Studies on Lumpy Skin Disease Virus

''Studies on Lumpy Skin Disease Virus'' Thesis submitted to Faculty of Veterinary Medicine Benha University By

Gehad Hossam ELdein Mohamed Elkady B. V. Sc Benha University (2012)

For The degree of M. V. Sc (Virology) Under supervision of Prof. Dr. Gabr Fikry El-Bagoury Professor of Virology Department of Virology Faculty of Veterinary Medicine Benha University

Dr. Ehab Mostafa El-Nahas Mohamed Ass. Professor of Virology Department of Virology Faculty of Veterinary Medicine Benha University

Dr. Ayman Saeed Emam El-habbak Ass. Professor of Virology Department of Virology Faculty of Veterinary Medicine Benha University

1

ACKNOWLEDGEMENT First of all and for most I’m indebted to Allah; the most kind and the most merciful, for all gifts which given to me. I would like to take this opportunity to express my deepest appreciation and sincere gratitude to Prof. Dr. Gabr F. El-Bagoury, professor of virology. Dept, Faculty of Vet. Med. Benha University, for his supervision of this work. My great appreciation to Dr. Ayman S. El-Habbaa, Assistant Prof. of Virology. Dept. Faculty of Vet. Med. Benha University, for his supervision of this work. I would like to express my gratitude to Dr. Ehab M. El-Nhas, Assistant Prof. of Virology department, Faculty of Vet. Med. Benha University for his supervision of this work. I would like to extend my best regards to Dr- Mohamed gouda abd -elwahab who is the professor of infectious department, faculty of veterinary medicine, Benha University, Dr-Wessel Dirksen who is the Laboratory manager at Ohio university, and Dr- Saeed Elshafae who is lecturer at pathology department, faculty of veterinary medicine, Benha University for their help to design the primers. Finally, my great gratitude to My family who adapted the optimum environment to complete this work.

2

LIST OF CONTENTS

FRONTCOVER…………………………………………………………………………………………………………………….1

ACKNOWLEDGMENT…………………………………………………………………………………………………………………….2

LIST OF CONTENTS…………………………………………………………………………………………………………….3

LIST OF ABBREVIATIONS……………………………………………………………………………………..4 LIST OF TABLES…………………………………………………………………………………………………..10 LIST OF FIGURES…………………………………………………………………………………………………11 LIST OF PHOTOS…………………………………………………………………………………………………12 ABSTRACT………………………………………………………………………………………………………….13 1. INTRODUCTION…………………………………………………………………………………………………………….15 2. AIM OF THE STUDY………………………………………………………………………………………………………..18 3. LITERATURE REVIEW………………………………………………………………………………………………………20 3.1. HISTORY OF LSDV……………………………………………………………………………………………………..21 3.2. TAXONOMY OF LSDV…………………………………………………………………………………………………22 3.3. STRUCTURE OF LSDV…………………………………………………………………………………………………22 3.4. ANTIGENIC CHARACTERS AND RELATIONSHIPS OF LSDV……………………………………………51 3.5. RESISTANCE OF LSDV TO PHYSICAL AND CHEMICAL AGENTS…………………………………….51 3.6. BIOLOGICAL PROPERTIES OF LSDV…………………………………………………………………………….52 3.6.1. REPLICATION IN THE HOST CELL………………………………………………………………………52 3.6.2. PROPAGATION IN VITRO…………………………………………………………………………………55 3.7. PATHOGENESIS AND HISTOPATHOLOGY OF LSDV…………………………………………………….56 3.8. LABORATORY DIAGNOSIS…………………………………………………………………………………………58

3

3.8.1. SAMPLING OF LSDV…………………………………………………………………………………………58 3.8.2. ISOLATION OF LSDV………………………………………………………………………………………...58 3.8.2.1. ISOLATION OF LSDV ON EMBRYONATED CHICKEN EGGS (SPF-ECES)………….58 3.8.2.2. ISOLATION OF LSDV ON CELL CULTURE………………………………………………………………….59 3.8.3. IDENTIFICATION OF LSDV …………………………………………………………………………………………………………………………….60 3.8.3.1. NON-SEROLOGICAL TECHNIQUES……………………………………………………………….60 3.8.3.1.1. TRANSMISSION ELECTRON MICROSCOPY………………………………………….60 3.8.3.1.2. HISTOPATHOLOGICAL EXAMINATION………………………………………………..61 3.8.3.2. SEROLOGICAL TECHNIQUES…………………………………………………………………………..63 3.8.3.2.1. INDIRECT FLUORESCENCE ANTIBODY TECHNIQUE (IFAT)……………………63 3.8.3.3. MOLECULAR IDENTIFICATION…………………………………………………………………………63 3.8.3.3.1. POLYMERASE CHAIN REACTION (PCR)……………………………………………….63 3.8.3.3.2. SEQUENCING OF THE VIRAL GENOME………………………………………………69 3.9. VIRAL IMMUNE EVASION…………………………………………………………………………………………75 4. MATERIAL AND METHODS STRATEGY…………………………………………………………………………78 4.1. MATERIAL…………………………………………………………………………………………………………………79 4.2. METHODS………………………………………………………………………………………………………………..102 5. RESULTS…………………………………………………………………………………………………………………………118 6. DISCUSSION, CONCLUSION AND RECOMMENDATION…………………………………………………145 7. SUMMARY ……………………………………………………………………………………………………………………153 8. REFERENCES …………………………………………………………………………………………………………………156 9. ARABIC SUMMARY………………………………………………………………………………………………………..2

4

LIST OF ABBREVIATIONS LSDV

Lumpy Skin Disease Virus

LSD

Lumpy Skin Disease

ds

Double Stranded deoxyribonucleic

SPPV

Sheep Pox Virus

GTPV

Goat Pox Virus

SPF

Specific Pathogen Free

ECE

Embryonated Chichen Egg

MDBK

Madin Darby Bovine Kidney Cell

CPE

Cytopathic effect

TEM

Transmission Electron Microscope

TEM

Transmission Electron Microscopy

PCR

Polymerase Chain Reaction

ORFS

Open Reading Frames

ITRS

Inverted Terminal Repeats

bp

base pair

GI

Gene Bank Identification

IMV

Intracellular Mature Virus

IEV

Intracellular Enveloped Virus

CEV

Cell- Associated Extracellular

DNA

acid

Virus EMV

Extracellular Mature Virus

IV

Immature Virion

MV

Mature Virus

EV

Enveloped Virus 5

EEV

Extracellular Enveloped Virus

NP

Nucleoprotein

VTM

Viral transport media

PM

Post mortem

S1

Sample 1

S2

Sample 2

PTFEL

Polytetrafluoroethylene laminated

I.V

Intravenous

W/V

Weight per volume

M.O.H

Manufacturer On Hold

Na+

Sodium

CL-

Chloride

W

Weight

L

Liter

EXP

Expired

Cat. No.

Catalogue Number

WFI

Water for Injection

ml

Milliliter

µm

Micrometer

⁰c

Degree Celsius

µl

Microliter

g

Gram

mg

Milligram

USA

United states of America

EMS

Electron Microscopy Sciences

µg

Microgram

Ca+2

Calsium

mg+2

Magnesium

6

min

Minute

Sec

Second

Temp

Temperature

N

Normality

M

Molarity

NaCL

Sodium chloride

NaOH

Sodium hydroxide

HCL

Hydrochloric acid

MEM

Minimum essential medium

NaHCO3

Sodium bicarbonate

PBS

Phosphate buffered saline

KCL

Pottasium hydroxide

Na2 HPO4

Di-sodium hydrogen phosphate

KH2PO4

Pottasium di-hydrogen phosphate

DH2O

Distilled Water

EDTA

Ethylene diamine tetra acetic acid

MW

Molecular weight

M

Mole or mol

mM

Millimole

Co2

Carbon dioxide

NSA

non enyl succinic anhydride

ERL-4206 (VCD)

(Vinyl Cyclohexene Dioxide)

DER 736 EPOXY RESIN

diglycidyl ether of polypropylene

DMAE

Dimethylaminoethanol

DW

Distilled water

FITC

Fluorescein isothiocyanate

CAM

Chorioallantoic membrane

CAMs

Chorioallantoic membranes

HA

Haemagglutination

(Vinyl-4 Cyclohexene Diepoxide), glycol

7

IFAT

Indirect fluorescence antibody

qRT-PCR

Quantitative real-time PCR

mgCl2

Magnesium chloride

Taq

Thermus aquaticus

RNase

Ribonuclease

dNTP

Deoxy nucleotide tri-phosphate

Tm

Melting temperature

nm

Nanomole

OD

Optical density

cm

Centimetre

Kcal

Kilocalories

Ext. Coefficient

Extinction coefficient

L

Length

µm

Micromole

TAE

Tris acetic acid EDTA

FW

Formula weight

POP

Performance Optimized Polymers

ABC

Anode Buffer Container

CBC

Cathode Buffer Container

P/N

Part number

rpm

Round per minute

H&E

Hematoxylin and eosin

RBCS

Red blood cells

Pmol

Picomol

ng

Nanogram

Acc.no

Accession number

BLAST

Basic local alignment search tool

Ncbi

National center for biotechnology

Hr

Hour

technique

information

8

Max

Maximum

No

Number

cm3

Cubic centimetre

Abs

Antibodies

UV

Ultraviolet

Nm

Nanometer

FBT

foetal bovine testes

LK

Londiani Kenya

LT

lamb testes

ELISA

Enzyme linked immunosorbent

VNT

Viral neutralization test

BVD

Bovine viral diarrhea

SA

South Africa

EBL

Embryonic bovine lung

CER

Chicken embryo rough

MAFFT

Multiple Alignment using Fast

assay

Fourier Transform

9

LIST OF TABLES TABLE.NO

TITLE

TABLE_1

DNA replication and nucleotide

TABLE_2

RNA transcription and modification

metabolism genes of LSDV genes of LSDV

TABLE_3

Structure and assembly genes of LSDV

TABLE_4

Viral virulence and host range genes of LSDV

TABLE_5 TABLE_6

Major gene families of LSDV Alterations on CAM and Embryo of SPF ECE inoculated with two suspected skin samples for LSD virus.

TABLE_7

Characteristics of suspected LSD virus

isolate strain on SPF ECE and MDBK cell line.

10

LIST OF FIGURES FIGURE.NO

TITLE

FIGURE_1

Morphological structure LSDV

FIGURE_2

Diagram shows the surface structure of an un enveloped virion, whereas the other part shows the crosssection through the center of an enveloped virion

FIGURE_3

Linear map of the LSDV genome.

FIGURE_4

The poxvirus lifecycle

FIGURE_5

Material and method of TEM.

FIGURE_6

The partial sequence profile of LSDV envelope protein-like gene

FIGURE_7

The partial sequence profile of LSDV

FIGURE_8

Alignment report of partial nucleotide

envelope protein-like gene

sequences for the envelope protein-like gene FIGURE_9

Pair wise sequence distance for the envelope protein-like gene

FIGURE_10

Phylogenetic tree of local LSDV strain

FIGURE_11

Alignment report of partial nucleotide sequences for the envelope protein-like gene of local LSDV strain

FIGURE_12

Pair wise sequence distance for the envelope protein-like gene of local LSDV strain

FIGURE_13

Phylogenetic tree of local LSDV strain

11

LIST OF PHOTOS PHOTO.NO

TITLE

Photo_1

Suspected cattle for LSD

Photo_2

Signs of LSDV multiplication on ECE-SPF CAM

Photo_3

Signs of LSDV multiplication on ECE-SPF embryo

Photo_4

Control non- infected complete sheet of MDBK cells

Photo_5

Characteristic CPE of suspected LSDV on the sheet of MDBK cells

Photo_6

Histopathological examination of

Photo_7

Transmission Electron Microscopy of

intracytoplasmic inclusions of LSDV LSDV

Photo_8

HA property of LSD virus isolate

Photo_9&10

Serological identification of suspected LSD virus isolate using IFAT

Photo_11

Electrophoresis of the amplified products

12

13

ABSTRACT Between 2013 -2014, outbreaks of LSDV were reported in Qaliubiya province, where animals suffered from severe signs differ from the previous outbreaks such as suffocation and deaths. This thesis presents the first investigation that the LSDV changes its biological properties and also its molecular properties. The general objective of the pilot study was to study the biological and molecular characteristic of recent isolate of LSDV. Trial for isolation and identification of LSDV was carried out using SPF-fertile ECE and MDBK cell line, which show new signs on inoculated egg, such as edema and hemorrhage, with hepatomegaly and bloody liver of embryo, hemorrhagic and slight heart hypertrophy in addition to pock lesion on CAM in the form of white line. Moreover cell rounding and clustering on MDBK cells. The presence of virus confirmed by non-serological techniques, such as TEM, where the virus appeared as rounded shape with inclusion bodies, histopathological examination, where intracytoplasmic inclusion bodies appeared, and hemagglutination technique where button shape appeared, serological technique, such as IFAT, where intracytoplasmic apple green fluorescence emission appered and molecular identification, such as conventional PCR, cycle sequencing, gene alignment and phylogenetic analysis of target gene confirmed the success isolation of LSDV.

14

15

1- INTRODUCTION Lumpy skin disease virus (LSDV), a DNA virus of the genus Capripoxvirus, chordopoxvirinae subfamily and Poxviridae family. The prototype strain is Neethling virus (Gari, G.et al,2010). It is closely related to sheep pox (SPPV) and Goat pox virus (GTPV) (Babiuk, S et al,2009). However, although all three viruses are considered distinct species, they can't be differentiated serologically (Magori-Cohen at al, 2012). Therefore, the only molecular techniques to distinguish LSDV from SPPV and GTPV. It exists epidemically or sporadically in southern and eastern Africa and more recently in northern Africa and the Middle East (Fenner et al,1996), It was reported in unvaccinated cattle in Bulgaria, the Former Yugoslavian Republic of Macedonia, Turkey, Greece (OIE a and b, 2016) and Israel (Brenner et al., 2006), and in the Sultanate of Oman (Kumar, 2011; Tageldin et al., 2014), UAE (Abutarbush, 2015), in Jordan (Abutarbush etal, 2015) and Iraq (Al-Salihi and Hassan, 2015). It affects cattle and occasionally buffaloes, it causes LSD which characterized by lachrymation and nasal discharge. Subscapular and precrural lymph nodes become markedly enlarged. High fever accompanies the appearance of highly characteristic skin lesions of 10-50 mm in diameter. The number of the lesions may vary from a few in mild cases, to multiple lesions, covering the entire body in severely infected individuals. Necrotic plaques may appear in the mucous membranes of the oral and nasal cavities, causing purulent or mucopurulent nasal discharge and excessive salivation. Painful ulcerative lesions may appear in the cornea of one or both eyes, leading to blindness in some cases. Pox lesions are found throughout the entire digestive and respiratory tracts and on the surface of almost any internal organ. Necrotic skin lesions in the legs and on top of the joints may lead to deep subcutaneous infections complicated with secondary bacterial infections and lameness. Pneumonia caused by the virus itself or secondary bacterial infection, is a common complication. Silent subclinical infections are common in the field. In experimentally infected animals approximately one third of the cattle did not show any clinical signs, although all of the infected animals became viraemic. It is transmitted by biting flies, especially during very high rainfall where its high activity. Only mechanical transmission in insects has been reported, such as in Aedes aegypti mosquitoes. The outbreak in Israel (1989) was attributed to Stomoxys calcitrans carried by wind from Ismailiya to Egypt. Recent transmission studies with ticks on animals demonstrated mechanical/intrastadial and transstadial transmission by Amblyomma hebraeum and Rhipicephalus appendiculatus adult ticks. Transovarial transmission of the virus was demonstrated in Rhipicephalus 16

decoloratus. Both intrastadial and transstadial passage of LSDV has been demonstrated in R. appendiculatus and A. hebraeum through detection of LSDV in saliva of adult ticks fed is either adult or nymphs respectively. However, transmission may also occur by direct or indirect contact, via contaminated food or water, or via artificial insemination or natural mating. The incubation period in naturally infected animals may be up to 5 weeks. but in experimentally infected animal is 6-9 days until the onset of fever (Eeva S. M. Tuppurainen et al, 2015). Subcutaneous inoculation or intradermal inoculation of cattle with LSDV results in the development of a localized swelling at the size of inoculation after 4-7 days and the enlargement of the regional lymph nodes, while generalized eruption of skin nodules usually occurs 7 to 19 days after inoculation. In experimentally infected cattle LSDV was demonstrated in saliva at least for 11 days after the development of fever, in semen for 42 days and in skin nodules for 39 days. Viraemia occurred after the initial febrile reaction and persisted for 2 weeks. Viral replication in pericytes, endothelial cells and probably other cells in blood vessel and lymph vessel walls causes vasculitis and lymphagitis in some vessels in affected areas. In severe cases infarction may result. (Coetzer et al ,2004). My recent LSDV strain (2014), mortality occurs due to the nodules developed in the mucosa of RT particulary trachea and lungs leading to suffocation. Investigated cutaneous and testicular lesions with diffuse degenerative and inflamatory changes in seminiferous tubules and blood vessels, the seminiferous tubules were devoid of primary, secondary spermatocytes and spermatids, although spermatogonia and sertoli cells are resistant, so transient infertility in bulls as the regeneration of the germinal epithelium depends mainly on the persistence of the spermatogonia and sertoli cells, although extensive fibrosis may preculde the return to fertility (Cornelius Henry Annandale et al,2006). Immunity after recovery from natural infection is life-long in most cattle; calves of immune cows acquire maternal antibody and are resistant to clinical disease for about 6 months. Microscopically, the lesions vary considerably depending on the stage of development. In the acute stage vasculitis is sometimes with concomitant thrombosis, and infarction, as well as perivascular fibroplasia and infiltration of macrophages and some lymphocytes and eosinophils in particulary the dermis and subcutis. During the acute and subacute stages of the disease eosinophilic intracytoplasmic inclusion bodies (Coetzer et al,2004).

17

18

2- AIM OF THE STUDY Between 2013-2014, outbreaks of LSDV were reported in Qaliubiya province, where animals suffered from severe signs differ from the previous outbreaks, such as suffocation and deaths, so The general objective of the pilot study was to obtain a proof of concept that there is may be a new strain of LSDV differ from the neethling strain. The objectives set for the thesis could be obtained through, For the first time, isolation and identification of LSDV was demonstrated by isolation on SPF-fertile ECE and MDBK cell line, which show new signs on inoculated egg. In addition, the presence of virus confirmed by non-serological techniques, such as TEM, haemagglutination technique, and histopathological examination, serological techniques, such as indirect fluorescence antibody technique and molecular identification by using conventional PCR, cycle sequencing, gene alignment and phylogenetic analysis.

19

20

3- LITERATURE REVIEW 3.1. History of Lumpy Skin Disease (LSD): 3.1.1. History in Egypt: Several outbreaks of LSD were reported among cattle from different governorates in Egypt. In 1988, it was appeared in Suez in June, and Ismailia in October (House et al.,1990). It was recorded also in 2006 at Beni-Suef (Tamam et al., 2006), and in early 2006 in Fayoum, Menofia and Sharquia (El-Kholy et al., 2008), Qaliubiya and Alexandria (Sohair et al., 2008), Damietta (Awadin et al., 2011). At 2008, it remerged again in different localities in Egypt (Ahmed and Kawther, 2008), (Amal et al., 2008), (Omyma, 2008). At 2010, LSDV infection was recognized and diagnosed in Egypt (Awad et al., 2010) and diagnosed among buffaloes from Qaliubiya governorate (EL Nahas et al., 2011) and at 2011 LSDV was diagnosed among cattle and buffaloes in Qaliubiya (Sharawi and Abd ElRahim, 2011), among cattle in Ismailia (EL-Kenawy and EL-Tholoth, 2011), in Monoufia and Fayoum (Abou Elyazeed, et al, 2012) and among cattle at Ismailia (Ahmed and Amina, 2013). At 2013, LSDV was identified among cattle at Ismailia (El-Haig et al., 2014) and among cattle at Qaliubiya (Aziza et al., 2015) and at July to November 2014 in Sharquia governorate (Neamat-Allah et al., 2015). 3.1.2. History in the World: LSD was recorded in Russia and countries of the former Soveit Union (Orlova et al., 2006). It was recorded also in Europe, Asia and it is endemic in most African countries and Middle East (Tuppurainen and Oura, 2012). LSD was reported affecting cattle in Europe (Kreindel et al., 2015), the Eastern Mediterranean Basin countries (Wainwright et al., 2013), and Greece, (Dilaveris, 2015). It was reported in unvaccinated cattle in Bulgaria, the Former Yugoslavian Republic of Macedonia, Turkey, Greece (OIE a and b, 2016) and Israel (Brenner et al., 2006; Stram et al., 2008; Brenner et al., 2009; Reuma Magori-Cohen et al., 2012). An outbreak of LSD among cattle in the Sultanate of Oman (Kumar, 2011; Tageldin et al., 2014), UAE (Abutarbush et al., 2015), in Jordan (Abutarbush, 2015) and Iraq (Al-Salihi and Hassan, 2015). LSD was reported in Kenya (Binepal et al., 2001) and Ethiopia (Gari et al., 2008; Gezahegn et al., 2013; Zelalem et al., 2015). LSD was also 21

reported in South Africa in recurrent outbreaks (Hunter and Wallace, 2001; Tulman et al., 2001; Chihota et al., 2001; Wallace and Viljoen, 2002; Kara et al., 2003; Chihota et al., 2003; Coetzer et al., 2004; Tuppurainen et al., 2005; Irons et al., 2005; Annandale et al., 2005; Annandale et al., 2006; Osuagwuh et al., 2006 and 2007; Annandale et al., 2010; Tuppurainen et al., 2011; Lubinga et al., 2013 and 2014; Tuppurainena et al., 2015). 3.2. Taxonomy of Lumpy Skin Disease Virus (LSDV): Poxviridae is divided into two subfamilies: poxviruses affecting insects (Entomopoxvirinae) and vertebrates (Chordopoxvirinae) and several genera. Within the Chordopoxvirinae the genus Capripoxvirus, comprises LSDV, sheep pox virus (SPPV) and goat pox virus (GTPV). The prototype of LSDV is Neethling strain which was first isolated in South Africa (Alexander et al., 1957). LSDV belongs to the family Poxviridae, subfamily Chordopoxvirinae, genus Capripoxvirus (International Committee on Taxonomy of Viruses, ICTV, 2013; Tuppurainen et al, 2015).

3.3. Structure of LSDV:

Figure (1): Morphological structure of LSDV (Haftu et al., 2012). 22

Figure (2): Diagram shows the surface structure of an unenveloped virion, whereas the other part shows the crosssection through the center of an enveloped virion. (Fenner's Veterinary virology, fourth edition, 2011).

Pox virions are brick or oval shaped with the average size of LSDV is length 294±20 nm and width 262±22 nm (Kitching and Smale, 1986). Within the virion, there are over 100 polypeptides, which are arranged in a core, two lateral bodies, an outer membrane and an envelope. The core of the virus is dumbbell-shaped and the nature of lateral bodies is unknown. The core of the viruses contains proteins that include a transcriptase and several other enzymes (Fenner et al., 2011). Poxviruses exist in the intracellular space, with or without an envelope and are

23

enveloped in the extracellular space (Fenner et al., 2011). Both forms are infectious and have the same core and genetic material. “Mature virions” (MV) (Moss, 2006) also called “intracellular mature virions” (Fenner et al., 2011) are surrounded by a single lipid membrane with irregular arrangements of tubular proteins on the surface. These are the most abundant form of the virus and are believed to be responsible of host to-host spread, Intracellular enveloped virions (IEV) (Fenner et al., 2011), more recently referred as “wrapped virions” (Moss, 2006) develop from MV, surrounded by two additional layers of membrane, originating from the trans-Golgi apparatus or endoplasmic network. While budding out, the outmost layer of wrapped virions fuses with the plasma membrane, releasing extracellular enveloped viruses (EV) (Fenner et al., 2011). All vertebrate poxviruses share a group-specific antigen (NP antigen) (Woodroofe and Fenner, 1962; Tuppurainen et al, 2015). Poxviridae comprise a diverse family of large double-stranded DNA viruses that undergo replication exclusively in the host–cell cytoplasm. Each virion contains a single linear genome that varies in length (130– 360 Kb) depending on the virus strain. The genomes are compact, with open reading frames (ORFs) being closely spaced and non-overlapping with no evidence of mRNA splicing. Although individual strains may contain more than 200 ORFs, only 50 are thought to encode proteins essential for viral transcription, DNA replication, or the formation of new virions. These ORFs cluster in the central region of the genome and are well conserved in sequence and position across different species. The remaining ORFs are more variable and tend to be distributed more towards the terminal ends of each genome that encode factors confer virulence, tissue tropism, or serve to expand host range. Poxviruses have captured host genes during their evolution in order to evade immune detection and elimination. Also, poxviruses also adapt to changes in host defense by altering their existing repertoire of factors through accumulation of point mutations, occurrence of unequal crossovers giving rise to chimeric factors, or transient genomic expansions that increase the number of targets available for mutation. Poxvirus genomes are modified in response to evolutionary pressure, several poxvirus families show signs of ORF duplication and divergence. These include: the ankyrin-repeat proteins, the serpin family, the C7L family, the kelch-like

24

proteins, and the Bcl-2-like proteins (Nelson et al., 2015). The 151-kbp LSDV genome consists of a central coding region bounded by identical 2.4 kbpinverted terminal repeats and contains 156 putative genes. Comparison of LSDV with chordopoxviruses of other genera reveals 146 conserved genes which encode proteins involved in transcription and mRNA biogenesis, nucleotide metabolism, DNA replication, protein processing, virion structure and assembly, and viral virulence and host range. In the central genomic region, LSDV genes share a high degree of collinearity and amino acid identity (average of 65%) with genes of other known mammalian poxviruses, particularly suipoxvirus, yatapoxvirus, and leporipoxviruses. In the terminal regions, collinearity is disrupted and poxvirus homologues are either absent or share a lower percentage of amino acid identity (average of 43%). Most of these differences involve genes and gene families with likely functions involving viral virulence and host range (Tulman et al., 2001). The genomes of SPPV and GTPV are very similar to that of LSDV, sharing 96% nucleotide identity within the genus Capripoxvirus (Tulman et al., 2002). However, molecular studies have demonstrated that LSDV, SPPV and GTPV are phylogenetically distinct (Tulman et al., 2001 and 2002; Tuppurainen et al., 2015).

25

Figure (3): Linear map of the LSDV genome. ORFs are numbered from left to right based on the position of the methionine initiation codon. ORFs transcribed to the right are located above the horizontal line; ORFs transcribed to the left are below. Genes with similar functions and members of gene families are colored according to the figure key. ITRs are represented as black bars below the ORF map (Tulman et al., 2001 at J. Virol. 2001; 75:7122-7130).

LSDV NW-LW isolate Neethling Warmbaths LW, complete genome sequence is 150793 bp DNA that was published on the gene bank data base (https://blast.ncbi.nlm.nih.gov/Blast.cgi) in accession number AF409137, version AF409137.1, GI:22595533 with following organized protein coding genes in the following tables.

26

Table (1): DNA replication and nucleotide metabolism genes. CDS

Codon

complement

start

LD018_R-L 11586..1202

=1

ORF

1

Product

protein_id

dUTPase

AAN02584 GI:225955

6 2

LD020_R-L 13849..1481

.1 =1

ribonucleotide reductase small

4

db_xref

51

AAN02587 GI:225955 .1

54

subunit 3

LD039_R-L 32313..3534

=1

DNA polymerase

5 4

LD066_L-R 56798..5733

.1 =1

thymidine kinase

1 5

LD077_L-R 69235..7018

AAN02607 GI:225955

AAN02634 GI:225956 .1

=1

DNA topoisomerase

8

01

AAN02645 GI:225956 .1

27

74

12

Note

6

LD082_L-R 74375..7503

=1

1 7

LD083_L-R 75074..7743

uracil DNA glycosylase

=1

putative NTPase

4

AAN02650 GI:225956 .1

17

AAN02651 GI:225956 similar to vaccinia .1

18

virus strain Copenhagen D5R

8

LD112_L-R 103931..105

=1

putative DNA polymerase

223


48

processivity factor 9

LD133_L-R 120352..122

=1

031 10 LD139_L-R 131627..132 544

DNA ligase-like protein

=1

putative Ser/Thr protein kinase

virus strain Copenhagen A20R

AAN02701 GI:225956 .1

68


74

virus strain Copenhagen B1R

28

Table (2): RNA transcription and modification genes. ORF

1

LD032_R

CDS

Codon

complement

start

23753..25177

=1

-L

Product

protein_id

poly(A) polymerase large subunit

db_xref

note

AAN02600 GI:225955 similar to vaccinia virus .1

67

strain Copenhagen E1L, PAPL

2

LD036_R

27988..28593

=1

-L

RNA polymerase subunit


70

strain Copenhagen E4L, RPO30

3

LD049_L- 42985..45015

=1

putative RNA helicase AAN02617 GI:225955 similar to vaccinia virus

R

.1

84

strain Copenhagen I8R, NPH-II

4

LD051_L- 47125..47793 R

=1

putative transcriptional elongation factor 29


87

strain Copenhagen G2R

5

LD055_L- 49454..49645

=1

R



90

strain Copenhagen G5.5R, RPO7

6

LD058_L- 51334..52116

=1

R

putative late transcription factor


93

strain Copenhagen G8R , VLTF-1

7

LD068_L- 58056..59057

=1

R

poly(A) polymerase small subunit


03

strain Copenhagen J3R, PAPS

8

LD069_L- 58972..59529

=1

R



04

strain Copenhagen J4R , RPO22

9

LD071_L- 60022..63879 R

=1



06

strain Copenhagen J6R , RPO147

30

10 LD075_R

65982..68378

=1

-L

RNA polymeraseassociated protein


10

strain Copenhagen H4L , RAP94

11 LD076_L- 68522..69193

=1

R



11

strain Copenhagen H5R , VLTF-4

12 LD079_L- 70682..73210

=1

R

ORF

CDS

Codon

complement

start

mRNA capping

AAN02647 GI:225956 similar to vaccinia virus

enzyme large subunit

.1

14

Product

protein_id

db_xref

31

strain Copenhagen D1R

note

13 LD084_L- 77431..79338

=1

putative early transcription factor

R

AAN02652 GI:225956 .1

19

small subunit 14 LD085_L- 79363..79854

=1

R


similar to vaccinia virus strain Copenhagen D6R , VETFS

AAN02653 GI:225956 .1

20

similar to vaccinia virus strain Copenhagen D7R , RPO18 "

15 LD087_L- 80536..81297

=1

multi motif protein

R

AAN02655 GI:225956 putative gene expression .1

22

regulator; similar to vaccinia virus strain CopenhagenD10R

16 LD088_R

81303..83210

=1

-L

putative transcription AAN02656 GI:225956 termination factor

.1

23

similar to vaccinia virus strain Copenhagen D11L , NPH-I

17 LD089_R -L

83237..84100

=1

mRNA capping enzyme small subunit

32


24

strain Copenhagen D12L

18 LD091_R

85816..86268

=1

-L



26

strain Copenhagen A1L , VLTF-2

19 LD092_R

86298..86996

=1

-L



27

strain Copenhagen A2L , VLTF-3

20 LD096_L- 89865..90377

=1

R



31

strain Copenhagen A5R , RPO19

21 LD098_R

91522..93666

=1

putative early transcription factor

-L


33

large subunit 22 LD099_L- 93723..94595 R

=1

strain Copenhagen A7L , VETFL

putative intermediate AAN02667 GI:225956 similar to vaccinia virus transcription factor subunit 33

.1

34

strain Copenhagen A8R , VITF-3

23 LD110_L- 101937..1033 R

=1

putative DNA helicase AAN02678 GI:225956 similar to vaccinia virus transcriptional

79

.1

45

strain Copenhagen A18R

elongation factor 24 LD115_L- 105723..1068 R

=1

putative intermediate AAN02683 GI:225956 similar to vaccinia virus transcription factor

80

.1

50

strain Copenhagen A23R

subunit 25 LD116_L- 106911..1103 R

=1

81



51

strain Copenhagen A24R , RPO132

26 LD119_R -L

111265..1121 76

=1



54

strain Copenhagen A29L , RPO35

34

Table (3): structure and assembly genes ORF

CDS

Codo

complement

n

Product

protein_id

db_xref

note

Start 1

LD025_R- 16655..17998

=1

L 2

protein kinase

LD027_R- 18951..20867

=1

L 3

putative Ser/Thr

putative EEV maturation protein

LD028_R- 20874..21986

=1

.1

59

AAN02595 GI:225955 .1

62

putative palmitylated AAN02596 GI:225955 virion envelope

L

AAN02592 GI:225955

.1

63

similar to vaccinia virus strain Copenhagen F10L similar to vaccinia virus strain Copenhagen F12L similar to vaccinia virus strain Copenhagen F13L

protein 4

LD031_LR

23435..23749

=1 putative DNA-binding AAN02599 GI:225955 virion core phosphoprotein 35

.1

66

similar to vaccinia virus strain Copenhagen F17L

5

LD040_L-

35379..35666

=1

R

6

LD041_R- 35663..36055

LD043_R- 38202..39146

AAN02608 GI:225955

protein

=1

L

7

putative redox

.1

putative virion core protein

=1

76

AAN02611 GI:225955

binding virion core

L

AAN02609 GI:225955 .1

putative DNA-

75

.1

78

similar to vaccinia virus strain Copenhagen E10R

similar to vaccinia virus strain Copenhagen E11L

similar to vaccinia virus strain Copenhagen I1L

protein 8

LD046_R- 40247..40483

=1

hypothetical protein

L 9

LD048_R- 41678..42979 L

AAN02614 GI:225955 .1

=1


AAN02616 GI:225955 .1

36

81

83

similar to vaccinia virus strain Copenhagen I7L

10 LD050_R- 45012..46802

=1

L

putative

AAN02618 GI:225955

metalloprotease

11 LD053_R- 47757..48137

=1

.1

putative glutaredoxin AAN02621 GI:225955

L

.1

12 LD057_R- 50183..51304

=1

L 13 LD060_L-


53154..53891

=1

88

AAN02625 GI:225955 .1

92

putative myristylated AAN02628 GI:225955 IMV envelope

R

85

.1

95

similar to vaccinia virus strain Copenhagen G1L

similar to vaccinia virus strain Copenhagen G4L similar to vaccinia virus strain Copenhagen G7L similar to vaccinia virus strain Copenhagen L1R

protein 14 LD063_LR

55198..55959

=1

putative DNA-

AAN02631 GI:225955

binding virion core protein

.1

98

similar to vaccinia virus strain Copenhagen L4R ,VP8

37

ORF

CDS

Codo

complement

n

Product

protein_id

db_xref

note

start 15 LD072_R- 63884..64399

=1

L

putative proteintyrosine phosphatase

16 LD074_R- 64984..65952

=1

L

putative IMV

AAN02640 GI:225956 .1

07

AAN02642 GI:225956

envelope protein

.1

09

similar to vaccinia virus strain Copenhagen H1L

similar to vaccinia virus strain Copenhagen H3L, p35

17 LD080_R- 73172..73639

=1

L 18 LD081_L-

protein 73641..74378

=1

R 19 LD090_R- 84140..85789 L

putative virion

.1

putative virion protein

=1

AAN02648 GI:225956

AAN02649 GI:225956 .1

putative rifampicin resistance protein 38

15

16

AAN02658 GI:225956 .1

25

similar to vaccinia virus strain Copenhagen D2L similar to vaccinia virus strain Copenhagen D3R similar to vaccinia virus strain Copenhagen D13L

20 LD094_R- 87229..89214

=1

L

putative virion core

AAN02662 GI:225956

protein

.1

29

similar to vaccinia virus strain Copenhagen A3L , P4b

21 LD095_R- 89339..89824

=1

L

22 LD100_R- 94619..94855

AAN02663 GI:225956

protein

=1

L 23 LD101_R- 94856..97570


.1

putative IMV

AAN02668 GI:225956

membrane protein =1

L

30

.1


35

AAN02669 GI:225956

protein

.1

36

similar to vaccinia virus strain Copenhagen A4L

similar to vaccinia virus strain Copenhagen A9L similar to vaccinia virus strain Copenhagen A 10L, P4a

24 LD103_R- 98535..99107 L

=1


AAN02671 GI:225956

protein

.1

39

38


25 LD104_R- 99172..99375

=1

L

AAN02672 GI:225956

membrane protein

26 LD105_R- 99457..99744

=1

L

putative IMV

=1

Putative

39

.1

40

AAN02677 GI:225956

phosphorylated IMV

22

.1

AAN02673 GI:225956

membrane protein

27 LD109_R- 101332..1019 L

putative IMV

.1

44




membrane protein 28 LD117_R- 110395..1108 L

41

=1

putative fusion

AAN02685 GI:225956

protein

.1

40

52


ORF

CDS

Codo

complement

n start

29 LD121_R- 112548..1133 L

30 LD122_LR

31 LD123_LR

32 LD126_LR

=1

12

113444..1140

=1

AAN02689 GI:225956

putative DNA

putative EEV

.1

putative EEV protein

82

116147..1166 92

.1

putative EEV

57

AAN02691 GI:225956 .1

=1

56

AAN02690 GI:225956

glycoprotein

=1

db_xref

note

Product

packaging protein

34

114067..1145

protein_id

58

AAN02694 GI:225956

glycoprotein

.1

41

61


similar to vaccinia virus strain Copenhagen A33R



33 LD141_LR

133347..1340

=1

21

putative EEV host range protein

AAN02709 GI:225956 .1

similar to vaccinia virus

76

strain Copenhagen B5R

db_xref

NOTE

Table (4): Viral virulence and host range genes ORF

1

LD003_R-

CDS

Codon

complement

start

1433..2155

=1

Product

putative ERlocalized apoptosis

L

protein_id

AAN02569 GI:225955 .1

36

regulator 2

LD005_L-

2450..2962

=1

R 3

LD006_RL

interleukin-10like protein

2973..3668

=1

interleukin-1 receptor-like protein 42

similar to myxoma virus M004; similar to ORF LD154

AAN02571 GI:225955 .1

38

AAN02572 GI:225955 .1

39

4

LD008_R-

4841..5668

=1

putative soluble interferon gamma

L

AAN02574 GI:225955 .1

41

receptor 5

LD010_R-

6445..6933

=1

L 6

LD011_R-

LAP/PHD-finger protein

6978..8111

=1

receptor-like

L

43

AAN02577 GI:225955 .1

44

protein 7

LD013a_R

8932..9918

=1

similar to GenBank Accession Number S78201

interleukin-1 receptor-like

-L

M007

AAN02576 GI:225955 .1

CC chemokine

similar to myxoma virus

AAN02579 GI:225955 .1

46

LD013a differs from LSDV013 due to a frameshift at the C-

protein

terminus end producing a stop 8

LD014_RL

9978..10247

=1

putative eIF2 alpha-like PKR inhibitor 43

AAN02580 GI:225955 .1

47

similar to vaccinia virus strain Copenhagen K3L

9

LD015_R- 10234..10719

=1

putative

AAN02581 GI:225955

interleukin-18

L

.1

48

binding protein 10 LD016_R- 10757..11026

=1

L 11 LD017_R- 11017..11547

EGF-like growth factor

=1

L

AAN02582 GI:225955 .1

putative integral membrane protein

49

AAN02583 GI:225955 .1

50

apoptosis regulator; similar to myxoma virus M011L

12 LD034_R- 27393..27926

=1

L 13 LD067_L- 57404..57997 R

putative PKR inhibitor

=1

AAN02602 GI:225955 .1

putative host range protein

44

69

AAN02635 GI:225956 .1

02

similar to vaccinia virus strain Copenhagen E3L similar to vaccinia virus strain Copenhagen C7L

ORF

CDS

Codon

complement

start

14 LD128_R- 117528..1184 L

R

protein_id

.1 =1

superoxide dismutase -like

57

db_xref

NOTE

CD47-like protein AAN02696 GI:225956

33

LD131_L- 119272..1197 15

=1

Product

63

AAN02699 GI:225956 .1

66

protein

16 LD135_L- 128334..1294 R

=1

putative IFN-alpha AAN02703 GI:225956 /beta binding

16

.1

70

protein 17 LD138_L- 131028..1315 R

88

=1

Ig domain OX-2like protein

45

AAN02706 GI:225956 .1

73

similar to vaccinia virus strain Copenhagen B19R

18 LD140_L- 132576..1332 R

=1

putative RING finger host range

98

AAN02708 GI:225956 .1

75

similar to rabbit fibroma virus N1R

protein 19 LD142_L- 134023..1344 R

27

20 LD143_L- 134464..1353 R

R

=1

tyrosine protein kinase-like protein

=1

05

22 LD149_L- 143480..1444

putative secreted virulence factor

72

21 LD146_L- 139264..1405 R

=1

phospholipase Dlike protein

=1

AAN02710 GI:225956 .1

77

.1

78

AAN02714 GI:225956 81

serpin-like protein AAN02717 GI:225956 .1

46

strain Copenhagen N1L

AAN02711 GI:225956

.1

93


84

similar to vaccinia virus strain Copenhagen K4L

23 LD154_L- 148639..1493 R

=1

putative ER-

AAN02722 GI:225956

localized apoptosis

61

.1

similar to myxoma virus

89

M004; similar to LD003

db_xref

note

regulator

Table (5): Major gene families 1-ANKYRIN REPEAT ORF

CDS complement Codon

Product

protein_id

Start 1 LD012_R-

8218..8853

=1

L 2 LD145_L- 137231..139135

R

AAN02578.1 GI:22595545

protein =1

R 3 LD147_L- 140572..142068

ankyrin repeat

No. S78201

ankyrin repeat

AAN02713.1 GI:22595680

protein =1

similar to GenBank Acc.

ankyrin repeat protein

47

AAN02715.1 GI:22595682

4 LD148_L- 142116..143459

ankyrin repeat

=1

R

AAN02716.1 GI:22595683

protein

5 LD152_L- 146780..148249

ankyrin repeat

=1

R

AAN02720.1 GI:22595687

protein

2-KELCH LIKE ORF


Product

protein_id

db_xref

note

start 1

LD019a_R-

12073..12945

=1

L

kelch-like

AAN02585.1 GI:22595552

LD019a and LD019b appear to be a

protein

frameshifted homolog of LSDV019 2

LD019b

12972..13784

=1

kelch-like

AAN02586.1 GI:22595553

LD019a and LD019b appear to be a

protein 48

frameshifted homolog of LSDV019 3

LD144_L-R 135541..137193

=1

kelch-like

AAN02712.1 GI:22595679

protein 4

LD151_L-R 145059..146714

=1

kelch-like

AAN02719.1 GI:22595686

protein

3-A52R LIKE ORF


Product

protein_id

db_xref

note

Start 1 LD001_R-

238..717

=1

L 2 LD009_RL

hypothetical

AAN02567.1 GI:22595534

similar to ORF LD156

AAN02575.1 GI:22595542


protein 5701..6393

=1

putative alpha amanitin-sensitive protein 49

strain Copenhagen N2L

3 LD136_L- 129464..129925

=1

R 4 LD150_L- 144532..145017

R

AAN02704.1 GI:22595671

protein =1

R 5 LD156_L- 150077..150556

hypothetical

hypothetical AAN02718.1 GI:22595685 protein

=1

hypothetical AAN02724.1 GI:22595691 protein

50

similar to LD001

3.4. Antigenic characters and relationships of LSDV: All isolates of LSDV from collected a large number of samples from active cases in South Africa, Kenya and Malawi were belonged to Poxviridae (Prydie and Coackley, 1959; Weiss 1962 and 1966). They were antigenically similar and showed complete reciprocal cross-neutralization with the "Neethling" prototype strain. Complete cross-immunity between the South African "Neethling" virus and the Londiani strain, isolated in Kenya, has also been demonstrated (Prydie and Coackley, 1959). There is only one immunological type of LSDV responsible for true LSD. Antigenic relationship of LSDV to sheep pox was investigated. Cattle inoculated intradermally with sheep pox virus (Isiolo strain) isolated from sheep showing lesions of sheep pox, developed lesions indistinguishable from those of LSD and acquired immunity to challenge with LSDV (Capstick, 1959). It was thought that true sheep pox virus did not protect cattle as well against LSD because sheep pox virus (Isiolo strain) showed a closer relationship to goat pox virus (Andrewes, 1964). Later on, the immunological relationship of LSDV to sheep pox virus was further substantiated and it could be concluded that cattle could be protected against LSD by vaccination with a strain of sheep pox virus grown in tissue culture (Weiss et al,1968). 3.5. Resistance of LSDV to physical and chemical agents: LSDV was remarkably stable between pH 6.6 and 8.6 and showed no significant reduction in titer after exposure for 5 days at 37°C within the pH range mentioned above. The virus was readily inactivated by the detergent sodiumdodecyl-sulphate, chloroform and ether suggesting that lipid is incorporated in the structure of the virus (Plowright and Ferris, 1959; Weiss, 1959). In the skin lesions of infected animals, the virus can persist for at least 33 days even though the necrotic portions of skin have become completely dried out prior to sequestration. It has also been shown that the virus remained viable for 18 days in the lesions and superficial epidermal scrapings from such lesions in airdried portions of hide kept at room temperature (Alexander and Weiss, 1959). The virus was also recovered from intact skin nodules kept at -80°C for 10 years (Weiss, 1967), and from infected tissue culture fluid kept at 4°C for 6 months (Alexander and Weiss, 1959). Virus in tissue culture fluid has remained viable for at least 10 years under dry-ice refrigeration (Weiss, 1967). This is contrary to the report by 51

HAIG (1957) that prolonged storage of preparations of lumpy skin disease virus under dry-ice refrigeration reduced the infectivity (Weiss et al, 1968). 3.6. Biological properties of LSDV: 3.6.1. Replication in the host cell: There are three main stages in the poxvirus multiplication cycle (Roberts and Smith, 2008) including: 1) Virus attachment to host cell membrane and release of the poxvirus core. 2) Viral DNA replication and transcription of viral genes. 3) Assembly of infectious viral particles then release via budding or cell lysing. Entry of mature non-enveloped LSDV into the host cell occurs by micropinocytosis triggered by the viral surface protein phosphatidylserine and the receptors for the poxvirus thought to be Glycosaminoglycans (GAGs), (Haftu, 2012). Initiation of the process requires activation of the cellular p21-activated kinase1 (PAK-1) by the virus (Mercer and Helenius, 2008). In contrast, enveloped virus enters the host cell by endocytosis. Inside the endocytic vesicle the envelope is lysed, releasing mature virion (MV). The core of the virus is then released into the cytoplasm of the host cell by the fusion of the outer membrane of MV with the vesicle membrane (Fenner et al., 1987; Moss, 2006; Tuppurainen et al., 2015). After entry of the poxvirus core to the host cell, the infection process is initiated, poxvirus core (contains structural proteins, a linear double-stranded DNA genome and the enzymes required for early gene regulation) is transported along microtubules deeper into the cytoplasm (Gemma et al., 2003). Cores accumulate of the poxvirus cores in the perinuclear regions of the cell, forming viral factories, where transcription of viral early mRNAs occurs using the virus associated DNA-dependent RNA polymerase. The stages of the initiated replication process are determined by the three groups of poxvirus genes; early, intermediate and late. Expression of early gene occurs within 2hour post-infection where early gene products function mainly to modify the host cell environment and aid in viral escape from host immune responses (Carroll and Moss, 1997). Early gene expression is followed by poxvirus DNA replication. During DNA replication, intermediate gene expression occurs. Intermediate genes are fewer in number compared to early genes and their main function is to regulate the 52

expression of late genes. Late genes, in turn, generally encode final stage structural proteins responsible for virion formation, enzymes and transcription factors required for the next round of replication. Following late gene expression, a crescent shaped structure is formed (crescent structure consists of a host derived single layer lipid membrane and viral proteins) which marks the early stages of virion formation (Rosel et al., 1986). The infectious poxvirus occurs in four distinct forms (Richard et al., 2006): 1- Intracellular mature virus (IMV), non-enveloped and makes up the majority of virus particles. 2- Intracellular enveloped virus (IEV). 3- Cell-associated extracellular virus (CEV), enveloped. 4- Extracellular mature virus (EMV), non-enveloped. During early morphogenesis viral crescents grow to form spherical shapes that encapsulate the virus core components to form immature virions (IV). These IVs then mature into infectious brick shaped IMV through the proteolytic cleavage of core proteins. IMV is the first infectious form of the virus to occur and is encapsulated in a single lipid membrane. This form of the virus remains within the host cell until the cell lyses. Small subsets of IMV particles are enveloped by host cellular membranes (derived from endosomes or the Golgi network) to form IEVs. IEVs are transported along microtubules from the viral factories toward the periphery of cells. Here at the outer membrane of the host cell the outer membrane of IEVs fuse with the plasma host membrane. The virus may remain associated with the extracellular cell surface forming CEV which makes use of cellular actin filaments to aid in cell to cell viral transmission. Particles are also released from the cell surface forming EMVs which are thought to aid in long range transmission of the virus. The wrapping of viral particles in host membrane aid in viral evasion of the host immune response. The IMV and EMV disseminate through the host (Smith et al., 2002).

53

Figure (4): An overview of poxvirus multiplication including entry of EEV into host cell, membrane attachment and fusion of the IMV membrane with the host membrane, formation of viral factories, synthesis of crescent membranes are synthesized enclosing viral DNA and proteins to form circular immature virion (IV), formation of brick shaped intracellular mature virus (IMV), formation of the intracellular enveloped virus (IEV) by wrapping of IMV in Golgi membrane, finally IEV released as extracellular enveloped virus (EEV) through exocytosis but cell-associated enveloped virus (CEV) forms actin tails aid in cell to cell transmission of the virus (Smith et al., 2002). A hallmark of the acute to subacute stages of the lesions was the presence of intracytoplasmic eosinophilic inclusions in various cell types. The inclusions consisted of the viroplasm which was identified as aggregates of electron-dense, finely granular to fibrillar deposits in which membrane enclosed virions and occasional groups of tubular structures were observed. (Prozesky L, Barnard BJ., 1982).

54

3.6.2. Propagation in vitro: LSDV could be inoculated into rabbits causing generalized skin lesions (Alexander et al., 1957). The virus can also be propagated in the chorioallantoic membranes (CAM) of embryonated chicken eggs aged 9–12 days, causing macroscopic pock lesions (Alexander et al., 1957; Van Rooyen et al., 1969; House et al., 1990; Omyma et al., 2008; Sohair et al., 2008; Sharawi and Abd El-Rahim, 2011; EL-Kenawy et al., 2011; El-Nahas et al., 2011; Abou Elyazeed, et al., 2012). Capripoxviruses grow slowly in cell cultures and may require several passages. They grow on a wide variety of bovine and ovine cells, causing easily recognizable cytopathic effects (CPE) on cell monolayers (Alexander et al., 1957, Munz and Owen, 1966, Prydie and Coackley, 1959). Microscopic examination of LSDV infected monolayers, stained with haematoxylin eosin or haematoxylin-phloxin, showed that cytopathic changes are accompanied by the development of intracytoplasmic inclusion (Thomas and Mare, 1945). In tissue cultures, these inclusions at first appear as small round basophilic bodies surrounded by a halo. As they increase in size, they become more acidophilic and some inclusions appear to have basophilic "inner bodies", which have been shown to consist of cytoplasmic RNA by histochemical staining methods (Weiss and Broekman, 1965). Some inclusion bodies are round and others have an irregular outline and show small protuberances at their margins. LSDV could be cultured in a variety of cell cultures including lamb and calf kidney cells, calf testis cells, sheep kidney cells, lamb and or calf adrenal or thyroid cultures, foetal lamb and calf muscle cells, sheep embryonic kidney or lung cells, rabbit foetal kidney or skin cells, chicken embryo fibroblasts, adult vervet monkey kidney cell line (AVK 58), equine lung and baby hamster kidney cells (BHK/21) (Alexander et al., 1957; Prydie and Coackley, 1959; Weiss, 1968). Primary lamb testis (LT), bovine dermis cells and commercially available LT cell line were the most commonly used cells for the propagation of LSDV (Babiuk et al., 2007). 55

LSDV was adapted to multiply on VERO cells with CPE appeared after the third passage characterized by granulation of cells followed by cell rounding and aggregated together in a separate manner 4- 5days post inoculation (Rizkallah, 1994; Mangana- Vougiouka et al., 2000; Amal, et al., 2008). Cultivation of the virus was tried on MDBK cell line cultivated in Minimal Essential Media (MEM) supplemented with fetal calf serum and gentamycin (ElNahas et al,2011; Abou Elyazeed, et al., 2012). 3.7. Pathogenesis and Histopathology of LSDV: Subcutaneous inoculation or intradermal inoculation of cattle with LSDV results in the development of a localized swelling at the size of inoculation after four to seven days and the enlargement of the regional lymph nodes, while generalized eruption of skin nodules usually occurs seven to 19 days after inoculation. In experimentally infected cattle LSDV was demonstrated in saliva at least for 11 days after the development of fever, in semen for 42 or 22 days and in skin nodules for 39 or 33 days, but not in urine or faeces. Viraemia occurred after the initial febrile reaction and persisted for two weeks. A variety of cell types, including epithelial and endothelial cells, pericytes and fibroblasts are infected by the virus. Viral replication in pericytes, endothelial cells and probably other cells in blood vessel and lymph vessel walls causes vasculitis and lymphangitis in some vessels in affected areas. In severe cases infarction may result. Lumpy skin disease virus is present in skin nodules, normal skin, lymph nodes, liver, kidneys, skeletal muscle, saliva and semen of infected animals. Viral concentrations at the above sites, however, have not been determined (Coetzer et al,2004). After skin inoculation, virus replicates in epidermis and dermis, Infecting macrophages in regional lymph nodes for further replication, Resulting in enlargement of the regional lymph nodes, e.g. prescapular and prefemural lymph nodes. Macrophage associated viraemia , then further viral multiplication in many different organs including the liver, spleen, lung then secondary viraemia ,disseminating the virus to various tissues, skin and endothelium, Damaged endothelium results in vasculitis, thrombosis, marked dermal edema, infarction, Nodules are circumscribed, round, slightly raised, firm and painful and involve the entire skin and the mucosa of the GIT, RT, genital tract, developing inverted conical necrosis called the “sit fast”. Secondary bacterial infections develop in the necrotic cores of the nodules. Metastatic abscesses in the regional lymph nodes, lungs and other organs. Mortality is due to secondary infection. Poxviruses are generally 56

epitheliotrophic and can cause localized or systemic disease. Initial multiplication of the virus occurs at the entry site of the virus into the body. In systemic infections, further viral replication takes place in the draining lymph nodes, followed by viraemia and further viral multiplication in many different organs including the liver, spleen and lungs (Fenner et al. 1987). The later multiplication leads to establishment of secondary viraemia and subsequent infection and development of disseminated focal lesions in the skin. Viral replication takes place in the cytoplasm of cells. Viral particles are enveloped when mature virus particles move to the Golgi complex; most particles are however non- enveloped and are released by cell disruption. Both enveloped and non- enveloped particles are infectious (Fenner et al.1987). The earliest description Thomas and Mare (1945) highlighted the histological changes. Their findings were confirmed to a large extent by Prozesky and Barnard (1982) who found that LSDV exerts its pathogenic effects by infiltrating a variety of cell types, including epithelial and endothelial cells, pericytes and fibroblasts, resulting in lymphangitis and vasculitis. The later report highlighted the difference in histological changes asssociated with acute or chronic lesions. During the acute stage vasculitis and lymphangitis with concomitant thrombosis and infarction resulted in oedema and necrosis (Prozesky and Barnard 1982). The lesions were initially infiltrated by neutrophils and macrophages, and later on these cells were replaced by lymphocytes, plasma cells and macrophages as well as fibroblasts (Prozesky and Barnard 1982). Coagulation necrosis is the result of thrombi in the blood vessels. It seems not to be determined whether a single cell type is responsible for the spread of LSDV around the body and its localization in various organs. Nagi (1990) investigated cutanaeous and testicular lesions in an outbreak of LSD in Egypt 1989. It was noted that diffuse degenerative and inflamatory changes could be observed in the seminiferous tubules and blood vessels. The seminiferous tubules were devoid of primary and secondary spermatocytes and spermatids, although the spermatogonia and Sertoli cells appeared resistant. The author speculated that the possible infertility due to LSDV infection may be transient as the regeneration of the germinal epithelium depends mainly upon the persistence of the spermatogonia and Sertoli cells, although extensive fibrosis may preclude the return of fertility. (Cornelius Henry Annandale,2006). Microscopic examination of histological sections of the skin lesions of animals suffering from LSDV infection showed the development of intracytoplasmic inclusion (De Lange, 1959; Prydie and Coackley, 1959; Burdin, 1959).

57

Cells may contain one to several inclusion bodies of varying sizes. Affected cells become rounded and shrunken, the cytoplasm becomes intensely eosinophilic and the nuclei show degenerative changes consisting of margination of chromatin, juxtaposition of the nucleoli to the nuclear membrane, and eventual pyknosis and distortion (De Lange, 1959; Prydie and Coackley, 1959; Weiss et al, 1968). 3.8. Laboratory Diagnosis of LSDV: 3.8.1. Sampling of LSDV: The most suitable specimens for LSDV isolation collected as biopsy or at post-mortem include skin nodules, lung lesions, lymph nodes, buffy coat, semen from suspected animals (Davies, 1971; Tuppurainen, 2005; OIE, 2010), and milk, (S.S.A. Sharawi & I.H.A. Abd El-Rahim, 2011). For transportation of the viral samples over long distances, 50% glycerol saline as a viral transport medium was added to tissue samples kept on ice tanks. For storage of these tissue samples used for LSDV isolation, they should be kept at – 20°C (OIE, 2010). 3.8.2. Isolation of LSDV: 3.8.2.1. Isolation of LSDV on Specific Pathogen Free- Embryonated Chicken Eggs (SPF-ECEs): LSDV could be propagated in the chorioallantoic membranes (CAM) of 9 11 day old embryonated chicken eggs (ECEs) (Alexander et al., 1957). The supernatant fluid from the ground skin lesions of LSDV infected cattle was inoculated as 0.1 - 0.2 ml from the prepared samples via CAM, by drop membrane method (Van Rooyen et al., 1969; and House et al., 1990). Successful isolation of LSDV from prepared samples on CAM showed specific typical pock lesion on CAMs harvested 4days post inoculation (Omyma et al., 2008; Sohair et al., 2008), thickening and congestion (Tuppurainen et al., 2015). Isolation of LSDV from buffaloes revealed the characteristic pock lesion on CAM of ECE as numerous, small, scattered white foci (El-Nahas et al., 2011). Examination of CAMs from ECEs inoculated with LSDV from cattle showed small hemorrhagic areas at site of inoculation at day one post inoculation

58

(PI) considered as nonspecific, thickening, congestion and hemorrhage at day 3 PI, white and opaque area around site of inoculation at day 4 PI, this white and opaque area increase in size at day 5 PI and opaque pin point pock lesions arranged in streaks at day 6 PI but that of control non inoculated eggs showed no gross lesions (El-Kenawy et al., 2011). LSDV could be grown on embryonated chicken eggs of 7 – 9 days old embryos with maximum yield of the virus was obtained from CAM of infected eggs incubated at 33.5°C and 35°C for 5 – 6 days (Sharawi and Abd El-Rahim, 2011). Isolation of LSDV via CAM of ECES aged 9 days was tried and eggs incubated at 37ºC were examined by trans-illumination once or twice a day to determine the time of death. In the same time, sample eggs were opened at different times after inoculation, and the membranes, as well as the embryos, carefully examined for macroscopic pock lesions (Abou Elyazeed et al., 2012). 3.8.2.2. Isolation of LSDV on cell culture: Capripoxviruses grow slowly in cell cultures and may require several passages. They grow on a wide variety of bovine and ovine cells, causing easily recognizable cytopathic effects (CPE) on cell monolayers (Alexander et al., 1957; Prydie and Coackley, 1959; Munz and Owen, 1966). In addition, LSDV could be cultured in lamb and calf kidney cells, calf testis cells, sheep kidney cells, lamb and or calf adrenal or thyroid cultures, foetal lamb and calf muscle cells, sheep embryonic kidney or lung cells, rabbit foetal kidney or skin cells, chicken embryo fibroblasts, adult vervet monkey kidney cell line (AVK 58), equine lung and baby hamster kidney cells (BHK/21) (Alexander et al., 1957, Prydie and Coackley, 1959, Weiss, 1968). Primary lamb testis (LT) and bovine dermis cells, or a commercially available LT cell line were the most commonly used cells for the propagation of LSDV (Babiuk et al., 2007). Madin Darby bovine kidney (MDBK) cell line was used for LSDV isolation. Infected cells develop a characteristic CPE consisting of retraction of the cell membrane from surrounding cells, and eventually rounding of cells and margination of the nuclear chromatin (OIE, 2010; Abou Elyazeed et al., 2012).

59

prominent CPE on MDBK cells started from third day post inoculation until complete destruction of cell sheet. Characteristic CPE of LSDV in the form of clusters of cell rounding, cell aggregations and vacuoles then cell beginning of detachment. (El-Nahas et al,2011). LSDV could be isolated on VERO cell culture (Mangana- Vougiouka et al., 2000). LSDV was adapted on VERO cells and gave CPE after 3 successive passages with the CPE appeared as granulation of cells, cell rounding and aggregation at 4 – 5 days post inoculation (Rizkallah, 1994; Amal et al., 2008).

3.8.3. Identification of LSDV: 3.8.3.1. Non-Serological Techniques: 3.8.3.1.1. Transmission electron microscopy: For electron microscopic diagnosis of LSDV, preparation and negative staining of skin specimens were made (Tuppurainen et al., 2005). Semithin sections were carried out by fixing in 5%, glutaraldehyde then possessed for sectioning by ultra-microtome in thickness of 1micron. The sections were stained by Toluidine blue (Bancroft et al., 1990; Salib and Osman, 2011). Ultra-thin sections from skin nodules and CAM of ECE was stained with uranyl acetate and lead citrate then examined using electron microscope (Bozzala and Russell, 1992; Sohair et al., 2008). Electron microscopic examination determined LSDV size to range from 300 - 350 nm with crescent or ovoid shape (Madbouly et al., 2005; Ahmed and Kawther, 2008). Transmission electron microscope showed that capripox virion was brick shaped, covered in short tubular elements and measures approximately 290 × 270 nm. A host-cell-derived membrane may surround some of the virions, and as many as possible should be examined to confirm their appearance (Kitching and Smale, 1986; OIE, 2010; Haftu, 2012). Ultrastructurally, LSDV appeared as large cuboidal virus particles were found in both skin lesion and inoculated CAM. (Abou Elyazeed et al., 2012). Prepared suspensions of skin specimens from infected animals were stained with 3% phosphotungstic acid for electron microscopic examination. The viral particles appeared by negative staining roughly brick shaped particles with ridges covering them. (OIE, 2004; Tuppurainen, 2004; Omyma, 2008; El-Nahas et al., 60

2011; Tageldin et al., 2014), ovoid in shape, with rounded ends and characteristic ball of wool appearance (Aziza et al., 2015). 3.8.3.1.2. Histopathological Examination: Microscopic examination of stained sections of excised skin lesions and infected monolayers (Thomas and Mare, 1945) showed the characteristic histopathological changes and intracytoplasmic inclusion bodies associated with infection by LSDV (De Lange, 1959; Prydie and Coackley, 1959; Burdin, 1959). Lymphocytes, macrophages, plasma cells and fibroblast proliferation appear in the later stages, and if secondary infection occurs, polymorphonuclear leukocytes and red cells are seen (Thomas and Mare, 1945; Burdin, 1959). In tissue cultures, these inclusions at first appear as small round basophilic bodies surrounded by a halo. As they increase in size, they become more acidophilic and some inclusions appear to have basophilic "inner bodies", which have been shown to consist of cytoplasmic RNA by histochemical staining methods (Weiss and Broekman, 1965). Some inclusion bodies are round and others have an irregular outline and show small protuberances at their margins. Cells may contain one to several inclusion bodies of varying sizes. Affected cells become rounded and shrunken, the cytoplasm becomes intensely eosinophilic and the nuclei show degenerative changes consisting of margination of chromatin, juxtaposition of the nucleoli to the nuclear membrane, and eventual pyknosis and distortion (De Lange, 1959; Prydie and Coackley, 1959; Weiss et al, 1968). Intracytoplasmic inclusions were seen in cells stained with haematoxylin eosin (Nawathae et al., 1978). Histologically, skin lesions in the acute stage characterized by vasculitis, perivasculitis, lymphangitis, thrombosis, oedema, necrosis and infarction. (Thomas and Mare, 1945; Prozesky and Barnard, 1982). There was cuffing of blood vessels by leukocytes, and eosinophilic, intracytoplasmic pox inclusion bodies may be seen in the epithelioid cells, and cells of hair follicles, smooth muscle, and skin gland (Thomas and Mare, 1945; Burdin, 1959, Prozesky and Barnard 1982). Biopsies and tissues obtained at necropsy obtained from skin of the lower lip and chin showed acanthosis, including elongation of rete-ridges. The acanthotic skin and hair follicles had locally extensive epidermal necrosis with ballooning degeneration coalescing into multiple 61

intraepithelial or subcorneal microvesicles with acantholysis. The microvesicles coalesced to form larger vesicles. Individual cells in the epithelium were necrotic, and some epithelial cells had vacuolated nuclei and a round to oval eosinophilic intracytoplasmic inclusion body. These latter cells, known as “pox cells,” were found in most affected tissues, including keratinocytes, dermis, respiratory epithelial cells, and sebaceous gland epithelium. There was both superficial and deep dermatitis. Necrosis and mononuclear inflammation were also present in the sebaceous glands. There was extensive edema of the dermal papillae with some hemorrhage. A vasculitis with a mononuclear cell perivascular reaction with thrombosis leading to necrosis was evident in the dermis. There was lymphoid hyperplasia and reticuloendothelial hyperplasia (House et al., 1990). The histopathological examination of skin nodules of different cases (39) revealed hyperkeratosis, parakeratosis and acanthosis within the epidermis. The prickle cell layer was swollen and vacuolated. Coagulative necrosis and ulceration within epidermal layer was seen associated with presence of numerous homogenous eosinophilic intracytoplasmic inclusion bodies that were confirmed by phloxin tartrazin stain (Sohair et al., 2008). Histopathological examinations of lumpy skin disease revealed ballooning degeneration of stratum spinosum with microvesicles formation. Eosinophilic intracytoplasmic inclusion bodies were also noticed. (Salib and Osman, 2011). Histopathological examination of skin biopsy from living animals and skin samples of died animals showed round to oval eosinophilic intracellular inclusion bodies (Abou Elyazeed, 2012). Histopathological skin lesion of LSD on cattle as the epidermis was extensively necrotic, while in the intact areas, some ballooning degeneration of squamous epithelial cells with occasional intra-cytoplasmic inclusions were seen (Ahmed and Amina, 2013) that could be numerous intracytoplasmic eosinophilic inclusion bodies in some cases (Aziza et al., 2015). These characteristic pathognomonic eosinophilic intracytoplasmic inclusion bodies were present in the prickle cell layer (Neamat-Allah, 2015).

62

3.8.3.2. Serological Techniques: 3.8.3.2.1. Indirect Fluorescence Antibody Technique (IFAT): Indirect FAT was successfully carried out on the suspected LSDV samples isolated on CAM. Sixteen identified positive samples out of 23 showing bright greenish yellow fluorescence in CAM (Sohair et al., 2008). Capripoxvirus antigen can also be identified on the infected cover-slips or tissue culture slides using FAT. Indirect FAT carried out using immune cattle sera was subject to high background colour and nonspecific reactions, so, uninfected tissue culture should be included as a negative control as cross-reactions can cause problems due to antibodies to cellular components. However, a direct conjugate can be prepared from sera from convalescent cattle (or from sheep or goats convalescing from capripox) or from rabbits hyperimmunised with purified capripoxvirus (OIE, 2010). Indirect FAT was used to LSDV in ultrathin sections of the collected tissues with aid of using prepared rabbit hyperimmune serum and anti-rabbit FITC conjugate (EL-Kenawy and EL-Tholoth, 2011) Impression smear from CAMs that showing pock lesion or from skin lesions were stained with anti-capripoxvirus FITC conjugate and read with a fluorescence microscope. The conjugated anti-LSDV hyperimmune serum demonstrated typical apple green positive intra-cytoplasmic fluorescent reaction in the cells of all CAMs showing pock lesions (Abou Elyazeed, 2012, Aziza et al., 2015) 3.8.3.3. Molecular Identification: 3.8.3.3.1. Polymerase Chain Reaction (PCR): The polymerase chain reaction (PCR) is a scientific technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. The conventional gel based PCR method is a simple, fast and sensitive method for the detection of Capripoxvirus genome. In EDTA blood, biopsy, semen or tissue culture samples. However, it does not allow differentiation between LSD and sheep and goat pox viruses. Primers for the viral attachment protein gene and the viral fusion protein gene are specific for all the strains within the genus Capripoxvirus (Ireland and Binepal, 1998).

63

PCR was performed for diagnosis of LSDV in semen samples from affected bulls using commercially available primers for LSDV. The forward and reverse primers had the sequences 5’-TTTCCTGATTTTTCTTACTAT-3’ and 5’AAATTATATACGTAAATAAC-3’ respectively, rendering an amplicon of 192 bp. A positive control consisting of bovine semen spiked with LSDV and a negative bovine semen control as well as a water control were included in the PCR. Amplified products were analysed using a 100 bp DNA ladder as a molecular marker on 1.5% agarose gels. Amplicons were visualized using an UV transilluminator at a wavelength of 590 nm and positive reactions were confirmed according to size (Annandale et al., 2005). Also, semen was tested by PCR using primers developed from the gene for the viral attachment protein. The forward and reverse primers had the sequences 5’TTTCCTGATTTTTCTTACTAT3’ and 5’AAATTATATACGTAAATAAC3’ respectively, rendering an amplicon of 192bp (Irons et al., 2005). PCR was successfully performed for diagnosis of LSDV in skin biopsies (Tuppurainen et al., 2005). The PCR primers were developed from the viral attachment protein encoding gene and have the following sequences (Ireland & Binepal 1998): Forward primer 5’-d TTTCCTGATTTTTCTTACTAT-3’Reverse primer 5’-d AAATTATATACGTAAATAAC-3’. The size of the amplicon was 192 bp. PCR started with one cycle of 42 °C for 2 min and 94 °C for 10 min. The initial cycle was 94 °C for 1 min, 50 °C for 30 s and 72 °C for 1 min. This was followed by 40 cycles of 94°C for 1 min, 50°C for 30 s, and 72°C for 1 min, and a final elongation step of 72 °C for 1 min to complete the extension of the primers. PCR was successfully performed for diagnosis of LSDV in extracted DNA. The PCR primers were developed from the viral attachment protein encoding gene and have the following sequences: forward primer 5'-d TTTCCTGATTTTTC TTACTAT-3' and reverse primer 5'-d AAATTATATACGTAAATAAC-3’ (Ireland and Binepal 1998). DNA amplification was carried out in a final volume of 25 μl containing 12.5 μl Platinium® Quantitative PCR SuperMix-UDG, 1 μl 0.20 mM each primer, 9.5 μl distilled water and 1 μl DNA sample. The PCR started with one cycle of 42°C for 2 min and 94°C for 10 min. The initial cycle was 94°C for 1 min, 50°C for 30 s and 72°C for 1 min. This was followed by 40 cycles of 94°C for 1 min, 50°C for 30 s, and 72°C for 1 min, and a final elongation step of

64

72°C for 1 min to complete the extension of the primers. PCR assay indicated that there is a band at 192 bp which belonged to viral attachment protein encoding gene (Ahmed and Kawther, 2008). PCR was used for diagnosis of LSDV in extracted DNA from culture supernatant from the LSDV infected MDBK cells and skin biopsy specimens. PCR primers were chosen from unique LSDV sequences within the gene for viral attachment protein (Ireland and Binepal,1998). PCR reaction was applied in a total volume of 50 ml containing: 1X PCR buffer (20 mM Tris HCl pH 8.4 and 50 mM KCl); 1.5 mM MgCl2; 0.2 mM deoxynucleosides triphosphates mixture (dATP, dCTP, dGTP and dTTP); 20 pmol of each primer; 2.5 units (U) Thermus aquaticus Taq polymerase 0.1mg of extracted viral DNA and nuclease-free sterile double distilled water up to 50.0 ml. Then, the resulting mixture was subjected to precise thermal profile in a programmable thermocycler as follows: One cycle of: 94 oC for 2 min; 40 cycles of: 94oC for 50 sec, 50oC for 50 sec and 72oC for 1 min; followed by one final cycle of 72oC for 10 min. Analysis of PCR amplification products (amplicons) showed that the PCR amplicons of proper predicted size (about 192 bp) that were gel purified using DNA gel purification kit then quantitated and subjected for direct sequencing of PCR amplicons ( El-Kholy et al., 2008). PCR was used for diagnosis of LSDV in extracted viral DNA from skin biopsy and blood in EDTA (Awad et al., 2010). The PCR primers were developed from the gene for viral attachment protein with the following sequences; forward primer: 5′-TTTCCTGATTTTTCTTACTAT-3′ and reverse primer: 5′-AAATTAT ATACGTAAATAAC-3′. PCR was performed according to the procedures of Ireland and Binepal (1998) and the amplicon size of the PCR product is 192 bp. PCR was used for diagnosis of LSDV in extracted viral DNA from blood in EDTA, semen or tissue culture supernatant, skin and other tissue samples. The primers were developed from the viral attachment protein encoding gene. The size of the expected amplicon is 192 bp (Ireland & Binepal, 1998). The primers have the following gene sequences: Forward primer 5’-TCC-GAG-CTC-TTT-CCT-GAT-TTT-TCT-TAC-TAT-3’ Reverse primer 5’- TAT- GGT-ACC-TAA-ATT-ATA-TAC-GTA-AAT-AAC-3’. 65

DNA amplification is carried out in a final volume of 50 μl containing: 5 μl of 10 × PCR buffer, 1.5 μl of MgCl2 (50 mM), 1 μl of dNTP (10 mM), 1 μl of forward primer, 1 μl of reverse primer, 1 μl of DNA template (~10 ng), 0.5 μl of Taq DNA polymerase and 39 μl of nuclease-free water. The volume of DNA template required may vary and the volume of nuclease-free water must be adjusted to the final volume of 50 μl. Run the samples in a thermal cycler: first cycle: 2 minutes at 95°C, second cycle: 45 seconds at 95°C, 50 seconds at 50°C and 1 minute at 72°C. Repeat the second cycle 34 times. Last cycle: 2 minutes at 72°C and hold at 4°C until analysis (OIE, 2010). PCR was used for diagnosis of LSDV in extracted viral DNA from infected CAM and MDBK cells. It was performed according to the procedures of Ireland and Binepal, (1998) using primers developed from the gene for viral attachment protein with the following sequences: forward primer 5'-TTTCCTGA TTTTTCTTACTAT-3'and reverse primer 5'-AAATTATATACGTAAATAAC-3'. The specific primers set amplified a DNA fragment of 192 bp equivalent to the expected amplification product (amplicon) size from LSDV without significant differences between the LSDV reference strain and the local isolate from skin nodules, infected CAM and MDBK cells (El-Nahas et al., 2011). PCR was used for diagnosis of LSDV in extracted viral DNA from tissue samples. The DNA extracted from each sample was amplified using the protocol published by Ireland and Binepal, (1998). Briefly, each reaction mixture (50 μl) contained 250 ng of total DNA, 2 mM MgCl2, 50 pmol of each primer (forward primer 5´-TTTCCTGATTTTTCTTACTAT-3´ and reverse primer 5´AAATTATATACGTAAATAAC-3´), 200 μM of each dNTP and 2 U of DNA polymerase (Biotool, USA) in a reaction buffer (10×) containing 75 mM Tris-HCl (pH 9), 2 mM MgCl2, 50 mM KCl, 20 mM (NH4)2SO4 and 0.001% bovine serum albumin. Amplification was carried out in an MJ Thermal Cycler (MJ Corporation, USA), programmed to perform a denaturation step of 95°C for 5 min, followed by 40 cycles consisting of 1 min at 94°C for denaturation, 1 min at 50°C for primer annealing and 1 min at 72°C for extension. The last extension step was 10 min longer. A10 μl volume of PCR products was mixed with 2 μl gel loading buffer (Sigma-Aldrich) and electrophoresed in 1% agarose gel containing 1 μg/ml ethidium bromide in Tris-acetate buffer (0.04 M Tris-acetate and 0.001 M EDTA, pH 8). The resulting DNA fragments were visible at band of the appropriate size 192 bp, (Sharawi and Abd El-Rahim, 2011).

66

PCR was used for diagnosis of LSDV in extracted viral DNA from 22 blood samples. PCR was carried out for the confirmation of the disease by using commercial capripoxviru PCR kit‟ with the sequence of forward primer (SpGpRNAPol F) 5‟-TCTATGTCTTGATATGTGGTGGTAG-3‟ and reverse primer (SpGpRNAPol R) 5‟-AGTGATTAGGTGGTGTATTATTTTCC-3‟, amplifies CaPV homologues of the vaccinia virus E4L gen which encodes the 30 KDa DNA-dependent RNA polymerase subunit (Charles et al., 2011). DNA amplification was carried out in a final volume of 50 μl containing the following: 5 μl of (10Mm) PCR buffer, 1.5 μl of MgCl2 (25Mm), 1 μl of dNTP mixture (10 Mm), 1 μl of (50 Mm) forward primer, 1 μl of (50 Mm) reverse primer, 5 μl of DNA template, 0.5 μl of Taq DNA polymerase and 35 μl of RNAas free water. All PCR experiments performed using the following amplification program: initial denaturation at 95oC for 1 min; 40 cycles of denaturation at 95oC for 30s, annealing at 55oC for 30s and elongation at 72oC for 1 min. An additional elongation step was performed at 72oC for 5 min and the PCR products were stored at 4°C until analysis. Amplified products were analyzed and positive results were confirmed as 172bp product with positive samples (Haftu,2012). DNA was extracted from whole blood samples of infected cattle and was used as templates for PCR diagnosis of LSDV (El-Haig et al., 2013). The primers used were directed to the viral attachment protein encoding gene (forward primer 5′-TTTCCTGATTTTTCTTACTAT-3′, reverse primer 5′-AAATTATATACGT AAATAAC-3′, the amplicon size of PCR product is 192 bp (Ireland & Binepal, 1998) and LSD-specific primers (lsd43U 5′-GTGGAAGCCAATTAAGTAGA-3′, lsd1262L 5′-TAAGAGGGACATTAGTTCT-3′), the amplicon size of PCR product is 1237 bp, (Stram et al., 2008). Then, PCR was carried out in a programmable thermocycler as follow: one cycle of 95°C for 1 min., this was followed by 35 cycles of 94°C for 30s, 58°C for 30s and 72°C for 70s and a final extension step of 72°C for 5min. PCR was carried out for diagnosis of LSDV in thin tissue section removed from each sample. The primers were designed from sequence data derived from the South African Onderstepoort vaccine strain and Warm baths field isolate of LSDV (Kara et al. 2003). Primer pair 1, consisting of primer DW-TK (5′-GCCGAT AACATATATAGACCC-3′) and primer OP49 (5′-GTGCTATCTAGTGCAGCT AT-3′), is used to amplify a 434-bp LSDV genomic fragment between positions 56698–57132, and primer pair 2, consisting of primer L132F (5′- CACTTCCCT TTTAAGC-3′) and primer L132R (5′- CATTCTACAATCTCCATGCG-3′), 67

amplifies a 492-bp fragment between genomic positions 119801–120292. Template DNA was denatured initially for 90 s at 95 °C, followed by 35 cycles of denaturation (45 s at 95 °C), primer annealing (45 s at 56 °C) and strand extension (60 s at 72 °C), ending with a final strand extension step for 7 min at 72 °C. These conditions were used for both primer pairs. The two primer pairs used for virus identification are homologous to regions of the LSDV thymidine kinase (TK) and ORF132 genes, respectively. The TK gene is highly conserved among the capripoxviruses and thus primer pair 1 also binds to the TK genes of sheep pox and goat pox viruses. However, LSDV ORF132 is unique to LSDV and thus primer pair 2 only binds to LSDV DNA. Amplification products of the expected sizes for LSDV were obtained for all the samples, including the positive LSDV controls (Tageldin et al., 2014). PCR was carried out for diagnosis of LSDV using extracted DNA from tissue samples taken from skin nodules, lymph nodes, lung and liver (Aziza et al., 2015). It was performed using with commercially available primers for LSDV developed from the gene for viral attachment (Ireland and Binepal, 1998). The forward and reverse primers had the sequences 5'-TTCCTGATTTTTCTTACTAT3' and 5'-AAATTATATACGTAAATAAC-3', respectively. The precise thermal profile was as follows: an initial denaturation cycle of 94 °C for 2 min; followed by 40 cycles at 94°C for 50 seconds, 50 seconds at 50°C and 1 minute at 72°C for; followed by one final extension cycle of 72° C for 10 minutes, rendering an amplicon of 192bp. PCR was carried out for diagnosis of LSDV using extracted DNA from tick species associated in LSD infection in comparison with extracted DNA from scabs and skin lesions collected from experimentally infected donor animals (Tuppurainen, 2015). Primers were designed from the viral attachment gene (Ireland and Binepal, 1998) with the following sequences: Forward primer 5'TCCGAGCTCTTTCCTGATTTTTCTTACTAT-3', Reverse primer 5'TATGGTACCTAAATTATATACGTAAATAAC-3’. The thermal profile was 1 x 42 °C for 2 min and 94 °C for 10 min, 1x 94 °C for 1 min, 50 °C for 30 sec and 72 °C for 1 min, followed by 40 x 94 °C for 1 min, 50 °C for 30 sec, and 72 °C for 1 min and 1 x 72 °C for 1 min. Positive samples gave products of the expected size of 192 bp.

68

3.8.3.3.2. Sequencing of the viral genome: Multiple sequence alignments showed high homology percentage (≥ 99 %) of the nucleotide sequences among local isolates of LSDV. Nevertheless, blast searches over the Genebank database together with the phylogenetic analyses and sequence alignments revealed that local isolates of LSDV are highly related (≥ 95 %) to not only other LSDV strains but also other Capripoxviruses (goat and sheep pox). These results coincide with the theory of that all capripoxviruses are genetically related and originated from one ancestor lineage (Black etal., 1986, Fenner et al., 1987 and Tulman et al., 2001). (Alaa. A. El-Kholy et al.,2008). 1->gi|194031729|gb|EU807974.1|:1-172 Lumpy skin disease virus isolate Egy/2006 nonfunctional attachment protein (P32) gene, partial sequence AAATTATATACGTAAATAACATACCTGCTTAAAACCATAGTAATTTAGAATTCAAATCCAAAA TTATCATTATTATAATAAATAAAATAATAAGTGCTCCTATTATACTAATATCAAATATACCAA AAATTGAAACCAATGGATGGGATACATAGTAAGAAAAATCAGGAAA

>gi|14994025|gb|AF325528.1|:64986-65157 Lumpy skin disease virus NI-2490 isolate Neethling 2490, complete genome AAATTATATACGTAAATAACATACCTGCTAAAAACCATAGTAATTTAGAATTCAAATCAAAAA TTATCATTATTATAATAAATAAAATAATAAGTGCTCCTATTATACTAATATCAAATATACCAA AAAATGAAACCAATGGATGGGATACATAGTAAGAAAAATCAGGAAA

Sequence ID: gb|AF325528.1|Length: 150773, Number of Matches: 1 Related Information, Range 1: 64986 to 65157, Alignment statistics for match #1 Score

Expect

302 bits (163)

1e-83

Identities 169/172(98%)

69

Gaps 0/172(0%)

Strand Plus/Plus

Query

1

AAATTATATACGTAAATAACATACCTGCTTAAAACCATAGTAATTTAGAATTCAAATCCa

60

||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | Sbjct

64986

AAATTATATACGTAAATAACATACCTGCTAAAAACCATAGTAATTTAGAATTCAAATCAA

65045

Query

61

aaattatcattattataataaataaaataataagtgctcctattatactaatatcaaata

120

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

65046

AAATTATCATTATTATAATAAATAAAATAATAAGTGCTCCTATTATACTAATATCAAATA

Query

121

taCCAAAAATTGAAACCAATGGATGGGATACATAGTAAGAAAAATCAGGAAA

65105

172

||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct

65106

TACCAAAAAATGAAACCAATGGATGGGATACATAGTAAGAAAAATCAGGAAA

65157

/ gene="LD074 " CDS complement (64984..65952 ) / gene="LD074 " / note="similar to vaccinia virus strain Copenhagen H3L , p35; similar to GenBank Accession Number AF124516 " / codon_start=1 / product="putative IMV envelope protein " / protein_id="AAN02642.1 " / db_xref="GI:22595609 " 2- >gb|GQ202146.1| Lumpy skin disease virus isolate Egypt/Mansoura08 nonfunctional attachment protein gene, partial sequence, Length=192 >gb|AF325528.1| Lumpy skin disease virus NI-2490 isolate Neethling 2490, complete genome, Length=150773

70

Score = 235 bits (127), Expect = 2e-58, Identities = 159/174 (91%), Gaps = 4/174 (2%), Strand=Plus/Plus

Query

1

AAATTATATACGTAAATAACATACCTGCTTAAAACCATAGTAATTTAGAATTCAAATCCA

60

||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | Sbjct

64986

AAATTATATACGTAAATAACATACCTGCTAAAAACCATAGTAATTTAGAATTCAAATCAA

65045

Query

61

AAATTATCAT--TCCTAATAAATAAAATGGGAAGTGCTCCTATTATACTAATATCAAACT

118

||||||||||

|

|||||||||||||

||||||||||||||||||||||||||| |

Sbjct

65046

AAATTATCATTATTATAATAAATAAAATAATAAGTGCTCCTATTATACTAATATCAAA-T

Query

119

ATACCATTTGATTGAAACCAATGGATGGGATACATAGTAAGAAAAATCAGGAAA ||||||

Sbjct

65105

65104

172

| ||||||||||||||||||||||||||||||||||||||||||

ATACCA-AAAAATGAAACCAATGGATGGGATACATAGTAAGAAAAATCAGGAAA

65157

/ gene="LD074 " CDS complement (64984..65952 ) / gene="LD074 " / note="similar to vaccinia virus strain Copenhagen H3L , p35; similar to GenBank Accession Number AF124516 " / codon_start=1 / product="putative IMV envelope protein " / protein_id="AAN02642.1 " / db_xref="GI:22595609 " 3- Query= KU298637.1 Lumpy skin disease virus isolate 956/Egy/2015 envelope protein gene, partial cds, Length=331 >AF325528.1 Lumpy skin disease virus NI-2490 isolate Neethling 2490, complete genome, Length=150773

71

Score = 612 bits (331), Expect = 1e-176, Identities = 331/331 (100%), Gaps = 0/331 (0%), Strand=Plus/Plus

Query

1

AAGAGCATTACATAATCCAGAAAAATATTCTGTAAAATTTTCAACACCTCCTGATTTTTC

60

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

65692

AAGAGCATTACATAATCCAGAAAAATATTCTGTAAAATTTTCAACACCTCCTGATTTTTC

65751

Query

61

TACCTTTTCCCATATAAGGAACTTATATGATAAACTGATATCTTTTTTATCTTTaaaaaa

120

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

65752

TACCTTTTCCCATATAAGGAACTTATATGATAAACTGATATCTTTTTTATCTTTAAAAAA

65811

Query

121

aaaaTTTACATCTGAATTTTTAAAATCTTTTACTGTGTCAACTTTTTTATAAAATATATC

180

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

65812

AAAATTTACATCTGAATTTTTAAAATCTTTTACTGTGTCAACTTTTTTATAAAATATATC

65871

Query

181

ATTGTCACTTTTTAATTCTGGAACTACATCTGAAATTTCGCGACCAACGATTGGTATAAC

240

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

65872

ATTGTCACTTTTTAATTCTGGAACTACATCTGAAATTTCGCGACCAACGATTGGTATAAC

65931

Query

241

ATATAATGGGATATCTGCCATTTTTGATAATTAGTTATCTAAAGCACTATTTAGTTATTA

300

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

65932

ATATAATGGGATATCTGCCATTTTTGATAATTAGTTATCTAAAGCACTATTTAGTTATTA

Query

301

AAATTAAAGAAGTATAGCTCTCTAATTTTAG

65991

331

||||||||||||||||||||||||||||||| Sbjct

65992

AAATTAAAGAAGTATAGCTCTCTAATTTTAG

66022

gene complement (64984..65952 ) / gene="LD074 " CDS complement(64984..65952 ) / gene="LD074 " / note="similar to vaccinia virus strain Copenhagen H3L , p35; similar to GenBank Accession Number AF124516 " / codon_start=1 / product="putative IMV envelope protein " / protein_id="AAN02642.1 " / db_xref="GI:22595609, " gene complement(65982..68378 ) 72

/ gene="LD075 ", CDS complement(65982..68378 ) / gene="LD075 ", / note="similar to vaccinia virus strain Copenhagen H4L , RAP94 " ,/ codon_start=1 ,/ product="RNA polymerase-associated protein " / protein_id="AAN02643.1 ", / db_xref="GI:2259561 4- Query= KJ561442.1 Lumpy skin disease virus strain Egypt/BSU-1, G-proteincoupled chemokine receptor (GCPR) gene, partial cds, Length=557 >AF325528.1 Lumpy skin disease virus NI-2490 isolate Neethling 2490, complete genome, Length=150773, Score = 968 bits (524), Expect = 0.0, Identities = 556/569 (98%), Gaps = 12/569 (2%), Strand=Plus/Minus

Query

1

CTTAGTACAGTTAGTAGCGCAACCATGTATAATAGTAGCAGTAATATTACCACTATAGCT

60

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

8106

CTTAGTACAGTTAGTAGCGCAACCATGTATAATAGTAGCAGTAATATTACCACTATAGCT

8047

Query

61

ACTACAATTATTA-----------A-TACAATTTCAACTAATCAAAATAATGTTACAACG

108

|||||||||||||

| |||||||||||| |||||||||||||||||||||

Sbjct

8046

ACTACAATTATTAGTACAATTCTCAGTACAATTTCAACAAATCAAAATAATGTTACAACG

7987

Query

109

CCTTCAACTTATGAAAATACAACAACGATATCTAATTATACAACCGCATATAATACAACT

168

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

7986

CCTTCAACTTATGAAAATACAACAACGATATCTAATTATACAACCGCATATAATACAACT

7927

Query

169

TATTATAGCGATGATTATGATGATTATGAAGTGAGCATAGTCGATATCCCACATTGTGAT

228

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

7926

TATTATAGCGATGATTATGATGATTATGAAGTGAGCATAGTCGATATCCCACATTGTGAT

7867

Query

229

GATGGTGTGGATACTACAAGTTTTGGACTGATTACTTTATATTCGACTATATTCTTTCTT

288

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

7866

GATGGTGTGGATACTACAAGTTTTGGACTGATTACTTTATATTCGACTATATTCTTTCTT

73

7807

Query

289

GGATTATTTGGAAATATAATTGTGTTAACTGTTCTTCGTAAATATAAGATAAAAACAATA

348

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

7806

GGATTATTTGGAAATATAATTGTGTTAACTGTTCTTCGTAAATATAAGATAAAAACAATA

7747

Query

349

CAGGATATGTTTTTGCTTAATTTGACACTGTCTGATTTAATTTTCGTGTTGGTGTTTCCT

408

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

7746

CAGGATATGTTTTTGCTTAATTTGACACTGTCTGATTTAATTTTCGTGTTGGTGTTTCCT

7687

Query

409

TTTAATTTATACGATAGTATCGCTAAACAATGGAGTTTAGGAGATTGTTTGTGTAAATTT

468

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

7686

TTTAATTTATACGATAGTATCGCTAAACAATGGAGTTTAGGAGATTGTTTGTGTAAATTT

7627

Query

469

AAAGCTATGTTTTACTTTGTTGGTTTTTACAATAGCATGTCATTTATAACATTGATGAGT

528

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct

7626

AAAGCTATGTTTTACTTTGTTGGTTTTTACAATAGCATGTCATTTATAACATTGATGAGT

Query

529

ATTGATAGATACCTAGCTGTAGTTCACCC

557

||||||||||||||||||||||||||||| Sbjct

7566

ATTGATAGATACCTAGCTGTAGTTCACCC

7538

gene complement(6978..8111 ) / gene="LD011 " CDS complement(6978..8111 ) / gene="LD011 " / note="similar to GenBank Accession Number S78201 " / codon_start=1 / product="CC chemokine receptor-like protein " / protein_id="AAN02577.1 " / db_xref="GI:22595544

74

7567

3.9. Viral immune evasion: Successful transmission by viruses in the face of vigorous innate and acquired host immunity requires the ability to evade, obstruct, or subvert critical elements that mediate host antiviral responses. To that end, viruses with larger genomes, such as poxviruses, encode multiple classes of immunomodulatory proteins that have evolved specifically to inhibit such diverse processes as apoptosis, the production of interferons, chemokines, and inflammatory cytokines, and the activity of cytotoxic T lymphocytes (CTLs), natural killer (NK) cells, complement, and antibodies. Often, the evolutionary origins of these virusencoded immunomodulatory proteins are difficult to trace. The obvious sequence similarity between some immunomodulatory poxvirus genes and the cDNA versions of related cellular counterparts suggests that they were once captured by ancestral retrotranscription and/or recombination events and then reassorted into individual virus isolates during coevolution with vertebrate hosts. However, other poxviral immunomodulators have no known cellular counterpart or have putative functions that cannot be predicted based on similarity to known cellular proteins. The origins of these orphan regulators may be obscure, but their potential for immune subversion can be profound ( J. B. Johnston et al,2003). ADVANCES IN VIRAL GENOMICS: GENES APLENTY Poxvirus immunomodulatory proteins can be operationally divided by function into a trinity of distinct strategic classes, which we will refer to here as virostealth, virotransduction, and viromimicry. Virostealth is characterized by masking of the visible signals associated with virus infection, for example, by reducing the capacity of effector leukocytes to recognize and eliminate infected cells. Virotransducers are intracellular viral proteins that inhibit innate antiviral pathways, such as apoptosis, proinflammatory cascades, or the induction of the antiviral state. Virotransducers can also target host signal transduction pathways that influence host range. Viromimicry is exemplified by virokines and viroreceptors, which are virus-encoded proteins that mimic host cytokines or their receptors, respectively. These proteins block extracellular communication signals and promote a protected microenvironment for the virus within normally immuno-exposed tissues.This commentary focuses on a few select examples within each strategy and the reader is referred to other recent reviews for more comprehensive exegeses on this expanding subject. ( J. B. Johnston et al,2003). 75

1- VIROSTEALTH: SLEEPING WITH THE ENEMY The participation of innate and educated cytolytic immune cells, especially NK cells and CTLs, is critical for the rapid identification and clearance of virusinfected cells. Thus, both small and large viruses attempt to subvert the non self discrimination pathway, most commonly by down regulating recognition receptors and/or blocking the presentation of viral antigens to immune cells. The capacity to decrease expression of the class I MHC receptors that normally present endogenous viral antigens to circulating CD8_ CTLs correlates with the extent of systemic spread and replication within diverse tissues ( J. B. Johnston et al,2003). Poxviridae comprise a diverse family of large double-stranded DNA viruses that undergo replication exclusively in the host–cell cytoplasm. Poxvirus virions are easily identified by their characteristic brick-shaped appearance in electron micrographs. Each virion contains a single linear genome that varies in length (130–360 Kb) depending on the virus strain. The genomes are compact, with open reading frames (ORFs) being closely spaced and non-overlapping with no evidence of mRNA splicing. Although individual strains may contain more than 200 ORFs, only _50 are thought to encode proteins essential for viral transcription, DNA replication, or the formation of new virions . These ORFs cluster in the central region of the genome and are well conserved in sequence and position across different species. The remaining ORFs are more variable and tend to be distributed more towards the terminal ends of each genome. These ORFs likely encode factors that confer virulence, tissue tropism, or serve to expand host range. Ample evidence suggests that poxviruses have captured host genes during their evolution in order to evade immune detection and elimination. Yet it is clear from evolutionary studies comparing the sequences of ORFs across different genomes that poxviruses also adapt to changes in host defense by altering their existing repertoire of factors. Possible mechanisms to explain the observed alterations include accumulation of point mutations, the occurrence of unequal crossovers giving rise to chimeric factors, or transient genomic expansions that increase the number of targets available for mutation. In support of the idea that poxvirus genomes are modified in response to evolutionary pressure, several poxvirus families show signs of ORF duplication and divergence. These include: the ankyrin-repeat proteins, the serpin family, the C7L family, the kelch-like proteins, and the Bcl-2-like proteins. From a structural point of view, each of these families can be thought of as sharing an easily 76

identified fold. Within each family, individual members likely derive from an ancestral factor that was used as a common structural scaffold and modified repeatedly to create different binding specificities for host molecules. These modifications were presumably driven by host-mediated selective pressure. (A. Nelson et al, 2015).

77

78

4. MATERIAL AND METHODS STRATEGY

4.1. Material: 4.1.1. History of the outbreak: Lumpy skin disease (LSD) was suspected among cattle at different localities in Qaliubiya province, Egypt during summer 2013-2014. Suspected cattle used as source for viral samples collection demonstrate skin nodules and scabs scattered all over the body parts (Photo_1&2). The animals showed 20 days duration of illness, and history of vaccination with local modified live sheep pox vaccine before 7 months and 1.5 months of the occurrence of infection. 4.1.2. Viral Samples: Two skin biopsies from cutaneous scabs (S1 from a 2 year old Frisian bull and S2 from 2 years old Frisian cow) were collected on 50% glycerol saline. These samples were used for isolation of Lumpy Skin Disease Virus (LSDV) on Specific Pathogen Free-Embryonated Chicken Egg (SPF-ECE) and MDBK cell line.

79

A

B

80

C

D 81

E F

F

82

H

G

(Photo_ 1): Suspected cattle for LSD showing skin lesions as skin nodules scattered all over the body (A and B (S2)), including vulva (C) and udder (D). Suspected cattle for LSD showing skin lesions as skin scabs (E_S1), ulcerative lesions (F) complicated to necrotic skin lesions on legs, especially on top of the joints (G) and accompanied with limb edema (H).

83

4.1.3. Reagents for sample preparation: 1- Physiological saline 0.9%, pH 7-ready to use. Sterile I.V infusion 0.9% W/V & pyrogen free, 9 gram in 500 ml solution with Na+ 154 m. Mol/L and Cl– 154 m. Mol/L, M.O.H Reg.No:27829/2012. Single dose container (500ml), Isotonic, Batch No: 109141632, Manufactured by ATECO PHARMA EGYPT, EL Obour City- industrial Area (B) No:122. 2- antibiotic. Garamycin®, Gentamicim (as sulphate), 80mg/2ml, Memphis, B.N. ET13-AMKB-46, an antimicrobial spectrum for Gram negative and Gram positive bacteria. 3- antifungal . Mycostatin™, Nystatin,100,000 units/ml, Manufactured by GlaxoSmithKline Egypt, Elsalam City, Cairo, Batch No: A507926. 4- Working solution of saline: (Payment and Trudel,1993, modified). 1. physiological saline (0.9%)

500 ml

2. gentamycin

1 ml

3. mycostatin

100-200µl

4. mixing well. 5. Filter sterilized and pH was adjusted to 7.5 by N/10 HCl or 1N NaOH then stored at 2-8°C. 4.1.4. Specific Pathogen Free-Embryonated Chicken Eggs (SPF-ECE): SPF-ECE days old were obtained from the SPF production Farm, Koum Oshiem, Fayoum, Egypt. The fertilized eggs were incubated at the 37°C and 80% humidity till reach suitable age (10-12 days old). It was used for isolation of LSDV from the suspected samples and IFAT. 84

4.1.5. Madin – Darby Bovine Kidney (MDBK) cell line: MDBK cell line was produced by Ames, Iowa Laboratory, USA and it was obtained from Cell Culture Department, VACSERA, Agouza, Giza., Egypt and maintained at Virology Department, Faculty of Veterinary Medicine, Benha University. It was used for virus isolation and IFAT. 4.1.6. Tissue culture media and Solutions: 4.1.6.1. Minimum Essential Medium (MEM): It was purchased from Biochrom, Leonorenstr: 2-6. D-12247 Berlin, Germany. Minimum Essential Medium (MEM) with Earle's salts and stable L-glutamine and 2.2 g/l NaHCo3, Cat. No. FG 0325, Lot. No. 1298A, was used for the maintenance and growth of cell cultures. The maintenance medium was supplemented with 2% new born calf serum, while the growth medium was supplemented with 10% new born calf serum. The final pH of the growth and maintenance media were approximately adjusted to 7.2. 4.1.6.2. New born calf serum: Virus and mycoplasma screened sterile new born calf serum PAN , Cat. No. P30-0402, Lot. No. P122207N was purchased from Biotech, Australia. It was used to supplement cell culture media. ™.

4.1.6.3. Cell culture growth media: (Payment and Trudel, 1993, modified). MEM (minimum essential media) Earle's supplemented with 10% new calf serum+ Antibiotic and antifungal: such as previously used in sample preparation, but with different concentrations, Gentamycin: 50µg/ml media, mycostatin:100 ug/ml, then adjust pH with NaHCO3 buffer (0.1M) with variable amount till pH reach 7.4,

85

4.1.6.4. Phosphate buffered saline (PBS), 1X: (Sambrook et al., 1989) NaCl KCl Na2HPO4 KH2PO4 Distilled water up to(DW)

8g 0.2 g 1.44 g 0.24 g 1000 ml.

pH was adjusted 7.4 with N/10HCl or 1N NaOH and the solution was dispensed into aliquots then sterilized by autoclaving 121ºC/20 minutes and stored at 4ºC, for washing of cell sheet. 4.1.6.5. Phosphate buffered saline (PBS) - without Ca+2 and mg+2: (Payment and Trudel, 1993) NaCl 8.00 g KCl 0.20 g Na2 HPO4 1.15 g KH2PO4 0.20 g Glucose 0.20 g Double distilled H2O up to 1000 ml Adjust pH to 7.4 by NaHCO3 buffer (0.1M) and sterilized by autoclaving 121ºC/ 20 min. This solution could be used for up to 2 years if kept at -20oC for three months at 4oC, for subculture of cells. 4.1.6.6. Trypsin-versene solution: (Payment and Trudel, 1993) - Trypsin 0.05 g - EDTA-disodium salt 0.02g - PBS without Ca+2 and mg+2 100 ml The total volume was sterilized by filtration (0.22µm diameter PTFEL plastic syringe filter), and stored in screw capped bottles. Adjust pH to 7.5 by NaHCO3 buffer (0.1M) and measured by pH meter. This solution could be used for up to 2 years if kept at -20oC, for three months at 4oC, for subculture of cells.

86

4.1.6.7. Cell culture buffers: (Hell Creek Life © 1997-2010 Phillip Bigelow Revised 1/24/2010) 4.1.6.7.1. Sodium bicarbonate solution (NaHCO3) 0.1 mol: It is consisted of NaHCO3 (MW = 84.007 g/ mol). NaHCO3 (0.1M) is prepared by dissolving 8.4007 g of NaHCO3 in 1000 ml double distilled water and sterilized by autoclaving. It was used to adjust the required pH of the cell culture media and solutions.

4.1.6.7.2. Sodium hydroxide solution (NaOH) 1 M: It is consisted of NaOH (MW = 40 g/ mol). NaOH (1 M) is prepared by dissolving 40 g of NaOH in 1000 ml double distilled water and sterilized by autoclaving. It was used to adjust the required pH of the cell culture solutions. 4.1.6.7.3. Hydrochloric acid (HCl) 100% as N/10: Equivalent mass of HCl 100% N/10 HCl mass in grams

= molar mass/ No. of hydrogen ions = 36.5/ 1= 36.5 g = N required x mass equivalent x amount in liters = 0.1x 36.5 x 1 = 3.65 g Volume of N/10 HCl 100% =Mass in grams/(HCl conc. x sp. gravity of HCl) = 3.65/ (1x 1.189)= 4.34 ml HCl It is consisted of 4.34 ml of HCl 100% dissolved in 1000 ml double distilled water and sterilized by autoclaving. It was used to adjust the required pH of the cell culture solutions. 4.1.8. Material for Transmission Electron Microscopy: 4.1.8.1. Sodium cacodylate Buffer (0.2 M): (Mercer and birbeck, 1966) -Sodium cacodylate(Na(CH3)2AsO2· 3H2O, MW= 21.4 g 214.02) - distilled water 500 ml 87

It was adjusted to pH 7.3 by adding N/10 hydrochloric acid. (was supplied by EMS, Washington, USA) 4.1.8.2. Glutaraldehyde 25%: Glutaraldehyde 25% (OCHCH2CH2CH2CHO, F.W. 100.12 CAS #111-30-8) was supplied by EMS, Washington, USA), and was used for preparation of the fixation buffer of the samples. 4.1.8.3. Fixation Buffers: (Mercer and birbeck, 1966) 4.1.8.3.1. Glutaraldehyde 1-5% in Sodium cacodylate buffer 0.1 M: It was prepared as 1-5% glutaraldehyde in 0.1 M sodium cacodylate buffer as follow: - 25% glutaraldehyde 20 ml - distilled water 30 ml - 0.2 M sodium cacodylate buffer, PH 7.3 50 ml (was supplied by EMS, Washington, USA ) 4.1.8.3.2. Osmium tetroxide 1% (OsO4, F.W. 254.20) in 0.1 M Sodium cacodylate buffer: Add 2% aqueous solution of osmium tetroxide to an equal volume of 0.2 M sodium cacodylate buffer. (was supplied by EMS, Washington, USA) 4.1.8.4. Ehyl alcohol 100%: Ethyl alcohol 100% (CH3CH2OH, 46.07 g/ mol,) Cat. No. 15055, was supplied by ADWIC company, Egypt. Ethyl alcohol was prepared in different concentrations including 30%, 50%, 70%, 80%, 90% and 100% and were used for gradual dehydration of tissue samples at 4 ºC. 4.1.8.5. Infiltration and embedding media: All reagents were obtained from Electron Microscopy Sciences EMS,231MorrisRoad,Washington,https://www.emsdiasum.com/microsco py/

88

4.1.8.5.1. Acetone 100% (C3H6O, 58.08 g/mol, CAS #: 67-64-1): It is miscible to alcohol (some types of resin kits is not miscible to alcohol) and used to ensure dehyderation of sample after alcohol. 4.1.8.5.2. Epoxy Resin (Low Viscosity Embedding Media Spurr's Kit): Low viscosity embedding media was supplied by Spurr kit (EMS, Hatfield, PA, USA) with the following components: 1- NSA (non enyl succinic anhydride), MW: 227, Cat. # 19050. 2-

ERL-4206 (VCD) (Vinyl Cyclohexene Dioxide=Vinyl-4 Cyclohexene Diepoxide, MW: 140.18, Cat. #15000).

3- DER 736 (Epoxy Resin, MW: 380, Cat. #13000). 4- DMAE (Dimethylaminoethanol accelerator, MW:89.14, Cat. #13300). It was used for hardening of the samples in the following formula: NSA: ERL: DER (26: 10: 6) + DMAE (0.3 ml). DMAE was used as an accelerator (hardening and polymerization of tissue resin mixture at oven to form the tissue blocks). 4.1.8.6. Stains of the electron microscope: (Mercer and birbeck, 1966) All reagents were obtained from Electron Microscopy Sciences EMS,231MorrisRoad,Washington, https://www.emsdiasum.com/microscopy/ 4.1.8.6.1. Stain for semithin section: Methylene blue (0.1%)_ MW: 319.85. Distilled water.

0.1 g 100 ml

4.1.8.6.2. Stain for ultrathin section: 4.1.8.6.2.1. Uranyl acetate: Uranyl acetate

0.2 g 89

Distilled water

10 ml

Shake for 15 min till all crystals are dissolved then filter and store the solution in a dark bottle in refrigerator, used at room temperature).

4.1.8.6.2.2. Lead citrate: (Raylonds, 1963) Lead nitrate 1.55 g Sodium citrate 1.76 g Shake well for 5 min then leave to stand for 30 min and add 8 ml N/10 sodium hydroxide aqueous solution, finally add distilled water up to 50 ml then adjusted to pH12 by N/10 aqueous solution of sodium hydroxide and filter.

4.1.8.7. Equipments: (was supplied by EMS, Washington, USA) 1-Ultrasonicator (CREST, Germany). 2- Tissue cutter. 3-Reichert-Jung Ultra-cut 701701 Ultra Microtome (Stock: 22479, Dimensions: 20LX 14WX 18H). 4- Grid. 5- Grid holder. 6- Holder of grid holder. 7- Grid forceps. 8- Forceps of grid holder. 9- Grid fixer. 10- Grid rack. 11- Filter paper. 12- Transmission electron microscope JEM2100-Joel-Japan. 90

4.1.9. Material for histopathological examination: (Bancroft and Gamble, 2002) 4.1.9.1. Buffered neutral formalin 10%: A 10% formalin solution was used as fixative as follow: Formalin (37%) BP 93, ELnaser. 270 ml Normal saline to 1000 ml It is used for preparation of the fixative solution. 4.1.9.2. Fixative solution: 10% buffered neutral formalin 100 ml Anhydrous disodium phosphate 6.5 g Acid sodium phosphate monohydrate 4.0 g Distilled water 900 ml 4.1.9.3. Xylene: (Technical grade, ADWIC, X0018131) 4.1.9.4. Ethyl alcohol 100%: (MW: 46.07, Elsalam for chemical industries) It was used for preparation of grades of ethyl alcohol from 50%100%. 4.1.9.5. Paraffin wax: (Diapath. SPA diawax, melting point: 56-58). 4.1.9.6. Harris alum haematoxylin stain: Bancroft, J. D. and Gamble, M. (2002) Haemmatoxylin crystals Absolute alcohol Ammonium or Potassium alum sulphate Mercuric oxide Distilled water - Dissolve hematoxylin in alcohol then added to alum which previously dissolved in hot water, bring quickly to the boil and add mercuric oxide when the solution turn dark purple, cool rapidly under tape, filter before use. 91

1g 10 ml 20 g 0.5 g 200 ml

4.1.9.7. Stock aqueous eosin stains 1%: Eosin soluble Distilled water

10 g 1000 ml

4.1.9.8. Equipments: 1- Ultramicrotome (Microtec®, CUT 44055, CUT 2020A, low profile I, No. 10216380, Germany). 2- Glass slide. 3- Cover slip. 4- incubator. 5- deep freeze -20. 4.1.10. Material used in Haemagglutination test (HA): (Payment and Trudel, 1993). 4.1.10.1. Washed Red blood cells (RBCs): RBCs were obtained from healthy cattle, sheep, goat and chicken on EDTA as anticoagulant. The cells were washed three times with physiological saline 0.9% and packed cells were diluted as 1% for Haemagglutination. The diluent used in the HA test, for both the antigen and the erythrocytes, was the physiological saline 0.9%, pH 7. -preparation of red blood cells (RBCs): 1- Obtain blood by venipuncture or cardiac puncture and mix with 4 times the volume of NaCL 0.9%, pH 7. 2- Centrifuge at 1000xg for 15 min. 3- Discard the supernatant and suspend the pellet in the initial volume of buffer saline NaCL 0.9%. 92

4- Repeat steps 2 and 3 three times. 4.1.10.2. Equipments: 1- U-shape bottom haemagglutination plate Nunc ®. 2- Uni-channel Epindorf ® automatic pipette (10-100 ul) with tips. 4.1.11. Material for Indirect Fluorescent Antibody Technique (IFAT): 4.1.11.1. Hyperimmuneserum specific for LSDV: LSD virus hyperimmuneserum was supplied by Department of pox virus vaccine research and production, Veterinary Serum and Vaccine Research Institute, Abbasia, Cairo. It was used for serological identification of LSDV isolates using indirect FAT. 4.1.11.2. Goat anti-Bovine IgG conjugated with fluorescein Isothiocyanate: It is Goat anti-Bovine IgG (H+L) as an affinity purified antibody fluorescen labelled (Cat. No. 02-12-06, Lot No. 040659- - LB 261-06) and rehydrate and store as instructed by manufacturer, Kirkegaard and Perry Laboratories, 2 cessana court, Gaithersburg, Maryland 20879, USA, diluted 1:200 by isotonic NaCl 0.9%, pH7. 4.1.11.3. Acetone: Cold acetone(-20ºC) was used for fixation of infected cells on cover slips; it was obtained from BDH Chemicals LTD, England. 4.1.11.4. Mounting buffer (buffered glycerin): (Payment and Trudel, 1993).

1 PBS: 9 glycerin was used for mounting the infected cells fixed on the cover slips, it was obtained from elnasser for chemical industries. 4.1.11.5. conjugate diluent (isotonic NaCl 0.9%). 4.1.11.6. PBS 1X (washing solution). 93

4.1.11.7. Equipments: 1- Incubator. 2- Fluorescence microscope (Olympus_ Tokyo_ Japan, and LeicaGermany) 3- Automatic pipette with tips. 4.1.12. Material used for extraction of genomic DNA of LSDV from samples: 4.1.12.1. DNeasy® Tissue Kit (QIAGEN, USA): The kit contains DNeasy Mini Spin Columns (colorless) in 2 ml Collection Tubes, Collection Tubes (2 ml), Buffer ATL, Buffer AL, Buffer AW1 (concentrate), Buffer AW2 (concentrate), Buffer AE and Proteinase K. It was used for extraction of genomic DNA of LSDV from tissue samples. https://windward.hawaii.edu/paces/summerfiles/publications/qiagen.pdf_march, 2004. 4.1.12.2. QIAamp® DNA Mini and Blood Mini kits-Suspension (QIAGEN, USA): The kit contains QIAamp Mini Spin Columns, Collection Tubes (2 ml), Buffer AL, Buffer ATL, Buffer AW1, Buffer AW2, Buffer AE, QIAGEN® Protease, Protease Solvent and Proteinase K. It was used for extraction of genomic DNA of LSDV from prepared tissue samples suspensions. 3rdedition, June 2012_ https://moodle.ufsc.br/mod/resource/view.php?id=805619

4.1.12.3. Equipment and Reagents to be Supplied by User: 1. Pipets and pipet tips with aerosol barrier 2. Vortexer. 3. Microcentrifuge tubes (1.5 ml). 4. Microcentrifuge with rotor for 2 ml tubes. 5. Water bath, or heating block at 56ºC. 6. PBS, pH 7.2. 94

7. Ethanol (96–100%). 4.1.13. Material for conventional polymerase chain reaction (PCR): 4.1.13.1. QIAGEN® PCR Master mix. Taq PCR Master Mix 2x concentrated, (Catalog no. 201443) supplied by Qiagen, USA with the following composition: Taq PCR Master Mix (3 x 1.7 ml), RNase-Free water (3 x 1.7 ml), MgCl2 (3 mM), Taq DNA Polymerase (250 units), Qiagen PCR Buffer (2x) and each dNTP (400 μM). 4.1.13.2. Nuclease free water. Highly pure, nuclease-free water for use in all molecular biology applications, 500 ml, Catalog no. 129114, qiagen USA. 4.1.13.3. Primers: Two primer pairs were designed based on the sequence of LSDV attachment protein gene and were used in this study as following: 4.1.13.3.1. Primer pair one: The primer sequences were based on the sequence of LSDV attachment protein gene as described by OIE (2008). The specific primers were manufactured in the laboratories of the Midland Certified Reagent company Inc. of Midland, Texas. The sequence of oligonucleotides is: LSD1 5' -TTTCCTGATTTTTCTTACTAT- 3' Tm (50mM NaCl) *:44.5 ᵒc GC Content : 23.8% AMOUNT OF OLIGO 6.1= 33.1= 0.21 OD260 nmoles mg For 100 µM: add 331 µl LSD1 5'-AAATTATATACGTAAATAAC- 3' Tm (50mM NaCl) *:37.6 ᵒc GC Content : 15.0%

95

(forward)

(reverse)

AMOUNT OF OLIGO 5.7= 26.3= 0.16 OD260 nmoles mg For 100 µM: add 263 µl The primer sequence of LSDV attachment protein gene 172 bp fragment was selected for amplification of DNA, From positions: 64986- 65157.

4.1.13.3.2. Primer pair two: The specific primers were obtained kindly from Dr. Wessel Dirksen, Ohio State University Research Foundation, 925 Coffey RD, 345 Goss Lab/ College of Vet Med, Columbus, OH 43210, USA (P.O # RF01404362). The primer sequences were selected based on the sequence of LSDV attachment protein gene and was designedusingPrimer-BLASTsoftware (http://www.ncbi.nlm.nih.gov/tools/primer-blast). The specific primers (Package # 34851877) were manufactured in Integrated DNA Technologies (IDT), 1710 Commertial Park, Coralville, Iowa 52241. The sequence of oligonucleotides is: LSD2 5' - GGGAAAAGGTAGAAAAATCAGGAGG- 3'

(forward)

Tm (50mM NaCl) :55.6 ᵒc GC Content : 44.0% *

AMOUNT OF OLIGO 5.3= 19.1= 0.15 OD260 nmoles mg For 100 µM: add 191 µl LSD2 5' - CGCATCGGCATACGATTTCC- 3' Tm (50mM NaCl) *:56.6 ᵒc GC Content : 55.0%

(REVERSE)

AMOUNT OF OLIGO 5.6= 30.7= 0.18 OD260 nmoles mg For 100 µM: add 307 µl The primer sequence of LSDV attachment protein gene 137 bp fragment was selected for amplification of DNA, From positions: 65626- 65763. 96

4.1.13.4. Equipments 1- Thermal cycler (applied biosystem, Amp 9600 PCR system, ramp speed 9600). 2- Laminar air flow. 3- Micro centrifuge. 4- Sterile thin wall micro centrifuge tubes 0.2 ml capacity. 5- Ice buckets. 6- Latex gloves. 7- Spectrophotometer.

4.1.14. Material used for analysis of PCR product using Agarose Gel Electrophoresis 4.1.14.1. Agarose powder, molecular biology grade: (SPI, India). Agarose gel was prepared at concentration of 1.5 % 4.1.14.2. Tris Acetic acid EDTA (TAE) buffer 1X: 1. 40 mM Tris base (pH 7.6), Hydroxymethyle aminomethane, tromethamine, C3H11NO3.FW 121.14, Ultra pure, AMERICAN BIOANALYTICAL. 2. 20 mM acetic acid, HPLC GRADE REAGENT, INDIA, CH3COOH, M=60.05 g/mol 3. 1 mM EDTA, pH 8, Ethylenediaminetetra acetic acid disodium salt (Disodium ethylenediaminetetraacetate), C10 H14N2Na2O8 .2H2O, FW.292.24

97

- Preparation of EDTA 1 mM, pH 8. a.1 M= 292.24 g / 1 liter DW. b.1 mM = 0.29224 g / 1 liter DW. c. dissolve EDTA by magnetic stirrer and by gradual adding 10N NaOH till adjust to pH 8 by pH meter.

- Preparation of 20 mM acetic acid. 1M= 60.05 g/ l liter. 1 mM =0.06005 g/ 1 liter. 20 mM =1.201 ml / 1 liter.

- Preparation of 40 mM Tris. 1 M =121.14 g/ 1 liter. 1 mM=0.12114 g/ 1 liter. 40 mM=4.8456 g/ 1 liter.

- For preparation of 1 liter TAE buffer 1X: 1. Distilled water

600 ml

2. 40 mM Tris (pH 7.6)

4.8456 g

3. Add slowly acetic acid 20 mM 4. Add EDTA 1 mM, pH 8

1.201 ml 2 ml

Bulletin 6205 Rev A US/EG, 11-0864 1211 Sig 1211, Bio-Rad Laboratories, Inc. 98

4.1.14.3. Ethidium bromide: (Qiagen) It was prepared as stock of 10 mg/ml by dissolving 150 mg ethidium bromide in 15 ml dd. H2O. It was used as final concentration of 1μg/ml on stirrer for several hours to ensure complete dissolving. The solution was stored at room temperature wrapped in aluminum foil. 4.1.14.4. Gel Pilot DNA Loading Dye, 5x: (Cat. No. 239901, Qiagen, USA) It was mixed as 2 ml mixed with 10 ul of the PCR product to obtain 1X then the mixture was loaded into wells of the gel matrix using monochannel micro-titer pipette. 4.1.14.5. Gel Pilot 100 bp plus DNA ladder: (Cat. No. 239045, Qiagen, USA), 2% agarose. It was suitable for sizing linear double-stranded fragments from 1500 bp to 100 bp on gel electrophoresis supplied as sachet with data sheet. 4.1.14.6. Equipments: 1- Microwave (Panasonic). 2- Electrophoretic machine (Biometra)®. 3- UV transilluminator (Biometra)®. 4.1.15. Material used for purification of PCR product and sequencing: 4.1.15.1. QIAquick® PCR Purification Kit: septemper 2011, Link: 2012.igem.org/wiki/images/a/a3/QIAquick_PCR-purification.pdf. It is an extraction Kit for PCR product from the gel used as recommended by the manufacturer in the protocol of QIAquick® PCR purification kit Cat. Nos. 28104 and 28106 (Qiagen Inc., Valencia CA) with spin columns, buffers, and collection tubes for silica-membrane-based purification of DNA 70 bp to 10 kb fragments from gels (up to 400 mg slices).

99

4.1.15.2. Material used for gel electrophoresis of purified PCR product: As Gel electrophoresis (PCR product). 4.1.15.3. Cycle sequencing: BigDye® Terminator v3.1 Cycle Sequencing Kit. P/N 4337456, Link: https://www3.appliedbiosystems.com/cms/groups/mcb_marketing/.../cms _081527.pdf. 4.1.15.4. Purification after cycle sequence before injection: Using BigDye® X Terminator™ Purification Kit. Kit Contents: BigDye® X Terminator™ Solution and SAM™ Solution. For details P/N 4374408, Product P/N 4376487, Insert P/N 4376151, REV Printed in, California, USA, Product insert 27Dec2006 https://www3.appliedbiosystems.com/cms/groups/mcb_support/documen ts/generaldocuments/cms_042772.pdf. 4.1.15.5. Injection of sample into 3500 genetic analyzer (sequencer): 4.1.15.5.1. System Reagents: 1. Reagents Preserved at 4ºC: 1- POP-7™ 3500 Polymer (384 samples), (P/N 4393708): Performance Optimized Polymers. 2- Big Dye terminator (buffer). 3- Conditioning Reagent 3500 series, P/N 4393718. 4- Anode Buffer Container (ABC) 3500 Series, P/N 4393927. 5- Cathode Buffer Container (CBC) 3500 Series, P/N 4408256. 6- nuclease free water. 100

2. Reagents Preserved at -20 ºC: 1- Sequencing standard V3.1. 2-Hi- Di™ formamide, (P/N 4401457). 3- Big Dye® Terminator V3.1- Cycle Sequencing Kit (1,000 rxns), P/N 4337456. 4.1.15.5.2. Equipments: 1- Capillary Array 3500 (50 cm), P/N 4404685. 2- Septa Cathode Buffer Container 3500 Series, P/N 4410715. 3- 96 well- plate with septa. 4- Genetic analyzer 3500 (Sequencer) applied biosystem. 4.1.16. Material used for phylogenetic analysis of the sequence data: 4.1.16.1. Reference sequences of LSDV strains published on Gene Bank: Accession number of other LSDV strains were listed in table (3). Sequence data of these LSDV strains were published on gene bank and were used for multiple sequence alignments and phylogenetic analysis with the local LSDV isolated in this study. 4.1.16.2. Bioinformatics Programs: 4.1.16.2.1. BLAST and PSI-BLAST search programs: They were used for search of LSDV reference sequences in Gene Bank data base at National Center for Biotechnology Information (NCBI) on line.https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSear ch. 4.1.16.2.2. Clustal W and DNA star Mega: It is program for sequence alignment (Clustal W) and phylogenetic analysis (DNA star mega) of the LSDV nucleotide sequence.

101

4.2 Methods: 4.2.1. Preparation of suspected LSDV Samples: (OIE, 2010) It was carried out on skin scabs collected from suspected cattle using sterile scissor in sterile bottles containing 50% glycerol buffer saline pH 7.2 as following: 1- Scabs were transferred into sterile petri dish, cut into small pieces by sterile small scissor. 2- Transfer those pieces (about 200 mg) into 1.8 ml cryotube, with adding 1.5 ml physiological saline with antibiotic and antifungal solution. 3- Homogenization by homogenizer till formation of homogenized suspension. 4- Application of 3 cycles of freezing (-20) and thawing (room temperature) of homogenized suspension. 5- Centrifugation of thawed homogenized suspension at 3000rpm/15min. 6- Filtration of supernatant by plastic syringe filter (0.22µm-0.45µm). 7- Secondary filtration of supernatant was applied due to high contamination at collection), before inoculation into SPF-ECE, or stored at – 20 °C till used for isolation or PCR technique. 4.2.2. Isolation of suspected LSD virus in SPF-ECE: This method was carried out according to Van Rooyen et al.1969, in which SPF-ECE (4 for each sample) were examined (external and internal) and incubated in egg incubator at 37 Cº for 10, 11, or 12 days with daily examination by egg candler, regular shaking, ventilation and controlled humidity (70%). They inoculated via chorio-allantoic membrane (CAM) with dropped CAM method as following: 1- Candling of SPF-ECE for fertility, viability, then at embryo age of 10,11, or12 days with marking at sites where well developed CAM: a. The base of air cell, triangular area at the base of air cell beside large blood vessels, or b. base of air cell, triangular area at large blood vessels, or c. base of air cell, line at large blood vessels. 102

and marking of the embryo site. 2- Transfer the marked SPF-ECE eggs into sterile rack in vertical position under laminar air flow hood. 3- Disinfection of eggs by alcohol 70%. 4- Poring of the eggs at the top of the air cell by sterile egg porer. 5- Change the position of eggs into horizontal position. 6- Making small opening at the shell at site of triangular area or on the large blood vessels. 7- Apply the rubber teat at the top of the air cell for Suction of the air. 8- Inoculate 0.2 ml of prepared suspected viral sample by acute angle with slight penetration of the shell. 9- Sealing of triangular area and top of the air cell with paraffin wax then rotation of the inoculated egg around its longitudinal axis. 10- Incubate inoculated eggs in horizontal position at 37⁰C for 6- 8 days. 11- Daily examination of non-specific and specific deaths, during daily examination, chilling of dead eggs at 4⁰c/1hr, and after the end of incubation period, chilling of all inoculated eggs (dead or not), for harvestation. 12- Washing of CAM 3-5 times: inside the egg then by transfer it into petri dish containing physiological saline+ antibiotic+ antifungal solution. 13- Spread CAM well, and examined for detection of signs. 14-When lesion was not observed, two further passages were done and samples considered negative only if no signs observed after 3 passages. With each passage non inoculated SPF-ECEs were used as control. 4.2.3. Preparation of harvested CAM for serial passage of suspected LSD virus on SPF-ECE, and MDBK cells: 1- Harvested CAM was placed in sterile mortar and 2 ml of saline with antibiotic and antifungal solution was added. 2- Grinding of CAM by using a sterile pestle till homogenized suspension was formed then transfer the suspension into 2 ml epindorf tube and subjected for 2 cycles of freezing (-20 °C) and thawing (room temperature) of the suspension. 3- Centrifugation of the suspension at 3000 rpm for 5min then filtration of supernatant using syringe filter (0.22µm-0.45µm diameter), secondary filtration of supernatant was applied, then used for inoculation into SPF103

ECE, or MDBK cells, or stored at – 20 °C till used for isolation and PCR technique. 4.2.4. Propagation of suspected LSDV in MDBK cell line: 4.2.4.1. Subculture of MDBK cell line: This method was carried out according to Payment and Trudel (1993) as follows: 1- Examination of the sheet of cells in the vessel using inverted microscope. 2- Discard the spent cell culture media (yellow color). 3- Good washing for 3 times of the cell sheet using maintenance media without serum. 4- Place 3 ml trypsin-versene solution (roux bottle), 0.5 ml (10 ml prescription) and 1 ml (20 ml prescription). 5- Swirling the roux bottle or prescription at 37ºC or at room temperature till complete sheet detachment and dissociation of cells. (take long time at winter due to low temperature). 6- Shaking of flask or by pumping with automatic pipette for cell dispersion into solitary cells. 7- Examination under inverted microscope for sheet detachment and dissociation. 8- Place 200 ml growth media (Roux bottle), 20 ml (10 ml max. prescription) and 50 ml (20 ml max. prescription). 9- Cell counting and adjustment. 10- Distribute the cell suspension (100 ml / roux bottle, 10 ml / 20 ml prescriptions, 3 ml / tube, 200µl /well for plate). 11- Tightly closing the prescriptions, roux bottle, tubes and plates. 12- Examination under inverted microscope. 104

13- Incubation at 37ºCat dry incubator and daily examination till sheet formation. Cell counting using trypan blue exclusion method: 1- Mix 100µl trypan blue dye+ 400µl cell suspension by pipetting. 2- Place 10µl of mixture into haemocytometer chamber. 3- Cover the haemocytometer chamber with cover silde. 4- Counting under light microscope (adjust fine, filter). Counting method- in 5 secondary squares: Average live cells/ small square= = Average dead cells/ small square =

𝑁𝑜.𝑜𝑓 𝑙𝑖𝑣𝑒 𝑐𝑒𝑙𝑙𝑠 𝑖𝑛 𝑠𝑚𝑎𝑙𝑙 𝑠𝑞𝑢𝑎𝑟𝑒 5 𝑁𝑜.𝑜𝑓 𝑑𝑒𝑎𝑑 𝑐𝑒𝑙𝑙𝑠 𝑖𝑛 𝑠𝑚𝑎𝑙𝑙 𝑠𝑞𝑢𝑎𝑟𝑒 5

5: No of secondary squares. Cell viability = Cell density =

𝑎𝑣𝑒𝑟𝑎𝑔𝑒 𝑙𝑖𝑣𝑒 𝑐𝑒𝑙𝑙𝑠 𝑎𝑣𝑒𝑟𝑎𝑔𝑒 𝑑𝑒𝑎𝑑 𝑐𝑒𝑙𝑙𝑠

x100

𝐴𝑣𝑒𝑟𝑎𝑔𝑒 𝑙𝑖𝑣𝑒 𝑐𝑒𝑙𝑙𝑠 𝑥 𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛 𝑓𝑎𝑐𝑡𝑜𝑟 𝑣𝑜𝑙𝑢𝑚𝑒 𝑜𝑓 𝑎 𝑠𝑞𝑢𝑎𝑟𝑒 (𝑚𝑙 ) (0.004µ𝑙)

Total number of cells= cell density x volume (ml) 4.2.4.2. Inoculation of suspected LSDV in MDBK cell line: This method was carried out according to El-Nahas et al., (2011) as follows 1-Harvested CAMs and embryo heart and liver of inoculated SPF-ECE showing signs at the 3rd passage were prepared as previously prescribed and filtrated using syringe filter (0.22µm-0.45µm diameter).

105

2- Examination of the cell sheet under inverted microscope for 60–70 % confluency. 3- Under complete aseptic condition, remove the exhausted growth media then wash the cell sheet using 1X PBS for 3 times, 3ml each with discard of fluids completely. 4- Inoculate 0.15 ml of each prepared samples in 3 cell culture prescription (CAM, embryo heart and liver suspensions). 5- Swirl the prescriptions, tubes and plates, and incubate at 37⁰C for 30 min for adsorption time. 6- Place maintenance media (100ml / roux bottle, 10-20 ml / prescriptions, 3ml /tube, 200µl /plate.) then incubate at 37⁰C for 5-7 days till CPE formation. 7- Normal non-infected cells served as control. 8- Cells were examined for CPE then the infected cells were frozen and thawed three times, when the inoculated cell cultures show absence of CPE, two further passages were adapted. 4.2.5. Identification of suspected LSD virus isolate: 4.2.5.1. Transmission electron microscopy of suspected LSD virus isolate: It was applied in Transmission Electron Microscopy Unit, National Research Center, Dokki, Egypt. Inoculated CAM was prepared and examined under the transmission electron microscope using positive staining technique according to Bozzala and Russell (1992), modified as follows: 4.2.5.1.1. Sample Fixation: 1- The samples were embedded in 5% buffered glutaraldehyde for 4 – 12 hours.

106

2- The samples washed in sodium cacodylate buffer for 45 minutes with 3 changes, each one for 15 minutes. 3- The sample was fixed by embedding in 1% osmium tetraoxide in sodium cacodylate buffer for 2 hours. 4- Wash the sample in sodium cacodylate buffer for 45 minutes with 3 changes, each one for 15 minutes. 4.2.5.1.2. Sample Dehydration: The tissue pieces were dehydrated in ascending grades of ethanol; from 10% to 100%, 10 minutes in each one except the finally one 100% for 30 minutes for three changes (each one for 10 minutes). 4.2.5.1.3. Infiltration and embedding: 1- Treat the tissue pieces with 3 changes of acetone (100%) for 45 min each one for 15 minutes. 2- Tissue pieces impregnation with the epoxy resin as Epon (812) mixture, is done by immersion in a mixture of equal parts of resin mixture and acetone for 8 hours, then in mixture of 75/25 epoxy resin and acetone for 8 hours, then in two changes of pure resin for each 8 hour. 3- Finally, embed the tissue pieces in pure resin and leave for 48 hours in oven at 60ºC for resin polymerization for formation of tissue blocks. 4- Semi-thin sections were cut from these blocks by Ultracut Ultramicrotome, stained with methylene blue and examined by the light microscope. 5- Ultrathin sections obtained from selected blocks (by tissue cutter) by Ultracut Ultramicrotome are mounted on copper grids, and doublestained with uranyl acetate and lead citrate. 6- Then examined with Transmission Electron Microscope.

107

Tissue Blocks Semithin Section Under Ultracut for selection

The semi thin section 2 µm

of tissue by tissue cutter for ultracut section

The grid on filter paper during staining

Semithin section of CAM under light microscope

The Ultrathin section_1.3µm

Fig_5. material and method of TEM.

108

4.2.5.2. Histopathological examination: The specimens were fixed in 10% buffered neutral formalin and processed till paraffin sections were prepared for the light microscopy study. 4.2.5.2.1. Preparation of specimens for light microscopy: Specimens 1 cm3 were used in light microscope study according to the method and technique quoted from Bancroft and Gamble (2002). The specimens were washed in distilled water for removal of blood clots and other debris, then fixed in 10% buffered neutral formalin, dehydrated in ascending grades of ethyl alcohol, cleared in xylene and embedded in paraffin wax. 5µm thick sections were cut, place onto glass slides, and stained with Harris's hematoxylin and eosin stain for general histology of the specimens. 4.2.5.2.2. Method of staining, the following steps were applied: 1- Place the slide in xylene to remove paraffin. 2- Place the slide in alcohol to remove xylene. 3- rinse with distilled water. 4- Place the slide in hematoxylin stain for 1-2 minute. 5- Rinse with distilled water. 6- Place the slide in eosin for 2-3 minute. 7- Rinse in distilled water. 8- Dehydrate in ethyl alcohol 99%. 9- Place the slide in xylene. 10- Cover the slide by cover slide using Canada balsam then representative fields were photographed for morphology.

109

4.2.5.3. Haemagglutination test (HA): HA test was applied according to Payment and Trudel (1993): 1- The samples of examined LSDV were prepared in sterile NaCL 0.9% then mixed with equal amount of 1% cattle, sheep, goat, and chicken RBCs suspension in a plastic U shape bottom micro-titer plate as 50µl from each reactant. 2- Control negative sample was put in another well together with 50µl of RBCS and a control RBCs was placed as 50µl of RBCs in saline into one well of the plate. 3- Slight shaking of the plate is performed then the plate was incubated at 4ᵒC for 30 – 45 minutes until complete sedimentation of RBCs control. 4- Positive result was recorded as the occurrence of haemagglutination which was represented by lattice formation, while negative result was recorded as the absence of haemagglutination which was represented by button formation. 4.2.5.4. Serological identification of suspected LSDV isolate using Indirect Fluorescent Antibody Technique (IFAT): According to Davies et al. (1971) and Mishra and Mallick (1997)) A- On CAM of inoculated SPF-ECE: It was carried out as follows: 1- CAMs (which revealed the lesions) was spread on glass slide, followed by air dryness, and then fixed in cold acetone (-20°C), then incubated at 4 °C for 30 minutes. 2- The CAM was covered by 25µl standard LSDV antiserum then incubated at 37°C for 30 minutes (to allow antigen antibody reaction). 3- The CAM was washed for 3 times by 1 X PBS (to remove the unconjugated antibodies), then dried. 4- The CAM was finally stained with anti-bovine immunoglobulin conjugated with fluorescein Isothiocyanate (diluted to 1:200).

110

5- Incubation at 37°C for 30 minutes (to allow the conjugation of labblled antispecies antibody) with exposure to U.V light (for activation of fluorescence dye). 6- The CAM was washed for 3 times by 1 X PBS. 7- Mounting by fine drop of buffered glycerin, then examined by fluorescence microscope. B- On inoculated MDBK cell It was carried out on infected MDBK cells for detection of specific fluorescence of LSDV as following: 1- Permanent cell line of MDBK cells were grown on glass cover slips in Leighton tubes. 2- The culture tubes from which the growth medium had been discarded were inoculated with 0.2 ml of each of two suspected isolates from the third passage and incubated at 37ºC for one hour for virus adsorption. 3- After adsorption, 2 ml of medium supplied with 3% new born calf serum was added to each tube and incubated at 37ºC. 4- After 18-24-hour post inoculation cell sheet showing 50% CPE were used for IFAT. 5- The maintenance media was discarded and the cells attached to the cover slips were washed three times with PBS and fixed in cold acetone ( 200C), then acetone was discarded, air dryness, incubation at 4ºC/15 – 20 minutes. 6- The fixed cells were covered with 25µl of specific reference LSDV antiserum, incubated at 370C for one hour. 7- The cover slips were washed 3 times in PBS (PH 7.4). 8- 25µl of anti-bovine immunoglobulin conjugated with fluorescein Isothiocyanate stain diluted 1/200 were added to cover slips, incubated for one hour at 37ºC. 9- The excess of the conjugate was discarded and cells were washed 3 times with PBS, mounting, and examined under the fluorescence microscope (Olympus- Tokyo- Japan) U.V microscope with 10X ocular and 25X fluorite and 40X achromatic under dark field). Negative control cover slips consisted of non-infected MDBK cells were stained in the same way.

111

4.2.6. Molecular detection and characterization of Suspected LSDV Isolate: Molecular characterization of suspected isolated LSDV particles was done using PCR according to Tuppurainen et al., (2005), using a modified method. 4.2.6.1. Extraction of DNA: Extraction of DNA of LSDV from tissue samples (S1 scab, S2 scab). using DNeasy® Tissue Handbook kit, (Qiagen, USA) according the instructions of the kit manufacturer, while extraction of DNA of LSDV from prepared tissue samples suspensions (S1, CAM, embryo liver, cell culture supernatant). using QIAamp® DNA Mini and Blood Mini Handbook kit. (Qiagen, USA) according the instructions of the kit manufacturer. 4.2.6.2. PCR: DNA amplification was performed in 25 μl volume reaction mix as follow: Volume / reaction 12.5 μl 1 μl 1 μl 5 μl

PCR reaction Qiagen® PCR Master mix. Upstream primer Downstream primer DNA sample DNA purity:1.4, 1.5, 1.6.

Final concentration 1X 10 pmol 10 pmol 20-30 ng

Up to 25 μl

Nuclease free water

The thermal profile for primer 1 (LSDV1) was as following: Stage 1

Description Denaturation

2

Amplification 40 cycles

Temp. 94 ᵒC 94 ᵒC 52 ᵒC 72 ᵒC 112

Time 5 min 30 sec 30 sec 30 min

3

Final extension

72 ᵒC

7 min

The thermal profile for primer 2 (LSDV2) was as follow: Stage 1


2

Amplification 40 cycles

3

Final extension

Temp. 94 ᵒC 94 ᵒC 52 ᵒC 72 ᵒC 72 ᵒC

Time 5 min 30 sec 30 sec 30 min 7 min

The reaction was carried out in applied biosystem, Amp 9700 PCR system, ramp speed 9700.

4.2.6.3. Analysis of a Polymerase Chain Reaction (PCR) product using Agarose gel electrophoresis: E. Crandall/P.Barber, ProtocolGel - Agarose Electrophoresis https://www.coursehero.com/file/7572635/ProtocolGel, IRELAND, D.C. & BINEPAL, Y.S. 1998.

After the end of PCR run, the product was analyzed in agarose gel electrophoresis using 1.5 % agarose gel in TAE buffer stained with ethidium bromide as following: 1. Agarose powder

1.5 g

2. Tris acetic acid EDTA buffer 1X

100 ml

3. For a 1.5 % agarose gel, 1.5 gram of agarose (molecular biology grade) was weighed in a flask with addition of 100 ml of TAE buffer. 4. Melting of the mixture at microwave, repeat heating and swirling procedure every 10 seconds until mixture become clear with continuous shaking and avoid gel boiling. 113

5. After complete melting (gel become clear), place 2µl ethidium bromide (1µg/ml). 6. A slot former (comb) was placed in the gel box adjusted such that bottom of the slots was approximately 1 millimeter above horizontal surface of the gel box. 7. Pouring the melted gel in electrophoretic tray. (the amount of poured gel differs according to tray size. 8. With care, remove the comb after the solution become gelled to obtain the suitable wells. 9. the gel box filled with 1X TAE electrophoresis buffer such that the gel was completely submerged. 10. The DNA samples were prepared 5 μl of DNA as PCR product and 3 μl of 5 X gel loading buffer (Ambion)® to obtain 1X loading dye. 11. DNA ladder 5 μl (Gel pilot 100 bp plus, ladder 100) as a molecular marker was mixed with 3 μl of 5X gel loading buffer co-electrophoresed with the DNA samples of PCR product. 12.Electrophoresis was performed using a submarine-type apparatus (Biometra)® by running the gel at a constant voltage of approximately 106 V/cm, 155 amper for about 1 hour or until the bromophenol blue band has migrated half way down the gel. 13. The gel was then examined using ultraviolet trans-illuminator at a wave length of 590 nm and photographed. 14. Positive reactions were confirmed according to size of the amplification product in comparison to the base pair marker. 4.2.7. Purification of PCR product and sequencing: 4.2.7.1. Purification of PCR product: Purification of the PCR product of LSDV antigen attachment protein gene was performed following the procedure described by the

114

manufacturer in QIAquick® PCR Purification Kit (Cat. No. 28104 and 28106),http://2012.igem.org/wiki/images/a/a3/QIAquick_PCRpurification.pdf Gel slices are dissolved in the buffer containing a pH indicator, allowing easy determination of the optimal pH for DNA binding, and the mixture is applied to the QIAquick spin column (see figure "pH Indicator Dye"). Nucleic acids adsorb to the silica membrane in the high-salt conditions provided by the buffer. Impurities are washed away and pure DNA is eluted with a small volume of low-salt buffer provided or water, ready to use in all subsequent applications. 4.2.7.2. Gel electrophoresis of purified PCR product: Gel electrophoresis of the purified PCR product was carried out on 1.5% agarose gel as mentioned before except volume of sample in the gel well is 2µl. 4.2.7.3. Cycle Sequencing: Sequencing of the purified product of the PCR reaction of the amplified gene of LSDV (attachment protein gene) was performed following the procedure described by the manufacturer in Big Dye® Terminator v3.1 Cycle Sequencing Kit.

DNA sequencing was performed in 10 μl volume reaction mix as following: Component Big Dye Terminator 5x Sequencing Buffer Forward primer (3.2 pmol) Template (20 ng) Nuclease Free Water

Volume 2 µl 2µl 1µl 1µl Up to 10 µl

115

Control pGEM protocol in 20 μl volume reaction mix as follow: Component Big Dye Terminator 5x Sequencing Buffer Control Primer (3.2 pmol) Control Template (20 ng) Nuclease Free Water Total

Volume 4 µl 4 µl 4 µl 1 µl Up to 20 µl 20 µl

Thermal Profile: Stage 1


Temp. 96ºC 96ºC 52ºC 60ºC 4ºC

Time 1 min 10 sec Amplification 2 5 sec 25 cycles 4 min 3 Holding Pause was performed using applied biosystem, Amp 9600 PCR system, Ramp Speed must be slow (1ºC /sec.). 4.2.7.4. Purification after cycle sequence before injection: Purification of the product of PCR amplified gene of LSDV antigen binding protein was performed after cycle sequencing before injection following the procedure described by the manufacturer in BigDye® X Terminator™ Purification Kit. Kit Contents: BigDye® X Terminator™ Solution and SAM™ Solution. 4.2.7.5. Injection of the sample into the sequencer: Loading the sample into 96 well- plate with septa was done as following: 1- In one well, place 10 µl Hi- Di™ formamide + 20µl sample.

116

2- In another well, place 10 µl Hi- Di™ formamide + 20µl standard sequencing as positive control. 3-Place the plate in PCR device (applied biosystem, Amp 9600 PCR system) for denaturation step 96ºC for 5 min, then placed on crushed ice to avoid renaturation. 4- Place the plate in the sequencer. 5- Run the device program software. 4.2.8. Computer-assisted sequence and phylogenetic analyses ( according to Thompson et al., 1994), 4.2.8.1. BLAST and PSI-BLAST search programs: Alignment and calculation of homology between sequences of the isolates of LSDV and other published LSDV sequences in Gene Bank data base at National Center for Biotechnology Information(NCBI)on line.https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch. 4.2.8.2. Clustal W and DNA star mega: It is program for sequence alignment and phylogenetic analysis of the nucleotide and amino acid sequences of the isolates of LSDV and other published LSDV sequences in Gene Bank data base at National Center for Biotechnology Information (NCBI).

117

118

5-RESULTS 5.1. Isolation of LSD virus from Skin Nodule (scab) Samples on Specific Pathogen Free Embryonated Chicken Eggs (SPF-ECE):

Two skin lesion samples; S1 and S2 from clinically suspected Cattle showing signs of disease at Qaliubiya province, Egypt were inoculated in SPF ECE via CAM route. It was found that 2 samples induced lesion on CAMs by the 1st passage and signs on the embryos by the 2nd passage and these changes continued till the 3rd passage. BY examination of the collected chorio-allantoic membranes a hemorrhagic membrane with congestion and clotted blood in blood vessels appeared by the 1st passage then pock lesions were detected in the form of stretched white line, which became more pronounced after 6 days of inoculation at 2nd and 3rd passages. The dead embryos were hemorrhagic, edematous, with enlarged and bloody liver and clotted blood inside the heart as shown in

(table_ 6) and (photo_2 & 3 ).

119

(Table _ 6 ): Alterations on CAM and Embryo of SPF-ECE inoculated with two suspected skin samples for LSD virus. Passage No.

First Second

S1

S2

CAM Hemorrhagic and congested

Normal

Congested

Death,

Pock lesions

edema with

stretched

with clotted

blood inside

blood vessels

Embryo

CAM Hemorrhagic and

Embryo Normal

congested hemorrhage, enlarged

bloody liver

in the form of

Normal

white line

and clotted

blood inside

the heart with slight

hypertrophy Third

Congested

Death,

with clotted hemorrhage, blood inside edema with blood vessels enlarged bloody liver

Pock lesions

in the form of

Normal

stretched

white line

and clotted

blood inside

the heart with slight

hypertrophy The signs were observed 6days post-inoculation, S1: first skin suspected viral sample, S2: second skin suspected viral sample.

120

A

B C

C

(Photo_2): Characteristic lesions of two suspected skin samples (S1&S2) st

nd

rd

for LSD virus on CAM of SPF-ECE after 1 (A), 2 (B) and 3 (C) passages where the left (control), the middle (S1) and the right (S2). The black arrows refer to lesion.

121

A

B

C

(Photo_3): Characteristic signs of two suspected skin samples (S1&S2) for LSD virus on embryo of SPF ECE where the (A) and (B) were the 2 rd

nd

and

3 passages of S1 respectively, while S2 resembling the negative control (C). 122

5.2. Propagation of suspected LSD virus isolate on MDBK cells: The positive CAM of the 2

nd

passage of suspected samples was

prepared and inoculated on MDBK cell line. It was observed that infected cell culture was characterized by cell rounding, cell aggregation, coalesce together to form clusters that scattered all over the monolayer within 72hr post inoculation and gradually increased till 70-80 % of sheet was completely detached. These findings were demonstrated in (photo_5) as compared with normal control monolayer demonstrated in (photo _4).

(Photo_ 4): unstained (left, 20X) and stained (H&E, right, 40x) Control non- infected complete sheet of MDBK cells.

123

(Photo_5): characteristic CPE of suspected LSD virus isolate 72hrs post inoculation on MDBK cells in the form of rounding, coalescing and sheet detachment. The left (low power 10X), and the right (high power 20X).

124

(Table_ 7): Characteristics of suspected LSD virus isolate strain on SPFECE and MDBK cell line. Suspected LSD virus isolate strain

SPF-ECE CAM

MDBK Embryo

Congested with

Death,

Rounding,

inside blood

edema with

sheet detachment

clotted blood

vessels and Pock lesions in the

haemorrhage, enlarged and

bloody liver and

form of stretched clotted blood white line

inside the heart with slight

hypertrophy

125

coalescing and

within 72hr post inoculation

5. 3. Non Serological identification of suspected LSD virus isolates: 5.3.1. Histopathological examination of intracytoplasmic inclusions: Histopathological examination of inoculated CAM with suspected LSD viral samples showed slight proliferation in the ectodermal and mesodermal cell layers with large eosinophilic intracytoplasmic inclusion bodies characteristic for poxviridae (photo _6).

(Photo_6): stained inoculated CAM with suspected LSD viral samples. The arrows refer to eosinophilic intracytoplasmic inclusions in ectodermal cell and mesodermal cell layers (H&E_ 100X, oil emersion lens). 126

5.3.2. Transmission Electron Microscopy (TEM):

The electron microscopic examination of inoculated CAM with

suspected LSD viral samples revealed, that the infected cells contained few virus particles that appeared ovoid in shape, with rounded ends. high aggregates of viral proteins were present as inclusions in the cell cytoplasm. The characteristic virus particle was released from the cellular membrane by budding as shown in (photo_7).

127

1

2

3

4 (Photo_7): Electron micrographs of inoculated CAM with suspected LSD viral sample Stained with uranyl acetate and lead citrate. The arrows refer to budding of virus particle from the membrane (plasma and Golgi membranes 1,2). Note the aggregation of viral inclusion bodies (3). The virus particles appeared as ovoid in shape, with rounded ends (4). 128

5.3.3. Haemagglutination (HA) property: Examination of HA property of suspected LSD viral isolate for cattle, sheep, goat and chicken RBCs cleared that the isolate was non HA produce button shape resembling to the negative control sample as shown in (photo_8).

RBCS contr

Control ve

Viral sample

(Photo_8): HA micro-well plate with negative results of HA property (button shapes) of LSD virus isolate compared with negative control.

129

5. 4. Serological identification of suspected LSD virus isolate using IFAT: Indirect FAT was adapted for identification of LSD virus protein in infected CAM and infected MDBK monolayer with CAM and embryo liver and heart suspensions using specific hyper immune serum against LSD virus. It was observed, that specific intracytoplasmic yellowish green fluorescent granules emitted from the infected CAM (S1) (photo_9) and infected MDBK cells with CAM suspension (S1), from the infected MDBK cells with embryo liver and heart suspensions (S1) and infected MDBK cells with CAM suspension (S2). (photo_10).

130

(Photo_9): Stained infected S1 CAM (the upper, 4X) with FITC. Notice intracytoplasmic apple green fluorescence emission as a positive result for local LSD virus isolate.

131

(Photo_10): Stained infected MDBK cells with FITC after 72 hours post inoculation (S2 CAM suspension). Notice intracytoplasmic apple green fluorescence emission as positive result for local LSD virus isolate (20X).

132

5.5. Molecular identification of the recent local LSD virus isolate from cattle at Qaliubiya province, Egypt: Using Conventional Polymerase Chain Reaction (PCR): Two types of primer pairs were used for detection of the local LSDV strain in original skin samples (tissue & suspensions), infected CAM and embryo liver suspensions. The first primer (primer pair 1) targeted the LSDV attachment protein encoding gene was failed to amplify the specific products 172bp from the extracted DNA products using PCR and dimers appeared. The second primer (primer pair 2) targeted the LSDV envelope protein-like gene was succeeded to amplify the specific products 137bp from the extracted DNA products using PCR and the bands were ambigious. The amplified products 137bp with the second primer pair were clear and sharp by increasing the DNA concentration from target (photo_ 11). The resulted fragments were further purified and analyzed by gel documentation system for sequencing process and showed that three sharp bands had the sizes 137bp and two faint bands 137bp.

133

L

1

3

2

4

5

100bp Faint bands

(Photo_11): Electrophoresis of the amplified products 137bp of the envelope protein-like gene for local LSDV strain from different sources using the second primer after target concentration. Lane L: High molecular weight nucleic acid marker (100bp), Lane 1: S1 scab suspension, Lane 2: S1 CAM suspension, Lane 3: embryo liver suspension, Lane 4: S1 scab tissue, Lane 5: S2 scab tissue.

134

5.6. Partial Sequencing and Genbank submission of the envelope protein-like gene for the recent local LSD virus strain from different sources: The purified PCR products for the local LSDV strain from different sources were sequenced using automatic DNA sequencer. Analyzed sample data is displayed as an electropherogram, a sequence of peaks in four colors. Each color represents the base called for that peak. The fasta format for sequence were prepared and published in Genbank with their name and accession numbers; LSDV-Elkady-2014 (KU760905) from original skin suspension (S1), LSDV- Elkady-3-2014 (KX236312) from skin scab tissue (S1), LSDV-Elkady-4-2014(KX236313) from skin scab tissue(S2),

LSDV-Elkady-2-2014

suspension(S1),

(KX236311)

LSDV-Elkady-5-2014

suspension(S1)(repeated),

(KX250367)

LSDV-Elkady-1-2014

from from

(KX236310)

CAM CAM from

embryo liver of SPF-ECE (fig 6& 7). The electropherogram data looks mostly blank for CAM (Dirty sequence) so repeated and both were analyzed.

135

LSDV-Elkady-2014 (Acc.no .KU760905) from original skin suspension (S1)

GGTGTAAATTTTTCAGAATTATTTTTCTGGATTATGTAATGCTCTTTGTACAAAAGAGGCA AAAAGTTCTATTGCGAAACACTTTAGTTTATGGAAATCGTATGCCGATGCGA

LSDV- Elkady-3-2014 (Acc.no.KX236312) from skin scab tissue (S1)

TTTCCAGGAAATATTTTTTTCTGGATTATGTAATGCTCTTTGTACAAAAGAGGCAAAAAGT TCTATTGCGAAACACTTTAGTTTATGGAAATCGTATGCCGATGCGAA

LSDV-Elkady-4-2014(Acc.no.KX236313) from skin scab tissue (S2)

AAATTTTTTCTGGATTATGTAATGCTCTTTGTACAAAAGAGGCAAAAAGTTCTATTGCGAA ACACTTTAGTTTATGGAAATCGTATGCCGATGCGAA

(Figure_ 6): The partial sequence profile of LSDV envelope protein-like gene detected in the skin suspension, S1 and S2 samples. Note the name and accession no. for the strain. The electropherogram showing data analyzed with the KB™ basecaller and the fasta format for each sequence. 136

LSDV-Elkady-2-2014 (Acc.no.KX236311) from S1 CAM suspension

GGGGGCCCGAAACGATTTTCAGGATATGTAATGCTCTTTGTACAAAAGAGGCAAAAAGTTCT ATTGCGAAACACTTTAGTTTATGGAAATCGTATGCCGATGCG

LSDV-Elkady-5-2014 (Acc. no. KX250367) from S1 CAM suspension (repeated)

GCTGGTTAGAAGGTAAATTTCTGGATTATGTAATGCTCTTTGTACAAAAGAGGCAAAAAGTT CTATTGCGAAACACTTTAGTTTATGGAAATCGTATGCCGATGCGA

LSDV-Elkady-1-2014 (Acc. no. KX236310) from embryo liver suspension

GCCGGCCCAAAAGGGTAAATTATTCTGGATTATGTAATGCTCTTTGTACAAAAGAGGCAAAA AGTTCTATTGCGAAACACTTTAGTTTATGGAAATCGTATGCCGATGCGA

(Figure_ 7): The partial sequence profile of LSDV envelope protein-like gene detected in CAM and embryo liver for our strain. The electropherogram showing data analyzed with the KB™ basecaller and data looks mostly blank for CAM (Dirty sequence) so repeated. Note the name, accession no. and the sequence fasta format for the strain. 137

5.7. Partial Sequence analysis and alignment of the envelope protein-like gene for the recent local LSD virus strain from different sources: The partial sequence analysis and alignment report of the envelope protein-like gene for the recent local LSD virus strain from different sources using Clustal W showed high nucleotide similarity of the strain in their different sources with identity percent from 98 to 100%. The isolate sources (CAM and the embryo source) show 100% and 98.9% homology with their skin original samples; respectively. The embryo source shows 98.9% homology with CAM source (fig 8& 9) The phylogenetic tree was constructed to calculate and examine the evolutionary relationships of the sequences, in which the length of the horizontal line connecting one sequence to another is proportional to the estimated genetic distance between the sequences (fig 10).

138

Figure (8): alignment report of partial nucleotide sequences for the envelope protein-like gene of local LSDV strain from different sources.

Figure (9): pair wise sequence distance for the envelope protein-like gene of local LSDV strain from different sources.

Figure (10): phylogenetic tree of local LSDV strain from different sources based on partial nucleotide sequence of the envelope protein-like gene.

139

5.8. Partial Sequence analysis and alignment of the envelope proteinlike gene for the recent local LSD virus strain from different sources with the reference LSDV, Sheeppox virus and goatpox virus published in Genbank : The partial sequence of the envelope protein-like gene for the recent local LSD virus strain from different sources with the reference LSDV, Sheeppox virus and goatpox virus published in Genbank were analyzed using Clustal W. The alignment report and the pair-wise table were showed high nucleotide similarity of the strain in their different sources with LSDV- NI-2490 isolate Neethling 2490 (AF325528), LSDV/ NW/LW isolate

Neethling

Warmbaths

LW

(AF409137),

LSDV/2/Slemani/Kurdistan/2014 envelope (KM047051) and LSDV-B4 envelope protein (P32) gene (KT253438), then other LSDV strains and followed by Sheeppox and goatpox viruses. Both LSDV- NI-2490 isolate Neethling 2490 (AF325528) and LSDV/ NW/LW isolate Neethling Warmbaths LW (AF409137) revealed percent homology of 100% with LSDV-Elkady-5-2014 (KX250367) , 94.3% with LSDV-Elkady-2014 (KU760905) and 98.9% with other strain sources include, LSDV-Elkady-1-2014(KX236310), Elkady-2-2014 (KX236311), LSDV-Elkady-3-2014(KX236312)and

LSDV-Elkady-4-

2014(KX236313).TheLSDV/2/Slemani/Kurdistan/2014 (KM047051) revealed percent homology of 100% with LSDV-Elkady-5-2014 (KX250367), 93.7% with LSDV-Elkady-2014 (KU760905) and 98.9% with other strain sources, while LSDV-B4 (KT253438) showed percent homology of 100% with LSDV-Elkady-5-2014 (KX250367), 93.3% with LSDV-Elkady-2014 (KU760905) and 98.7% with other strain sources (fig 11& 12). 140

Figure (11): Alignment report of partial nucleotide sequences for the envelope proteinlike gene of local LSDV strain from different sources with the reference LSDV, Sheeppox virus and goatpox virus published in Genbank.

141

Figure (12): pair wise sequence distance for the envelope protein-like gene of local LSDV strain from different sources with the reference LSDV, Sheeppox virus and goatpox virus published in Genbank.

142

5.9. Phylogenetic analysis of the recent local LSD virus strain from different sources with the reference LSDV, Sheeppox virus and goatpox virus published in Genbank: clustal W analysis of the recent local LSD virus strain from different sources and other published LSDV, Sheeppox virus and goatpox virus strains in Genbank was performed based on the partial nucleotide sequence of the envelope protein-like gene as shown in figure (13). The phylogenetic tree was constructed to calculate and examine the evolutionary relationships of the sequences, in which the length of the horizontal line connecting one sequence to another is proportional to the estimated genetic distance between the sequences. The analysis can distinguish between viruses of LSD, sheep pox and goat pox viruses are grouped separately, even though our strain resources were related to each other

and

to

the

other

LSDV

include,

LSDV-

NI-2490

(AF325528),LSDV/ NW/LW(AF409137),LSDV/2/Slemani/Kurdistan/ 2014(KM047051) and LSDV-B4 (KT253438). Our strain seems to be related more closely to LSD virus than to sheep pox virus and goatpox viruses.

143

Figure (13): phylogenetic tree of local LSDV strain from different sources with the reference LSDV, Sheep pox virus and goat pox virus published in Genbank based on partial nucleotide sequence of the envelope protein-like gene.

144

145

6- DISCUSSION, CONCLUSION AND RECOMMENDATION Lumpy skin disease virus (LSDV), a member of the genus Capripoxvirus, belongs to family poxviridae with typical poxvirus geomorphology and closely related to the viruses of sheep and goat pox (MacLachlan and Dubovi, 2011). The genome is a150,000bp long double-stranded DNA, covalently cross-linked at the ends, similarly to other pox viruses. Capripox virus genomes sequences are highly conserved and there is more than 95% homology amongst LSD, sheep pox and goat pox viruses (Kara et al., 2003). It causes an acute, subacute or chronic disease of cattle, characterized by fever and the formation of multiple firm, circumscribed nodules in the skin of affected animals and necrotic plaques in the mucous membranes, as well as generalized lymphadenopathy (Buller et al., 2006). It was transmitted by biting insects, especially blood-feeding insects, such as the mosquito (Chihota et al., 2001), and there is a real danger that LSDV could spread from Africa (Egypt) (House et al., 1990) into Asia and Europe through the Middle East and vice versa. The Control of LSDV is achieved in endemic countries through the use of attenuated live virus vaccines (Brenner et al., 1992). In Egypt LSD was appeared first among imported and native breed of cattle in Suez at 1989, the disease was spread rapidly and diagnosed after El-tall El-Kbeer (Ismailia) out break (House et al, 1990). Reappearance of LSD was observed by EL-Bagoury et al., 1995 during Minia outbreak. Then during late summer and autumn of 2006 in different Egyptian governorates (Stram et al,2008), and during 2010 in cattle and buffaloes at Qaliubiya province (El-Nahas et al,2011). In the present study a massive outbreak of suspected LSD in cattle population were observed during 2013 and 2014 at Qaliubiya province.

146

Because, it is clear that there are many diseases causing similar signs like pseudo lumpy skin disease, dermodicosis, oncocercasiosis, insect bite allergies, BVD, bovine malignant catarrhal fever, Rinderpest (Alexander et al,1957 and weiss1968), it is important to obtain a definite diagnosis to ensure the best preventive and control measures for the herd. The present study concerned with the trial for isolation of LSD virus from skin lesions of cattle from Qaliubiya province, Egypt on CAM of SPFECE and MDBK cell line with further identification by non -serological and serological means as well as advanced molecular characterization of virus isolate using PCR and sequencing with establishment of a phylogenetic tree between the local LSDV strain from different sources, sheep pox and goat pox viruses. Knowledge of capripoxvirus pathogenesis demonstrates that skin lesions are the most useful samples for virus isolation (Bowden et al., 2008). Our field isolate was able to replicate in CAMs and Embryos of SPFECE and MDBK cell line. The CAMs of S1 were hemorrhagic with clotted blood in blood vessels appeared by the 1st passage at the last day of incubation (the 7th day of inoculation), and become more pronounced after the 6th day of inoculation within the 2nd and 3rd passage, moreover the embryo died at the 2nd and 3rd passage at the 6th day of inoculation, the dead embryos were hemorrhagic, edematous, with enlarged and bloody liver (hepatomegaly) and clotted blood inside the heart, with slight hypertrophy ( this may be due to the virus affects the endothelial cells), whereas the CAMs of S2 were hemorrhagic at the 1st passage at the 9th day of inoculation, while at the 2nd passage pock lesion were detected in the form of stretched white line (this line may be due to the cell to cell transfer of the virus) at the 8th day of inoculation, and become more pronounced at the 3rd passage (8th day of inoculation), while the embryos of S2 not died at any of the three passages. The development of lesion on CAM was firstly observed by Alexander et al., 1957 and Van Rooyen et al., 1969 and varied from thickening and congestion (Badr et al,2008; El-Kenawy and El- Tholoth,2011) to clearly visible pock lesion (Woods, 1988; House et al., 1990) that appeared like numerous, small, scattered white foci (El-Nahas et al,2011). Characteristic pock lesions were observed after 1st passage and become clear after 3rd passage (Tamam,2006) and become clearly observed 4days post inoculation (Abdel-Rahim et al. 2002; El-Desawy et al, 2008). 147

Sequential detection of lesion on CAM by El-Kenawy and ElTholoth,2011, at day 1, small hemorrhagic areas are seen at site of inoculation on CAM (non-specific), at day 2, thickening of the membrane and become congested and hemorrhagic, at day 3, white and opaque area around site of inoculation, at day 4, this white and opaque area increase in size, at day 5, opaque, pin point pock lesions arranged in streaks, at day 6, opaque pin point pock lesions arranged in streaks. The maximum yields of LSDV in CAM were 5 to 6 days (Van Rooyen et al., 1969, El-Nahas et al, 2011). The cell rounding, aggregation, coalescing and detachment within 72hr post inoculation of our LSDV isolate on MDBK cell line confirm the susceptibility of our isolate to this cell line. For Capripoxviruses isolation, the recommended cells are primary or secondary culture lamb testis or kidney cells. As an alternative, bovine cells can also be used. The cytopathic effect (CPE) of the virus on the cells can be seen in 1 week, although this can be up to 2–3 weeks, with several blind passages needed (Binepal et al., 2001). Vero cells are less sensitive to capripox virus (Bhanuprakash et al., 2006). The South African LSDV (type SANeethling) vaccine strain could passaged on MDBK cells and foetal bovine testes (FBT) cells (VanRooyen et al., 1969). The LSDV Neethling strain 2490 (LK) was originally isolated in lamb testes (LT) cells (Tulman et al., 2001). In study by Wallace and Viljoen 2002 they demonstrated that both wild type and lacZ recombinant of LSD virus grew to high levels in normal MDBK cells. The most susceptible cell culture to the local Egyptian isolates of LSDV were MDBK cells compared to EBL and CER cells as sequentially detected by CPE and infectivity titration (El-Bagoury et al., 1995). Also most Egyptian LSDV strains were successfully isolated on MDBK cells (Ahmed et al., 2005; El-Nahas et al, 2011). The surprise by our isolate was its signs on the Embryo of SPF-ECE in addition to its lesion on CAM and CPE on the MDBK cells indicating a new biological characteristic not observed by other Egyptian LSDV strains. This characteristic could be expected as LSDV encodes five proteins containing ankyrin repeat motifs that have been associated with host range functions and inhibit virally induced apoptosis (Mossman et al., 1996; Shchelkunov et al., 1998; Tulman et al., 2001). Characteristic eosinophilic intracytoplasmic inclusion bodies were detected in the ectodermal and mesodermal cell layers of stained CAM by hematoxylin & eosin that infected with suspected LSD viral sample. These inclusions were indicative for the presence of LSDV as a member of 148

capripoxviruses replicating in the cytoplasm and could differentiate from pseudo lumpy skin disease, caused by bovine herpesvirus 2 causing intranuclear inclusion bodies (MacLachlan and Dubovi, 2011). The intracytoplasmic inclusion bodies characteristic for LSDV was described in infected monolayers stained with hematoxylin & eosin or hematoxylinphloxin (Thomas and Mare, 1945) in histological sections of the skin lesions of animals suffering from LSD (Burdin, 1959) and in trypsenized cell of infected CAM with LSDV (Tamam 2006). Our isolate appeared ovoid in shape, with rounded ends by transmission electron microscope with electron dense inclusion in the cell cytoplasm and released particles through budding indicate Capripoxviruses. All virions of Capripoxviruses have an ovoid shape with an average size of 294×273 nm (Kitching and Smale, 1986, Woods 1988). This structure was observed in negatively stained skin biopsies for 33day post infection (Tuppurainen et al. (2005), in inoculated cell cultures with LSDV and the virus size was found to range from 300 - 350 nm with crescent or ovoid shape (Ahmed and Kawther 2008) and in inoculated CAM (El-Nahas et al, 2011). The histopathology and transmission electron microscopy confirm LSDV detection (Tageldin et al., 2014) and help in the differentiation between LSD from pseudo-LSD (MacLachlan and Dubovi, 2011). The non haemagglutinating property of our isolate emphasized the result of Matthews, 1982, who mentioned that Capripoxviruses are nonhaemagglutinating. Though all the haemagglutination tests consist basically of an indirect haemagglutination test (Tiwari et al., 1996; Rao et al., 1997). Capripoxvirus isolation can be confirmed by immunostaining using anti-capripoxvirus serum (Gulbahar et al., 2006; Babiuk et al., 2007). The OIE (2004) recommended serological tests used for LSD diagnosis are IFAT, ELISA and VNT. Gari et al. (2008) demonstrated that IFAT has high accuracy to be used for the diagnosis and sero-surveillance analysis of LSD in the target population. The IFAT detect the LSDV antigen in the skin and internal organs of naturally infected cattle (El-Kenawy and ElTholoth, 2011). Examinations using FAT may indicate the presence of LSD virus antigens especially in the early stages of the disease (Davies et al., 1971). However, it is not possible to differentiate the different members of the capripoxvirus group with the direct or indirect FAT (Kitching et al., 1986), show brilliant, stippled cytoplasmic staining of virus-infected cells 24hr and 72hr post infection. This bright greenish 149

yellow fluorescence was observed on CAM (House et al., 1990) and in lamb testis cell cultures after 48 hours of inoculation (Davies et al., 1971). A sterile fluorescein conjugated anti-LSDV IgG with dilution 1/20 was prepared to detect LSDV in the MDBK cells using IFAT ( Razek, et al., 2009). Two local isolates of LSDV were successfully identified by IFAT using reference anti-LSDV hyper immune serum. Sequential detection of a specific intracytoplasmic and membranous fluorescence was developed in infected cells as early as 12hrs PI, become more intense and diffused at 48hr and 72hr PI (El-Bagoury et al., 1995). Several passages of LSDV on SPF-ECE and MDBK cells were identified by IFAT (Ahmed et al., 2005; Tuppurainen et al.,2005; El-Nahas et al, 2011). LSD, goat pox and sheep pox viruses are serologically identical, and so their specific identification relies exclusively on the use of molecular tools (Le Goff et al 2009). In addition, SPPV and GTPV are extremely host specific (Rao and Bandyopadhyay, 2000), but in some countries both viruses can cross infect sheep and goats, which poses a problem in diagnosis. Although recent molecular studies suggest that the Capripoxvirus genus including SPPV, GTPV and LSDV are very similar in terms of antigenic characteristics, these viruses are phylogenetically similar and can be differentiated by accurate molecular techniques (Bhanuprakash et al., 2006). In our study, two types of primer pairs, the first targeted the LSDV attachment protein gene was failed to amplify the specific products (172bp) from the extracted DNA products using PCR and primer dimers appeared. The second primer pair targeted the LSDV envelope proteinlike gene was succeeded to amplify the specific products (113bp-104(107)111-108-97 from the extracted DNA products and the bands were clear and sharp by increasing the DNA concentration from target. The first primer pair was used by Ahmed and Zaher, (2008) and El-Kholy et al. (2008) who succeed to obtain the specific products from the original skin sample and other isolate resources. The failed primer pair in our study may be related to badly defined primers, incorrect primer specificity due to our strain differs from the existing strain or needs for optimal reaction conditions rather than mentioned by the author. The second primer pair was sensitive to detect LSDV strain in its original skin samples and their resources.

150

The PCR was a specific assay for specific detection of LSD virus in skin lesion (Stram et al. 2008, El-Nahas et al, 2011), CAMs and cell culture (El-Kholy et al. 2008, El-Kenawy and El-Tholoth, 2011), semen (Bagla et al. 2006) and blood and skin samples (Tuppurainen et al., 2005).

The local LSDV strain from different sources were sequenced and published in Genbank with their designations as; LSDV-Elkady-2014 (KU760905) from original skin scab suspension (S1), LSDV- Elkady-32014 (KX236312)from skin scab tissue1(S1),LSDV-Elkady-42014(KX236313) from skin scab tissue2(S2),LSDV-Elkady-2-2014 (KX236311) from CAM suspension (S1),LSDV-Elkady-5-2014 (KX250367) from CAM suspension (S1) (repeated), LSDV-Elkady-12014 (KX236310) from embryo liver suspension of SPF-ECE. The electropherogram data looks mostly blank for CAM suspension (Dirty sequence), so repeated and both were analyzed. Clustal W analysis for the recent local LSD virus strain from different sources based on the envelope protein-like gene showed 98 to 100% identity. The isolate sources (CAM and the embryo sources) show 100% and 98.9% homology with their skin original samples respectively. The embryo source shows 98.9% homology with CAM source. This homology emphasis the theory of Kara et al., (2003) mentioned that Capripoxvirus genomes sequences are highly conserved and there is more than 95% homology amongst LSD, sheep pox and goat pox viruses and Tulman et al. (2001) that recorded extremely conserved Capripoxvirus isolates genome with identities of at least 96%. The high similarities between resources indicate the low effect of passage in the mutational process. High nucleotide similarity of the strain in their different sources were showed with LSDV- NI-2490 isolate Neethling 2490 (AF325528), LSDV/ NW/LW isolate Neethling Warmbaths LW (AF409137), LSDV/2/Slemani/Kurdistan/2014 envelope (KM047051) and LSDV-B4 envelope protein (P32) gene (KT253438). Both LSDV- NI-2490 isolate Neethling 2490 (AF325528) and LSDV/ NW/LW isolate Neethling Warmbaths LW (AF409137) revealed percent homology of 100% with LSDV-Elkady-5-2014 (KX250367) , 94.3% with LSDV-Elkady-2014 (KU760905) and 98.9% with other strain sources include, LSDV-Elkady-

151

1-2014 (KX236310), Elkady-2-2014 (KX236311), LSDV-Elkady-3-2014 (KX236312) and LSDV-Elkady-4-2014(KX236313). The LSDV/2/Slemani/Kurdistan/2014 (KM047051) revealed percent homology of 100% with LSDV-Elkady-5-2014 (KX250367), 93.7% with LSDV-Elkady-2014 (KU760905) and 98.9% with other strain sources, while LSDV-B4 (KT253438) showed percent homology of 100% with LSDV-Elkady-5-2014 (KX250367), 93.3% with LSDV-Elkady-2014 (KU760905) and 98.7% with other strain sources. This report was indicative by House et al., (1990); Al-Salihi and Hassan; (2015); Rashid et al, (2016) who cleared that LSD of cattle was caused by a capripox virus and was closely related to the viruses which caused sheep and goat pox. Their isolate was related to The Neethling strain which is the original prototype for the disease. Our phylogenetic tree grouped viruses of LSD, sheep pox and goat pox viruses separately, even though our strain resources were related to each other and to the other LSDV include, LSDV- NI-2490 (AF325528), LSDV/ NW/LW (AF409137), LSDV/2/Slemani/Kurdistan/2014 (KM047051) and LSDV-B4 (KT253438). Our strain seems to be related more closely to LSD virus than to sheep pox virus and goatpox viruses. The phylogenetic plot constructed by MAFFT version 7 revealed and emphasis the high similarities in sequence between our LSDV strain resources and reverse strand for both LSDV- NI-2490 (AF325528) and LSDV/ NW/LW (AF409137). Hosamani et al., (2004) clustered SPPV, GTPV and LSDV into host species-specific groups. Phylogenetic analysis of a 466-bp fragment next to the genome ends showed that this system can distinguish between: sheep pox, goat pox and LSD viruses and the Israeli isolates from 2006 and 2007 were in the same clad and essentially identical the Kenya NI-2490 isolate, and the South African LD virulent isolate (Stram et al., 2008). All Kurdistan LSDV strains in clustered in one lineage and releated to The Neethling strain. LSDV/2/Slemani/Kurdistan/ 2014 was separated from the other LSDV isolates and it formed a different subcluster Rashid et al, (2016). In conclusion, there may be a new LSDV isolate in Egypt, which uniquely shared the same characteristic sequence (partial sequence about 113bp) with LSDVNI-2490 Neethling isolate and LSDV/2/Slemani/Kurdistan/2014 and differ in biological properties in embryonated eggs. So further molecular sequencing for more specific sufficient target were needed and cross neutralization using monoclonal antibodies between our strain and the neethling type is recommended. 152

153

7- SUMMARY During 2014, suspected outbreaks of LSDV were reported in Qaliubia province, where animals suffered from severe signs differ from the previous outbreaks, such as suffocation and deaths, so the present study aimed to make a trial for isolation of LSD virus from skin nodule samples with further identification using serological, non serological and molecular techniques. The practical study revealed that: 1. Trials for isolation of LSD virus from skin scabs samples of clinically suspected cattle by three blind passages through CAM showed characteristic pock lesion on CAM and dead embryos, which were hemorrhagic, edematous, with hepatomegaly and clotted blood inside the heart, which became more pronounced after 6 days of inoculation at 2nd and 3rd passages. 2. Trials for isolation of LSD virus from infected CAM by three blind passages through on MDBK cell culture showed rounding, cell aggregation, coalesce together to form clusters that scattered all over the monolayer within 72hr post inoculation and gradually increased till 70-80 % of sheet was completely detached. 3- Histopathological examination of inoculated CAM with suspected LSD viral samples showed slight proliferation in the ectodermal and mesodermal cell layers with large eosinophilic intracytoplasmic inclusion bodies characteristic for poxviridae. 4-The electron microscopic examination of inoculated CAM with suspected LSD viral samples revealed that the infected cells contained few virus particles that appeared ovoid in shape, with rounded ends.

5- Examination of HA property of suspected LSD viral isolate for cattle, sheep, goat and chicken RBCs cleared that the isolate was non HA.

154

6-Serological identification of suspected LSDV isolate on CAM and infected MDBK monolayer revealed specific intracytoplasmic yellowish green fluorescence emission. 7- Molecular identification of LSDV isolate from original skin samples, infected CAM and embryo liver suspensions using PCR, an amplified specific size products of 137 were obtained using envelope protein-like gene targeting primer. 8-Sequencing of purified PCR products for LSDV isolate were published in GenBank with their names and accession numbers; LSDV-Elkady-2014 (KU760905), LSDV- Elkady-3-2014 (KX236312), LSDV-Elkady-42014(KX236313), LSDV-Elkady-2-2014 (KX236311), LSDV-Elkady-52014 (KX250367), LSDV-Elkady-1-2014 (KX236310). 9- Phylogenetic analysis of our published sequence with other published LSDV, sheep pox and goat pox on GenBank revealed that the recent local LSD virus strain from different sources showed high nucleotide similarities from 98 to 100%. Our strain was closely related to LSD virus than to sheep pox and goat pox viruses.

155

156

8- REFERENCES

1- 2012.igem.org/wiki/images/a/a3/QIAquick_PCR-purification.pdf. 2- A. A. El-Kenawy, M. S. El-Tholoth, 2010. Sequence analysis of attachment gene of lumpy skin disease and sheep poxviruses, Virologica Sinica, Volume 25, pp 409-416. 3- A.A.EL-Kenawy and M.S. EL-Tholoth, Department of Virology, Faculty of Veterinary Medicine, Mansoura University, Egypt, 2011. Lumpy Skin Disease Virus Identification in Different Tissues of Naturally Infected Cattle and Chorioallantoic Membrane of Embryonated Chicken Eggs Using Immunofluorescence, Immunoperoxidase Techniques and Polymerase Chain Reaction. International Journal of Virology 7 (4): 158-166. 4- Abd El-Rahim, I. H. A.; El-Ballal, S. And Hussein, M., 2002. An out break of lumphy skin disease among cattle in Upper Egypt (El-Menia governorate). Monofia Vet. J., 2(1); 185-200. 5- Abou Elyazeed, Ebtsam a. " Samya s. Abd-el Nabi' and e.m. Ebrahem',2012. detection of lumpy skin disease (LSD) virus in cattle in some Egyptian governorates using different diagnostic techniques, egypt. 1. agric. res., 90 (1). 6- Abutarbush SM1, Ababneh MM2, Al Zoubi IG1, Al Sheyab OM1, Al Zoubi MG3, Alekish MO1, Al Gharabat RJ4, 2015. Lumpy Skin Disease in Jordan: Disease Emergence, Clinical Signs, Complications and Preliminary-associated. Transbound Emerg Dis. 62(5):549-54. 7- Ahmed N. F. Neamat-Allah, 2015. Immunological, hematological, biochemical, and histopathological studies on cows naturally infected with lumpy skin disease, Veterinary World, EISSN: 2231-0916.

157

8- Ahmed, L. A.; El-Desawy, O. M. and Mohamed, A. T., 2005. Studies on bovine field skin lesions in Fayoum Governorate. Veterinary Medical Journal Giza; 53: 1, 73-81. 9- Alaa. A. El-Kholy*; Hatem M. T. Soliman* and Khaled A. Abdelrahman, 2008. Polymerase chain reaction for rapid diagnosis of a recent lumpy skin disease virus incursion to Egypt, Arab J. Biotech., Vol. 11, No. (2): 293-302. 10- Alexander, R. A., and K. E. Weiss, 1959. Unpublished observations. 11- Alexander, R.A.,; Plowright, W. and Haig,D.A.,1957. "Cytopathogenic agents associated with LSD of cattle". Bull.Epiz.Dis.Afr., 5: 489-492. 12- Ali Meawad Ahmed and Amina A. Dessouki, 2013. Abattoir-Based Survey and Histopathological Findings of Lumpy Skin Disease in Cattle at Ismailia Abattoir, International Journal of Bioscience, Biochemistry and Bioinformatics, Vol. 3, No. 4. 13- Amal, M. A. Raof,* Shahein, M. A.* and Hoda, Abd El Monem**,2008. Electrophoretic characterization of sheep pox virus, Goat pox virus and lumpy skin disease virus, Egypt. J. Comp. Path. & Clinic. Path. Vol. 21 No. 1; 15- 30.

14- Andrew1es, C., 1964. Viruses of Vertebrates. Bailliere, Tindall and Cox, London. 15- Aziza Amin1*, Ehab El-Nahas2, Abd-Elbaset El-Mashed, 2015. Pathological and Virological Studies on an Outbreak of Lumpy Skin Disease among Cattle in Kalubia Governorate-Egypt. Journal of Advanced Veterinary Research Volume 5, Issue 4, 165-175.

158

16- Babiuk, S., D.B. Wallace, S.J. Smith, T.R. Bowden, B. Dalman, G. Parkyn, J. Copps and D.B. Boyle, 2009. Detection of Antibodies against Capri poxviruses using an Inactivated Sheep pox Virus ELISA. Trans. and Emer. Dis., 10: 865-1682. 17- Babiuk, S., T.R. Bowden, B. Dalman, G. Parkyn and J. Copps, 2008. Quantification of lumpy skin disease virus following experimental infection in cattle. Transboundary and Emerging Diseases, 55: 299-307. 18- Babiuk, S.; Parkyn, G.; Copps, J.; Larence, J. E.; Sabara, M. I.; Bowden, T. R.; Boyle, D. B. and Kitching, R. P., 2007. Evaluation of an ovine testis cell line (OA3.Ts) for propagation of capripoxvirus isolates and development of an immunostaining tech1nique for viral plaque visualization. Journal of veterinary diagnostic; Vol. 19, No. (5): pp. 48691. 19- Bagla, V. P.; Osuagwuh, U. I.; Annandale, C. H.; Irons, P. C.; Venter, E. H, 2006. Elimination of toxicity and enhanced detection of lumpy skin disease virus on cell culture from experimentally infected bovine semen samples. Onderstepoort J. Vet. Res. Vol. 73, No. (4), pp.:263-268. 20- Bancroft, J. D. and Gamble, M., 2002. Theory and practice of Histological Techniques. 5th Ed., Churchill Livingstone, Medical Division of Pearson Professional Ltd.

21- Bancroft, J. D.; Stevens, A. and Tumer, D.R.,1990. "Theory and practice of histological techniques." Third Ed. 22- Bhanuprakash, V., Indrani, B.K., Hosamani, M., Singh, R.K., 2006. The current status of sheep pox disease. Comp. Immunol. Microbiol. Infect. Dis. 29, 27–60. 23- Bowden, T. R., S. L. Babiuk, G. R. Parkyn, J. S. Copps, and D. B. Boyle, 2008. Capripoxvirus tissue tropism and shedding: A quantitative study in experimentally infected sheep and goats. Virol. 371, 380–393.

159

24- Bozzalo, J. and Russell, D.,1992. "Electron microscopy. Principals and techniques for biologists." Jones and Bartle-tte Publishers. Boston. U.S.A.

25- Brenner, J., 2Haimovitz, M., 3Oron E., 1Stram, Y., 1Fridgut, O., 1 Bumbarov, V. 1Kuznetzova, L., 2Oved, Z., 2Waserman, A., 2Garazzi, S., 4 Perl, S., 4Lahav, D., 4Edery, N. and 1Yadin, H, 2006. Lumpy Skin Disease (LSD) IN A Large Dairy Herd in Israel, June, Israel Journal of Veterinary Medicine. 26- Brenner, J., D. David, A. Avraham, U. Klopfer-Orgad,I. Samina, and B. A. Peleg, 1992. Experimental infection with local lumpy skin disease virus in cattle vaccinated with sheep pox vaccine. Isr. J. Vet. Med. 47, 17–21.

27- Buller, R. M.; Arif, B. M., Black, D. N., Dumbell, K. R.; Esposito, J. J., Lefkourtz, E. J.; McFadden, G., Moss, V., Mercer, A. A., Moyer, R. W., Skinner, M. A.; Tripathy, D. N, 2006. Poxviridae In Virus Taxonomy. VII the report of the International Committee on Taxonomy of viruses. Academic Press, PP. 117-133. 28- Bulletin 6205 Rev A US/EG, 11-0864 1211 Sig 1211, Bio-Rad. Burdin, M. L., 1959. The use of histopathological examinations of skin material for the diagnosis of lumpy skin disease in Kenya. Bull. epizoot. Dis. Afr. 7, 27. 29- Burdin, M. L., and J. PRYDIE, 1959. Observations on the first outbreak of lumpy skin disease in Kenya. Bull epizoot. Dis. Afr. 7, 21. 30- C. M. Chihota1,*, L. F. Rennie2, R. P. Kitching3, P. S. Mellor2, 2003. Attempted mechanical transmission of lumpy skin disease virus by biting insects. Medical and Veterinary Entomology Volume 17, pages 294–300. 31- C. M. Chihota a1, L. F. Rennie a1, R. P. Kitching a1 c1 and P. S. Mellor a1 , 2001. Mechanical transmission of lumpy skin disease virus by Aedes aegypti (Diptera:Culicidae). Epidemiology and Infection ,Volume 126, pp 317-321.

160

a

a

b

a

32- C.H. Annandale , P.C. Irons , V.P. Bagla , U.I. Osuagwuh , E.H. b, Venter 2005. Sites of persistence of lumpy skin disease virus in the genital tract of experimentally infected bulls.

33- Capstic, P. B.; Prydie,J.; Coakley,W. and Burdin, N.L.,1959. "Protection of cattle against the Neethling type virus of LSD". Vet. Rec., 71: 122-123. 34- Carroll MW, Moss B.,1997. Poxviruses as expression vectors. Curr Opin Biotechnol (5):573-7. Review. 35- CH Annandale1, PC Irons1, VP Bagla2, UI Osuagwuh1, EH Venter2., 2010. Sites of Persistence of Lumpy Skin Disease Virus in the Genital Tract of Experimentally Infected Bull. Reproduction in Domestic Animals. Volume 45, pages 250–255. 36- Charles. L., Le Goff. B., Roland. C., David. B., Wallace. D., Vely´ Gulyaz. F., Tuppurainen. G., Madani. H., Caufour. B., Adami., El Harrak. j., George. A., Emmanuel B., Diallo A., 2011. Use of the Capripoxvirus homologue of Vaccinia virus 30 kDa RNA polymerase subunit (RPO30) gene as a novel diagnostic and genotyping target: Development of a classical PCR method to differentiate Goat poxvirus from Sheep poxvirus. Vet Microbiology 149: 30–39.

37- Christopher A. Nelson 1,*, Megan L. Epperson 1, Sukrit Singh 2, Jabari I. Elliott 1 and Daved H. Fremont 1,2,3, 2015. Structural Conservation and Functional Diversity of the Poxvirus Immune Evasion (PIE) Domain Superfamily, Viruses, 7, 4878–4898. 38- Cornelius Henry Annandale,2006. Mechanisms by which lumpy skin disease virus is shed in semen of artificially infected bulls. University of pertoria, Onderstepoort. 39- D. B. Wallace and G. J. Viljoen., 2002. Importance of thymidine kinase activity for normal growth of lumpy skin disease virus (SANeethling). Arch Virol 147: 659–663.

161

40- Davies F.G., Krauss H., Lund L.J. & Taylor M.,1971. The laboratory diagnosis of lumpy skin disease. Res. Vet. Sci., 12, 123–127. 41- De lange, M., 1959. The histopathology of the cytopathogenic changes produced in monolayer epithelial cultures by viruses associated with lumpy skin disease. Onderstepoort J. vet. Res. 28, 245.

42- Dimitrios Dilaveris,2015. Lumpy Skin disease in Greece (Evros), EFSA Journal. 13(1):3986. 43- E. Crandall/P.Barber, https://www.coursehero.com/file/7572635/ProtocolGel. 44-E. R. Tulman, C. L. Afonso, Z. LU, L. Zsak, G. F. Kutish, And D. L. Rock*, 2001. Genome of Lumpy Skin Disease Virus, Journal of Virology, Vol. 75, p. 7122–7130. 45- E. R. Tulman,1 C. L. Afonso,1 Z. Lu,1 L. Zsak,1 J.-H. Sur,1 N. T. Sandybaev,2 U. Z. Kerembekova,2 V. L. Zaitsev,2 G. F. Kutish,1 and D. L. Rock, 2002. The Genomes of Sheeppox and Goatpox Viruses. JOURNAL OF VIROLOGY, p. 6054–6061, Vol. 76. 46- E. S. M. Tuppurainen1, W. H. Stoltsz2, M. Troskie2, D. B. Wallace2,3, C. A. L. Oura1, P. S. Mellor1, J. A. W. Coetzer2, E. H. Venter, 2011. A Potential Role for Ixodid (Hard) Tick Vectors in the Transmission of Lumpy Skin Disease Virus in Cattle. Transboundary and Emerging Diseases. Volume 58, pages 93–104. 47- E.S.M. Tuppurainena,∗, E.H. Venterb, J.A.W. Coetzerb, L. BellSakyia,2015. Lumpy skin disease: Attempted propagation in tick cell lines and presence of viral DNA in field ticks collected from naturallyinfected cattle, Ticks and Tick-borne Diseases 6,134–140. 48- E.S.Orlova,A.V. Shcherbacov, V.I. Deiv, and V.M.Zakharov, 2006. Differetiation Of Capripoxvirus Species and Strains by Polymerase Chain Reaction. MOLECULAR BIOLOGY, Vol 40,pp139-145. 49- Edgar Howard Mercer, M. S. C. Birbeck, 1966. Electron Microscopy: A Handbook for Biologists. 162

50- Edward S. Reynolds, 1963. The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. 51- Eeva S. M. Tuppurainen, Evaluation of Vector Potential of Rhipicephalus Appendiculatus, Amblyomma Hebraeum and Rhipicephalus Decoloratus ticks for lumpy skin disease virus, 2015.phD, Department of Veterinary Biosciences, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland.

52- El-Bagoury, G. F.; Madbouly, H. M.; Iman, A. A. Farrag and Saber, M. S.,1995. Isolation and characterization of Lumpy skin disease (LSD) virus from cattle during natural outbreak in Minia Governorate. Alex. J. Vet. Sci., Volume 11, 167-174. 53- El-Nahas, A.S. El-Habbaa, G.F. El-bagoury and Mervat E.I. Radwan, 2011. Isolation and Identification of Lumpy Skin Disease Virus from Naturally Infected Buffaloes at Kaluobia, Egypt ,Global Veterinaria 7 (3): 234-237. 54- Fayez Awadalla Salib* and Ahmed Hassan Osman, 2011. Incidence of lumpy skin disease among Egyptian cattle in Giza Governorate, Egypt, Veterinary World. Vol.4(4):162-167. 55- Felsenstein, J., 2001. Taking variation of evolutionary rates between sites into account in inferring phylogenies. J. Mol.Evol., 53 : 447-455. 56- Fenner F, 1996. Poxviruses. In: Fields BN, Knipe DM, Howley PM (eds), Fields virology third edn., vol 2. Chapter 84. Lippincott-Raven, Philadelphia, PA. 57- Fenner, F., P. A. Bachmann, E. P. J. Gibbs, F. A. Murphy, M. J. Studdert and D. O. White, 1987. Poxviridae. Veterinary Virology. Academic Press, London. Fenner's Veterinary virology, fourth edition, 2011.

163

58- G. Garia, b, , ,F. Biteau-Corollerb, C. LeGoffc, P. Caufourc, F. Rogerb, 2008. Evaluation of indirect fluorescent antibody test (IFAT) for the diagnosis and screening of lumpy skin disease using Bayesian method. Veterinary Microbiology Volume 129. Pages 269–280. 59- Gari, G., A. Waret-Szkuta, V.Grosbois, P.Jacquiet and F. Roger, 2010. Risk factors associated with observed clinical lumpy skin disease in Ethiopia. Epidemiol. Infect. 138: 1657-1666. 60-Gemma C. Carter,1 Gaener Rodger,1,2 3 Brendan J. Murphy,1 Mansun Law,1,2 Oliver Krauss,2 4 Michael Hollinshead1,2 and Geoffrey L. Smith,2003. Vaccinia virus cores are transported on microtubules, Journal of General Virology, 84, 2443–2458. 61- Gezahegn Alemayehu & Girma Zewde & Berhanu Admassu, 2013. Risk assessments of lumpy skin diseases in Borena bull market chain and its implication for livelihoods and international trade. Trop Anim Health Prod, 45:1153–1159.

62- Gulbahar MY, WC Davis, H Yuksel and M Cabalar, 2006. Immunohistochemical evaluation of inflammatory infiltrate in the skin and lung of lambs naturally infected with sheeppox virus. Vet Pathol, 43: 67-75. 63- Hell Creek Life © 1997-2010 Phillip Bigelow Revised 1/24/2010. 64- Hosamani, M.; Mondal, B.; Temburne, P. A.; Bandyopa, S. K.; Singh, R. K. and2 Rasool, J. J., 2004. Differentiation of sheep pox and goat pox virus sequence analysis and PCR-RELP of P32 gene. Virus genes. Vol. 29,pp. 73-80. 65- http://www.ncbi.nlm.nih.gov/tools/primer-blast. 66- https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch. 67- https://moodle.ufsc.br/mod/resource/view.php?id=805619. 68.https://windward.hawaii.edu/paces/summerfiles/publications/qiagen.p df_march. 164

69- https://www.emsdiasum.com/microscopy/. 70.https://www3.appliedbiosystems.com/cms/groups/mcb_marketing/.../c ms_081527.pdf. 71.https://www3.appliedbiosystems.com/cms/groups/mcb_support/docu ments/generaldocuments/cms_042772.pdf. 72-HunterP,WallaceD,2001. Lumpy skin disease in southern Africa: are view of the disease and aspects of control. J S Afr Vet Assoc 72: 68–71.

73- Identification and Purification of a Local Isolate of Infectious Laryngotracheitis Virus. Egyptian J. Vet. Sci. 39: 11-20. 74- Ireland D.C. & BINEPAL Y.S., 1998. Improved detection of capripoxvirus in biopsy samples by PCR. J. Virol. Methods, 74, 1–7. 1a 2 75- Irons P C , Tuppurainen E S M , Venter E H,2005. Excretion of lumpy skin disease virus in bull semen. Theriogenolog 63: 1290-1297.

76-J. B. Johnston and Grant McFadden, 2003. Poxvirus Immunomodulatory Strategies: Current Perspectives, JOURNAL OF VIROLOGY. Vol. 77, p. 6093–6100. 77- J. Brennera, , , M. Bellaicheb, E. Grossc, D. Eladd, Z. Ovedc, M. Haimovitzc, A. Wassermanc, O. Friedguta, Y. Strama, V. Bumbarova, H. Yadina, 2009. Appearance of skin lesions in cattle populations vaccinated against lumpy skin disease: Statutory challenge. Vaccine.Volume 27, Pages 1500–1503. 78- J. C. Lubinga, E. S. M. Tuppurainen, J. A. W. Coetzer, W. H. Stoltsz, E. H. Venter ,2014. Evidence of lumpy skin disease virus over-wintering by transstadial persistence in Amblyomma hebraeum and transovarial persistence in Rhipicephalus decoloratus ticks. Experimental and Applied Acarology . Volume 62, pp 77-90 .

165

79- J. C. Lubinga1,2,*, E. S. M. Tuppurainen3, R. Mahlare1, J. A. W. Coetzer1, W. H. Stoltsz1 E. H. Venter, 2013. Evidence of Transstadial and Mechanical Transmission of Lumpy Skin Disease Virus by Amblyomma hebraeum Ticks. Transboundary and Emerging Diseases. 80- James A. House, Terrance M. Wilson, Sinan El Nakashly, Ikram A. Karim,Ibrahim Ismail, Nabil El Danaf, Aly M.Moussa, Nazmi N. Ayou,1990. The isolation of lumpy skin disease virus and bovine herpesvirus- from cattle in Egypt, J Vet Diagn Invest 2:111-115. 81- K. A. Al-Salihi and I. Q. Hassan, 2015. Lumpy Skin Disease in Iraq: Study of the Disease Emergence, Transboundary and Emerging Diseases. 62, 457–462.

82- Kitching, R. P. and C. Smale, 1986. Comparison of the external dimensions of capripoxvirus isolates.Res. Vet. Sci., 41, 425-427. 83- Kitching, R. P.; Hammond, J. M. and Black, D. N., 1986. Studies on the Major Common Precipitating Antigen of Capripoxvirus J. gen. Virol. Vol. 67, pp. 139 – 148. Laboratories, Inc.

84- Le Goff, C.; Lamien, C.E.; Fakhfakh, E.; Chadeyras, A.; AbaAdulugbad, E.; Libeau, G.; Tuppurainen, E.; Wallace, D.; Adam, T.; Silber, R.; Gulyaz, V.; Madani, H.; Caufour, P.; Hamammi, S.; Diallo, A. and Albina, E., 2009. Capripoxvirus G-protein-coupled chemokine receptor,a host-range gene suitable for virus-animal origin discrimination.J. Gen. Virol. Vol. 90, pp. 1967-1977.

85- M. El-Tholoth* and A. A. El-Kenawy, 2015. G-Protein-Coupled Chemokine Receptor Gene in Lumpy Skin Disease Virus Isolates from Cattle and Water Buffalo (Bubalus bubalis) in Egypt. Transboundary and Emerging Diseases.

166

86- M.El-Haig.A.Selim and A.Shahira,2014. Efficiency of PCR as Compared with Dot Blot Hybrdization Techniques in Diagnosis of Lumpy Skin in Cattle in Egypt. International Journal of Virology 10 (2): 136-142.

87- MacLachlan, N. J. and Dubovi, E.J, 2011. Poxviridae. In MacLachlan, N. J. and Dubovi, E.J editors, Fenner's veterinary virology. 4th ed. London ; Boston : Academic press,p.157-160. 88- Magori-Cohen, R., Y. Louzoun, Y. Herziger, E. Oron, A. Arazi, E. Tuppurainen, N.Y. Shpige and E Klement, 2012. Mathematical modelling and evaluation of the different routes of transmission of lumpy skin disease virus. Veterinary Research, 43(1): 1297-1299. 89- Mahmoud M. ElHaig1, Abdelfatah Selim and Abdelwahab Shahira,2013. Polymerase chain reaction and Dot blots hybridization techniques for diagnosis of lumpy skin disease in cattle in Egypt, Jokull journal , Vol 63, No. 6,

90- Mangana-Vougiouka, O.; Mark-oulatos, P.; Kaptopoulos, G.; Nonikou, K.; Bakandritosos, N. and Papadopulos, P., 2000. "Sheep pox virus id-entification from clinical specimens by PCR, cell culture, immuno fluorescence and agar gel immuno precipitation assay." Mol. Cell. Probes, (5): 305-310. 91- Matthews, R.E.F., 1982. Classification and nomenclature of viruses. Inter virology 17:1-199. 92- Mercer J, Helenius A, 2008. Vaccinia virus uses macropinocytosis and apoptotic mimicry to enter host cells. Science 320: 531–535.

93- Methods and techniques in virology, Pierre Payment and Michel Trudel, 1993.

94-Mishra, S.S and B.B. Mallick, 1997. Detection of fowl pox virus using immunoperoxidase test and fluorescent antibody technique Indian Vet. J., 74: 199-202. 167

95- Mohamed Hassan Tageldin & David Brian Wallace & Gertruida Hermanna Gerdes & John Fraser Putterill & Roelf Rudolph Greyling & Maanda Noaxe Phosiwa & Rashied Mohammed Al Busaidy & Sultan Issa Al Ismaaily, 2014. Lumpy skin disease of cattle: an emerging problem in the Sultanate of Oman. Trop Anim Health Prod . 46:241–246. 96- Moss, B., 2006. Poxvirus entry and membrane fusion. Virology, 344, 48-54.

97- Mossman, K., Lee, S. F., Barry, M., Boshkov, L., McFadden, G, 1996. Disruption of M-T5, a novel myxoma virus gene member of poxvirus host range superfamily, results in dramatic attenuation of myxomatosis in infected European rabbits. J. Virol. 70:4394–4410.

98- Munz E K, Owen N C, 1966. Electron microscopic studies on lumpy skin disease virus type ‘Neethling’. Onderstepoort Journal of Veterinary Research 33: 3–8. Nagi, A. A., 1990. Lumpy skin disease: cutaneous and testicular lesions. Assiut. Vet. Med. J. 23, 90–99. 99- Nawathae,D.R.; Gibbs,E.P.J.; Asagba,M.O. and Lawman, M.J.P., 1978. "Lumpy skin disease in Nigeria". Trop. Anim. Hlth. Pro., 10:49-54. 100- OIE, 2004. Manual of diagnostic tests and vaccines for terrestrial animals. OIE Part 2, 1–17. 101- OIE, 2008. Lumpy Skin Disease (Neethling, Knopvelsiekte): A technical Report. The Centre for Food Security and Public Health, Iowa State University. 102- OIE, 2010. Terrestrial Manual of Lumpy Skin Disease, Chapter 2.4.14. Version adopted by the World Assembly of Delegates of the OIE in May 2010, OIE, Paris. 103- OIE, 2016. Lumpy skin disease Chapter 2.4.13. 104- Omyma, M. El-Desawy,2008. Recent Isolation and identification of lumpy skin disease virus from cattle in Egypt, Egypt. J. Comp. Path. & Clinic. Path. Vol. 21 No. 1; 139- 147. 168

105- Osuagwuh U.I., Bagla V., Venter E.H., Annandale C.H., Irons P.C., 2007.Absence of lumpy skin disease virus in semen of vaccinated bulls following vaccination and subsequent experimental infection. Vaccine, 25:2238–2243. 106- Osuagwuh, Uchebuchi I, 2006.Semen quality and the excretion of lumpy skin disease virus in semen following vaccination and experimental challenge of vaccinated bulls. 107- P. D. Kara, C. L. Afonso, D. B. Wallace, G. F. Kutish, C. Abolnik, Z. Lu, F. T. Vreede, L. C. F. Taljaard, A. Zsak, G. J. Viljoen, 2003. Comparative sequence analysis of the South African vaccine strain and two virulent field isolates of Lumpy skin disease virus. Archives of Virology, Volume 148, pp 1335-1356. 108- P. T. Richard C. Condit, Nissin Moussatche, 2006. “In A Nutshell: Structure and Assembly of the Vaccinia Virion,” Advances in Virus Research, vol. 66, pp. 124–131. 109- Plowright, ViT., and R. D. FERRIS, 1959. Ether sensitivity of some mammalian pox viruses. Virology 7, 357. 110- Prof. JAW Coetzer and Dr. Eeva Tuppurainen, 2004. Lumpy skin disease, in: Infectious diseases of livestock, edited by Coetzer, J.A.W. & Tustin, R.C. Cape Town: Oxford University Press Southern Africa, 2:1268-1276. 111- Prozesky L, Barnard BJ, 1982. A study of the pathology of lumpy skin disease in cattle. Onderstepoort J Vet Res. 49(3):167-75. 112- 1Rao, T. V. and Bandyopadhyay, S. K., 2000. Comparative review of goatpox and sheeppox and their diagnosis.Anim. Health Res. Rev., 1: 127 – 136. 113- Rao, T.V.S., Negi, B.S., Bansal, M.P., 1997. Development and standardization of a rapid diagnostic test for sheep pox. Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases 18: 47– 51.

169

114- Rashid, P. M. A., Baba Sheikh, M. O., Raheem, Z. H. Marouf, A. S, 2016. Molecular characterisation of lumpy skin disease virus and sheeppox virus based on p32 gene . Bulgarian Journal of Veterinary Medicine, DOI: 10.15547.

115- Razek, A. ; Omar, B. and Magda, M. S., 2009. Preparation and Evaluation of Lumpy Skin Disease Hyperimmune Serum Coniugated with Fluorescein.International Journal of Virology; Volume: 5, Issue: 1, Pp.: 44-48. 116- Rgbe Haftu, Lumpy Skin Disease (LSD): outbreak investigation, isolation and molecular detection of LSDV in selected areas of eastern shewa, ethiopia, 2012. degree of Masters Science in Veterinary microbiology, Addis Ababa University, Ethiopia.

117- Rizkallah, S.S.,1994. "Further studies on sheep pox disease in Egypt." Ph.D. Thesis (Infectious and Fish diseases). Faculty of Vet. Med., Cairo university. 118- Roberts KL, Smith GL. 2008. Vaccinia virus morphogenesis and dissemination. Trends Microbiol. 16:472–479. 119- Rosel, J. L., P. L. Earl, J. P. Weir, and B. Moss,1986. Conserved TAAATG sequence at the transcriptional and translational initiation sites of vaccinia virus late genes deduced by structural and functional analysis of the HindIII H genome fragment. J. Virol. 60:436-449. 120- S. M. Tamam, 2006. Isolation of Lumpy skin disease virus form naturally infected cattle previously vaccinated with live attenuated sheep poxvirus vaccine. BS. VET. MED. J. VOL. 16, p. 27-31. 121- S.S.A. Sharawi & I.H.A. Abd El-Rahim, 2011. The utility of polymerase chain reaction for diagnosis of lumpy skin disease in cattle and water buffaloes in Egypt, Rev. sci. tech. Off. int. Epiz., 30 (3), 821830.

170

122- Salib F., Osman A., 2011. Incidence of lumpy skin disease among Egyptian cattle in Giza Governorate, Egypt. Vet. World 4162–167. 123- Sambrook, Fritsch, and Maniatis, 1989. Molecular Cloning: Alaboratory manual 2nd ed., cold spring Harbor press, cold spring Harbor, NewYork, vol.3, appendix B12. 124- Sameeh M Abutarbush, 2015.Hematological and serum biochemical findings in clinical cases of cattle naturally infected with lumpy skin disease, J Infect Dev Ctries, 9(3):283-288.

125- Shchelkunov, S. N., Safronov, P. F., Totmenin, A. V., Petrov, N. A., Ryazankina, O. I., Gutoro,V. V., Kotwal, G. J.,1998. The genome sequence analysis of the left and right species-specific terminal region of a cowpox virus strain reveals unique sequences and a cluster of intact ORFs for immunomodulatory and host range proteins. Virology 243:432– 460.

126- Sherrylin Wainwright a, Ahmed El Idrissi et al, 2013. Emergence of lumpy skin disease In the Eastern Mediterranean Basin countries, empress watch, VOL 29. [email protected]. 127- Silvia Kreindel, Julio Pinto, Caryl Lockhart, Ahmed ElIdrissi, Eran Raizman, 2015. Emergence of lumpy skin disease, express watch, VOL 33. 128- Smith, G.L., Vanderplasschen, A., Law, M., 2002. The formation and function of extracellular enveloped vaccinia virus. J. Gen. Virol. 83, 2915 – 2931. 129- Sohair, I. Badr*; Ibrahim, E. M.* and Shahein M.A.,2008. Virological and pathological studies on lumpy skin disease in naturally infected cattle, Egypt. J. Comp. Path. & Clinic. Path. Vol. 21, 446- 465. 130- Sumasundaram Mathan Kumar, 2011. An outbreak of Lumpy Skin Disease in a Holstein Dairy Herd in Oman: A Clinical Report. Asian Journal of Animal and Veterinary Advances 6 (8): 851-859.

171

131- Thomas, A.D. and Mare, C.V.E.,1945. " Kopvesiekte". J.S.Afri. Vet. ed. Assoc., 16:36-43 132- Thompson, J. D.; Higgins, D. G. andGibson, T. J.,1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673-4680. 133- Tiwari, A.K., Rao, T.V.S., Negi, B.S., 1996. Spot agglutination test for the rapid diagnosis of goat pox. Tropical Animal Health and Production, 28(3):213-215. 134- Tuppurainen E.S.M., Venter E.H. & Coetzer J.A.W., 2005. The detection of lumpy skin disease virus in samples of experimentally infected cattle using different diagnostic techniques. Onderstepoort J. Vet. Res., 72, 153–164. 135-Tuppurainen, E.S.M. and C.A.L. Oura, 2012. Review: Lumpy Skin Disease: An Emerging Threat to Europe, the Middle East and Asia. Tran boundary and Emerging Diseases, 59(1): 40-48. 136- Van Rooyen, P.J.,E.K. Munz and K.E. Weiss, 1969. The optimal condition for the multiplication of Neethling type LSDV in embryonated eggs. Onderstepoort, J. Vet.Res., 36: 165-174. 137- W. Awadin1,2, H. Hussein1, Y. Elseady1, S. Babiuk3,4, H. Furuoka2, 2011. Detection of Lumpy Skin Disease Virus Antigen and Genomic DNA in Formalin-Fixed Paraffin-Embedded Tissues from an Egyptian Outbreak in 2006. Transboundary and Emerging Diseases. Volume 581, pages 451–457. 138- W. M. Ahmed and Kawther S. Zaher,2008. Observations on lumpy skin disease in local Egyptian cows with emphasis on its impact on ovarian function, African Journal of Microbiology Research Vol. (2) pp. 252-257. 139- Walid S. Awad, Adel K. Ibrahim, Khaled Mahran, Khaled M. Fararh, Mervet I. Abdel Moniem, 2010. Evaluation of different diagnostic methods for diagnosis of Lumpy skin disease in cows. Tropical Animal Health and Production .Volume 42, pp 777-783.

172

140- Weis1s, K. E., 1959, 1960, 1962, 1964, 1966, 1967. Unpublished observations, 141- 1Weiss, K. E., and J. Broekman, 1965. Unpublished work. 142- WEI1SS, K. E., and S. M. GEYER, 1959. The effect of lactalbumin hydrolysate on the cytopathogenesis of lumpy skin disease virus in tissue culture. Bull. epizoot. Dis. Afr.7, 243. 143- Weiss, K. E.,1968. Lumpy skin disease virus. Virol. Monograph, Vol. 3: pp. 111-31. 144- Wood roofe, G. M. and F. Fenner, 1962. Serological relationship within the poxvirus group: an antigen common to all members of the group. Virology, 16, 334-341. 145- Woods, J.A., 1988. "LSD, A review". Trop. Anim. Hlth. Prod., 20: 11-17.

146- Yehuda Stram, , Larisa Kuznetzova, Orly Friedgut, Boris Gelman, Hagai Yadin, Marisol Rubinstein-Guini, 2008. The use of lumpy skin disease virus genome termini for detection and phylogenetic analysis. Journal of Virological Methods. Volume 151, Pages 225–229. 147- YS. Binepal, F.A. Ongadi and J.C. Chepkwony, 2001.Alternative cell lines for the propagation of lumpy skin disease virus Onderstepoort Journal of Veterinary Research, 68: 151-153.

148- Zelalem Abera, Hailu De 1 2 gefu, 3Getachew Gari and 4Zelalem Ayana, 2015. Review on Epidemiology and Economic Importance of Lumpy Skin Disease. International Journal of Basic and Applied Virology 4(1): 08-21.

173

۱

۲

‫الملخص العربى‬

‫اثناء فترة ‪ 2014‬ظهرت حاالت لفيروس الجلد العقدى فى االبقار بمحافظة القليوبية حيث ان‬ ‫الحيوانات كانت تعانى من اعراض مرضية جسيمة تختلف عن اعراض الفيروس التى كانت‬ ‫تحدث سابقا مثل االختناق والموت بنسبة اعلى من نسبة الوفيات التى كانت تحدث سابقا‬ ‫حيث اظهرت النتائج العلمية مايلى‪:‬‬ ‫‪-۱‬اظهرت محاوالت عزل الفيروس من القشرة الجلدية من حاالت االبقار الحية بعد ثالث‬ ‫تمريرات خالل الغشاء الكوريونى ظهور اصابة تنكرزية فى الغشاء الكوريونى وموت لالجنة التى كانت‬ ‫تعانى من تورمات وانزفة وتورمات وانزفة على الكبد وانزفه وتورمات على القلب والتى كانت‬ ‫واضحه فى اليوم السادس من الحقن فى التمريرة الثانية والثالثة·‬ ‫على خاليا كلى المجترات لمادين‬

‫‪-۲‬اظهرت محاوالت عزل الفيروس من الغشاء الكوريونى المصاب‬ ‫وديربى المادين داربى بعددثالث تمريرات استدارة وتجمع للخاليا المصابة فى صورة عناقيد‬ ‫والتى كانت منتشرة على سطح الخاليا بالكامل وذلك بعد ‪ 72‬ساعة من حقن العينة والتى كانت‬ ‫تزداد تدريجيا نهاية بالوقوع الكامل للخاليا·‬

‫‪ -۳‬اظهر الفحص الهستوباثولوجى للغشاء الكوريونى المصاب بعينات فيروس مرض الجلد‬ ‫العقدى نموا كثيفا الى حد ما على خاليا طبقة االكتوديرم والميزوديرم مع وجود جسيمات كبيرة‬ ‫للفيروس فى السيتوبالزم الخاص بالخاليا·‬ ‫‪ -٤‬اظهر الفحص االلكترونى المجهرى الشكل البيضاوى المميز لعائلة فيروسات الجدرى فى الغشاء الكوريونى‬ ‫المحقون بعينات فيروس مرض الجلد العقدى‪.‬‬

‫‪ -٥‬اظهر فحص معزول فيروس مرض الجلد العقدى باختبار التلزن الدموى باستخدام كرات الدم‬ ‫الحمراء لالبقار والماعز واالغنام والدجاج على عدم قدرة الفيروس على احداث تالزن دموى‬ ‫لهذه الخاليا·‬ ‫‪ -٦‬اظهرالتعرف السيرولوجى على معزولة فيروس مرض الجلد العقدى فى الغشاء الكوريونى‬ ‫وخاليا الكلى لمادين وداربى وميضات فلوريسية ذات لون اصفر مخضر بداخل سيتوبالزم‬ ‫الخاليا والغشاء الكوريونى·‬

‫‪۳‬‬

‫‪-٧‬اظهر التعرف الجزيئى لفيروس مرض الجلد العقدى من العينات االصلية بالجلد والغشاء‬ ‫الكوريونى والكبد الجنينى باستخدام تفاعل انزيم البلمرة المتسلسل على وجود ناتج جينى بمقدار‬ ‫‪ 137‬والخاص بجين البروتين المماثل لغالف الفيروس·‬

‫‪ -٨‬حيث تم نشرتتابع معزول فيروس الجلد العقدى على الجين باالسماء وارقام االلتحاق التالية‬ ‫فيروس الجلد العقدى‪-‬القاضى‪KU 760905-2014-‬‬ ‫فيروس الجلد العقدى‪-‬القاضى‪KX236312- 2014-3‬‬ ‫فيروس الجملد العقدى‪-‬القاضى ‪KX236313-2014-4‬‬ ‫فيروس الجلد العقدى‪-‬القاضى‪KX236311-2014-2-‬‬ ‫فيروس الجلد العقدى‪-‬القاضى‪(KX250367) -2014-5-‬‬ ‫فيروس الجلد العقدى‪ -‬القاضى‪·(KX236310)-2014-1-‬‬ ‫‪-۹‬اظهر تحليل الشجرة الجينية لمعزول فيروس الجلد العقدى من مصادره المختلفة مع معزوالت‬ ‫فيروس الجلد العقدى وجدرى الغنم وجدرى الماعز المنشورين على الجين بنك انه يتشابه‬ ‫بدرجات من ‪ %99-98‬مع هذه المعزوالت لهذه الفيروسات_ لذلك عترتنا الجديده من فيروس‬ ‫الجلد العقدى اكثر تشابها لفيروس الجلد العقدى عن جدرى االغنام والماعز·‬

‫‪٤‬‬