, ND, USA

Biotechnology has continued to evolve rapidly, allowing the development of techniques to increase reproductive efficiency and contribute to the genetic improvement of cattle. Some of these techniques include the in vitro maturation (IVM) and IVF of oocytes, sperm sexing and embryo transfer (ET) to recipient females to obtain pregnancies and offspring. These modern assisted-reproduction techniques (ART) can help produce twin pregnancies and calving of a pre-determined sex. The aim of this study was to produce a high proportion of female bovine embryos in vitro using X-chromosome-selected sexed semen and to transfer them in pairs to recipient females, in order to evaluate the efficiency of transferring two female embryos in both cows and heifers. Cebu-cross ovaries were obtained from a local slaughterhouse and transported to a nearby laboratory in Chiapas, Mexico, to obtain cumulus-oocyte complexes by follicular aspiration and culture in maturation medium for 24 h. For IVF, frozen X-sorted semen (Milking Gyr and Holstein breeds, 90% purity, Sexing Technologies, Navasota, TX, USA) was used. Gametes were co-incubated for 22 h, then moved to embryo development medium and cultured for 7 days. Recipient Cebu-cross commercial cows (n ¼ 98) and heifers (n ¼ 50) were synchronized, using intravaginal devices impregnated with progesterone, administering eCG and prostaglandin at withdrawal. Seven days after heat, 88 recipients were subjected to non-surgical ET (59 cows and 29 heifers). Embryo transfers were performed in Tamaulipas and Veracruz, Mexico, and were divided into 2 groups: A) cows, and B) heifers. Only grade-1 embryos were selected for ET. Two embryos were loaded in a single 0.25 mL French straw and transferred to the uterine horn ipsilateral to the ovary with a corpus luteum. Pregnancy diagnosis was performed by ultrasound or rectal palpation 60 days after ET. A Fisher’s exact test (SPSS v. 16.0, SPSS Inc., Chicago, IL, USA) was used to determine statistical differences (a ¼ 0.05). Of IVF oocytes, 176/180 (98%) and 242/300 (81%) were fertilized, producing 96/180 (53.3%) Milking Gyr (semen)-Cebu (oocytes) and 92/300 (30.7%) Holstein (semen)-Cebu (oocytes) grade-1 embryos, respectively. Of the 88 recipients, 33 were pregnant (37.5%), however, it was not possible (at that time) to determine the number and sex of fetuses developing in utero. Overall, 8 of the 29 heifers were pregnant (27.6%), compared to 25 pregnancies in 59 cows (42.4%). For heifers, the pregnancy results for transferring Milking Gyr-Cebu embryos (4/11) versus Holstein-Cebu embryos (4/18) were not significantly different (P ¼ 0.433, two-tailed Fisher’s exact test). A similar comparison could not be made for cows given smaller sample sizes due to the extra variable of having taken place

Sexing


247

on several different ranches (n ¼ 11). The concept herein is that smaller twin female crossbred calves may reduce issues associated with freemartinism and dystocia while still maintaining the vigor of crossbred offspring. Results from this research can help contribute to the study and development of ART for increasing cattle production efficiency.

316

GENOMIC EVALUATION OF BOVINE EMBRYOS WITHIN 24 HOURS

S. JungA, M. ReichenbachB, R. FriesA, E. Wolf C, C. GschoedererB, J. ScherzerB, T. GruppB, and H.-D. ReichenbachD A

Chair for Animal Breeding, Technische Universita¨t Mu¨nchen, Freising, Germany; B Bayern-Genetik GmbH, Grub, Germany; C Chair for Molecular Animal Breeding and Biotechnology, Ludwig-Maximilians-University Munich, Munich, Germany; D Bavarian State Research Center for Agriculture, Institute of Animal Breeding, Grub, Germany The aim of this study was to develop a reliable procedure for genomic evaluation of bovine embryos to determine gender, polled status, and hereditary defects within 24 h after collection. German Simmental animals (n ¼ 15) were superovulated (n ¼ 25) using a standard protocol. Embryos were recovered on Day 7 (Day 0 ¼ oestrus). A total of 217 embryos (morula, n ¼ 130; early blastocyst, n ¼ 43; blastocyst, n ¼ 44) were biopsied with a steel blade attached to a micromanipulator. Biopsied cells were immediately transferred into 1 mL TE buffer to a 500 mL reaction tube and embryos were in vitro cultured until genomic results were available. For commonly used molecular genetic methods (e.g. 50 -exonuclease genotyping, PCR or high density genotyping) DNA amounts of 2–200 ng are required. However, the DNA quantity of a single diploid cell amounts to 6 pg only. The embryo biopsies used, usually consists of 10–30 cells, necessitating an artificial amplification of the embryonic genome. Taking all vital measures to avoid external DNA contamination, isothermal whole genome amplification was performed with the REPLI-g Mini Kit (Qiagen, Valencia, CA, USA) using random hexamers and Phi29-Polymerase. Depending on the number of cells, a total DNA amount of 4–7 mg was achieved. Polled status and gender was determined using PCR with subsequent gel-electrophoresis. 50 -exonuclease assays were used to obtain genotypes for the detection of genetic defects. At present, eight, mostly Simmental-specific genetic disorders can be examined: three traits associated with severe growth retardation, dwarfism (DW), Braunvieh-haplotype 2 (BH2) and stunted growth (FH2), the lethal skin disorder zinc deficiency-like syndrome (ZDL), a fertility trait bovine male subfertility (BMS), embryonic death Fleckvieh-haplotype 4 (FH4), a bleeding disorder thrombopathia (TP) and arachnomelia (A), within 24 h. On average, 8.7 embryos were biopsied per embryo recovery, i.e. 93.9% of the total number of transferable embryos. Fourteen embryo samples (6.5%) totally failed during analysis, possibly due to the loss of samples. In successful analyses, gender was undetermined in two embryos; remaining embryos were 52.2% female and 47.8% male. Polled status could be analysed in 92.6% of the embryos. The analyses of embryos for possible inherited genetic disorders (healthy, heterozygote, or homozygote; n ¼ 578) were successful in 90.1%. The transfer of biopsied embryos (n ¼ 30) led to 63.3% pregnancies (Day 42). A validation of the present results has to be done as soon as the produced calves are born, demonstrating the reliability of the procedure. Research was funded by the Bayerische Forschungsstiftung (AZ-1031-12).

317

SEX DETERMINATION OF EQUINE EMBRYOS BY PCR USING BLASTOCOELE FLUID

C. HerreraA,B, M. I. MorikawaB, C. Baca CastexC, M. R. PintoC, N. OrtegaA, T. FantiA, R. GaragusoA, M. J. FrancoA, M. CastanãresD, C. Castan˜eiraD, L. LosinnoD, M. H. MiragayaC, and A. A. MuttoA A

Instituto de Investigaciones Biotecnolo´gicas IIB-INTECH Dr. Rodolfo Ugalde, Universidad Nacional de San Martin, Buenos Aires, Argentina; B Crıá Tanoira Embriones, Buenos Aires, Argentina; C INITRA, Facultad de Ciencias Veterinarias, Universidad de Buenos Aires, Buenos Aires, Argentina; D Laboratorio de Produccioń Equina, Universidad Nacional de Rio Cuarto, Rio Cuarto, Cordoba, Argentina

Pre-implantation genetic diagnosis (PGD) is used in different species to determine specific genetic traits of early stage embryos. The first part of this technique involves obtaining one or more cells from the embryo. Then, the DNA in the sampled cells is amplified by PCR using specific primers. Recently Palini et al. (2013) performed PGD of human blastocysts using the DNA in blastocoele fluid. The aim of our work was to study if the sex of equine in vivo produced blastocysts could be determined by PGD using blastocoele fluid as a sample for PCR. Thirteen equine blastocysts produced by artificial insemination and uterine flush were used for this study. Once obtained each embryo was placed on a 50-mL droplet of D-PBS without calcium and magnesium supplemented with 10% FBS and 50 mg mL1 of gentamicin (working medium) under mineral oil, on an inverted microscope equipped with a micromanipulation system. The blastocoele fluid was aspirated using a beveled micropipette (9 mm ID) and then discharged on a 1-mL microdroplet of working medium. The microdroplet containing the blastocoele fluid was transferred to a 0.2-mL DNAse-free tube containing 4 mL of DNAse-free water. A duplex PCR was performed to amplify the Y-encoded testis-specific protein (TSPY) and amelogenin (AMEL) genes. The primer sequences used for this study were: AMEL-F 50 -CCAACCCAACACCACCAGCCAAACCTCCCT-30 , AMEL-R 50 -AGCATAGGGGG CAAGGGCTGCAAGGGGAAT-30 , TSPY-F 50 -GAAGTCAGGCACACCAGTGA-30 and TSPY-R 50 -TAAGGCTGCAGTTGTCATGC-30 . The PCR was performed twice, using the same primers and cycling protocol. Embryonic cells from embryos which have been previously diagnosed as male and female were used as positive controls for PCR. As a negative control, one tube was included containing all the components for PCR, except the DNA sample was replaced with the same volume of DNAse-free water. The amplification products were electrophoresed on a 2% agarose gel stained with ethidium bromide and visualised under UV light. Embryo viability post-blastocoele fluid aspiration was studied by individually incubating seven aspirated embryos in 50-mL microdroplets of SOFm with 19 mM D-glucose with 10% FBS under mineral oil at 388C, in 7% O2 and 5% CO2 and observed at 24, 48, and 72 h. The diameter of embryos was registered immediately before blastocoele fluid aspiration and every 24 h

248


Sperm Injection

during in vitro culture. The sex of 11 out of 13 embryos (84.6%) was determined and they were diagnosed as 8 males and 3 females. Six of the 7 embryos cultured in vitro expanded at 24 h and increased their diameter at 48 and 72 h. Our results demonstrate that PGD of equine embryos can be performed using blastocoele fluid only, avoiding the need of extracting cells from the embryo. The in vitro embryo survival after blastocoele fluid aspiration was high, showing that this technique does not impair the embryo’s viability. Further studies are being undertaken using a larger number of embryos to demonstrate if this approach can be used with high efficiency.

Sperm Injection 318 EFFECT OF SPERM PRETREATMENT WITH ISOBUTYLMETHYLXANTHINE AND METHYL-bCICLODEXTRYN ON THE EFFICIENCY OF BOVINE INTRACYTOPLASMIC SPERM INJECTION L. M. Aguila, M. E. Arias, R. S. Sanchez, T. C. Vargas, F. A. Zambrano, and R. F. Felmer Laboratory of Reproduction (CEBIOR-BIOREN), Universidad de La Frontera, Temuco, Chile The efficiency of intracytoplasmic sperm injection (ICSI) in bovines is lower than in other species. We propose that in vitro sperm capacitation could optimize the ICSI in cattle. The aim was to evaluate the effects of isobutylmethylxanthine (IBMX) and methyl-b-cyclodextrin (MbCD) on the sperm capacitation and in vitro development of embryos generated by ICSI. Frozen-thawed spermatozoa (3–5 106 cells mL1) were pre-incubated for 2 h at 38.58C, 5% CO2 in defined medium (Sp-TLP/PVA) supplemented with MbCD (1 mM) or IBMX (0.4 mM) (capacitating conditions). The untreated control group (UTG; not supplemented) and vehicle group (VG) were incubated for 2 h. The non-capacitating control group (NCG) was not supplemented (neither vehicle nor IBMX or MbCD) and not incubated. The sperm viability and capacitation {intracellular calcium [Ca2þ]i, plasma membrane fluidity (PMF), and acrosomal reaction} were evaluated by flow cytometry (n ¼ 3 biological replicates). For the ICSI procedure, only motile spermatozoa were selected. After ICSI, oocytes were activated with ionomycin þ cycloheximide. Culture was performed at 38.58C, 5% CO2, 5% O2, 90% N2, saturation humidity in KSOM base medium. Data were analysed by ANOVA and Scheffe’s test. Pronuclear formation was evaluated by a chi-square test with Bonferroni’s correction. Significance was set at P , 0.05. Pretreated spermatozoa showed lower (P , 0.05) viability (49 and 67% for IBMX and MbCD, respectively) compared with the NCG (89%), UTG (80%), and VG (78%). The [Ca2þ]I analysed by median fluorescence intensity (MFI) was lower (P , 0.05) in NCG (117 MFI) with respect to UTG (127 MFI), VG (124 MFI), IBMX (126 MFI), and MbCD (131 MFI). The PMF increased (P , 0.05) with IBMX (115 MFI) and MbCD (106 MFI) compared with NCG (70 MFI), UTG (89 MFI), and VG (65 MFI). Acrosome reaction improved with capacitating treatments with respect to both control groups (16, 23, 8, 4, and 3% for IBMX, MbCD, UTG, VG, and NCG, respectively). Analysis of capacitating v. non-capacitating conditions on ICSI efficiency revealed that the fertilization rate, assessed by pronuclear formation, was higher (P , 0.05) in ICSI-MbCD (76%; n ¼ 46) compared with ICSI-IBMX (55%; n ¼ 53) and ICSI-NCG (50%; n ¼ 44). Nevertheless, there were no differences among groups in cleavage (Day 3): 85, 86, and 84% and blastocyst rates (Day 8): 19, 25, and 18% for ICSIIBMX (n ¼ 8), ICSI-MbCD (n ¼ 7), and ICSI-NCG (n ¼ 7), respectively. The parthenogenetic and sham injection groups yielded a lower rate of cleavage (73 and 53%, respectively) and blastocyst (13% and 10%, respectively). The results demonstrated an improvement of the fertilization rate of bovine embryos generated by ICSI using sperm capacitated by MbCD pretreatment. However, more studies are necessary to improve in vitro developmental potential of these embryos to the blastocyst stage. Frigorı´fico Temuco and funding support from FONDECYT 1120241 CONICYT-Chile are gratefully acknowledged.

319

APPROACHES TO IMPROVE INTRACYTOPLASMIC SPERM INJECTION MEDIATED TRANSGENESIS AND MAXIMIZE THE USE OF SEX-SORTED SPERM IN BOVINE N. G. CanelA, R. J. BevacquaA, M. I. HiriartA, N. Chavez RabeloB, L. S. Almeida CamargoA, and D. F. SalamoneA A

Lab. de Biotecnologıá Animal, Facultad de Agronomıá, Universidad de Buenos Aires, Buenos Aires, Argentina; B Universidade Federal de Juiz de Fora, Embrapa Gado de Leite, Minas Gerais, Brazil

Intracytoplasmic sperm injection (ICSI) mediated transgenesis is an effective tool for transgenic animal production. However, ICSI in cattle remains inefficient. In this work, we assayed approaches to improve egfp expressing blastocysts production by ICSI: the sperm pretreatment with heparin and L-glutathione (Hep-GSH), the use of sex-sorted sperm (SS), the refrozen/thawing of SS sperm, and the combination of these. Quality of ICSI blastocysts was analysed by studying the expression of 4 genes, and the rates of DNA fragmentation. Cumulus-oocyte complexes from slaughtered cow ovaries were in vitro-matured for 21 h. Nonsorted (NS) and sex-sorted (SS) frozen straws were thawed. Some of them were incubated with 80 mM Hep-15 mM GSH for 20 h (Hep-GSHþ). The Hep-GSH-control group was not pretreated. Semen samples were co-incubated with 50 ng mL1 of pCXEGFP for 5 min before ICSI. Moreover, the SS sperm that are usually discarded after ICSI were cryopreserved and used for ICSI after a second thawing (ICSI SS refrozen). The ICSI NS, sham, and diploid parthenogenetic (Diplo PA) controls were included. Oocytes were activated with 5 mM ionomycin for 4 min, TCM-199 for 3 h (except for diploid PA), and 1.9 mM DMAP for 3 h. Cleavage and blastocyst/egfp expression rates were evaluated on Days 2 and 7 post-ICSI, respectively. Results are shown in Table 1. Relative expression of HMGN1, GLUT5, AQP3, and OCT4 genes from ICSI NS Hep-GSHþ and IVF blastocysts were compared by qPCR. Data were analysed by the pair-wise fixed reallocation randomisation test. None of the 4 genes showed differences between groups. The DNA fragmented nucleus index/blastocyst cell numbers were determined by TUNEL assay, not showing differences between groups (Kruskal–Wallis test, P # 0.05). Means s.d. were 29 17/91 27 for ICSI Hep-GSHþ; 27 15/ 63 34 for ICSI Hep-GSH; 28 17/68 17 for ICSI SS, 28 13/75 24 for ICSI SS refrozen; and 21 13/105 59 for IVF SS control. The Hep-GSH pretreatment can increase blastocyst and transgene expressing blastocysts rates after TM-ICSI, except when SS semen is used. Interestingly, the use of SS sperm for ICSI can be maximized by cryopreservation and reuse of discarded sperm cells. The parameters analysed in this

Sperm Injection


249

work indicate that the proposed approaches do not affect blastocyst quality. Therefore, Hep-GSH pretreatment of NS sperm and refrozen SS sperm could be applied for TM-ICSI in bovine for the production of transgenic animals. Table 1. In vitro development and egfp expression of ICSI embryos fertilized with nonsorted (NS) and sex-sorted (SS) sperm pretreated with Hep-GSH, refrozen, or both Group ICSI NS ICSI SS ICSI SS Refrozen Sham Diplo PA

Hep-GSH

n

Cleavage (%)

Blastocysts (%)

efgp Blastocysts (%)1

þ þ

217 206 121 200

132 (61)a 72 (35)b 111 (92)ce 187 (94)c

42 (19)a 10 (4.85)b 4 (3)b 20 (10)c

26 (62)a 2 (20)bc 3 (75)ab 16 (80)a

þ NA

92 120 105 307

74 (80)d 113 (94)c 84 (80)d 262 (85)de

8 (9)c 12 (10)c 6 (6)bc 147 (48)d

6 (75)ab 7 (58)ab 0c –

Values with different superscripts in the same column differ by Fisher’s exact test (P # 0.05). efgp-expressing blastocysts; rates/blastocysts.

a–e 1

320 EFFECTS OF DIFFERENT ACTIVATION REGIMENS ON PRONUCLEAR FORMATION AND PRE-IMPLANTATION DEVELOPMENTAL COMPETENCE OF IN VITRO-MATURED BOVINE OOCYTES AFTER INTRACYTOPLASMIC SPERM INJECTION M. E. Arias, R. Sanchez, and R. Felmer La Frontera University, Temuco, Chile Intracytoplasmic sperm injection (ICSI) is an assisted reproductive technique that has been used with considerable success in humans; however, in the bovine species the efficiency of this technique is far from optimal. The objective of the present study was to evaluate the effect of 4 chemical activation treatments, 6-dimethylaminopurine (DMAP), cycloheximide (CHX), anisomycin (ANY), and ethanol (EtOH) on the pronuclear formation and embryo development of bovine embryos generated by ICSI. Cumulus-oocyte complexes were aspirated from abattoir ovaries, selected, and matured in 400-mL drops of standard TCM-199 maturation medium for 22 h at 38.58C and 5% CO2. The ICSI was performed by a standard procedure. Injected oocytes were randomly distributed and activated by 5 mM ionomycin for 5 min (Io) followed by i) 5 mg mL1 CHX for 5 h (Io/CHX), ii) 3 h window followed by a second Io treatment plus 1.9 mM DMAP for 4 h (2Io/DMAP), iii) 1 mg mL1 ANY for 5 h (Io/ANY), and iv) 3 h window followed by 7% ethanol (Io/EtoH). Embryos were cultured in 50-mL drops of KSOM medium under mineral oil at 38.58C and 5% CO2, 5% O2, and 90% N2. Cleavage was recorded at 72 h and blastocyst rate at 192 h. Pronuclear formation analysis was carried out at 18 hpa with Hoechst staining. An oocyte was considered fertilized when 2 polar bodies and 1 female and 1 male pronucleus (or a decondensed sperm head) could be observed. The data were transformed to arcsine, analysed by ANOVA, and means were compared using Tukey’s test with Statgraphics Plus 2 Software. Results with a total of 431 injected oocytes (114, 104, 101, and 112 for DMAP, CHX, ANY, and EtOH, respectively) showed differences in cleavage (P , 0.01) in DMAP, CHX, and ANY treatments (86, 72, and 78%, respectively), relative to EtOH (12%). Similarly, the rate of blastocysts/injected oocyte at 192 h was higher with DMAP, CHX, and ANY (41, 20, and 32%, respectively), relative to EtOH (4%). Sham-injected oocytes showed cleavage and blastocyst rates of 67, 43, 68, and 12% and 32, 11, 19, and 5%, for DMAP, CHX, ANY, and EtOH, respectively. Despite the higher developmental rate observed with DMAP, pronuclear formation assessment revealed that fertilization rate was higher in CHX (87%) and ANY (75%) treatments relative to DMAP (35%). In conclusion, the results of the present study show that activation of bovine oocytes after ICSI is more efficient with DMAP and ANY, compared with CHX and EtOH. Provision of ovaries by our local slaughterhouse (Frigorifico Temuco, Chile) and funding support from FONDECYT 1120241 CONICYT, Chile, are gratefully acknowledged.

321 CYTOSKELETAL ALTERATIONS OF EQUINE OOCYTES THAT FAILED TO CLEAVE AFTER INTRACYTOPLASMIC SPERM INJECTION: EVALUATION OF MATERNAL AND CELL AGING E. RuggeriA, K. DeLucaB, C. GalliC,D, G. LazzariD,E, J. DeLucaB, and E. CarnevaleF A

Department of Biomedical Sciences, College of Veterinary Medicine & Biomedical Sciences, Colorado State University, Fort Collins, CO, USA; B Department of Biochemistry and Molecular Biology, College of Natural Sciences, Colorado State University, Fort Collins, CO, USA; C Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia, Bologna, Italy; D Avantea, Laboratory of Reproductive Technologies, Cremona, Italy; E Avantea Foundation, Cremona, Italy; F Equine Reproduction Laboratory, Colorado State University, Fort Collins, Colorado, USA

Intracytoplasmic sperm injection (ICSI) is used for assisted fertilization of equine oocytes. However, not all oocytes cleave after ICSI. Maternal aging deleteriously affects fertility in mares and women, with reduced oocyte quality and success of assisted reproductive technologies. In the oocyte,

250


Stem Cells

senescence and cell-programmed death begins after maturation; the extent that maternal age affects these events is unknown. We hypothesised that formation of a/b tubulin asters and f-actin bubbles are associated with aging of the oocyte in vitro and/or aging of the oocyte in vivo, in aged donors. In Exp 1, oocytes were collected from ovaries obtained from an abattoir and matured for 28 h and selected for polar body extrusion (0 h). At 0, 24, and 48 h, oocytes (n ¼ 38 total) were fixed in MTSB-XF and transferred into wash solution with 1% BSA and 0.1% Triton X-100 in PBS for immunostaining. For experiment 2, oocytes were collected from preovulatory follicles of mares (9–25 yr) in a clinical ICSI program and injected with sperm from various stallions after extrusion of a polar body. Between 24 to 51 h after ICSI, uncleaved oocytes (n ¼ 52, single cell without evidence of fragmentation or indentation of the oolemma) were fixed. All oocytes were incubated with a/b tubulin and human-anti-centromere antibody-CREST/ACA (1 : 100 each). Following primary incubation, oocytes were washed and incubated with Alexa 488, Alexa 647, Alexa 561phalloidin, and Hoechst 33258. Images and Z-stacks were acquired on an Olympus IX81 spinning disk confocal microscope. Morphometric and intensity analyses of images were performed using SlideBook software (Denver, CO). Student’s t-test, Fisher’s exact test, and chi-square analyses were used for statistical comparisons. After aging in vitro (experiment 1), the number of oocytes with tubulin multiasters increased (P , 0.001; 9% at 0 h, 14% at 24 h, 85% at 48 h); however, actin bubbling was observed in only 5/38 (13%) oocytes, with no effect of incubation time. In experiment 2, tubulin multiasters were present in 62% of oocytes that failed to cleave. More multiasters were observed per oocyte from mares #13 yr than $20 yr (P ¼ 0.03) and fixed at 24 to 28 h than 44 to 51 h (P ¼ 0.04). Actin bubbles were observed in 71% of oocytes that failed to cleave after ICSI, with more actin bubbles in oocytes from mares $20 yr than #13 yr (P ¼ 0.01) and fixed 44 to 51 h versus 24 to 28 h after ICSI (P ¼ 0.05). The sum intensity and area of the actin bubbles were higher in oocytes fixed at 44 to 51 h than 24 to 28 h (P ¼ 0.01 and P ¼ 0.04). The area occupied by the actin bubbles was larger (P ¼ 0.05) in oocytes from mares $20 yr than #13 yr. This study demonstrates actin bubbles and tubulin asters are involved in oocyte aging and cytoskeleton remodelling with or without fertilization. Although actin structures were associated with donor age and hours after ICSI, they were not present in unfertilized oocytes aged in vitro. Multiaster formation was associated with cell senescence in oocytes aged in vitro. Although not previously reported for the equine oocyte, multiaster formation appeared to be an initial fertilization event within the oocyte associated with attempted zygote development.

322

SPERM PRESERVATION BY FREEZE-DRYING IN ENDANGERED ANIMALS T. Kaneko Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, Kyoto, Japan

Sperm preservation is a useful tool for conservation of endangered animals. Freeze-drying sperm have been studied as new preservation method in various mammals as samples can be preserved in a refrigerator at 48C or ambient temperature. Sperm preservation by freeze-drying is the ultimate method by which sperm can be stored that neither required specialised cryoprotectants nor constant supply of liquid nitrogen. We established the freeze-drying method that mouse and rat sperm could be preserved long-term at 48C after freeze-drying using a simple solution containing 10 mM Tris and 1 mM EDTA (TE buffer; 2012 PLoS ONE 7, e35043; 2012 Cryobiology 64, 211–214). Using this method, the fertility of the chimpanzee, giraffe, and jaguar sperm after freeze-drying were estimated. Ejaculated chimpanzee and giraffe and cauda epididymal jaguar sperm were freezedried using TE buffer. Sperm were rehydrated with sterile distilled water after storage at 48C for 1 month. Sperm with normal shape were injected into mouse oocytes in CZB medium with HEPES, and oocytes were then cultured in vitro for 6 to 8 h in the same media. In all animals, pronuclei and sperm tail were observed into oocytes without artificial activation after injection of freeze-dried sperm. When chimpanzee, giraffe, and jaguar sperm were injected into oocytes, 86% (12/14), 100% (12/12), and 96% (22/23) of oocytes formed 2 distinct pronuclei. This study demonstrated that the sperm of various animals could be decondensed into the mouse oocytes after freeze-drying using the same protocol. A further advantage is that freeze-dried sperm can be transported oversea at ambient temperature. Freeze-drying preservation without using liquid nitrogen can be protected strongly valuable gametes of endangered animals even in the event of unexpected accidents and disaster such as earthquakes and typhoons. Freeze-drying of sperm has been applied as a ‘‘freeze-drying zoo’’ for conservation of endangered animals (http://www.anim.med.kyoto-u.ac.jp/reproduction/home.aspx).

Stem Cells 323

ESTROGEN-INDUCED EPITHELIAL-MESENCHYMAL TRANSITION AND EXPRESSION OF PROAPOPTOTIC MARKERS IN PORCINE STEM CELLS Y.-S. KimA, S.-H. HyunB, C.-K. LeeC, and K.-C. ChoiA

A

Laboratory of Veterinary Biochemistry and Immunology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea; B Laboratory of Veterinary Embryology and Biotechnology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea; C Department of Agricultural Biotechnology, Animal Biotechnology Major, and Research Institute for Agriculture and Life Science, Seoul National University, Seoul, Republic of Korea In transgenic pig production for generating animal models of human diseases, apoptosis of early implantation embryo disturbs the transgenic pig production. In general, epithelial-mesenchymal transition (EMT) is considered important in embryo development and apoptosis. In addition, it was reported that 17b-oestradiol (E2), among hormones that participate in early implantation of embryo, could induce EMT and neural differentiation in mouse embryonic stem cells. Therefore, in this study, we examined the effects of the steroid hormone, E2, in the changes of EMT and apoptotic markers in porcine embryonic stem cells (pESC) and porcine induced pluripotent stem cells (piPSC). During the study, we cultured pESC and piPSC in pESC media containing basic fibroblast growth factor (b-FGF) and leukemia inhibitory factor (LIF) and performed RT-PCR and an alkaline phophatase (AP) test to measure pluripotent and undifferentiation markers of these porcine stem cells. The RT-PCR results showed that OCT4, NANOG, and SOX2 were expressed in these pESC and piPSC, indicating their pluripotency as stem cells. Also, these porcine stem cells showed

Stem Cells


251

positive AP activity, demonstrating undifferentiation. Additionally, we treated pESC and piPSC with E2 to examine effects of steroid hormone on the changes of EMT and apoptotic markers (i.e. bcl-2, bax, E-cad, and vimentin). The E2 treatment increased the expression of vimentin and bcl-2, while decreased the expression of E-cadherin and bax. By using immunocytochemistry (ICC), we examined the protein expression of EMT markers, which are vimentin and E-cadherin at the translational level, and found that expression of vimentin protein was increased while E-cadherin protein level was reduced at periphery of the colonies in pESC and piPSC. In conclusion, these results indicate that E2 can promote EMT process and reverse apoptosis in these pESC and iPSC. In a future study, we will further examine the effects of progesterone on the expressions of EMT and apoptotic markers in pESC and piPSC. Consequently, this study will contribute to elucidate the underlying mechanisms of EMT and apoptosis controlled by steroid hormones in porcine stem cells.

324

TESTIS-SPECIFIC EXPRESSION OF OCT4-EGFP TRANSGENE IN PIG

M. Nowak-ImialekA,B, N. LachmannB, D. HerrmannA, F. JacobA, and H. NiemannA,B B

A Institute of Farm Animal Genetics, Friedrich-Loeffler-Institut, Mariensee, Germany; REBIRTH Research Group Reprogramming, Hannover Medical School, Hannover, Germany

Oct4 is a transcription factor essential for establishment and maintenance of pluripotency in mammalian stem cells. Oct4 expression was found in early embryos and germ cells throughout fetal development. In male mice, Oct4 expression is found in mitotically arrested prospermatogonia until birth. After onset of spermatogenesis, expression is maintained in type A spermatogonia, but is downregulated in type B spermatogonia and in spermatocytes (Pesce et al. 1998 Mech. Dev). Previously, we successfully generated Oct4-EGFP reporter pigs carrying the entire 18-kb genomic sequence of the murine Oct4 gene fused to the enhanced green fluorescent protein (EGFP) cDNA (Nowak-Imialek et al. 2011 Stem Cells Dev.). This animal model is unique because it allows in vivo and in vitro visualisation of Oct4-positive cells. Germ line specific Oct4-EGFP expression was analysed in testis isolated from young (,1 week) and adult (.7 months) pigs. Squash preparation of testicular tissue isolated from adult transgenic boars revealed high amounts of EGFP-positive cells compared to young piglets. We confirmed Oct4 and EGFP expression in the testis from young and adult transgenic animals using Northern blot analysis. Specific expression of Oct4 and EGFP in testis could be observed in blots as a single band of 1.5 kb. As a loading control, the blot was rehybridized with a b-actin probe. Mammalian testes contain different cell types, including germ cells, Sertoli cells, Leydig cells, and peritubular cells. To define the cellular origin of EGFP-expressing cells, we isolated these cells from adult transgenic testis using fluorescence-activated cell sorting (FACS)-based techniques. Analysis of isolated EGFP positive cells with qRT-PCR demonstrated the presence of marker genes specific for undifferentiated (Oct4, UTF1, FGFR3, PGP 9.5, THY-1, SALL4, and GFRa1) and differentiated (BOLL and PRM2) germ cells. Markers specific for Sertoli cells (vimentin) and Leydig cells (LHCGR) were not observed. To verify the localization of EGFPpositive cells in seminiferous tubules, we performed immunohistochemical detection of GFP in adult pig testis. Unlike the Oct4-EGFP reporter mouse model, GFP protein was not found in spermatogonia attached to the basement membrane of seminiferous tubules, but instead were found in differentiated germ cells, including spermatocytes and spermatids. These results show that the Oct4-EGFP expression in testis differs between mouse and porcine Oct4-EGFP transgenic models. To verify that the EGFP expression driven by the mouse Oct4 promoter in porcine testis reflects the endogenous Oct4 expression profile, Western blot and histochemical analyses are currently underway.

325

CHARACTERIZATION OF PRIMED PORCINE PLURIPOTENT STEM CELL LINES DERIVED FROM VARIOUS ORIGINS INCLUDING IPS-NT E. KimA, C.-K. LeeB, and S.-H. HyunA A

Laboratory of Veterinary Embryology and Biotechnology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, South Korea; B Department of Agricultural Biotechnology, Animal Biotechnology Major, and Research Institute for Agriculture and Life Science, Seoul National University, Seoul, Korea Pigs are significant as a disease model in translational research. However, authentic porcine embryonic stem cells (ESC) have not yet been established showing limited capacities until now. In this study, a total of 7 primed ESC lines were derived from porcine embryos of various origins, including in vitro-fertilized (IVF), parthenogenetic activation (PA), and nuclear transfer (iPS-NT) from a donor cell with induced pluripotent stem cells (iPSC). We observed typical morphology, intensive alkaline phosphatase activity, and normal karyotype in all pESC lines. Also, the expression of pluripotency markers such as OCT4, Sox2, NANOG, SSEA4, TRA 1–60, and TRA 1–81 was shown in our pESC. We investigated expression of key markers of lineage commitment to confirm the differentiation potentials of the 7 cell lines to formation of EB and all 3 germ layers, such as AFP (endoderm), DESMIN (mesoderm), and CRABP2 (ectoderm) by RT-PCR and Cytokeratin 17 (endoderm), Desmin (mesoderm), and Vimentin (ectoderm) by immunofluorescence analysis. We also examined the XIST gene expression and nuclear H3K27me3 foci from all female cell lines for analysing epigenetic characteristics. Furthermore, we classified 2 colony types (normal and transformed colony) and 3 subpopulations of ES cells composed of transformed colonies with intrinsic morphological characteristics: petaloid rapidly self-renewing cells, small spindle-shaped cells, and large flattened cells. This result will help to approach the goal for establishing authentic naive pluripotent stem cells in pigs and it will make possible sophisticated genetic manipulation to create ideal animal models for preclinical research and studies of human diseases. This work was supported, in part, by a grant from the National Research Foundation of Korea Grant Government (NRF-2012R1A1A4A01004885, NRF-2013R1A2A2A04008751), Republic of Korea.

252


Stem Cells

ASSESSMENT OF PORCINE-INDUCED PLURIPOTENT STEM CELLS BY IN VIVO ASSAYS

326

J. SecherA, K. FreudeB, S. PetkovC, A. CeylanD, M. SchmidtA, and P. HyttelB A

Department of large Animal Sciences, Section for Veterinary Reproduction and obstestrics, University of Copenhagen, Frederiksberg, Denmark; B Department of Veterinary Clinical and Animal Sciences, University of Copenhagen, Frederiksberg, Denmark; C Friedrich-Loeffler-Institut, Neustadt, Germany; D Department of Histology and Embryology, Ankara University, Faculty of Veterinary Medicin, Ankara, Turkey

Porcine-induced pluripotent stem cells (piPSC) have been established since 2009, but only 1 report demonstrated contribution to germline chimeras. One well-established in vivo pluripotency assay is the teratoma assay, which has recently been questioned due to the lack of standardized guidelines. In the present study we have characterised GFP-tagged in vitro and in vivo tetracycline-inducible piPSC [porcine MYC, SOX2, KLF4 (pOMSK)] and their capacity to form teratomas. We injected 1.5 million cells in 250 mL of PBS subcutaneous into NOD/SCID mice and followed them up to 6 weeks. The teratomas were analysed by immunohistochemistry for the 3 germlayer markers b3 tubulin, a fetoprotein, and smooth muscle actin. We not only found our teratomas positive for these markers, but also co-positive for GFP, clearly showing that the teratoma was made from porcine cells, which was not sufficiently proven in former studies. Our H&E staining revealed the following structures: cuboidal ephitelium, thyroid-like structure, renal corpuscle, and steroid producing cells. We continued to test the capacity of our venus iPS cells to contribute to in vitro chimeras. To achieve this we used a micromanipulator to inject 15 cells into Day 5 parthenotes, and subsequently cultured them in PZM3 with 10% FCS, cultured with or without doxycycline. These in vitro chimeras were followed until Day 7 in Nikons Biostation IM and used for differential staining. In all groups we saw good survival, hatching, and maintenance of GFP, indicating integration of these cells in our in vitro assay. We only found differences between survivals of the cell lines in the group cultured with doxycycline. Finally, in order to assess if the naı¨ve type venus iPS cells could possibly be a truly naı¨ve piPSC, we tested their capacity to form in vivo germline chimeras. This was tested by injecting 15 piPSC into Day 4 to 5 in vivo embryos. The injected embryos were transferred into 5 surrogate mothers, 3 of them were fed doxycycline before the transfer and 5 days after, and the last 2 recipient sows were not fed doxycycline. The pregnancies were terminated at Day 32 and the embryos were examined for fluorescence and the GFP transgene by PCR. In summary, it appears that both naı¨ve type and primed type venus iPS cells are still strongly dependent on the pOMSK transgene expression, and the ultimate proof for pluripotency, the chimera production, seems to be not achievable under the condition we have chosen.

327

PORCINE AMNION: A SOURCE OF EPITHELIAL STEM CELLS

A. Lange-ConsiglioA, B. CorradettiB, V. NotarstefanoB, M. G. MariniB, C. PerriniA, D. BizzaroB, and F. CremonesiA B

A Universita` degli Studi di Milano, Large Animal Hospital, Reproduction Unit, Lodi, Italy; Universita` Politecnica Marche, Department of Life and Environmental Sciences, Ancona, Italy

The use of pig models for preclinical testing is well established, and the availability of stem cells from this species would open the way to preclinical studies for application of cell therapy. According to the developmental stage from which they are obtained, stem cells are classified as being embryonic, fetal, or adult. Embryonic stem cells have unlimited self-renewing capacity and multilineage differentiation potential, but their clinical application seems to be hindered by the high tumorigenic rate after transplantation. Mesenchymal stem cells (MSC) derived from adult tissues are considered to be more limited in their potential and the risk of the immunological rejection of the transplanted stem cells by the recipient is an important limiting factor. The MSC derived from extra-fetal tissues could overcome many of these restrictions. Indeed, in veterinary medicine, MSC isolated from equine term placenta were the ideal candidates for tendon disease treatment, specifically for their plasticity and their reduced immunogenicity compared to bone marrow-derived cells. Extra-fetal derived MSC in porcine have been isolated from the umbilical cord matrix and amniotic fluid. The aim of this work was to provide, for the first time, an isolation protocol and the characterisation of stem cells from porcine amniotic membrane, which could hold potential uses in regenerative medicine. The amnion is a thin, avascular membrane made of an epithelial layer and an outer layer of connective tissue. From 3 samples of allanto-amnion retrieved at delivery, each amniotic membrane was stripped from the overlying allantois and, for isolation of the epithelial cells, it was digested with trypsin. After removal of epithelial cells, the stromal layer was digested with collagenase to obtain amniotic mesenchymal cells. The cellular yield from term amnion resulted only in epithelial cells (AEC) at a concentration of 10 106 for 1 g of digested tissue while no MSC were obtained. Histology, indeed, revealed very few cells in the stromal layer. The AEC readily attached to plastic culture dishes. Culture was established in DMEM-HG medium, supplemented with 10% serum and 10 ng mL1 of EGF where the cells proliferated robustly. The AEC displayed typical cuboidal morphology. These cells showed a mean of 31 0.24 cell population doublings after 31 days. The mean frequency of colony-forming unit fibroblasts was 1 for each of the 75 plated cells. The AEC expressed MSC mRNA markers (CD29, CD166, CD90, CD73, CD117) and pluripotent markers (Nanog and Oct4), while were negative for CD34 and MHC-II. Osteogenic, adipogenic, and neurogenic differentiations were confirmed by von Kossa, Red Oil, and Nissle stains, respectively, and by expression of specific markers (osteocalcin and osteopontin for osteogenic differentiation, adiponectin and leptin for adipogenic differentiation, and glial fibrillary acid protein and nestin for neurogenic differentiation). We conclude that porcine amnion contain unique and primitive cells whose potential is as yet undefined. Ease of collection and propagation of AEC make this tissue an attractive candidate as a resource for stem cell biotechnology and biomedical research.

Stem Cells


328

253

NONVIRAL REPROGRAMMING OF MCHERRY-EXPRESSING PORCINE FIBROBLASTS INTO INDUCED PLURIPOTENT STEM CELLS BY PIGGYBAC TRANSPOSONS D. KumarA,B, T. R. TalluriA,C, and W. A. KuesA B

A Institute of Farm Animal Genetics, Friedrich-Loeffler-Institute, Mariensee, Germany; Animal Physiology and Reproduction Division, Central Institute for Research on Buffaloes, Hisar, Haryana, India; C National Research Centre on Equines, Regional Station Bikaner, Rajasthan, India

The generation of induced pluripotent stem (iPS) cells is a promising approach for innovative cell therapies, as well as for animal biotechnology. The original method requires viral transduction of several reprogramming factors, which may be associated with an increased risk of tumorigenicity due to the preferential integration into active genes. The domestic pig is an attractive large animal model for preclinical testing of safety and efficacy of cellbased therapies. Porcine organs are similar in size and physiology to their human counterparts, and a suitable model for cardiovascular disease, muscular dystrophies, atherosclerosis, wound repair, diabetes, and ophthalmological diseases. Therefore, the present study was carried out to derive porcine iPS cells from transgenic fetuses systemically expressing mCherry (Garrels et al. 2011 PLOS ONE 6) through a nonviral piggyBac transposon. The piggyBac transposon system has several advantages: (i) piggyBac has no bias to integrate in expressed gene-like lenti- or retroviral vectors, (ii) the cargo capacity is .100 kb, (iii) seamless removal is possible, and (iv) the production of transposon plasmid is cost-efficient and does not require S2 safety cabinets. Porcine fetal fibroblasts isolated from CAGGS-mCherry founder porcine line fetuses (passage 2), were co-electroporated with a PB transposon carrying a multigene cassette consisting of human cDNA for OCT4, SOX2, KLF4, c-MYc, NANOG, and LIN28 separated by self-cleaving 2A peptide sequences, driven by a CAGGS promoter and a helper plasmid expressing the pCMV-PB transposase. On Day 6 postelectroporation, morphology of fibroblasts started change to round structure, and on Day 9 loose aggregates of cells developed. Putative iPS cell colonies were cultured, propagated, and characterised through morphology and expression of pluripotency markers, such as AP, OCT4, SSEA-1, and SSEA-4, through immunostaining. Further, various stemness genes, including OCT4, SOX2, NANOG, and UTF, were detected by porcine-specific primers through endpoint RT-PCR. In vitro differentiation potential was assessed by embryoid body (EB) formation. The formed EB exhibited the expression of mCherry in their cells and expressed differentiation markers, such as NESTIN, TUJI, GATA4 and AFP. To test their tumorigenic potential, 1 106 iPS cells were injected under the skin of nude mice. An mCherry-positive tumour was recovered 6 weeks later. Presently the tumour is being prepared for histological analysis. This study indicates that piggyBac transposon containing 6 transcription factors is able to reprogram porcine fetal fibroblasts into iPS cells. These cells could be cultured and maintained in vitro for a prolonged period, exhibit characteristics of stem cells, and offer a potential source for future blastocyst complementation experiments.

329

CHONDROGENIC POTENTIAL OF PORCINE ADIPOSE-DERIVED STEM CELLS, CHONDROCYTES, PERIOSTEAL CELLS, AND FIBROBLASTS IN A PELLET CULTURE SYSTEM K. K. HerzogA, D. J. MilnerB, S. J. JohnsonA, and M. B. WheelerA,B A B

Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL, USA; The Institute for Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, IL, USA

Regenerative medicine has long sought to develop therapies for articular cartilage repair and for enhancing endochondral ossification to address complications of long bone healing. The objective of this study was to determine the chondrogenic potential of porcine primary cell cultures for possible utility in orthopedic tissue engineering applications. Adipose-derived mesenchymal stem cell (ASC), chondrocyte (positive control), periosteal cell, and fibroblast (negative control) primary cell cultures from 8- to 12-month-old Yorkshire pigs were plated at 5000 to 10 000 cells cm2 in 75-cm2 cell culture flasks using high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with NaHCO3, 10% fetal bovine serum (FBS), and antimicrobials (penicillin-streptomycin, gentamicin sulfate, and amphotericin B), then incubated at 378C, 5% CO2, and 18% O2. Cells were trypsinized at ,80% confluency and transferred into 15-mL conical tubes at 500 000 cells tube1. Suspensions were washed twice by centrifugation in DPBS then condensed via a final centrifugation in 1.0 mL of negative control media (DMEM þ 10% FBS) or chondrogenic base media consisting of high-glucose DMEM with 40 mg mL1 of proline, 50 mM ascorbic acid-2phosphate, 100 nM dexamethasone, antimicrobials, and 1 insulin-transferrin-selenium solution added. Chondrogenic additives tested were 2% FBS, Kartogenin (200 nM, 400 nM, or 4 mM), 10 ng mL1 of BMP-4, or a combination of 10 ng mL1 of BMP-6 þ 10 ng mL1 of TGFb-3. Pellets were incubated with media changed every 2 to 3 days for a period of 2 to 4 weeks, fixed with 4% paraformaldehyde in DPBS, and then frozen at 808C in Neg 50 Frozen Section Medium. Eight-micrometer sections were cut using a cryostat onto charged slides. Histochemical staining was performed using hematoxylin and eosin (H&E) for cell morphology and Safranin O and Alcian Blue for cartilage matrix markers. Immunofluorescent staining was done to detect collagen II and aggrecan with the nuclear marker lamin-C used to assess cell viability. Chondrocyte pellets grown in chondrogenic media, regardless of additive, exhibited cartilage matrix formation with H&E and stained strongly positive with Safranin O, Alcian Blue, and collagen II. The ASC pellets grown in chondrogenic media showed mixed cell morphology and areas of early cartilage matrix formation with H&E and stained faintly positive with Safranin O, Alcian Blue, and collagen II at 3 weeks in culture. Periosteal cell pellets had similar morphology in all conditions and did not stain positive for cartilage matrix markers. Fibroblast pellets did not survive any condition for processing. In conclusion, porcine chondrocytes and ASC were able to form cartilage matrix in a pellet culture system with chondrogenic media regardless of additive, while porcine fibroblasts and periosteal cells showed limited to no chondrogenic potential in the conditions tested.

254


Stem Cells

330 DERIVATION OF PORCINE INDUCED PLURIPOTENT STEM CELLS FROM FIBROBLASTS OF A TRANSLOCATED AZOOSPERMIC BOAR A. CongrasA, H. BarascB, C. DelcrosA, F. VignolesA, A. PintonB, K. Canale-TabetA, O. Feraud C, A. TurhanC, M. Afanassieff D, M. Yerle-BouissouA, and H. AcloqueA A

INRA, UMR1388 Genetique, Physiologie et Systemes d’Elevage GenPhySE, Castanet-Tolosan, France; INPT-ENVT, UMR1388 Genetique, Physiologie et Systemes d’Elevage GenPhySE, Toulouse, France; C INSERM U935 ESteam, Villejuif, France; D INSERM U846 SBRI, Bron, France

B

Chromosomal rearrangements have a crucial impact on the proper proceedings of meiosis and can lead by several mechanisms to the production of unbalanced gametes or to the complete arrest of gametes production. To assess the impact of these rearrangements in the early development of pig germ cells, we proposed to generate a library of stem cells from infertile boars that are carriers of chromosomal abnormalities as a new tool for the development of an in vitro differentiation system from pluripotent stem cells to germ cells. We report here the reprogramming of fibroblasts from an azoospermic boar carrying a reciprocal translocation t(Y:14) by integrative or nonintegrative viral overexpression of Oct4, Sox2, Klf4, and c-Myc. The iPS cell lines were characterised for pluripotency, cell cycle, and differentiation potential by conventional methods. Genomic stability was analysed by G-banding karyotype, comparative genomic hybridization, and FISH. The porcine iPS-like cell lines harbored characteristics of ground and naı¨ve pluripotency when cultured in specific media. They expressed several pluripotency genes and harbored an ES-like cell cycle. Nevertheless, contrary to mouse and human iPS, they did not silence the integrated exogenes, leading to a poor differentiation potential. Moreover, cytogenetic analysis revealed a high genomic instability upon passaging, which suggests the development of a population with an increased selective advantage. We characterised the selected duplications and compared them to those previously described in other species. In contrast, the nonintegrative reprogrammation system gives us promising results regarding differentiation potential and genomic stability and will bring new insights into the molecular factors controlling and maintaining pluripotency in the pig species.

331

ABNORMAL DNA METHYLATION PATTERNS AND ALLELE-SPECIFIC EXPRESSION OF IMPRINTED GENES IN BOVINE-INDUCED PLURIPOTENT STEM CELLS F. F. BressanA, J. TherrienB, F. FilionB, F. PerecinA, L. C. SmithB, and F. V. MeirellesA A

Department of Veterinary Medicine, Faculty of Animal Sciences and Food Engineering, University of Saõ Paulo, Pirassununga, Saõ Paulo, Brazil; B Centre de recherche en reproduction animale (CRRA), Faculty of Veterinary Medicine, University of Montreal, Saint-Hyacinthe, Quebec, Canada

Pluripotency reacquisition of somatic cells has been achieved through nuclear transfer (NT) to oocytes and, more recently, through induction with pluripotency-related factors (iPS cells). However, the epigenetic reprogramming process that enables the derivation of both NT-derived cloned animals and iPS cells is usually incomplete, leading to unhealthy offspring and poorly reprogrammed iPS cell lines. These unfavourable outcomes result in part from abnormal genome DNA methylation that leads to aberrant gene expression patterns. For instance, differentially methylated regions (DMR) and monoalleleic expression of imprinted genes, essential for normal cellular commitment and early development, are thought to be severely disturbed by reprogramming techniques. Indeed, H19 and SNRPN, imprinted genes, were disturbed in bovine NT-derived embryos and fetuses. Herein we investigated whether the DMR and parent-of-origin expression of the imprinted genes H19 and SNRPN are also perturbed in iPS lines. To analyse the DMR methylation patterns and allelic expression of H19 and SNRPN using parental-specific polymorphisms, we derived multiple clones of bovine iPS (biPS) cells from an interspecies (Bos indicus Bos taurus) fetal fibroblast (bFF) using transduction with a policystronic lentivirus containing mouse Oct4, Sox2 c-Myc, and Klf-4 transcription factors. The DNA methylation patterns were evaluated by bisulfite sequencing and allelic expression by designing allele-specific PCR probes. We also quantified transcript expression by RT-PCR of H19, IGF2, SNRPN, OCT4, and NANOG by normalization with 3 housekeeping genes (GAPDH, NAT1, and ACTB). The biPS lines were characterised by a high nuclear : cytoplasmic ratio, dome-shaped colonies, positive AP activity, embryoid body formation, in vitro and in vivo (teratoma) formation, and expression of pluripotency-related genes. Compared to the bFF cells, methylation analyses of H19 showed partial hypomethylation of the paternal DMR on 1 iPS cell line and partial demethylation of the CTCF-binding region in the DMR of 2 other biPS lines, indicating abnormal demethylation of 3 out of the 4 biPS lines analysed. Methylation analyses of SNRPN revealed a partial hypomethylation in the maternal DMR and partial hypermethylation of the paternal DMR in 2 iPS lines. Gene expression analyses revealed the biallelic expression of H19 and decreased global expression of both H19 and IGF2, as well as the exclusively monoallelic paternal expression and significant increase in global expression of SNRPN. Interestingly, although OCT4 was substantially overexpressed in biPS lines, we identified a hypermethylation of the CG-rich region of the OCT4 exon 1. Endogenous NANOG expression was observed in 2 biPS clones. We conclude that imprinting errors are observed in biPS clones, suggesting that these epigenetic anomalies are related to the reprogramming process and could be directly responsible for the variable phenotypes and low success rates of both cloning and iPS derivation procedures. Financial support was from NSERC, FAPESP (13/13686-8, 11/08376-4, 57877-3/2008, 08.135-2/2013), CNPq (573754/2008-0, 482163/2013-5).

Stem Cells


332

255

DERIVATION OF BOVINE-INDUCED PLURIPOTENT STEM CELLS BY PIGGYBAC-MEDIATED REPROGRAMMING T. T. RaoA, K. DharmendraA,B, G. SilkeC, W. GarrelsC, H. NiemannA, K. DebowskiD, R. BehrD, and W. A. KuesA

A

Friedrich-Loeffler-Institut, Institut fu¨r Nutztiergenetik, Neustadt, Germany, Neustadt, Germany; B Central Institute for Research on Buffaloes, Hisar; India, Hisar; India; C Medical School Hannover, Hannover, Germany, Hannover, Germany; D German Primate Center, Go¨ttingen, Germany, Go¨ttingen, Germany

Induced pluripotent stem (iPS) cells are a seminal breakthrough in stem cell research and are promising for the development of advanced regenerative therapies and farm animal biotechnology. Considering the potential of this technology for both basic and clinical research, it is tempting to extend this research to important livestock species, such as cattle, in which authentic embryonic stem cell lines are yet not available. The first attempts to produce iPS cells from livestock species were made using retro- and lentiviral vectors, which are associated with an increased risk of insertional mutagenesis and which are not removable after reprogramming. Here, we describe a nonviral method for the derivation of bovine iPS cells, employing a piggyBac (PB) transposon system. The reprogramming PB transposon encodes the primate cDNA of 6 core reprogramming factors, OCT4, SOX2, KLF4, MYC, LIN28, and NANOG, separated by self-cleaving 2A peptide sequences and driven by the chimeric CAGGS promoter. The derived bovine iPS line expressed typical endogenous genes (OCT4, SOX2, c-MYC, KLF4, NANOG, REX1, and ALP) by RT-PCR and OCT-4 as well as SSEA-1 and 4 pluripotency-related markers by immunostaining, and it exhibited silencing of exogenous reprograming factors. Moreover, the iPS line showed longterm proliferation (until the 40th passage) under feeder-free culture conditions, differentiated into derivatives of the 3 germ layers in vitro, and formed teratomas (4/6) after subcutaneous injection into immunodeficient nude mice. These results are a major step towards the derivation of authentic bovine iPS cells, and thus facilitate the genetic modifications of the bovine genome.

333

GENERATION OF OOCYTE-LIKE STRUCTURE FROM OVARIAN SURFACE EPITHELIAL STEM CELLS OF GOAT

S. Fatima, V. Sharma, S. Saini, S. Saugandhika, H. N. Malik, S. Kumar, and D. Malakar Animal Biotechnology Center, National Dairy Research Institute, Karnal, Haryana, India Stem cells have potential for therapeutic application. Continuous repair of ovarian surface epithelium following folliculogenesis and ovarian carcinoma suggests the presence of stem cells in ovarian epithelial cells. In vitro gametogenesis in livestock will result in large numbers of oocytes production from a single ovary, resulting in faster multiplication of superior germplasm of livestock species, treatment of infertile animals, and conservation of endangered species. The present study was conducted with the objective of in vitro differentiation of putative ovarian surface epithelial stem cells into oocyte-like structures in goat model. Ovary samples of 1- to 2-year-old goats were collected from slaughterhouse. The surface of the ovary was gently scraped using sterile blunt scraper to isolate ovarian surface epithelial stem cells. These scraped cells were cultured in DMEM/F12 supplemented with 20% FBS for 3 weeks in 5% CO2 at 378C with maximum humidity. The cultured stem cells were characterised for stemness by RT-PCR and immunostaining for Oct4, Sox2, and Nanog genes after 3 weeks. These putative stem cells were in vitro differentiated spontaneously to oocyte-like structures in DMEM/F12 medium and characterised for premeiotic markers by RT-PCR and immunostaining for VASA, DAZL, and STELLA genes. Results of this study provide evidence for the presence of putative stem cells with pluripotent characteristics in the ovarian surface epithelium. The cultured cells were found to be round in shape, with a high nucleus to cytoplasm ratio under inverted microscope, and found positive for stem cell markers of Oct4, Sox2, and Nanog genes. A total of 66 oocyte-like structures were produced from 12 ovaries. These oocyte-like structures were nearly similar to oocytes produced in vivo, both morphologically and in molecular gene expression. The oocyte-like structures were also found positive for premeiotic markers of VASA, DAZL, and STELLA genes by RT-PCR and immunostaining. From this study, we concluded that the ovarian surface epithelial cells have putative stem cells which can be in vitro differentiated into oocyte-like structures in goat. These oocyte-like structures need further characterisation of their surface membrane, more molecular markers, and following their developmental potential. These oocytes can help for multiplication of elite germplasm, curing infertile animals, and saving endangered species.

334

FACTORS AFFECTING HEMATOPOIETIC ENGRAFTMENT OF MONKEY EMBRYONIC STEM CELLS IN SHEEP FETUSES Y. NagaoA,B, T. AbeC, A. HaraA,B, B. SarentonglagaA,D, M. YamaguchiA,B, K. OgataA,B, R. FukumoriA, and Y. HanazonoC

A University Farm, Faculty of Agriculture, Utsunomiya University, Tochigi, Japan; Department of Animal Production Science, United Graduate School of Agricultural Science, Tokyo University of Agriculture and Technology, Tokyo, Japan; C Division of Regenerative Medicine, Center for Molecular Medicine, Jichi Medical University, Tochigi, Japan; D Collaboration Center for Research and Development of Utsunomiya University, Tochigi, Japan B

Previously, we generated monkey/sheep haematopoietic chimeras by in utero transplantation (IUT) of monkey embryonic stem (ES); however, the factors that control how the ES cells successfully engraft and differentiate into haematopoietic tissue in sheep fetuses remain uncertain. Here, we examined factors that might influence donor cells and recipient sheep and affect successful ES cell engraftment. We transplanted either

256


Stem Cells

undifferentiated monkey ES cells or ES-derived cells at an early haematopoietic differentiation stage into sheep fetuses. The latter cells were allowed to differentiate by culturing on OP9 cell layers for 6 days. Cells were transplanted into the liver or subcutaneous tissue of recipient sheep fetuses at 43 to 50 or 51 to 67 days of gestation (full term ¼ 147 days) using ultrasound to identify the site for transplantation. After birth, monkey haematopoietic engraftment in the bone marrow was analysed in 40 lambs using colony-PCR with cells grown in methylcellulose in the presence of defined cytokines; teratoma formation was analysed by biopsy and immunohistochemistry. We found that haematopoietic engraftment was only observed when ES-derived cells at the early differentiation stage were transplanted into fetal livers at 51 to 67 days of gestation (6/9). However, teratoma formation with mature monkey tissue structures was only observed following transplantation of undifferentiated ES cells into fetal subcutaneous tissues at 43 to 50 days of gestation (4/6), but that was not observed when both types of cells were transplanted into the liver (0/18) or at 51 to 67 days of gestation (0/24). These results demonstrate that the differentiation status of the donor cells, the transplantation site, and the age of the fetus at transplantation are important factors in engraftment and differentiation into haematopoietic tissue or teratoma formation in sheep fetuses.

335

GENE THERAPEUTIC EFFECT OF ENGINEERED STEM CELLS EXPRESSING CYTOSINE DEAMINASE AND INTERFERON-B AGAINST ENDOMETRIAL CANCER IN A XENOGRAFT MOUSE MODEL B.-R. Yi and K.-C. Choi

Laboratory of Biochemistry and Immunology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, Republic of Korea To generate an animal model of endometrial cancer, Ishikawa cells (2 106 cells) were implanted via subcutaneous injection into SCID mice. In order to evaluate the therapeutic effect on tumour growth, human neural stem cells (HB1.F3), transduced with genes expressing cytosine deaminase (CD) and interferon-b (IFN-b), were labelled with the membrane dye stained with CM-DiI and were injected nearby into the tumour masses (250 mm3) in these SCID mice (n ¼ 24). Two days after stem cell injections, 5-fluorocytosine (5-FC) was intraperitoneally injected (500 mg kg1 per day) for 14 consecutive days. Mice were sacrificed at 48 h after the last treatment with 5-FC delivered by intraperitoneal injection for 14 days. Results demonstrated that tumour mass growth in mice treated with stem cells and 5-FC was significantly inhibited (450 mm3 52) in comparison to that of nontreated mice (1400 mm3 124; P , 0.01). We confirmed that injected stem cells migrated to the tumour masses by visualising the red-coloured cells in the endometrial cancer masses. The RT-PCR analysis showed that the VEGF gene was highly expressed in endometrial cancer cells, while migration-induced uPA, SDF-1, SCF, MCP-1, IL-6, and IL-8 genes were moderately expressed in these tumour cells. Histological analysis of tumour masses showed that the aggressive nature of endometrial tumour masses, determined by labelled stem cells, was inhibited in treated mice. A further analysis showed that expression of proliferating nuclear antigen (PCNA) was significantly decreased in tumour masses from treated mice. To evaluate the effect of 5-FU on Ishikawa cells, 5-FU (1.0 mg mL1) was added to in vitro-cultured cells and the levels of IFN-a/b receptor 2 (IFNAR2) and BAX, a proapoptotic genes, were detected by RT-PCR. In these cells, IFNAR2 and BAX genes were significantly increased by the addition of 5-FU. Taken together, these results indicate that co-expression of CD and IFN-b significantly inhibited the growth of endometrial tumour masses in the presence of 5-FC, and 5-FU and IFN-b inhibits tumour growth by inhibition of DNA synthesis and enhancing the apoptotic cascade, respectively. We provide evidence to support the efficacy of therapeutic stem cell-based immuno-therapy involving the targeted expression of CD and IFN-b genes at endometrial cancer sites. This work was supported by a National Research Foundation of Korea (NRF) grant (2013R1A1A2059092) funded by the Ministry of Education, Science and Technology (MEST) of the Republic of Korea government.

336

DIFFERENTIATION OF MOUSE EMBRYONIC STEM CELLS USING SF1 INTO THE STEROID-PRODUCING CELLS H. Y. Kang, Y.-K. Choi, and E.-B. Jeung

College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, South Korea Steroidogenic factor 1 (SF-1) is essential for the development and function of steroidogenic tissues. Stable incorporation of SF-1 into embryonic stem cells has been reported to prime the cells for steroidogenesis. In this study, we obtained SF1 cDNA from mRNA of murine pituitary glands and constructed the SF1-expressing vector controlled by the CMV promoter. The SF1 transgenic mouse embryonic stem cells (SF1-mES cells) were established through transfection using the nucleofector (Lonza) and selection process using G418 at 250 mg mL1. The SF1-mES cells were aggregated in hanging drops for 2 days and were transferred to suspension culture for an additional 1 day in mouse basal differentiation medium. Three-day-old SF1-mESC-derived EB were attached onto 6 well culture plates and differentiated into granulosa-like cells. Differentiated SF1-mES cells were analysed by expression of steroidogenesis-related genes and gonadal lineage-markers to the level of mRNA via real-time PCR method. To test the phenotype for granulosa-like cells, we confirmed transcripts of specific forkhead transcription factor FOXL2 and the follicle-stimulating hormone receptor (FSHR). On the other hand, we monitored some specific genes related to differentiation into testicular tissue. We observed the progress to primitive streak-mesendodermby gene expression analyses. In addition, we observed that differentiated SF1-mES cells express steroidogenic enzymes, such as 3b-hydroxysteroid dehydrogenase, cytochrome P450-containing enzyme (CYP)-11A1, and CYP19A1. Using the advanced approach, we explored culture conditions that optimize SF-1-mediated differentiation of ES cells into defined steroidogenic and gonadal lineages. We also induced granulosa-like cells. We established the effective protocol to generate ovarian cells. The derivation of these cells explores new avenues for the further study and potential application of these cells in steroidogenesis.

Stem Cells


337

257

PROMOTER-DEPENDENT SILENCING OF REPROGRAMMING TRANSCRIPTION FACTORS IN MOUSE INDUCED PLURIPOTENT STEM CELLS PRODUCED WITH SLEEPING BEAUTY TRANSPOSON VECTORS S. G. Petkov, W. A. Kues, and H. Niemann Institute for Farm Animal Genetics, Friedrich-Loeffler-Institute, Neustadt, Niedersachsen, Germany

Epigenetic silencing of the transgenes has been considered a prerequisite for complete reprogramming of mouse somatic cells to induced pluripotent stem cells (miPSC). Here, we examined the activity status of the reprogramming transcription factors in miPSC produced with Sleeping Beauty (SB) transposon vectors carrying expression cassettes with the porcine OCT4, SOX2, c-MYC, and KLF4 (pOSMK) under the control of doxycycline (DOX)-inducible (TetO) or constitutive (CAG) promoters. Mouse embryo fibroblasts (MEF) were electroporated with SB-TetO-rTA-SV40pATetO-pOSMK-IRES-tdTomato-bGHpA (TetO group) or with SB-loxP-CAG-pOSMK-IRES-tdTomato-SV40pA-loxP (CAG group) together with SB100x (SB transposase). The cells were cultured on mitotically inactivated MEF feeders with DMEM supplemented with 20% knockout serum replacement, 2 mM L-glutamine, penicillin-streptomycin, nonessential amino acids, 0.1 mM 2-mercaptoethanol, 1000 U mL1 of ESGRO, and 5 mg mL1 of DOX. The miPSC colonies were individually picked, disaggregated to single cells, and propagated further under the same culture conditions. Three cell lines from each experimental group were examined for pluripotency characteristics, and the activity of the transgenes was monitored by the presence of tdTomato fluorescence and by RT-PCR. The miPSC produced with TetO vector silenced the transgene expression within 11 days post-transfection (in the presence of DOX) and upregulated the endogenous pluripotency genes Oct4, Sox2, Nanog, Rex1, and Utf1. These cells showed typical miPSC morphology and ability to differentiate into cells from the 3 primary germ layers in vitro and in vivo (teratomas). At the same time, the miPSC from the CAG group did not silence the transgenes even after 20 passages of continuous propagation, although they upregulated the endogenous pluripotency genes similarly to the TetO group. Moreover, these cells also showed ability to differentiate in vitro into cells from the 3 germ layers (contracting cardiac myocytes, neurons, epithelia) expressing differentiation markers Afp, Sox17, Gata4, Gata6, cardiac troponin, nestin, and PGP 9.5. Following Cre-mediated excision of the reprogramming cassette, the miPSC from the CAG group continued to selfrenew and the expression of pluripotency markers Oct4, Sox2, Nanog, and Rex1 did not change significantly, as evidenced by real-time RT PCR (all P . 0.1), showing that these cells were not dependent on the transgenes for maintaining their pluripotency characteristics. Currently, we are investigating the ability of the miPSC from the CAG group to differentiate in vivo by producing teratomas and chimeras. The results from our preliminary investigations suggest that porcine transcription factors can be used for production of miPSC and that the silencing of the reprogramming transcription factors in miPSC is promoter-dependent, but may not be absolutely necessary for complete reprogramming to pluripotency.

338

IN VITRO GENERATION OF LENTOID BODIES FROM INDUCED PLURIPOTENT STEM CELLS OF TRANSGENIC MICE T. AnandA,B, D. KumarA,C, T. R. TalluriA,B, H. NiemannA, and W. A. KuesA A

Institute of Farm Animal Genetics, Friedrich-Loeffler-Institut, Mariensee, Germany; B National Research Centre on Equines, Hisar, Haryana, India; C Central Institute for Research on Buffaloes, Hisar, Haryana, India

Pluripotent cells have the developmental potential to generate all adult cell types, so ocular diseases resulting from the failure of specific cell types could be potentially treatable through the transplantation of differentiated cells derived from stem cells. The present study was conducted with the aim of generating a cataract model. We attempted to derive the induced pluripotent stem (iPS) cells from fibroblast cells of transgenic (crytom) mice carrying a transgenic construct-alphaA crystallin promoter driving the tandem dimer (td) Tomato marker transgene, integrated in the genome. The 4- to 6-week-old female crytom mice were selected, superovulated, and mated. The fetuses were recovered and examined on various different days (10.5 to 15.5 days postfertilization), and the reporter expression was found to be initiated 12.5 days postfertilization and the intensity was increased thereafter. The expression of tdTomato was confirmed in the fetuses by Western blotting. Murine embryonic fibroblast (MEF) cultures were generated and electroporated with a reprogramming transposon cassette carrying Yamanaka factors (OCT4, SOX2, KLF4, and MYC) and Sleeping Beauty transposase to generate iPS cells which were picked up and clonally expanded. The cells were confirmed by PCR for tdTomato in the genome and characterised for the expression of Oct4 and cryAB by immunofluorescence. The iPS cells were also injected into the nude CD1 mice to test for teratoma formation. The generated cells were allowed to differentiate spontaneously on 3 different types (viz. P19, NTERA, and STO) of cell lines as feeders, in the absence of LIF, and cells were expected to fluoresce if differentiated to eye lens lineage. After long-term cultures, the iPS cells were found to differentiate and form lentoid bodies which expressed tdTomato. Thus, alphaA crystallin-tdTomato construct was allowed following lens cell formation by specific fluorescence excitation in a spatial and temporal manner. The employment of cell type-specific reporters for establishing and optimizing targeted differentiation in vitro seems to be an efficient and generally applicable approach for developing differentiation protocols for desired cell populations. Hence a transgenic murine iPS cell line was generated which exhibited potential to be used as a model for eye cataracts and other eye abnormalities.

258


339

Stem Cells

INFLUENCE OF BFGF AND ACTIVIN A ON CAT FEEDER AND EMBRYONIC STEM CELLS

M. DuqueA, M. N. BiancardiA, J. H. GaliguisA, C. E. PopeA, C. DumasA, G. WangB, and M. C. Go´mezA A

Audubon Center for Research of Endangered Species, New Orleans, LA, USA; B Gene Therapy, LSU Health Sciences Center, New Orleans, LA, USA

Different feeder cells (FC) influence the isolation, proliferation, and self-renewal of cat embryonic stem cells (cat ESC; Go´mez et al. 2010 Theriogenology 74, 498–515) possibly by secretion of growth factors that affect intracellular signalling pathways involved in self-renewal. Supplementation of the culture medium with fibroblast growth factor (FGF) stimulates the secretion of Activin A in mouse and human FC, which enhances undifferentiation in human ESC (Eiselleova et al. 2008 Int. J. Dev. Biol. 52, 353-363). Moreover, the Activin/Nodal pathway plays an important role in maintaining pluripotency of hESC through mechanism(s) in which FGF acts as a competence factor (Vallier et al. 2005 J. Cell Sci. 118, 4495–4509). Little is known about secretion of growth factors by cat FC and whether cat ESC use the activin/nodal pathway for their selfrenewal. Our previous work has indicated that culturing cat ESC with bFGF enhances the stem cell replication and self-renewal (Go´mez et al. 2010 Theriogenology 74, 498–515). Here we evaluated the effect of bFGF supplementation in the culture medium on the abilities of cat embryonic fibroblast (CEF) and mouse embryonic fibroblast (MEF) FC to: (1) secrete Activin A and (2) support undifferentiated growth of cat ESC. For experiment 1, mitomycin-C-treated CEF (n ¼ 2) and MEF (n ¼ 2) were, respectively, cultured with ESC medium supplemented with (1) LIF (1000 IU), (2) bFGF (10 ng mL1), (3) LIF þ bFGF, or (4) no factors. The medium for each condition was collected at 24 h after culture and Activin A protein concentration was detected with a feline Activin A-ELISA kit. Results showed that supplementation of ESC medium with bFGF with or without LIF significantly increased the secretion of Activin A in MEF (5256 and 7048 ng mL1, respectively; P , 0.001), but not in CEF (150 and 131 ng mL1, respectively). Moreover, differences in Activin A secretion were observed between both MEF cell lines (10 269 v. 2034 ng mL1; P , 0.001). For experiment 2, cat ESC were cultured in CEF or MEF in the ESC medium supplemented with bFGF (10 ng mL1), LIF (1000 UI), and an inhibitor of glycogen synthase kinase-3 b (GSK3-b), SB 216763 (2.1 mM mL1). Results showed differences in morphology of cat ESC cultured in CEF or MEF, where colonies cultured in CEF had clearly defined borders and a tightly domed shape, with a high nucleus to cytoplasm ratio and prominent nucleoli. In comparison, ESC cultured in MEF had poorly defined borders and a flattened shape. In addition, the mean cell size of colonies at passage 8 (P8) cultured on CEF was larger (612 0.9 mm) than that of those cultured on MEF (360 0.5 mm; P , 0.001). Colonies cultured on MEF differentiated into fibroblast-like cells and other noncharacterised cell types after P8. These results clearly indicated that CEF do not secrete Activin A. The negative effect of Activin A on the morphology of cat ESC cultured on MEF may suggest a synergism between GSK3b inhibitor and Activin A that may induce differentiation, possibly into mesoendodermal cells (Teo et al. 2014 Stem Cell Rep. 3, 5–14). Studies that evaluate the effects of supplementing ESC medium with a lower concentration of Activin A may help to elucidate the importance of the Activin/Nodal pathway in cat ESC.

340

BIOLOGICAL CHARACTERISTICS AND FUNCTIONAL CAPABILITY OF FELINE ADIPOSE TISSUE-DERIVED MESENCHYMAL STEM CELLS M. C. Go´mezA, Q. QinA, M. N. BiancardiA, J. GaliguisA, C. DumasA, G. WangB, and C. E. PopeA B

A Audubon Center for Research of Endangered Species, New Orleans, LA, USA; Gene Therapy Program, Louisiana State University Health Sciences Center, New Orleans, LA, USA

Chronic kidney disease is a major cause of mortality in cats (Boyd et al. 2008J. Vet. Intern. Med. 22, 1111–1117). Similarly, the black-footed cat (Felis nigripes; BFC) frequently suffers from kidney failure caused by amyloidosis (Terio et al. 2008 Vet. Pathol. 45, 393–400). Adipose tissuederived mesenchymal stem cells (AMSC) are a valuable cell source in regenerative medicine for treating certain diseases, including those suffered by endangered species. In the domestic cat (DSH), AMSC have been isolated from subcutaneous (SQ; Quimby et al. 2011 J. Feline Med. Surg. 13, 418–426) and epididymal adipose tissue (Zhang et al. 2014 Stem Cell Rev. Rep. 10, 600–611). Whether AMSC isolated from visceral fat of the abdominal cavity (AB) have similar developmental potential has not been studied. In this study, we (1) compared the biological characteristics of DSH-AMSC isolated from AB and SQ adipose tissue, and (2) evaluated the functional capability of DSH and BFC-AMSC to differentiate into other cell types. The AB and SQ adipose tissues were harvested via laparoscopy or from an incision in the ventral abdomen, respectively. Tissues were digested with collagenase II (1 mg mL1) at 378C for 20 to 40 min with shaking at 150 rpm for 20 to 40 min. Cells from the stromal vascular fraction were cultured in DMEM-F12 medium with 12% fetal bovine serum under 5% CO2 in air at 388C. Results showed that AB biopsies were smaller (1.2 0.2 g) than that of SQ biopsies (3.6 0.7 g). The mean number of nucleated cells per gram from AB biopsies (0.6 to 22 106) was similar to that of SQ biopsies (0.4 to 24 106). The cell-doubling numbers (days) per passage (P1 to P5) in both cell types remained constant (0.9 to 2.6), but SQ-AMSC at P5 required more cell doublings (4.5 2.1) to reach 50% confluence. The AB-AMSC showed more colony-forming units (CFU; 7.0%) after 8 to 10 days of seeding at 8000 per cm2 than did SQ-AMSC (1.5% CFU). The SQ-AMSC did not form colonies at cell densities below 4000 per cm2. However, AB-AMSC colony formation only substantially decreased when the cell densities were below 1000 per cm2 (0.1%). Flow cytometry analysis revealed higher percentages of CD90þ (92%), CD105þ (80%), and CD146þ (17%) cells in AB-AMSC than in SQ-AMSC (77, 57, and 9%, respectively). Both AB and SQ-AMSC showed negative expressions of CD14, CD45, CD73, and HLA-DR. Gene expression analysis revealed that pluripotent genes Nanog, KLF4, Oct-4, and proto-oncogene C-Myc were expressed by both cell types, while Sox2 was not expressed in either type of AMSC. Under appropriate stimuli, DSH- and BFC-AMSC demonstrated differentiation potential towards adipogenic, osteogenic, chondrogenic, and neurogenic lineages. The AMSC from both species were less responsive towards osteogenesis than adipogenesis, and BFC cells had more capability to differentiate towards chondrocytes. These results suggest that the defined AMSC population (regardless of site of collection) could potentially be employed as a therapeutic agent for diseased or injured felids, both domestic and endangered.

Stem Cells


341

259

FELINE EMBRYONIC STEM-LIKE CELLS DERIVED FROM IN VITRO-PRODUCED BLASTOCYSTS RETAIN IN VITRO DIFFERENTIATION POTENTIAL T. Tharasanit, N. Tiptanavattana, P. Phakdeedindan, and M. Techakumphu Chulalongkorn University, Bangkok, Thailand

Embryonic stem (ES) cells are pluripotent cells that can differentiate into all 3 germ layers, including endoderm, mesoderm, and ectoderm. Embryonic stem cells are generally divided into 2 types, naı¨ve and primed-state, depending on their signaling pathways. Domestic cat is a useful animal model for the study of human diseases because many genetic and infectious diseases in the cat are analogous with similar aetiology to human diseases. The cat can also be used as a research model for reproductive physiology and conservation of wild felids. Until recently, information on establishment of feline ES cells is limited. The objectives of this study were to isolate cat ES cells from in vitro-produced blastocysts and to examine the effect of different concentrations of basic fibroblast growth factor (bFGF) on the expression of pluripotent genes. Inner cell masses (ICM) from cat blastocysts (n ¼ 40, Day 7 after in vitro fertilization) that were matured, fertilized, and cultured entirely in vitro, were isolated by immunosurgery and plated on mitmycin-treated mouse embryonic fibroblasts. The ICM (n ¼ 20) were then cultured in embryonic stem cell medium containing 1000 IU mL1 of leukemia inhibitory factor (LIF) and different bFGF concentrations (0, 4, 10, and 20 ng mL1). The ICM outgrowths at 7 days postplating were collected and analysed for expression of pluripotent genes (SOX-2, OCT-4, and NANOG). Results showed that transcription levels of all 3 pluripotent genes were higher in ICM outgrowths cultured in 20 ng mL1 of bFGF compared with the lower concentrations. For isolation of ES cells, ICM (n ¼ 20) were cultured in embryonic stem cell medium supplemented with 1000 IU mL1 of LIF and 20 ng mL1 of bFGF due to the results obtained from the above experiment. Established ES cells were characterised by detecting alkaline phosphatase (AP) activity and expression of ES markers (SOX-2, OCT-4, SSEA-4) at protein level, and karyotyped at passage 20 and 40. In vitro differentiation into embryoid bodies (EB) was induced by the hanging drop technique, and EB samples (n ¼ 5 for each time point) were tested for the expression of TTR, AFP, T (Bracyury), NKX2.5, MAP-2, and NESTIN genes at 0, 7, and 14 days of culture. A total of 3 ES-like cell lines were established with a typical ES morphology, such as a welldefined colony, a large nucleus to cytoplasm ratio with 1 to 2 prominent nucleoli. The 3 ES-like cell lines were passaged up to 40 times with a normal diploid karyotype (n ¼ 38). They were strongly positive for AP, SOX-2, OCT-4, and SSEA-4. Following EB culture, cell aggregation and cystic-like structure were observed. The EB samples also expressed all differentiation markers. This study reports that feline ES-like cell lines can be generated from in vitro-produced feline blastocysts. The ES cell lines can be repeatedly passaged indicating self-renewal ability, and gene expression of the EB demonstrates cellular differentiation into all 3 germ layers.

342

QUANTITATIVE IMAGING FLOW CYTOMETRY CHARACTERIZATION OF FUNCTIONALITY AND VIABILITY OF EQUINE ADIPOSE-DERIVED STEM CELLS L. M. V. QueirozB, L. BonillaA, P. F. MalardB, and J. P. VerstegenA A

MOFA Global, LLc, Verona, Wisconsin, USA; B BioCell, Brasilia, DF, Brazil

Equine adipose-derived mesenchymal stem cells (Eq adMSC) are a potential cell source for cell therapy due to their capacity to self-renew and differentiate in specialised cell types. In 2006, the International Society for Cellular Therapy (ISCT) defined human MSC as aplastic-adherent cells showing the capacity of tri-lineage differentiation that express specific surface markers (i.e. CD73, CD90, and CD105). In 2013, under the statements of the ISCT and International Federation of Adipose Therapeutics (IFAT), Bourin et al. added CD44 and CD29 to the list of MSCspecific surface antigens and recommended to include in the validation some markers of functionality and viability. Establishing a specific Eq adMSC panel has, up to now, never been done and is complicated by the nonavailability of equine-specific antibodies. Indeed, to our knowledge, only CD44 and MHCII equine-specific monoclonal antibodies are available commercially. To develop an equine-specific characterisation of Eq adMSC, nonequine antibodies should be tested for cross-reactivity. The aim of the present study was to immunophenotypically characterise Eq adMSC for the presence of membrane and intracellular proteins, as well as for apoptosis and viability. The information would then be used to establish references for equine stem cells. The Eq adMSC were obtained from the subcutaneous fat tissue of 13 adult horses. Briefly, fat tissue was minced, washed in PBS buffer, and digested for 30 min in a solution containing 1 mg mL1 of collagenase I. The cells were washed in PBS and resuspended in D-MEM, low glucose-containing 10% FBS, and antibiotics, plated at a density of 2.5 104 cells cm2, and cultured for 8 days in 5% CO2 at 378C. After 24 h, nonadherent cells were washed off and the Eq adMSC were cultured until 90% confluence was obtained. The Eq adMSC were then detached with trypsin, first passaged until 90% confluence, and evaluated. The following markers were evaluated by quantitative imaging flow cytometry (ImageStream MK II, Amnis-Millipore): surface (CD29-RD1, CD44-FITC, and CD105-AF648); haematopoietic (CD34FITC); intracellular (SOX2-DL488 and OCT3/4-DL488); and apoptosis (Annexin V-FITC and DraQ5). At the same passage, as an additional validation, osteogenic differentiation was induced. After 20 days, Alizarin O Red was used to detect extracellular calcium deposition. Following quantitative imaging flow cytometry analyses, all 13 cell lines were simultaneously positive for CD44, CD29, CD105, SOX2, and OCT3/4 and negative for CD34 (mean SD across all cell lines: 95.21 10.4, 99.00 0.93, 97.37 2.90, 79.82 14.99, and 0.37 0.13%, respectively). Low frequencies of apoptotic (1.25 0.5%) and necrotic cells (3.10 0.8%) were found. All the 13 horse cultures differentiated in osteogenic tissue, confirming the efficiency of the purification process. These results demonstrate the presence of the ISCT and IFAT main specific markers in Eq adMSC and validate the efficiency of our purification protocol. This information will be used to further improve our knowledge of Eq adMSC in this species.

260


343

Stem Cells

DIRECT EXPRESSION OF PLURIPOTENCY MARKERS IN CULTURED SOMATIC CELLS BY SMALL REPROGRAMMING MOLECULES P. Toschi, D. Iuso, D. A. Anzalone, M. Czernik, G. Ptak, and P. Loi University of Teramo, Teramo, Italy

The differentiate state of the cell may be reversed by a process called reprogramming. To date, a totipotent status is conferred to a somatic cell by nuclear transfer (SCNT) and a condition of pluripotency is conferred by induced expression of defined factors (iPSC). While the restoration of full totipotency by SCNT is rarely achieved, pluripotency by Yamanaka’s factors (Oct4, c-myc, Sox-2, Klf4) is inducible, although with low efficiency, in a large set of cell in different animal models. However, the isolation of iPSC requires complex technical skills and time-consuming protocols. In our laboratory we have observed that the simple expansion of fibroblasts in culture switches on pluripotency markers such as Oct4 and Nanog (Anzalone et al. 2015 Reprod. Fertil. Dev. IETS Abstract 344). CHIR99021 is a small molecule, targeting the Wnt/b-catenin signalling pathway, which is used for stem cell culture (Li et al. 2009). CHIR99021 acts as selective inhibitor of both isoform of GSK3 a/b regulating cellular proliferation and differentiation. In this work we tested the hypothesis that the exposure to a small reprogramming molecule (CHIR99021) induces pluripotency marker expression in primary cultures of somatic cells. Sheep and mouse primary fibroblasts cultured in low oxygen and induced to enter GO (low serum, 0.5% FBS for 5 days, ,3% cell proliferation in our conditions) were treated with different CHIR concentrations (from 2.5 to 5 mM) for different time periods (from 1 to 5 days) in order to test the proper concentration and to exclude any cytotoxic effects. Nuclear reprogramming was assessed in treated and control cells by analysing b-catenin and oct4, nanog, sox2, klf4, and c-myc expression by immuno-detection and PCR. We found that CHIR interferes with b-catenin pathway in both sheep and mouse fibroblast in a time- and dose-dependent manner; the best results were obtained using 3 mM of CHIR for 3 days. Western blot analysis confirmed that CHIR treatment leads to an increased cellular level of b-catenin; furthermore, pluripotency marker expression (protein and mRNA) was increased (P ¼ 0.023 nonparametric Mann-Whitney test) in CHIR-treated cells compared to controls. These observations, confirmed in both the experimental models, indicate that treatment with a small molecule inhibitor interfering with glucose metabolism induces the expression of pluripotency marker in somatic cells.

344

LOSS OF CONSTRAINTS IMPOSED BY TISSUE ENVIRONMENT ACTIVATES EARLY SIGNALS OF CELLULAR REPROGRAMMING D. A. Anzalone, D. Iuso, P. Toschi, F. Zacchini, G. E. Ptak, and P. Loi University of Teramo, Teramo, Italy

Pluripotency is the ability of one cell to generate every cell type of the 3 germ layers, a property typically owned by embryonic stem cells (ESC) and induced pluripotent stem cells (iPSC), with some exceptions; multilineage-differentiating stress-enduring (Muse) cells are an example. Muse cells, described as pre-existing pluripotent stem cells in mesenchymal tissues (Kuroda et al. 2010) are able to form clusters from single cells in suspension culture, express pluripotency factors and differentiate into cell types of the 3 germ layers, like ESC and iPSC. In addition, Muse cells are proposed to be the only source of cells capable to generate iPSC by current methodologies (Wakao et al. 2011). However, it is unclear whether they are normally present in adult tissue, derive from precursors stem or differentiated cells, or are induced by the in vitro conditions. In our work, we tested the hypothesis that the transition from a committed (tissue) to an uncommitted (in vitro culture) environment triggers in the cells the activation of a default gene circuitry leading to pluripotency. Adult skin fibroblasts were obtained from sheep ear biopsy (n ¼ 3) and expanded in vitro (A) or cultured in suspension in hanging drops (B) or in nonadherent dishes (C) in MEM with 10% FBS. In a subsequent experiment, clonal expansion was attempted by culturing single suspension cells in drops of medium (D). Pluripotency was assessed analysing Oct4 and Nanog expression, using real-time PCR (mRNA) and Western blotting (protein), in cultured fibroblasts compared to whole ear biopsy (30-day-old fetus was used as positive control, CTR). Furthermore, in adherent cells (A) and in clusters obtained from suspension culture (B, C, D), Oct4 and Nanog expression was compared by immunofluorescence. We found that while in the ear biopsy not one of these pluripotency markers was expressed, in in vitro-expanded fibroblasts both mRNA and protein expression was detected; mRNA expression value (mean s.e.m. relative to CTR) was 0.59 0.18 for Nanog and 0.2 0.07 for Oct4. Moreover, fibroblasts in suspension (B, C, D) were able to form clusters [obtained from 32% (16/50) of single cells, D] similar to those normally obtained with ESC, iPSC. and Muse cells. All the clusters (B, C, D) showed a more intensive signal of Oct4 and Nanog protein compared to adherent cells by immunofluorescence. In the present work we demonstrate that adult somatic cells (skin fibroblasts) express key pluripotency factors, such as OCT4 and Nanog, in both adherent and suspension culture, after removal from the tissue (ear). We can conclude that the simple in vitro culture switches on the expression of pluripotency markers in adult somatic cells. Removal from the context of the tissue probably leads the cells to lose their tissue-specific identity and acquire a new undifferentiated one, which in an optimal condition culture could result in pluripotency. Our interpretation is that reprogramming must be an automatic, default response when differentiated cells are removed from the constraints imposed by a multicellular environment.

345

LOSS OF BRM AND BAF170, COMPONENTS OF THE ATP-DEPENDENT CHROMATIN REMODELING COMPLEX, FACILITATES REPROGRAMMING OF SOMATIC CELL Z. Jiang, Y. Tang, and X. Tian

Center for Regenerative Biology, Department of Animal Science, University of Connecticut, Storrs, Connecticut, USA The SWI/SNF [SWItch/Sucrose NonFermentable; also known as BAF (Brg/Brahma-associated factors)] ATP-dependent chromatin remodelling complexes are epigenetic modifiers that change the structure of chromatin, and thereby modulate gene transcription. The BAF chromatin remodeling complexes undergo progressive changes in subunit composition during cellular differentiation. In embryonic stem cells (ESC), BAF complex,

Superovulation


261

esBAF, contains Brg1 and Baf155, which are crucial for ESC self-renewal and also facilitate induced pluripotent stem cell (iPSC) reprogramming from somatic cells. Here we sought to determine the roles of somatic BAF components (Brm and Baf170, homologues of Brg1 and Baf155, respectively) in mouse iPSC reprogramming through shRNA-mediated knockdown studies. We found that the expression of Brm and Baf170 were inhibited in reprogramming by Janus kinase/signal transducer and activator of transcription 3 (Jak/Stat3) activity, which is essential for pluripotency establishment. We further found that knockdown of Brm and Baf170 in mouse somatic cells promotes reprogramming efficiency. Specifically, loss of Brm and Baf170 during early (Days 3 and 6 after initial iPSC induction) and later-stage (Day 9) reprogramming, respectively, improves the numbers of iPSC colonies formed. These also led to significant upregulation of pluripotent genes, including Sox2, Nanog, Fgf5, and Tbx3. Although the somatic Brm and Baf170 are believed to be absent in ESC, the expression levels of Nanog and Tbx3 were increased significantly by knockdown of either Brm or Baf170 in ESC. Finally, we showed that inhibition of these somatic BAF components also promotes complete reprogramming of partially reprogrammed cells (pre-iPSC). These data suggest that inhibiting somatic BAF complex improved complete reprogramming by facilitating the activation of the pluripotency circuitry. A reduced activity of the somatic BAF complex constitutes part of the Stat3 regulated epigenetic changes during pluripotency establishment.

346

EXPRESSION OF IMPRINTED NONCODING RNA FROM THE DLK1-DIO3 LOCUS IN HUMAN EMBRYONIC STEM CELLS ADVANTAGES NEURAL LINEAGE DIFFERENTIATION C.-F. MoA, F.-C. WuB, K.-Y. T. TaiC, W.-C. ChangA, K.-W. ChangC, H.-C. KuoD, H.-N. HoB, H.-F. ChenB, and S.-P. LinA,E A

Institute of Biotechnology, National Taiwan University, Taipei, Taiwan; Department of Obstetrics & Gynecology, National Taiwan University Hospital, Taipei, Taiwan; C Genome and Systems Biology Degree Program, Academia Sinica, Taipei, Taiwan; D Genomic Research Center, Academia Sinica, Taipei, Taiwan; E Agricultural Biotechnology Research Centre, Academia Sinica, Taipei, Taiwan

B

Pluripotent stem cells are increasingly used for therapeutic models, including transplantation of neural progenitors derived from human embryonic stem cells (hESC). Recently, long noncoding RNA (lncRNA), including Maternally Expressed Gene 3 (MEG3) derived from the DLK1-DIO3imprinted locus, were found to be expressed during neural developmental events. Their deregulations are associated with various neurological diseases. The DLK1-DIO3-imprinted locus encodes abundant noncoding RNA (ncRNA) that are regulated by differential methylation on the locus. The aim of our research was to study the correlation between the DLK1-DIO3-derived ncRNA and the capacity of hESC neural lineage differentiation. We classified hESC into MEG3-ON and MEG3-OFF based on the expression levels of MEG3 as well as its downstream microRNA by qRT-PCR. Initial embryoid body (EB) formation was conducted to examine the 3 germ layer’s differentiation ability. Complementary DNA microarray was used to analyse the gene expression profiles of hESC. Directed neural lineage differentiation was performed, followed by analysis of neural lineage marker expression levels and neurite formation via qRT-PCR and immunocytochemistry methods to investigate the capacity of neural differentiation in MEG3-ON and MEG3-OFF hESC. As for statistics, error bars indicate standard error of the mean. Student’s t-test was used for calculating P-values, and a P-value of less than 0.05 was considered to be significant. Our results showed that MEG3-ON and MEG3-OFF hESC differed greatly in DLK1-DIO3-derived ncRNA expression levels, but had comparable pluripotency gene expression profiles. Genes related to nervous system development and neural cancers were differentially expressed in MEG3-OFF hESC, where DLK1-DIO3-derived ncRNA were repressed compared to MEG3-ON ones before differentiation. In neural lineage-like cells derived from MEG3-OFF hESC, lower expression levels of neural lineage markers and impaired neurite formation were observed compared to MEG3-ON hESC at the same time points after differentiation. We suggest that the expression of DLK1-DIO3-derived lncRNA, MEG3, can be used as a simple and effective screening criterion for identifying MEG3-ON hESC with activation of DLK1-DIO3-imprinted ncRNA as starting materials to benefit neural lineage-associated studies.

Superovulation 347

COULD THE DIFFERENTIAL EXPRESSION OF LUTEINIZING HORMONE RECEPTOR ISOFORMS EXPLAIN THE VARIABILITY IN SUPEROVULATORY RESPONSES IN CATTLE? S. Wohlres-VianaA,B, E. K. N. ArashiroA,C, J. G. V. GraziaB, L. S. A. CamargoA, M. A. MachadoA,B, and J. H. M. VianaA,C B

A Embrapa, Juiz de Fora, MG, Brazil; Federal University of Juiz de Fora, Juiz de Fora, MG, Brazil; C University of Alfenas, Alfenas, MG, Brazil

Embryo production in vivo is highly variable among donors. The Gir breed (Bos indicus) is well known to show a low embryo production after superovulation (2.5 to 3.5 viable embryos per flush), and a high variance in superovulatory responses, which makes this breed an interesting model to study this trait. The aim of this study was to evaluate the expression pattern of LHR isoforms in Gir heifers previously characterised as good (10.3 1.2 embryos/flush, N ¼ 5) or poor (1.1 0.3 embryos/flush, N ¼ 5) responders to superovulation protocols. In both groups, an adapted ultrasound-guided follicular aspiration system (Arashiro et al. 2012 Reprod. Fertil. Dev. 24, 175) was used to collect granulosa cells (GC) from 8-mm follicles growing in either a synchronized but not stimulated follicular wave (FW) or in the fourth day of superovulation (SOV), induced with 200 UI of FSHp (Pluset, Serono). The recovered follicular fluid was centrifuged and the cells were washed with NaCl 0.9% saline and kept in RNA Later (Ambion, Austin, TX, USA). Total RNA extraction was performed using the commercial RNeasy Micro Kit (Qiagen, Valencia, CA, USA). The RNA samples were quantified and reverse transcribed using the commercial Superscript III kit (Invitrogen, Carlsbad, CA, USA). Complementary DNA samples were amplified

262


Superovulation

through real-time PCR, using a LH receptor primer – not selective for LHR isoforms (total LHR) – and 4 sets of isoform selective primers (S1, S10, S10þ11, and S11). All samples were previously tested for theca cell contamination through detection of CYP17A1 gene, and those showing contamination were excluded. The b-actin gene was used as endogenous control. Analyses were performed using the REST software and the expression values are shown as mean s.e.m. For comparisons between good and poor responders, the first was set as 1.00. For comparisons between FW and SOV, FW was set as 1.00. In the good responder group, there was no difference (P . 0.05) in total LHR expression among GC samples from FW and SOV. However, the S10þ11 isoform was down-regulated (0.4 0.1; P , 0.01) after SOV. In the poor responders group, total LHR expression was down-regulated (0.2 0.1; P , 0.01) after SOV, but there was no difference in the expression of isoforms (P . 0.05). Contrasting the response groups (good and poor), total LHR (15.1 7.6; P , 0.001), and the isoforms S10 (5.7 2.7; P , 0.01), S10þ11 (1.9 0.6; P , 0.01), and S11 (5.1 2.5; P , 0.01) were up-regulated in FW of poor responders, but there was no difference (P . 0.05) in any LHR form during SOV. We concluded that 1) LHR expression is different between heifers characterised as good or poor responders to superovulation; 2) superovulation modulates the LHR expression and reduces the original differences observed in unstimulated cycles; 3) diminished expression of total LHR, but not in the isoforms, in poor responders heifers could suggest a reduction in the expression of full-length LHR, with possible consequences to ovulatory capability after superovulation. Financial support was provided by CNPq Project 477701 and Fapemig PPM 0067/11.

348

¨ LLERIAN HORMONE AND SUPEROVULATORY RESPONSE IN DONOR COWS ANTI-MU MANAGED IN 2 SEMIARID ENVIRONMENTS IN NORTHWEST MEXICO J. F. TorresA, G. A. Bo´B, M. G. ThomasC, F. LaresA, C. PenãA, and P. LunaA A

Instituto Tecnolo´gico de Sonora, Ciudad Obregoń, Sonora, Me´xico; Universidad Nacional de Villa Marıá, Villa Marıá, Co´rdoba, Argentina; C Colorado State University, Fort Collins, CO, USA

B

An embryo transfer program in cows relies on the superovulatory (SPO) response after receiving a hormonal treatment. Anti-Mu¨llerian hormone (AMH) has been proposed as an endocrine marker associated to superovulation; however, the SPO response of donors has also been influenced by the environment. Thus, objective herein was to evaluate effects of serum AMH levels on number of ovarian follicles (NOF), corpora lutea (CL), and transferable embryos (TE) in superovulated donor cows managed under summer or winter conditions in northwest Mexico. Fifty-two cows in a random stage of the oestrous cycle were used in this study. All cows received an Eazi-Breed CIDR cattle insert (1.384 g of progesterone; Zoetis, USA), and 2.76 mg of oestradiol benzoate (Sigma-Aldrich, St. Louis, MO, USA) plus 50 mg of progesterone (Vetoquinol, Canada) given i.m. to synchronize follicular wave emergence (Day 0). The SPO treatment started on Day 4 with decreasing doses (120, 80, 40, and 20 mg) of FolltropinV (Vetoquinol, Canada) injected twice daily until Day 7. Artificial insemination was performed on days 8 p.m. and 9 a.m. and ova/embryos were collected on Day 15. Transrectal ultrasonography was done on Days 8 and 15 to determine the number of follicles .9 mm in diameter on Day 8 and CL on Day 15, respectively. Blood samples were collected on the first day of SPO treatment (Day 4) to measure serum AMH concentrations, which served to classify cows as high- (.400; n ¼ 29) and normal-AMH donors (100–400 pg mL1; n ¼ 23). A mixed effects model was used to analyse SPO response in cattle including level of AMH and season as fixed effects, age as covariate, and sire as random. Level of AMH, season, and their interaction resulted as significant (P , 0.05) sources of variation. Pearson correlations were determined between serum AMH concentrations and SPO response for summer and winter. Average serum levels of AMH were 471.5 70.4 and 1194.2 57.3 pg mL1 during summer and winter, respectively. The SPO response differed in high- and normal-AMH donor cows (P , 0.05). Mean ( s.e.m.) NOF, CL, and TE were 19.8 1.0, 12.8 0.6, and 7.3 0.5 for high-AMH donors, and 10.9 1.6, 6.5 1.9, and 3.8 1.1 for normal-AMH donor cows, respectively. Environment of donor cows also influenced SPO response as NOF, CL, and TE increased 42, 50, and 45%, respectively, during winter compared with summer (P , 0.05). Correlations among NOF, CL, and TE with serum AMH levels were moderate for donor cows managed during winter (0.657, 0.523, and 0.431, respectively; P , 0.01), and low in cows managed during summer (0.309, 0.195, and 0.085, respectively; P . 0.05). Results from this study indicated that SPO response in donor cows is associated with serum concentrations of AMH; however, the relationship among these variables appears to be affected in the summer when drought and severe heat stress are common. We concluded that under winter conditions of northwest Mexico, the serum levels of AMH should be considered as an endocrine marker associated with ovarian traits indicative of the SPO response in donor cows.

349

SUPEROVULATORY RESPONSE AND EMBRYO QUALITY RECOVERED FOLLOWING FLUSHING NGUNI HEIFERS AND COWS A. MaqhashuA,B, M. L. MphaphathiA, V. MuchenjeB, and T. L. NedambaleA,C A Agricultural Research Council, Animal Production Institute, Private Bag X2, Irene, South Africa; University of Fort Hare, Department of Livestock and Pasture Sciences, Private Bag X1314, Alice, South Africa; C University of Free State, Department of Animal, Wildlife and Grassland Sciences, Bloemfontein, South Africa

B

Most of the South African indigenous cattle breeds are facing genetic degradation due to unselective crossbreeding and irregular matings especially in small scale farming. The aims of the study were to compare superovulatory (SO) response, fertilization rate and to evaluate embryo quality recovered from superovulated Nguni stud cows and heifers. Nguni stud cows (n ¼ 15) and heifers (n ¼ 10) aged 4–6 and 2 years, respectively, were used as embryo donors for ex situ conservation. Nine days following heat observation for the first oestrus synchronisation protocol, superstimulation of donor cows and heifers were administered with a total of 350 mg of FSH (Follotropin-VÒ, porcine pituitary glands extract) divided into 2 injections daily 12 h apart (6 a.m. and 6 p.m.) for 4.5 days on a decreasing dosage. Two injections of prostaglandin F2a were

Superovulation


263

administered on Day 3 and 4 of FSH injections. Semen was collected from 2 Nguni bulls (bull 1 and 2) and assessed by computer aided sperm analysis before artificial insemination (AI). The AI was conducted with fresh semen 3 times, 12 h apart, and the first AI was performed at the onset of oestrus. Semen from bull 1 was used to inseminate the cows, and bull 2 was used for heifers. Embryos were flushed 7 days after AI using a nonsurgical technique. Embryos were evaluated under stereo microscope and classified according to IETS standard codes (code 1, good and excellent; code 2, fair). Recovered embryos were then vitrified and stored for future use. Superovulatory response was measured by counting number of corpus lutea in each ovary. Data were analysed using 1-way ANOVA (SAS, 2003, SAS Institute Inc., Cary, NC, USA). There was no statistical difference between bull 1 (93.7%) and bull 2 (83.5%) on total sperm motility rate. Furthermore, no significant differences were recorded on fertilization rate between cows (67.5%) and heifers (53.5%). There was also no significant difference on the proportion of Nguni cows (40%) and heifers (40%) that responded to superovulation treatment. There was a significant difference on the ovary reaction (number of corpus lutea) of cows (11.3 1.41) and heifers (4.0 0.57). There were no significant differences recorded on the embryo quality recovered between Nguni cows (code 1, 2.5 1.00; code 2, 1.3 0.59) and heifers (code 1, 0.8 0.41; code 2, 1.0 0.36). However, cows had higher numbers of unfertilized ova than heifers (5.5 1.05 and 1.8 0.47, respectively) and degenerate embryos (3.7 1.00 and 1.3 0.39, respectively). Although superovulatory response of both Nguni cows and heifers was low, Nguni cows had higher ovarian response than heifers. Moreover, the quality of embryos recovered was similar for both Nguni cows and heifers.

350 EFFECT OF DIFFERENT SUB-DOSES OF EQUINE CHORIONIC GONADOTROPIN ON PREGNANCY AND TWINNING RATES OF CYCLIC ZEBU COWS SUBMITTED TO FIXED-TIME ARTIFICIAL INSEMINATION R. H. AlvarezA, F. L. N. NatalA, R. M. L. PiresB, K. M. R. DuarteB, and C. A. OliveiraC A

Agency for Agribusiness Technology of Saõ Paulo, Piracicaba, SP, Brazil; B Instituto de Zootecnia/APTA, Nova Odessa, SP, Brazil; C Animal Reproduction Department/FMVZ/USP, Saõ Paulo, SP, Brazil

The injection of a low dose of eCG has the potential to induce multiple ovulation and pregnancies in cattle. The present study aimed to evaluate the ovarian response, conception rate and incidence of twin pregnancies of cyclic cows receiving 1 of 2 low doses of eCG. Multiparous Nellore (Bos t. indicus) cows with plasma progesterone levels .1 ngmL1 on at least one of 2 blood samples collected at 10-day intervals (Day 10 and Day 0) received an intramuscular (IM) injection of 2 mg of oestradiol benzoate (EB; EstroginÒ, AUSA, Saõ Paulo, Brazil) and a vaginal device (DIP) containing 1 g of progesterone (PrimerÒ, Tecnopec, Saõ Paulo, SP, Brazil) on Day 0. On Day 8, the DIP was removed and cows received an IM injection of 150 mg of cloprostenol (VeteglanÒ, Hertape Calier, Juatuba, MG, Brazil). At this time, the animals were randomly distributed into 3 groups. Group 1 (n ¼ 30) received an IM injection of 2 mL of saline, whereas groups 2 (n ¼ 41) and 3 (n ¼ 23) received 600 IU and 900 IU of eCG (NovormonÒ MSD Saude Animal, Saõ Paulo, Brazil), respectively. Twenty-four hours later (Day 9), all groups received 1 mg of EB and were submitted to fixed-time artificial insemination (FTAI) 30 h later (i.e. 54 h after DIP removal). Oestrus observation was performed daily from the time of the withdrawal of the DIP until the day of FTAI. Ovaries were examined ultrasonically at the time of FTAI, the following day and 7 days after FTAI. Pregnancy diagnosis was done by ultrasonography 30 days after FTAI and the incidence of twin or single calves was recorded at birth. Data were analysed by chi-square test. The rate of expression of oestrus was 70.0% (group 1), 82.9% (group 2), and 78.2% (group 3; P ¼ 0.25). Cows that had 2 or more large follicles at the time of FTAI was 0% (group 1), 14.6% (group 2), and 34.8% (group 3; P , 0.05). The ovulation rate of cows in group 1 (80.0%) was higher than cows in groups 2 (48.8%) and 3 (52.2%; P , 0.05). The conception rates for groups 1, 2, and 3 were 50.0, 26.8, and 39.1%, respectively (P , 0.05). Two animals in group 3, one in group 2, and none of group 1 had twin pregnancies on Day 30 after FTAI. Only one of these cows (group 3) had a twin calving. It was concluded that the injection of 600 or 900 IU eCG, in an oestradiol/progestogen FTAI protocol does not result in an increase in the rate of twin calvings, but may negatively affect pregnancy rates of cyclic Nellore cows. Financial support was provided by FAPESP (proc. 2011/13096–0).

351

A COMPARISON OF 2 APPROACHES FOR THE USE OF GNRH TO SYNCHRONIZE FOLLICLE WAVE EMERGENCE FOR SUPEROVULATION R. H. HinshawA, M. L. SwitzerA, R. J. MapletoftB, and G. A. BoĆ,D A Ashby Embryos, Harrisonburg, VA, USA; University of Saskatchewan, Saskatoon, SK, Canada; C Instituto A.P. de Ciencias Basicas y Aplicadas, Universidad Nacional de Villa Maria, Cordoba, Argentina; D Instituto de Reproduccion Animal Cordoba (IRAC), Cordoba, Argentina B

Although oestradiol has been used successfully to synchronize follicle wave emergence for superovulation, it cannot be used in many countries. Attention has turned to alternatives, including the use of GnRH to induce ovulation of a dominant follicle, which will be followed by emergence of a new follicular wave in 1 to 2 days. However, GnRH synchronizes follicular wave emergence only when it induces ovulation and administration of GnRH at random stages of the oestrous cycle results in ovulation in less than 60% of animals. The objective of the study was to compare superovulatory response and ova/embryo production following synchronization of follicle wave emergence for superovulation with GnRH administered 2 days after insertion of a progestin device, with a protocol in which GnRH is administered 7 days after administration of prostaglandin F2a and a progestin device. Beef donors of various breeds were placed at random into 1 of 2 groups and superstimulated by replicate so that one cow in each group had ova/embryos collected on the same day. Sixty-six superstimulations were performed in this study; 26 were performed in 13 donors that

264


Superovulation

were superstimulated twice in a crossover design, and 40 donors were superstimulated once (i.e. 20 donors in each treatment group). Cows in group 1 received CIDR devices (Zoetis Animal Health, USA) on Day 2 and 100 mg of GnRH (Cystorelin, Merial USA) on Day 0; FSH treatments were initiated on Day 2 with 288 mg of Folltropin-V (Vetoquinol, Canada) given in twice-daily decreasing doses for 4 days. Prostaglandin F2a (PGF; 35 mg dinoprost, Lutalyse, Zoetis) was given with the last 2 injections of Folltropin-V and CIDR were removed with the last Folltropin-V administration (i.e. Day 6). Donors received a second GnRH at the onset of oestrus and were AI 8 and 20 h later. Donors that were still in standing oestrus at the second AI were AI again at 30 h. Ova/embryo collections were done on Day 14 and embryos were classified according to the IETS manual. Cows in group 2 received an injection of PGF and a CIDR on Day 7 and 100 mg of GnRH on Day 0; FSH treatments were initiated on Day 2 and the remainder of the treatment protocol was as in group 1. Data (total ova/embryos collected and transferable embryos) were analysed by ANOVA for mixed models, using treatment as a fixed variable and cow (i.d.) as a random variable. The group 1 cows produced a mean ( s.e.m.) of 18.6 1.9 total ova/ embryos of which 12.7 1.5 were of transferable quality (7.2 1.3 grade 1). Cows in group 2 produced a mean ( s.e.m.) of 19.5 1.7 total ova/ embryos, of which 14.8 1.5 were of transferable quality (8.9 1.2 grade 1). Although 2 more transferable embryos were obtained in group 2, differences were not significant (P . 0.3). At the same time as this experiment was done, 214 other cows were superstimulated in this practice, yielding an average of 7.9 transferable embryos per donor. Results suggest that both approaches are efficacious for the superstimulation of beef cows. Special thanks to Vetoquinol/Bioniche Animal Health, USA for support.

352

¨ LLERIAN HORMONE IN SHEEP AS AN ENDOCRINE MARKER THE USE OF PLASMA ANTI-MU OF THE OVARIAN RESPONSE TO FOLLICLE-STIMULATING HORMONE IN MULTIPLE-OVULATION EMBRYO TRANSFER PROGRAMS B. LahozA, J. L. AlabartA, M. J. CoceroB, D. MonniauxC, S. FabreC, and J. FolchA A

CITA de Aragoń, Zaragoza, Spain; B INIA, Madrid, Spain; C INRA UMR85, CNRS UMR7247, Physiologie de la Reproduction et des Comportements, Nouzilly, France The performance of MOET (multiple-ovulation embryo transfer) programs in sheep is limited, mainly due to variable ovarian responses to FSH superovulation treatments. In several mammalian species, anti-Mu¨llerian hormone (AMH) has been demonstrated to be a good predictor of the ovarian follicle population able to respond to gonadotropins. Therefore, we aimed to evaluate its usefulness in ovine MOET programs. With this goal, two MOET trials involving 24 adult ewes in total were performed. Each ewe received a fluorogestone acetate sponge (Sincropart 30 mg, CEVA Animal Health SA, Barcelona, Spain) which was replaced by a new one after 6 days (T4). Four days later (T0), the first FSH injection (Folltropin-V, Minitub Ibe´rica SL, Tarragona, Spain) of a superovulation treatment consisting in 280 IU of FSH administered in 8 decreasing doses was applied. Blood samples were taken at T4 and T0 using lithium heparin tubes for AMH measurement. Ewes were inseminated 51 h after sponge removal. Eight days after sponge removal, ovulation rate was recorded and embryo recovery was carried out under general anaesthesia. After morphological evaluation, 2 embryos were transferred to each recipient previously synchronized. The plasma concentrations of AMH were determined using the AMH equine ELISA kit (AnshLab, Webster, TX, USA). The sensibility of the assay was 27.8 pg mL1, and the intra-assay coefficient of variation was 4.8%. Relationships between the AMH concentration of each animal and the number of corpora lutea (CL), embryo recovered and lambs born per donor ewe were tested using the Pearson correlation coefficient. Normality of the variables was assessed by Kolmogorov–Smirnov test. The plasma AMH concentrations at T4 were highly correlated with those at T0 (r ¼ 0.95; P , 0.01), so both sampling times could be used indistinctly. The plasma AMH concentration at T0 was highly variable between animals, ranging from 0 to 309.1 pg mL1 (mean s.e.m.: 98.4 18.4 pg mL1). Similarly, the number of CL ranged from 2 to 29 (12.2 1.5), recovered embryos from 0 to 17 (7.6 1.2), and lambs born per donor and session from 0 to 13 (4.5 0.9). The AMH concentration at the beginning of the FSH treatment (T0) was highly correlated with the total number of CL (r ¼ 0.70; P , 0.01), but significance was not attained for AMH with the other variables. The number of CL was also correlated with the number of recovered embryos (r ¼ 0.69; P , 0.01) and lambs born (r ¼ 0.58; P , 0.01). In conclusion, AMH concentrations measured in blood plasma before the FSH treatment could be used to predict the number of CL per donor ewe, and so to improve the efficiency of MOET programs. Further studies are necessary to assess the individual repeatability of a given ewe from session to session as well as the relationship of AMH with other embryo-related variables.

353

FOLLICULAR POPULATION STATUS AT THE FIRST FOLLICLE-STIMULATING HORMONE INJECTION IN EWES SUPERSTIMULATED NEAR THE FIRST FOLLICULAR WAVE OF CIDR PROTOCOL M. E. F. OliveiraA, M. A. R. FelicianoA, L. G. OliveiraA, J. F. FonsecaB, and W. R. R. VicenteA A

FCAV, UNESP, FCAV, UNESP, Jaboticabal/SP, Brazil; B Embrapa, Embrapa, Coronel Pacheco/MG, Brazil

This study was designed to evaluate the follicular status at the 1st FSH injection in ewes superstimulated near the 1st follicular wave of the CIDR protocol during nonbreeding (NB), transition (T), and breeding (B) season, and thus to correlate them with the superovulatory response (SR). On Day 0, all females (30 Santa Ines ewes; n ¼ 10 per season) received a progesterone (P4) device (CIDRÒ; Zoetis, Brazil) and 37.5 mg of D-cloprostenol. The superestimulation (ST) was initiated on Day 4, 4, and 6 of protocol in the NB, T, and B season, respectively. These follicular wave emergence days were defined in a previous study that evaluated the follicular dynamic in P4 protocol (Oliveira et al. 2011 Acta Scientiae Veterinariae, 38, 361). The ST consisted of 8 injections of pFSH administrated twice a day in descending order (40/30/20/ and 10 mg of pFSH; Folltropin-V, Bioniche,

Transgenesis


265

Canada). The P4 device was removed 2 days after the beginning of the FSH treatment and all ewes received another injection of 37.5 mg of D-cloprostenol and a dose of 200 IU of eCG at the same time. B-mode ultrasound of ovaries was performed immediately before the 1st FSH injection. The follicles were classified according to their diameters into categories based on physiological dynamics: (C1) 2–4.25 mm, representative of the population before dominance phase; (C2) 4.5–5 mm, initial dominance phase; (C3) 5.25–5.75 mm, middle dominance phase; and (C4) 6 mm, preovulatory phase. Data were analysed by GLIMMIX using SAS comparing mean values ( s.e.m.) between seasons (P , 0.05) and Pearson correlation was made. All ewes had small follicles (C1) at the beginning the ST; however, only one female had solely C1 follicles. The number of C1 follicles did not differ between seasons (12.9 0.9, 12.8 0.8, and 12.1 0.5 follicles for the NB, T, and B season, respectively). One-half of the animals from NB and T seasons had no C3 and C4 follicles, whereas 40% of females in B season showed the same follicular status. The percentage of ewes that had no C4 follicles was 80, 100, and 50% for the NB, T, and B season, respectively. There were no difference between season in number of C2 follicles (1.8 0.5, 1.7 0.4, and 1.7 0.4) and C3 follicles (0.3 0.1, 0.6 0.2, 0.1 0.1) for NB, T, and B seasons, respectively. However, the number of C4 follicles was significantly higher (P , 0.05) in the NB (0.2 0.13) and B (0.6 0.2) season than T period, which had no follicles in this category. The SR did not differ between seasons (12.4 0.9, 13.1 2.3, and 17.0 2.3 for the NB, T, and B season, respectively) and had no correlation to any follicular category. In conclusion, the ST started on a day when there was a large population of small follicles, regardless of the season, confirming proximity to follicular wave emergence. However, the ovarian population was not restricted to this category. Therefore, it is possible that wave emergence has already started in some ewes before the initiation of the ST. Financial support is from FAPESP and CNPq.

354

COMPARISON OF OVARIAN CONTENTS OF AKT ISOFORMS AMONG 4 STRAINS OF MICE O. Suzuki National Institute of Biomedical Innovation, Ibaraki, Osaka, Japan

Strain/individual differences in superovulation efficiency with gonadotropins constitute a serious problem in mouse reproduction (Suzuki et al. 1996 Reprod. Fertil. Dev. 8, 975–980). Because the PI3K/Akt signalling pathway is involved in ovarian folliculogenesis, quantitative difference of protein components in the PI3K/Akt signalling pathway among mouse strains may explain the strain difference in superovulation efficiency. The present study compared ovarian contents of AKT isoforms among 4 strains to examine the involvement of the PI3K/Akt signalling pathway in superovulation. Ovarian protein contents of AKT1, AKT2, and AKT3 isoforms in 4-week-old females of 4 mouse strains were measured by quantitative Western blots with GAPDH as an internal control using whole ovary homogenates (see Suzuki et al. 2011 Exp. Anim. 60, 193–196, for method details). Observed values were compared among strains by 1-way ANOVA after normality (Shapiro-Wilk) and equal variance (Levene) were confirmed. Ovarian protein contents of all 3 AKT isoforms in A/J, C57BL/6N, DBA/2, and C3H/He (arbitrary unit, mean s.e.m., n ¼ 4) were significantly different among strains by 1-way ANOVA (P , 0.05). Ovarian AKT1 contents were 1.01 0.10a, 0.98 0.07, 0.89 0.03, and 0.84 0.02b, respectively. Ovarian AKT2 contents were 1.39 0.13a, 0.74 0.10b, 1.03 0.07c, and 0.91 0.19bc, respectively. Ovarian AKT3 contents were 1.24 0.38, 1.55 0.24a, 1.11 0.09, and 0.67 0.18b, respectively. a–cValues with different superscripts in each isoform are significantly different by Tukey test (P , 0.05). Thus, significant quantitative differences in ovarian AKT isoforms among strains suggest that the ovarian PI3K/Akt signalling pathway acts differently among strains. This activity difference of the pathway may explain the strain difference in superovulation efficiency in mice. This work was supported by a grant from the Ministry of Health, Labour and Welfare of Japan.

Transgenesis 355

COMPARISON OF TN5 AND SLEEPING BEAUTY SYSTEMS IN BOVINE EMBRYOS AND IN OVINE OFFSPRING

R. J. BevacquaA,B, R. Fernande´z MartıńA, A. GibbonsC, D. TeixeiraD, N. G. CanelA, F. LangeB, M. I. HiriartA, W. A. KuesE, S. FerrarisB, and D. F. SalamoneA A

B

Laboratorio de Biotecnologıá Animal, FAUBA, Buenos Aires, Argentina; Laboratorio de Clonacioń y Transgeńesis, Universidad Maimońides, Buenos Aires, Argentina; C Estacioń Experimental Bariloche, INTA, Bariloche, Rıó Negro, Argentina; D Laboratorio de Fisiologia e Controle da Reproduçaõ, FAVET, UECE, Fortaleza, Brazil; E Friedrich-Loeffler-Institut, Neustadt, Germany

Current techniques for the production of transgenic domestic animals remain inefficient. Only recently, DNA transposons resulted in improved efficiencies for mouse and pig transgenesis. In this work, we evaluated Tn5 and Sleeping Beauty systems for transgenesis in bovine and ovine species. First, both transposon systems were assessed in vitro in bovine embryos employing transposons carrying fluorescent reporter genes. In vitro-produced bovine zygotes were microinjected with either 1) a complex of Tn5:egfp transposon (20 ng mL1) (protein: transgene with mosaic ends recognised by Tn5, in Mgþ2 free medium), or 2) two plasmids carrying Sleeping Beauty 100X (pSB100X, 5 ng mL1) and pT2/Venus transposon (10 ng mL1). In vitro results for Tn5 transgenesis in bovine showed that blastocysts, Day 4 egfp embryos and egfp blastocysts rates for the group injected with Tn5: egfp did not differ from the group injected with the egfp transposon alone (73/145, 50%; 86/145, 59%; and 65/145, 45% v. 65/129, 50%; 87/129, 67%; and 57/129, 44%, respectively). For SB transgenesis, blastocysts, D4 Venus embryos, and Venus blastocysts rates did not differ between co-injection

266


Transgenesis

of pSB100X and pT2/Venus or injection with pT2/Venus alone (46/99, 46.5%; 64/99, 64.6%; and 33/99, 33.3% v. 41/83, 49.4%; 52/83, 62.7%; and 26/83, 31.3%, respectively). However, Venus intensity in blastocysts was markedly higher for the group co-injected with pSB100X and pT2/ Venus respective to pT2/Venus alone. Both systems were assessed in vivo for the production of transgenic lambs employing a functional transposon (hrFIX, recombinant human factor IX driven by a Beta-lactoglobulin promoter). Laparoscopic artificial insemination of donor sheep was performed, and presumptive zygotes were flushed from the oviducts. The microinjections were done identically as described for the bovine embryos. A total of 24 presumptive zygotes were recovered and injected with the Tn5:hrFIX complex. Then, 21 zygotes were transferred to 5 synchronized ewes; one pregnancy of siblings was obtained, and one animal was born. Genomic DNA from skin, placenta, and blood was genotyped by PCR, but the hrFIX gene could not be detected. For the SB approach, 64 presumptive zygotes were recovered from 4 superovulated ewes, microinjected with the SB plasmids, and 21 of them were transferred to 7 oestrous synchronized recipients. The remaining zygotes were cultured in vitro and blastocysts (n ¼ 7) were vitrified. Currently, 3 donor ewes are pregnant, one with siblings (4 total fetuses). Deliveries are expected by the end of August of this year. Our results indicate that both Tn5 and SB systems are capable of resulting in the production of transgene expressing embryos, and the presence of the transposases does not affect embryo viability. However, phenotyping of blastocyst stages does not seem to be predictive for stable transgene integration. The in vivo results will help to better address the suitability of Tn5 and SB approaches for the production of transgenic sheep.

356

SLEEPING BEAUTY TRANSGENESIS IN CATTLE

A,B

W. Garrels , T. R. TalluriA, R. BevacquaC, A. AlessioD, A. FiliD, D. ForcatoD, N. RodriguezD, M. F. Olmos NicotraD, Z. IvicsE, D. F. SalamoneC, P. BoschD, and W. A. KuesA A

Friedrich-Loeffler-Institut, Institut fu¨r Nutztiergenetik, Neustadt, Germany; Institute for Laboratory Animal Sciences, Medical School Hannover, Hannover, Germany; C Departamento de Produccioń Animal, Universidad de Buenos Aires, Argentina; D Departamento de Biologıá Molecular, FCEFQyN, Universidad Nacional de Rıó Cuarto, Co´rdoba, Argentina; E Paul-Ehrlich-Institute, Langen, Germany B

Transposon-mediated transgenesis is a well-established tool for genome modification in small animal models. However, translation of this active transgenic method to large animals warrants further investigations. Here, the Sleeping Beauty (SB) transposon system was assessed for stable gene transfer into the cattle genome. The transposon plasmids encoded a ubiquitously active CAGGS promoter-driven Venus reporter and a lens-specific a A-crystallin promoter driven tdTomato fluorophore, respectively. The helper plasmid carried the hyperactive SB100x transposase variant. In total, 50 in vitro-derived zygotes were co-injected (Garrels et al. 2011 PLoS ONE 6; Ivics et al. 2014 Nat. Protoc. 9) and cultured up to blastocyst stage (Day 8). Two blastocysts were Venus-positive and were transferred to synchronized heifers, resulting in one pregnancy. The resulting calf was normally developed and vital; however, it died shortly after cesarean section due to spontaneous bleeding from an undetected aneurism. Phenotypic analysis suggested that the calf was indeed double-transgenic, showing widespread expression of Venus and lens-specific expression of tdTomato. Genotyping and molecular analyses confirmed the integration of both reporter transposons and the faithful promoter-dependent expression patterns. Subdermal tissue of an ear biopsy was used to culture fibroblasts, which were employed in somatic cell nuclear transfer experiments. In total, 39 embryos were reconstructed, of which 34 underwent cleavage, and at the end of culture 12 morulas and 12 blastocysts were obtained. Ten of the blastocysts were Venus positive, and embryo transfer of Venus-positive blastocysts is planned. In summary, we showed that the cytoplasmic injection of SB components is a highly efficient method for transgenesis in cattle. Due to the modular composition of SB plasmids, even double transgenic cattle can be generated in a one-step procedure. Importantly, the SB-catalyzed integration seems to favour transcriptionally permissive loci in the genome, resulting in faithful and robust promoter-dependent expression of the transgenes. The transposon constructs carry heterospecific loxP sites, which will be instrumental for targeted insertion of functional transgenes by Cre recombinase-mediated cassette exchange. Financial support of DFG (Ku 1586/3-1), UNRC, CONICET and Agencia Nacional de Promocioń Cientı´fica y Tecnolo´gica de la Argentina (ANPCyT) is gratefully acknowledged.

357

EARLY FETAL DEVELOPMENT OF NUCLEAR TRANSFER BOVINE EMBRYOS GENERATED FROM FIBROBLASTS GENETICALLY MODIFIED BY PIGGYBAC TRANSPOSITION

A. AlessioA, A. FiliA, D. ForcatoA, M. F. Olmos-NicotraA, F. AlustizaA, N. RodriguezA, R. V. SampaioB, J. SangalliB, F. BressanB, P. Fantinato-NetoB, F. MeirellesB, J. OwensC, S. MoisyadiC, W. A. KuesD, and P. BoschA B

A Department of Molecular Biology, FCEFQyN, National University of Rıó Cuarto, Rıó Cuarto, Co´rdoba, Argentina; Department of Veterinary Medicine, Faculty of Animal Sciences and Food Engineering, University of Saõ Paulo, Saõ Paulo, Brazil; C Department of Anatomy, Biochemistry and Physiology; John A. Burns School of Medicine, Honolulu, HI, USA; D Friedrich-Loeffler-Institut, Institut fu¨r Nutztiergenetik, Mariensee, Germany

Transposon-mediated transgenesis is a well-established tool for genome manipulation in small animal models. However, translation of this active transgenesis method to the large animal setting requires further investigation. We have previously demonstrated that a helper-independent piggyBac (PB) transposon system can efficiently transpose transgenes into the bovine genome [Alessio et al. 2014 Reprod. Domest. Anim. 49 (Suppl. 1), 8]. The aims of the current study were a) to investigate the effectiveness of a hyperactive version of the PB transposase, and b) to determine the ability of

Transgenesis


267

the genetically modified cells to support early embryo and fetal development upon somatic cell nuclear transfer (SCNT). Bovine fetal fibroblasts (BFF) were chemically transfected with either pmGENIE-3 (a helper-independent PB transposon conferring genes for hygromycin resistance and enhanced green fluorescent protein (EGFP); Urschitz et al. 2010 PNAS USA 107, 8117–8122), pmhyGENIE-3 (carrying an hyperactive version of the PB transposase; Marh et al. 2012 PNAS USA 109, 19 184–19 189), or pmGENIE-3/D PB (a control plasmid lacking a functional PB transposase). Upon transfection, cell cultures were subjected to 14 days of hygromycin selection. Antibiotic-resistant and EGFPþ colonies were counted and data analysed by ANOVA and Tukey’s test. For SCNT, pmhyGENIE-3 and pmGENIE-3 polyclonal cell lines were selected by FACS and individual cells used as nuclear donors. Day 7 blastocysts were nonsurgically transferred to synchronized recipients. Conceptuses were recovered by Day 35 of gestation, observed under fluorescence excitation, and genotyped. The mean number of colonies in pmhyGENIE-3 group was significantly higher than those in pmGENIE-3 and the control group (324.0 17.8 v. 100.0 16.1 and 2.8 0.8 respectively, n ¼ 4–7; P , 0.05). The hyperactive transposase increased transgene integration efficiency 3.24 times compared with the conventional PB transposase. The SCNT and early fetal development data are summarised in Table 1. Phenotypic analysis revealed that both transgenic fetuses and the extraembryonic membranes expressed EGFP with no macroscopic evidence of variegated transgene expression. Molecular analysis by PCR confirmed that both fetuses carried the transposon DNA. Here, we demonstrate that a hyperactive version of the PB transposase is more active in bovine cells than the conventional PB transposase. In addition, SCNT embryos generated from genetically modified cells by the pGENIE transposon system can progress to early stages of fetal development. Table 1. SCNT and early fetal development of bovine fibroblasts transposed with piggyBac1 Experimental group

Oocytes

Fused couplets (%)

Cleavage (%)

Blastocysts (%) [no. of blastocysts expressing EFGP]

No. of transferred embryos

No. of pregnant/total recipients

No. of recovered fetuses (Day 35)/ no. of transgenic fetuses

pmGENIE-3 pmhyGENIE-3 PA

58 58 30

26 (44.8) 36 (62.0) –

26 (100) 33 (91.7) 28 (93.3)

4 (15.4) [4] 9 (25.0) [9] 19 (63.3) [0]

4 9 n.a.

0/2 2/8 n.a.

0/0 2/2 n.a.

1

PA ¼ parthenogenetic activation; n.a. ¼ not applicable.

The financial support of UNRC, CONICET and ANPCyT from Argentina is gratefully acknowledged.

358

EXCESS EXPRESSION OF 11B-HSD1 CONTRIBUTES TO LETHALITY THROUGH DYSFUNCTION IN ENERGY BALANCE BETWEEN ANABOLIC PROCESS AND ENERGY RECOVERY PROCESS H. Y. Kang and E.-B. Jeung College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, South Korea

11b-Hydroxysteroid dehydrogenase type 1 (11b-HSD1) effectively amplifies glucocorticoid action in liver, adipose tissue, and brain. This enzyme converts the inactive 11-keto form into a glucocorticoid (e.g. cortisol). Glucocorticoids (GC) are steroid hormones found in the body and produced by the adrenal cortex, the outer layer of the adrenal glands. Glucocorticoids are lipophilic and readily access their intracellular receptors. Glucocorticoids regulate carbohydrate, fat, and protein metabolism. In a previous study, we constructed a vector composed of 2 parts: the 11b-HSD1 expression cassette and the selection cassette containing EGFP and Neo resistant genes. Porcine fibroblasts overexpressing 11b-HSD1 under the control of adipose tissue-specific aP2 promoter were established and used in somatic cell nuclear transfer (SCNT). Somatic cells from the resulting stillborn transgenic piglets were used in a second round of SCNT. Non-obese, transgenic piglets overexpressing 11b-HSD1 were obtained and were identified through PCR-based methods using specific primers for the targeting cassettes from the genomic DNA of piglets. Six live piglets, 1 stillborn piglet, and 3 mummies were born. Integration of target gene into the genomic DNA was confirmed for all of them. However, all 6 live piglets died within 1 month. All of the piglets had displayed hypoglycemia. Increased expression of 11b-HSD1 in metabolic tissues induced up-regulation of gluconeogenesis-related genes (G6PT, G6Pase, PEPCK, HNF4a, FOXO1) in liver and kidney, and showed up-regulation of lipogenesis-related genes (SREBP1c, FASN, DGAT, ACC, SCD) in muscle. The AMPK and SIRT signalling, which controls energy balance and mitochondrial biogenesis, was also stimulated. We propose that overexpression of 11b-HSD1 evokes the excess production and action of glucocorticoid or its receptors, and activates gluconeogenic and lipogenic pathways. For this reason, AMPK and SIRT1 signalling was induced. Also, in compensation of energy loss by anabolic processes, the expression of mitochondrial biogenesis-related genes was increased. Finally, the constitutive expression of 11b-HSD1 might continuously activate complementary energy-gaining processes, and these problems could develop into more fatal diseases that resulted in the piglets’ death.

268


359

Transgenesis

A NONINVASIVE APPROACH TO DIAGNOSE TRANSGENIC CONCEPTI DURING PREGNANCY IN GOATS K. C. S. Tavares, C. R. Lazzarotto, C. M. Calderon, L. T. Martins, S. G. Neto, L. H. Aguiar, A. M. Miranda, M. Bertolini, and L. R. Bertolini Universidade de Fortaleza, Fortaleza, Ceara, Brazil

The discovery of cell-free fetal DNA (cffDNA) circulating in the blood of pregnant women, and more recently in cows, ewes, and mares, paves the road towards the development of molecular tools to explore genetic features of embryos and/or fetuses before term. Albeit a wide range of analyses are in current use and development in humans, genetic diagnostic targets other than sex determination are still not described for other mammalian species. The aim of this study was to detect cffDNA from transgenic goat concepti for the human lysozyme (hLZ) gene in the blood of nontransgenic dams. Blood was collected from 3 nontransgenic goats carrying hLZ-transgenic concepti on Days 40–50, 80–90, and 110–120 of gestation. Also, blood was drawn 8 and 12 days after parturition from two other nontransgenic goats that delivered hLZ-transgenic offspring. Blood samples (10 mL) were spun at 1200 rpm for 10 min; resulting serum or plasma were stored at 208C (serum) or 48C (plasma). The DNA was extracted by mixing 350 mL of serum or plasma with an equal volume of TE buffer and 5 mL of proteinase K (20 mg mL1). The mixtures were incubated at 558C for 3 h, followed by phenol extraction and DNA precipitation by sodium acetate and 100% ethanol, with further incubation at 208C overnight and centrifugation at 12 000 g for 10 min. The DNA pellets were washed with 70% ethanol and eluted in 20 mL of ultrapure water. For the PCR, primer sets for the hLZ transgene (hLZ-i1-F 50 CGGTCCAGGGCAAGGTCTTTGA 30 and hLZ-i1-R 50 ACTGCTCCTGGGGTTTTGCC 30 ) and for GAPDH as the endogenous control were used. Reactions contained 3 mL of DNA, 200 nM of each primer, and 45 mL of PCR Mastermix (Quatro G Pesquisa & Desenvolvimento, Porto Alegre, Brazil). The DNA from serum and plasma of nontransgenic goats were used as negative controls. The cycling conditions were 958C for 10 min, followed by 55 cycles of 958C for 30 s, 588C for 30 s and 728C for 30 s, plus a final extension at 728C for 10 min. The PCR products were analysed by electrophoresis in 2% agarose gel. As expected, GAPDH was amplified in most of the samples (12/13). The 200-bp PCR product corresponding to hLZ was detected in the dam’s serum in all 3 gestational phases, with 2 out of 3 animals being positive on 40 to 50 and 80 to 90 days, and all 3 on 110 to 120 days of pregnancy. Furthermore, the transgene was amplified from dam’s plasma in all samples after parturition. Only GAPDH amplification was detected in the blood of nontransgenic goats. These results suggest that cffDNA is present in the goat’s blood circulation at the fetal phase during pregnancy and at least during the first 2 weeks after parturition. This method can be safely applied as a useful tool in zygote-DNA microinjection experiments, providing an early and preterm diagnostic of transgenic concepti through the dam’s blood. Research was supported by FINEP.

360

DOUBLE KNOCKOUT OF GOAT MYOSTATIN AND PRION PROTEIN GENE USING CLUSTERED REGULARLY INTERSPACED SHORT PALINDROMIC REPEAT (CRISPR)/CAS9 SYSTEMS S. Hu, M. Yang, and I. Polejaeva Department of Animal, Dairy & Veterinary Sciences, Utah State University, Logan, UT, USA

Myostatin (MSTN) acts as a negative regulator of skeletal muscle development and growth. Inhibition of MSTN expression may be applied to enhance animal growth performance in livestock production. Prion protein (PrPc) is associated directly with the pathogenesis of the transmissible spongiform encephalopathies occurring in variety of species including human, cattle, sheep, goats and deer. Prion protein-deficient livestock may be a useful model for prion research and producing animal conferring potential disease resistance. The goal of this study was to generate MSTN/PrPc double knockout goat by using CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system. We generated 2 CRISPR/Cas9 plasmids targeting MSTN and PrPc genes, respectively. The CRISPR/Cas9 plasmids targeting each gene were respectively transfected into goat fibroblasts, and the efficiency of gene modification was determined at Day 3 using restriction fragment length polymorphism (RFLP) assay. The RFLP assay showed that CRISPR/Cas9 plasmids targeting MSTN and PrPc induced precise gene mutations with efficiency of 59 and 70%, respectively. Single cell-derived colonies were further isolated by limiting dilution after co-transfection of 2 CRISPR/Cas9 plasmids targeting MSTN and PrPc. The RFLP assay and DNA sequence analysis indicated that 9 out of 45 colonies (20%) carried simultaneous disruption of both target genes. Moreover, 5 of 9 mutant colonies (55%) had mutations in all 4 alleles of 2 genes. These double-gene knockout fibroblast cells will be used as nuclear donors for developing double knockout goat deficient in MSTN and PrPc. The CRISPR/Cas9 system represents a highly effective and facile platform for multiplex editing of large animal genomes, which can be broadly applied to both biomedical and agricultural applications. This work was supported by the Utah Science Technology and Research Initiative and Utah Agricultural Experiment Station project #31294.

Undergraduate Poster Competition


269

361 GROWTH HORMONE RECEPTOR MUTANT PIGS PRODUCED BY USING THE CLUSTERED REGULARLY INTERSPACED SHORT PALINDROMIC REPEATS (CRISPR) AND CRISPR-ASSOCIATED SYSTEMS IN IN VITRO-PRODUCED ZYGOTES M. KuromeA, M. Dahlhoff A, S. BultmannB, S. KrebsA, H. BlumA, B. KesslerA, H. LeonhardtB, and E. Wolf A A

Chair of Molecular Animal Breeding and Biotechnology, and Laboratory for Functional Genome Analysis, Gene Center, LMU Munich, Munich, Germany; B Chair of Human Biology and BioImaging, BioCenter, LMU Munich, Munich, Germany

Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) technology is considered as an efficient strategy for generating gene edited large animals, such as pigs. Compared to somatic cell nuclear transfer, this new technology offers a relatively simple way to generate mutant pigs by direct injection of RNA into the cytoplasm of zygotes. Moreover, the use of in vitro produced zygotes would provide a highly effective and practical method for the production of porcine disease models for biomedical research. Here we examined the production efficiency of growth hormone receptor (GHR) mutant pigs by the combination of the CRISPR/Cas system and in vitro produced zygotes. In vitro maturation (IVM) of oocytes was performed as described previously (Kurome et al., Meth. Mol. Biol., in press). In all experiments, the same batch of frozen sperm was used. After IVM, around 20 oocytes with expanded cumulus cells were incubated with 5 104 spermatozoa in a 100-mL drop of porcine fertilization medium for 7 h. In vitro-produced embryos were assessed by the ratio of normal fertilization (eggs with 2 pronuclei) and blastocyst formation at Day 7. The Cas9 mRNA and a single guide RNA, recognising a short sequence of 20 base pairs in exon 3 of the GHR gene, were injected directly into the cytoplasm of the embryos 8.5 to 9.5 h after IVF. Injected embryos were transferred laparoscopically to recipient pigs, and 86.4% (57/66) of spermpenetrated oocytes (66/96) exhibited normal fertilization. Incidence of polyspermy was relatively low (9/66, 13.6%). Developmental ability of in vitro-produced embryos to the blastocyst stage was 17.4% (24/138). In total, 426 RNA-injected embryos were transferred into 2 recipients, one of which became pregnant and gave birth to 8 piglets. All piglets were clinically healthy and developed normally. In 3 out of 8 piglets (37.5%), mutations were introduced. Next-generation sequencing revealed that all of them were mosaics: one with a single mutation (22% wild-type/78% mutant) and 2 piglets with 2 different mutations (80% wild-type/2% mutant_1/18% mutant_2 and 94% wild-type/4% mutant_1/2% mutant_2). Four out of 5 mutations caused a frameshift in the GHR gene. Our study reports for the first time generation of GHR mutant pigs by the use of the CRISPR/Cas system in in vitro-produced zygotes. Because all GHR mutant offspring were mosaic, Cas9 activation probably occurred after the 1-cell stage under our experimental conditions. The founder animal with the highest proportion of mutant GHR alleles will be used for breeding to establish a large animal model for Laron syndrome. This work is supported by the German Research Council (TR-CRC 127).

Undergraduate Poster Competition 362

DIFFERENT IN VITRO DEVELOPMENT AFTER AGGREGATION OF BOVINE AND FELINE PARTHENOGENETIC EMBRYOS A. De Stefano, A. Gambini, and D. Salamone Facultad de Agronomia Universidad de Buenos Aires, Capital Federal, Argentina

Embryo aggregation has been shown to improve embryo development in several species. However, the effects seem to be different among species. Thus, the aim of this study was to compare the effect of embryo aggregation over in vitro development and blastocyst quality of bovine and feline parthenogenetic (PA) embryos. To this aim, bovine cumulus-oocyte complexes (COC) were collected from slaughterhouse ovaries, whereas cat ovaries were obtained from ovariectomized animals. The COC were in vitro matured in TCM199 supplemented following standard protocols for each species. After 24 h, cumulus cells and zona pellucidae were removed. Matured oocytes were selected and activated by 5 mM ionomycin treatment for 4 min followed by incubation in 1.9 mM 6-DMAP. Bovine and feline PA embryos were cultured in SOF medium in the well of well system in two different groups: only one PA embryo per microwell (1X); and three PA embryos per microwell (3X, aggregated embryos). Cleavage and blastocyst rates from all groups were assessed at Days 2 and 7, respectively. Size of blastocysts was measured at Day 7 using a millimetre eyepiece, and total cell number was determined by Hoechst 33342 staining. Blastocyst rates and embryo size were analysed by Fisher’s test (P , 0.05) and total cell numbers by Kruskal–Wallis test with Dunn’s correction (P , 0.05). Statistical differences were found in PA blastocyst rates between experimental groups (1X: 15/104, 24.6% v. 3X: 27/37, 62.2% for feline; and 1X: 21/113, 19.4% v. 3X: 20/32, 62.5% for bovine), but no differences were found between species. In addition, there was no statistical difference in the number of blastocysts obtained per oocyte used in any of the experimental groups. Bovine aggregated PA blastocysts were significantly larger than non-aggregated embryos (.200 microns, 1X: 2/20, 10% v. 3X: 9/19, 47.4%), but no differences were found in cell number. On the other hand, cat aggregated PA blastocysts had significantly higher cell numbers (1X: 122.4 79.66 cells v. 3X: 259.8 137.1 cells), but no differences were found in blastocyst size. This observation can contribute in the understanding of embryo physiology, suggesting that benefits of embryo aggregation in parthenogenic embryos vary among these species.

270


363

Undergraduate Poster Competition

EXTENDING THE IN VIVO MATURATION TIME TO PERMIT FLEXIBLE TIMING OF OOCYTE COLLECTION IN SUPERSTIMULATED WOOD BISON (BISON BISON ATHABASCAE) M. W. von der Porten, M. P. Cervantes, J. M. Palomino, and G. P. Adams Department of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, Saskatchewan, Canada

Wood bison are a species threatened by endemic brucellosis and tuberculosis. Reproductive technologies are being developed in an effort to ensure the genetic diversity of wild wood bison, and to prevent disease transmission to healthy bison, livestock, and humans. For the purposes of IVF, recent results revealed that cumulus cell expansion was more extensive in in vivo- v. in vitro-matured cumulus-oocyte complexes (COC), and more oocytes reached maturity after 30 v. 24 h of in vivo maturation following hCG treatment (Cervantes et al. 2013 Reprod. Fert. Develop. 25, 283). An experiment was designed to determine the effects of an additional 4 h of in vivo maturation on follicle development, unwanted ovulation, and COC collection efficiency. Wood bison cows (n ¼ 28) underwent transvaginal ultrasound-guided follicle ablation to induce emergence of a new follicular wave (Day 0 ¼ day of wave emergence, 1 day after ablation) during the non-breeding season. Bison were given FSH diluted in hyaluronan IM on Days 0 (300 mg) and 2 (100 mg), and 2500 IU hCG IM on Day 4. Bison were then assigned randomly to 2 groups (n ¼ 14 per group) in which transvaginal oocyte collection was done at either 30 or 34 h after hCG treatment. The number and size of follicles available for aspiration (i.e. ¼ 5 mm) was compared between groups by Student’s t-test. Binomial data (COC collection rate and ovulation rate) were compared by chi-square, and the proportion of cows that ovulated was compared using a Fisher’s exact test. Ovulation was defined as the sudden disappearance of follicles $10 mm from the hCG treatment to the time of COC collection. The numbers of follicles $5 mm and $10 mm at the time of COC collection were not different between the 30 and 34 h groups (19.0 1.4 v. 17.4 2.4, and 9.5 1.2 v. 7.7 1.8), nor was the average size of follicles ¼ 5 mm (9.9 0.2 v. 9.8 0.2 mm). The number of follicles aspirated was similar between the 30 and 34 h groups (16.4 1.4 v. 13.4 2.1), but the pre-collection ovulation rate was lower in the 30 h group (12/89 [13.5%] v. 47/147, [32.0%]; P ¼ 0.003), as was the proportion of bison that ovulated (3/14 v. 10/14, P ¼ 0.02). The COC collection rate was lower in the 30 v. 34 h group (64.3% v. 78.2%; P ¼ 0.003), but the total number of COC collected per bison was similar (10.6 1.7 v. 10.5 1.5). Although waiting for 34 h before COC collection resulted in a larger proportion of unwanted ovulations, a greater collection efficiency in the 34 h group resulted in a similar number of COC collected per bison. We conclude that the 30 to 34 h in vivo maturation window provides flexibility for the purposes of oocyte collection and immediate in vitro fertilization in wood bison. We thank Bioniche Animal Health for providing FSH (Folltropin-V) and hyaluronan (MAP-5), and Merck Animal Health for hCG (Chorulon).