Subunit of - The Journal of Biological Chemistry

THE JOURNAL OF BIOLOGICAL CHEMISTRY © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 273, No. 33, Issue of August 14, pp. 21386 –21392, 1998 Printed in U.S.A.

A Pro504 3 Ser Substitution in the b-Subunit of b-Hexosaminidase A Inhibits a-Subunit Hydrolysis of GM2 Ganglioside, Resulting in Chronic Sandhoff Disease* (Received for publication, March 6, 1998, and in revised form, June 9, 1998)

Yongmin Hou‡§, Beth McInnes‡, Aleksander Hinek‡, George Karpati¶, and Don Mahuran‡§i From the ‡The Research Institute, The Hospital for Sick Children, Toronto, Ontario M5G 1X8, Canada, the §Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario M5G 2C4, Canada, and the ¶Department of Neurology and Neurosurgery, McGill University and Montreal Neurological Institute, Montreal, Quebec H3A 2B4, Canada

The GM2 gangliosidoses are caused by mutations in the genes encoding the a- (Tay-Sachs) or b- (Sandhoff) subunits of heterodimeric b-hexosaminidase A (Hex A), or the GM2 activator protein (AB variant), a substratespecific co-factor for Hex A. Although the active site associated with the hydrolysis of GM2 ganglioside, as well as part of the binding site for the ganglioside-activator complex, is associated with the a-subunit, elements of the b-subunit are also involved. Missense mutations in these genes normally result in the mutant protein being retained in the endoplasmic reticulum and degraded. The mutations associated with the B1variant of Tay-Sachs are rare exceptions that directly affect residues in the a-active site. We have previously reported two sisters with chronic Sandhoff disease who were heterozygous for the common HEXB deletion allele. Cells from these patients had higher than expected levels of mature b-protein and residual Hex A activity, ;20%. We now identify these patients’ second mutant allele as a C1510T transition encoding a b-Pro504 3 Ser substitution. Biochemical characterization of Hex A from both patient cells and cotransfected CHO cells demonstrated that this substitution (a) decreases the level of heterodimer transport out of the endoplasmic reticulum by ;45%, (b) lowers its heat stability, (c) does not affect its Km for neutral or charged artificial substrates, and (d) lowers the ratio of units of ganglioside/ units of artificial substrate hydrolyzed by a factor of 3. We concluded that the b-Pro504 3 Ser mutation directly affects the ability of Hex A to hydrolyze its natural substrate but not its artificial substrates. The effect of the mutation on ganglioside hydrolysis, combined with its effect on intracellular transport, produces chronic Sandhoff disease.

The hydrolysis of GM2 ganglioside (GM2)1 requires the proper * This work was supported by a Medical Research Council of Canada Grant MT-10435 (to D. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. i To whom correspondence should be addressed: Research Institute, The Hospital For Sick Children, 555 University Ave., Toronto, Ontario M5G 1X8, Canada. Tel.: 416-813-6161; Fax: 416-813-8700; E-mail: [email protected]. 1 The abbreviations used are: GM2, GM2 ganglioside, GalNAcb(1– 4)[NANAa(2–3)-]-Galb(1– 4)-Glc-ceramide; Hex, b-hexosaminidase; activator, GM2 activator protein; MU, 4-methylumbelliferone; MUG, 4-methylumbelliferone-b-N-acetylglucosamine; MUGS, 4-methylumbelliferone-b-N-acetylglucosamine-6-sulfate; CRM, cross-reacting material; ER, endoplasmic reticulum; kb, kilobase pair(s); bp, base pair(s); PCR,

synthesis, intracellular transport, and protein-protein interactions of three different gene products. Two of these, encoded by the evolutionarily related HEXA (15q23-q24 (1)) and HEXB (5q13 (2)) genes, are the a- and b-subunits of heterodimeric b-hexosaminidase A (Hex A), respectively. The third gene product is a small heat-stable protein, the GM2 activator protein (activator), encoded by the GM2A gene (5q31.3–33.1 (3)). Mutations in any one of these genes can result in the storage of GM2 and one of the family of human diseases known as the GM2 gangliosidoses. HEXA mutations are associated with Tay-Sachs disease, HEXB with Sandhoff disease, and GM2A with the AB variant form (reviewed in Ref. 4). The GM2 gangliosidoses show extreme variability in clinical expression. Typically, the earlier the age of onset of clinical symptoms the more severe the disease. A nomenclature based on the different clinical phenotypes and recognizing the dominance of the encephalopathy (rather than only the age of onset) has been suggested (4): acute (the classical infantile form), subacute (late infantile and juvenile forms), and chronic (adult and chronic forms). The most common, acute form is a severe neurological disorder that usually results in death within 4 years. Mutations associated with this classical phenotype prevent the formation of any functional Hex A. It is now generally believed that the broad range of less severe phenotypes result from small variations in the levels of residual Hex A activity, on the order of 0 –5% (5). Healthy individuals with ;10% residual Hex A activity have been described (reviewed in Ref. 4). While patients with the acute form of GM2 gangliosidosis are deficient in Hex A activity, their total Hex activity, as measured by neutral artificial substrates, is significant. Tay-Sachs patients often have nearly normal levels of activity due to the presence of the homodimeric Hex B isozyme (bb), and Sandhoff patients have 1–5% of normal levels from homodimeric Hex S (aa) (reviewed in Ref. 4). Since any dimeric combination of aand/or b-subunits produces an active isozyme, each subunit must contain a potential active site. The characteristics of the two sites have been examined in the two homodimers (6) and in a novel form of Hex A with an inactive b-subunit due to an Arg211 3 Lys substitution (7). These data indicate that the presence of the b-subunit affects the Km and Vmax of the a active site toward neutral substrates (7). Whereas both subunits of Hex A are equally capable of hydrolyzing neutral b-GlcNAc- or b-GalNAc-containing substrates, e.g. 4-methylumbelliferyl-b-N-acetylglucosamine (MUG), only isozymes containing an a-subunit can efficiently hydrolyze negatively charged b-GlcNAc-6-sulfate-containing substrates, e.g. methpolymerase chain reaction; CHO, Chinese hamster ovary; GA2, asialo GM2 (gangliotriaosylceramide).

21386

This paper is available on line at http://www.jbc.org

A b-Subunit Mutation Affecting GM2 Ganglioside Hydrolysis ylumbelliferyl-b-N-acetylglucosamine-6-sulfate (MUGS), i.e. the MUG/MUGS hydrolysis ratio for Hex B is ;300, for Hex A ;4, and for Hex S ;1 (7). The specificity of the Hex isozymes for GM2 ganglioside indicates that it should also be considered as a negatively charged substrate, presumably due to the sialic acid residue attached to the penultimate Gal residue. However, whereas Hex S as well as Hex A, but not Hex B, can hydrolyze GM2 in the presence of detergents, only Hex A is functional in vivo with the GM2 activator-GM2 ganglioside complex (reviewed in Ref. 4). Thus, some component(s) of the b-subunit are necessary for the hydrolysis of GM2 in vivo. The exact role of the activator remains controversial (8 –10). However, it is generally agreed that it binds both the lipid and oligosaccharide portions of GM2, extracting or at least lifting the ganglioside out of the membrane, and then the complex interacts with Hex A for hydrolysis (11). Hex B can hydrolyze the neutral, asialo derivative of GM2, GA2, in the presence of detergent, but it has little activity in the presence of activator. Furthermore, it has been reported that the activator, even in the absence of GM2, can slightly inhibit the hydrolysis of MUGS by both Hex A and Hex S (reviewed in Refs. 12 and 13). These data indicate that at least a portion of the binding site for the complex is also located in the a-subunit. The required elements of the b-subunit may function by increasing the affinity of Hex A for the complex and/or correctly orient the complex, allowing the efficient hydrolysis of the terminal sugar from the ganglioside. Furthermore, these b-elements may act directly by interacting with the complex or indirectly by affecting the conformation of the a-subunit. Other functions associated with the b-subunit include greatly increasing the stability of the resulting dimer and facilitating the transport of the a-subunit out of the endoplasmic reticulum (ER) (reviewed in Refs. 4 and 14). To date, all missense mutations except those at two codons, in either HEX gene, result in normal levels of mutant mRNA but paradoxically with a dramatic reduction in both mature band/or a-protein and Hex B and/or Hex A activity in patient cells. This is believed to be the result of a strict “quality control system” in the ER that prevents the transport and increases the degradation rate of missfolded proteins or unassembled subunits (unlike b-subunits, a-subunits have an apparently low affinity for each other) (reviewed in Refs. 4 and 14). In several cases, it has been demonstrated that subunits with missense mutations, even those associated with the most severe clinical phenotype, are not totally incapable of forming a partially functional Hex A but may be prevented from doing so by their retention and degradation in the ER (15, 16). Thus, the major detrimental effect caused by most HEX missense mutations is at the level of intracellular transport rather than structural changes specifically affecting some aspect of enzyme function. The exceptions to this conclusion are the missense mutations at a-Arg178 (17, 18) and a-Asp258 (19), which produce the B1 biochemical phenotype. Patients with the most common Arg178 3 His substitution were originally thought to have an activator defect, because they express normal levels of both Hex A and Hex B activities, as assayed with neutral (common) substrates, e.g. MUG. However, unlike the normal Hex A found in the true AB variants, Kytzia et al. (20) found that B1 variant-Hex A was inactive toward an a-specific GlcNAc 6-sulfatecontaining substrate (as well as GM2 ganglioside even in the presence of added activator protein), and they suggested the presence of a mutation at or near the active site of the a-subunit. This hypothesis has been demonstrated to be correct for substitutions at either residue based on mutational and expression studies of the aligned b-residues, i.e. b-analogs, b-Arg211 (21, 22) and b-Asp290 (23), and on molecular modeling of human Hex using the structure of bacterial chitobiase (24).

21387

We described 10 years ago two sisters of French Canadian ancestry with a chronic Sandhoff phenotype (25). We have also previously reported that these patients are heterozygous for the common 16-kb 59 HEXB deletion allele, which does not transcribe b-mRNA (26). In this report, we characterize the second mutant allele in these patients, a missense mutation in exon 13 of the HEXB gene that results in a Pro504 3 Ser substitution. This mutation produces a novel biochemical phenotype that impacts directly on the ability of Hex A to hydrolyze GM2. This is the first report of a mutation in the b-subunit that affects the ability of Hex A to hydrolyze its natural but not its artificial substrates and localizes essential elements of the b-chain for natural substrate hydrolysis to its C terminus. MATERIALS AND METHODS

Preparation of Genomic DNA—Cultured fibroblasts were lysed by directly adding 1.0 ml of DNAZOL Reagent (Life Technologies, Inc.) to the 10-cm2 culture dish. The lysate was then transferred into an Eppendorf tube, and insoluble cell debris was removed by brief centrifugation. The genomic DNA in the supernatant was precipitated with ethanol and resuspended in 10 mM Tris-HCl buffer containing 1 mM EDTA, pH 7.4 (27). RNA Isolation and Reverse Transcription—Total RNA was isolated by using TRIzoI Reagent (Life Technologies, Inc.), as described by Hou et al. (28). Two mg of total RNA were used to synthesize the single strand cDNA according to the SUPERSCRIPTTM II procedure (Life Technologies). Briefly, RNA was first denatured at 70 °C for 10 min and then incubated at 42 °C for 50 min with 200 units of SUPERSCRIPT II and 0.2 mg of random primers in 20 ml of 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 20 mM dithiothreitol, and 0.5 mM each of four dNTPs. Two ml of this mixture were directly used for PCR to synthesize and amplify double strand cDNA. DNA Amplification and Direct Sequencing—Amplification of exonic and intron/exon junctions from genomic DNA and cDNA fragments was performed by PCR as described previously (27). The reactions were carried out in a 100-ml volume of 0.1– 0.5-mg genomic DNA or 2 ml of cDNA (by reverse transcription), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 0.2 mM each of four dNTPs, 0.5 mg of each primer, and 2.5 units of AmpliTaqTM Taq polymerase. Amplification was achieved by incubation in a DNA Thermal Cycler (Perkin-Elmer) for 30 cycles, each consisting of 30 s of denaturation at 94 °C, 30 s of annealing at 55– 60 °C, and 1–3 min of extension at 72 °C. The region around exon 13, found to be heterozygous for Pro504 3 Ser mutation in genomic DNA and homozygous in cDNA was amplified by PCR using oligonucleotides 129 (exon 10, sense; GGTTTTGGATATTATTGCAACCATAAA) and 14A (39-untranslated region, antisense; TCAATCAATAAAAATATTTTATTC). The resulting PCR products from genomic DNA and cDNA were 799 and 716 bp, respectively. PCR products were purified by utilizing the Geneclean Kit (Bio 101, Inc., Vista, CA), and direct sequencing was performed with [a-35S]dATP using a modification of the SequenaseTM protocol (U.S. Biochemical Corp.), as described by McInnes et al. (27). Generation of Mutant Constructs—The wide type constructs, pREP4-a and pEFNEO-b, have been reported (7). The mammalian expression vectors pREP4 (Invitrogen) and pEFNEO (kindly supplied by Dr. Anson) (29), have hygromycin B and neomycin (G418) resistance markers, respectively. To construct the mutant cDNA into pCD vector, a 636-bp product by reverse transcription-PCR from patient fibroblast (as described above) containing b-Pro504 3 Ser was digested with PflMI at a site 59 to the mutation and BanI at a site 39 to the mutation. The middle fragment of 387 bp was purified and subcloned into pCDb43 (21) treated with PfoMI/partial BanI. To generate the mutant pEFNEO-bPro504 3 Ser, a 2.0-kb fragment, partially digested by BamHI from pCD-b-Pro504 3 Ser, was isolated and subcloned into the BamHI site of the pEFNEO-b vector. The mutation was verified by DNA sequencing. A construct encoding an Asp208 3 Asn substitution in the b-cDNA insert of pEFNEO has previously been reported (23). In permanently transfected CHO cells, this construct produces only soluble, monomeric, precursor b-subunits (23). We now used this transfected clonal CHO cell line as a control for the ER-retention on mutant b-protein. Cell Culture and DNA Transfection—CHO cells were grown in minimal essential medium with 10% FCS and antibiotics at 37 °C in 5% CO2. Transfections were performed using Lipofection from Life Technologies, as described previously (7). Transfected cells were also grown in serum-free medium containing 10 mM NH4Cl, which diverts proteins targeted to the lysosome to the secretory pathway, for 1 and 2 days, and

21388

A b-Subunit Mutation Affecting GM2 Ganglioside Hydrolysis

the Hex activity was measured using MUG. Hex Activity Assay—Cells were lysed in a buffer of 10 mM Tris-HCl, pH 7.5, and 5% glycerol through five sets of freeze-thaw cycles. Protein from cell lysate was quantitated by the Lowry method (30). Hex activity from cell lysates was determined using a a-chain-specific substrate MUGS and the common substrate MUG (15). Western Blotting—The protein (amounts loaded are indicated in each figure) from cell lysates or DEAE fractions were resolved by SDS-PAGE using a Bio-Rad minigel system (31). Proteins were transferred to nitrocellulose overnight at 4 °C. The filter was blocked in 5% skim milk and then incubated overnight with primary antibody, rabbit anti-human Hex A (7, 28). Nitrocellulose was washed four times with 1% skim milk and incubated with a secondary antibody, horseradish peroxidaseconjugated goat anti-rabbit IgG for 1 h. The filter was developed and exposed to Hyperfilm using the ECL system (Amersham Pharmacia Biotech). Separation of Hex Isozymes—Proteins (3 mg) from lysates of patient or normal fibroblasts or from control or transfected CHO cells were applied to a 1.0-ml column of DEAE CL-6B (Amersham Pharmacia Biotech). The unbound Hex B fraction was collected with 10 mM sodium phosphate, pH 6.0. Hex A was eluted by applying 0.15 M NaCl in 10 mM sodium phosphate, pH 6.0 (7). Three-ml fractions were collected and assayed for Hex activity. Kinetic Analysis—The Km value was determined by varying the concentration of the substrates from 0.125 to 4.0 mM for MUG and from 0.05 to 2.5 mM for MUGS. Also, 10 experimental points were used for each Km determination. The normal and mutant Hex A from transfected CHO or patient cells were purified away from the other Hex isozymes by DEAE ion exchange chromatography (see above). Kinetic constants were calculated using a computerized nonlinear least squares curve fitting program for the Macintosh, KaleidaGraphTM 3.0 (7). GM2 Hydrolysis Assay—[3H]GM2 ganglioside (20 nmol), labeled in the C-6-position of its N-acetylgalactosamine moiety (32), was incubated in the presence of 2.0 mg of recombinant activator protein from bacteria (33, 34) at 37 °C for 18 h in 10 mM citrate buffer (pH 4.1), 0.5% human serum albumin, and 10 mM GlcNAc (carrier), with 0, 50, 100, and 200 units of Hex A (nmol of MUGS hydrolyzed/h), from normal or patient fibroblasts or produced from human cDNAs (normal a with normal or mutant b) in transfected CHO cells (final volume of 100 ml). The hydrolyzed product from GM2, i.e. [3H]GalNAc, was separated from the unreacted GM2 substrate by passage through a positively charged ion exchange minicolumn of 0.6 ml of AG3X4 (acetate form) resin. The unbound fraction containing [3H]GalNAc was determined by liquid scintillation counting, as described previously (7). Thermal Stability Study—The wild-type and mutant Hex A or Hex B isozymes, which had been separated by DEAE chromatography, were added to 700 ml of preheated citrate phosphate buffer (pH 4.1) with 0.3% human serum albumin. The heat denaturation was performed at 45 °C, and aliquots (100 ml) were removed at intervals of 0, 15, 30, 45, 60, 75, and 90 min for Hex A and 0, 30, 60, 90, 120, 150, and 180 min for Hex B, placed on ice, and assayed for enzyme activity. The wild-type and mutant Hex A from transfected CHO cells were also tested for their residual MUGS activity after incubation at 37 °C for 18 h, under conditions that mimicked the natural substrate assay above. Intracellular Localization of b-Proteins Quantified Using Indirect Immunofluorescence—Nontransfected CHO cells or CHO cells transfected with constructs encoding (a) the wild-type b-cDNA (lysosomal localization control), (b) the Pro504 3 Ser substitution, or (c) an Asp208 3 Asn substitution (ER localization control) were grown at 37 °C in 5% CO2 on glass slide covers in a 10-cm2 culture dish. After 24 h of incubation, the cells were fixed and gently permeabilized with 100% cold methanol at 220 °C for 30 min. The fixed cells were then washed in phosphate-buffered saline, blocked with 1% bovine serum albumin, and incubated with the primary polyclonal anti-Hex B antibody (35), diluted 1:200 for 1 h. The secondary antibody, a green fluoresceinlabeled goat-anti-rabbit IgG F(ab9)2), diluted 1:100, was then added for 1 h, either alone or in combination with a 1:10,000 dilution of propidium iodide, which in addition to nuclear DNA also stains the cytoplasmic RNA and marks the position of the ER with the red fluorescence. The cells were then washed three times with phosphate-buffered saline and mounted with elvanol. In control cultures, the preimmune rabbit IgG substituted for the primary antibody. The slides were analyzed, and the proportion of b-protein present in the ER or endosome/lysosome was determined using a fluorescent microscope (Olympus Vanox-AH-3, magnification 3 800) and two narrow band filters to detect the green and red fluorescence separately. An additional broad spectrum filter was also used for the simultaneous detection of the fluorescein-tagged green Hex B and the nucleic acids labeled with red propidium iodide

FIG. 1. Autoradiography of nucleotide sequencing gels. Shown is direct sequencing of PCR products from genomic DNA (sense strand) (A) and cDNA (antisense strand) (B). The mutation is indicated by an asterisk. fluorescence. In this setting, the overlapping of the red and green labels in the cytoplasm is marked by yellow fluorescence and indicates the colocalization of Hex B and ER (36). Multiple images of the same cell obtained with all of the above mentioned filters were captured with the CCD camera (Optronix), stored in a Macintosh 9500 computer, and quantitatively analyzed using the Image Pro Plus program (Media Cybernetics, Silver Spring, MD) according to the manufacturer’s instructions. In each of the three experimental groups (wild type b, b-Pro504 3 Ser, and b-Asp208 3 Asn), images of 50 cells were analyzed, and results were statistically evaluated to give quantitative measurements of the percentage of each b-protein that resides in the ER and/or lysosome. RESULTS

Direct sequencing of the exons and exon/intron junctions of the HEXB gene revealed that the patients were heterozygous for a C1510T transition in exon 13 (12 bp from intron 12) at the codon for Pro504, which results in its conversion to a Ser codon (Fig. 1A). We have previously reported that the patients were also heterozygous for the common 16-kb 59 partial HEXB deletion allele, D16kb (26). To confirm that this missense mutation was not part of the deletion allele, we also sequenced the b-cDNA. In this case, the patients appear to be homozygous for the missense mutation (Fig. 1B). Since a HaeIII site was predicted to be lost in the presence of the C 3 T transition, the direct sequencing results from both genomic DNA (Fig. 2A) and cDNA (Fig. 2B) were confirmed by HaeIII digestions of a strategic PCR fragment from both patients and normal individuals. In addition to the genomic PCR fragments from the five normal individuals shown in Fig. 2A, samples from at least 45 other normal individuals were analyzed and found not to contain this


21389

TABLE I Hex A present in fibroblasts measured after isozyme separation by chromatofocusing (27, 47) Values shown are percentages of normal level as based on units (nmol of MU h21 mg21) of the indicated substrate hydrolyzed by Hex A or Hex B. MUG Hex A

MUGSa (Hex A)

33 12–26 2.1 6 0.9 0.06 6 0.02e

29 9–23 2.2 6 0.6 0.8 6 0.3e

Cell line Hex B %

Carrierb (n 5 1) Chronicc,d (n 5 2) Subacutec (n 5 5) Acutec (n 5 11)

15 1.5–2 0.5 6 0.2 0.02 6 0.02

%

a These data, while determined during the O’Dowd et al. study (47), have not been previously reported. b From Ref. 47. c The chromatofocusing profile of lysate from one of these cell lines has previously been reported (27). d The range of numbers presented are the range of activities measured in the two affected sisters’ cell lines. e This MUG/MUGS ratio, 1.5:1 (7) plus the slightly lower pH of elution (47) suggests that this activity is from a small amount of pro-Hex S; mature Hex S is well separated from Hex A by this procedure (27, 47) (the pro-a-chain loses basic amino acids during maturation (50)).

FIG. 2. Direct restriction digest assay (see diagrams at the top of each panel) for the presence of the C1510T transition in PCR fragments from genomic DNA (A) and cDNA (B). M-1 (line 2399) and M-2 (line 2400) are samples from our two patients’ fibroblasts, N and N-1 to N-5 are samples from the fibroblasts of six different normal individuals. Std., molecular size standards with the indicated number of base pairs (left).

mutation (data not shown). Thus, the C 3 T transition in the Pro504 codon is not present in either the 16-kb deletion or any of the 100 normal HEXB alleles we analyzed. Interestingly, the residual Hex A activity present in the patients’ fibroblasts, ;20%, is only about half that found in cells from an obligate carrier of Sandhoff disease (acute form), 5–10-fold higher than the average levels of five cell lines from subacute patients (Table I), and even slightly higher than those reported for asymptomatic individuals with low Hex A activity (10 –15%) (5, 37, 38). We also investigated the levels of a- and b-CRM in the patient’s cells and compared them to levels found in cell lines from a normal individual, a subacute patient (2.5% residual Hex A activity), and an acute patient (0% residual Hex A activity) (Fig. 3). The apparent levels of mature b-CRM in these samples were consistent with the decreased Hex A and B activities reported in Table I, indicating that the specific activity of the mutant Hex isozymes for artificial substrates had not changed. However, it was also apparent that there was a great increase in the ratio of precursor/mature forms of the a- and/or b-polypeptides, suggesting that the b-Pro504 3 Ser mutation results in the retention of a significant amount of newly synthesized pro-b-chains in the ER (39, 40) and probably a more rapid turnover rate (41). To confirm that the mutant mature polypeptides were not being degraded in the lysosome, normal and patient cells were grown in media containing leupeptin,

FIG. 3. Western blot analyses using an anti-human Hex A antibody of the a- and b-polypeptides in the total cell lysates (the amount of protein loaded is given directly below the sample lane) from co-transfected CHO cells (with wild type a-cDNA and mutant b-cDNA, b*); normal fibroblasts (Normal); and fibroblasts from Sandhoff patients presenting with chronic (Chr.*, one of the subjects of this report; line 2400) subacute (Subac.; line GM 2094), and acute (Acute; line GM 294) forms of GM2 gangliosidosis (the genotype of each patient is given at the bottom of the figure below the corresponding sample lane). Analyses of the polypeptides present after isozyme separation (Hex B and Hex A; Hex S was not eluted from the column) by ion exchange chromatography (DEAE-Separated) of co-transfected CHO cell lysates are also shown.

which has been shown to inhibit the turnover of mutant b-chains in the lysosome (21, 22). No dramatic increase in either Hex activity or mature b-CRM was observed (Fig. 4). To fully characterize the biochemical effects of the Pro504 3 Ser mutation, CHO cells were permanently co-transfected with two cDNAs encoding the normal a- and the mutant b-polypeptides. A high producing clone was isolated and grown (Fig. 3). The Hex isozymes from the lysate of these cells were separated by ion exchange chromatography (Fig. 3). Since several mutations linked to the chronic form of GM2 gangliosidosis have been shown to produce a less heat-stable isozyme, as well as an increased retention of the mutant subunit in the ER (15, 16, 42,


21390

43), the T1⁄2 values of both Hex isozymes carrying the mutant b-subunit were determined at 45 °C (Table II). Consistent with these previous observations, the b-Pro504 3 Ser substitution decreases the heat stability of both the A and B isozymes (Table II). The ability of the b-Pro504 3 Ser substitution to inhibit ER to Golgi transport was directly confirmed by immunofluorescence microscopy (Fig. 5). CHO cells permanently transfected with either the wild-type (Fig. 5B) or mutant b-cDNAs encoding the Pro504 3 Ser (Fig. 5D) or Asp208 3 Asn (Fig. 5C) substitutions were examined. The latter substitution results in only monomeric, precursor b-chains in transfected cells (23) and thus serves as a control for ER retention (39, 44). Quantitative measurements of the green versus yellow (overlapping of the red and green labels in the cytoplasm, i.e. ER) fluorescence in 50 cells from each group indicated that virtually all of the Asp208 3 Asn b-protein (97 6 2%) is present in the ER of transfected cells, compared with 60 6 10% of the b-Pro504 3 Ser protein and 15 6 5% of the wild-type b-chain (Fig. 6). Furthermore, CHO cells co-transfected with the wild type a and b and those transfected with a- and b-Pro504 3 Ser were

grown in 10 mM NH4Cl, and the MUG activity was measured in the media. Wild-type transfected cells secreted 1.1 3 104 nmol/ h/ml on day 1 and 2.4 3 104 units on day 2. Cells expressing the mutant b-cDNA secreted 0.18 3 104 units on day 1 and 0.28 3 104 units on day 2. Thus, diverting the mutant Hex from the lysosomes to the secretory pathway did not result in a large increase in activity, confirming that the loss of activity and b-CRM occurs at an early point in protein transport, i.e. the ER. Due to the relatively high levels of residual, mutant Hex A activity, i.e. ab-Pro504 3 Ser (ab*, Hex A*), that we found in both our patients’ cells and in co-transfected CHO cells, it remained difficult to explain why the patients should present with any disease phenotype. One possibility would be that the b-mutation had some direct effect on the function of the Hex A* isozyme. To address this question, we first examined the kinetic behavior of Hex A* with the common and a-specific substrates, MUG and MUGS, respectively. Kinetic analysis confirmed that Hex A* has the same apparent Km values as the wild type isozyme for these artificial substrates (Table II). We next tested the ability of the Hex A* to hydrolyze its natural substrate, the GM2 activator-GM2 ganglioside complex. Using samples of Hex A and Hex A* that contained the same number of MUGS units, we found that the mutant isozyme is 3-fold less active toward the natural substrate than is the wild type Hex A (Fig. 7, Table II). Furthermore, we confirmed that the residual Hex A in the patient’s fibroblasts also had a decreased activity toward GM2 as compared with MUGS (Table II, GM2/ MUGS ratio). Finally, we tested the stability of the wild type and mutant Hex A over the 18-h, 37 °C incubation period used in the GM2 hydrolysis assay. Both forms of Hex A lost some activity toward MUGS over this time period; however, at the end of 18 h. the residual activity of the mutant form was only 15% less than the wild type (Table II). DISCUSSION

FIG. 4. Western blot analyses using an anti-human Hex A antibody of the a- and b-polypeptides in the total cell lysates (the amount of protein loaded is given directly above the sample lane) from fibroblasts of one of our chronic patients (line 2400) and a normal individual. Cells were grown in the presence (1) or absence (2) of leupeptin, which inhibits lysosomal degradation of proteins. Total Hex-specific activities, using the MUG or MUGS artificial substrates, are given at the bottom of the figure.

We have previously demonstrated that two French Canadian patients with chronic Sandhoff disease are heterozygous for the common D16kb HEXB allele (26, 27). Since this allele produces no b-mRNA, the uncharacterized, second allele must be responsible for the 15–25% residual Hex A activity (using MUG) we reported to be present in the patients’ fibroblasts and for their mild chronic phenotype. Western blotting with anti-b antiserum has also indicated a similar reduction in the amount of mature b-protein (27). In this report, we identify the second allele as a C1510T transition encoding a Pro504 3 Ser substitution. We demonstrate that this substitution is not found in

TABLE II Biochemical characterization of the effects of the b-Pro504 3 Ser substitution Isozyme

Kma (MUG)

Kma (MUGS)

mM

mM

CHO(2)c Hex A (ab) Hex A* (ab*)e Hex B (bb) Hex B (b*b*) Fibroblast Hex A*g

NDd 0.80 6 0.05 0.74 6 0.03 0.71 6 0.05 ND ND

ND 0.26 6 0.02 0.29 6 0.02 ND ND ND

Remaining MUGS after 18 h 37 °Cb

103 3 GM2/MUGSa

45 °C t1⁄2b min

%

0.012 6 0.001 1.3 6 0.01 0.48 6 0.02 ND ND 0.44 6 0.03

ND 200 6 10 60 6 5 UDf 120 6 5 ND

ND 81 6 4 66 6 3 ND ND ND

a S.E. of the experimental points as calculated from the best fit curve based on the Michaelis-Menten equation (R values were all $0.998) or line (Fig. 7). b Mean and S.D. of values from three independent experiments. c Untransfected CHO cells; endogenous CHO cell Hex A does not bind the GM2-human activator complex; i.e. this is a species-specific reaction (7). d ND, not determined. e Hex A was isolated by ion exchange chromatography from CHO cells co-transfected with cDNAs encoding wild-type a and Pro504 3 Ser substituted b, b* subunits. f Undetectable loss in enzyme activity over the entire incubation period. g Mutant Hex A isolated from the patient’s fibroblasts by ion exchange chromatography.


21391

FIG. 7. Natural substrate, GM2 ganglioside-activator complex, assay of DEAE-separated Hex A (Fig. 3) from untransfected CHO cells (endogenous CHO cell Hex A) (filled squares); CHO cells co-transfected with either cDNAs encoding wild type prepro-a and -b polypeptides (filled circles); or wild type a- and b-Pro504 3 Ser prepropolypeptides (filled diamonds). For each form of Hex A, three samples containing 50, 100, and 200 units of MUGS were assayed and the best fit straight line drawn. The slopes of each line 6 its calculated S.E. are given in Table II. Note that for this assay the human activator is “species-specific”; i.e. endogenous CHO cell Hex A is virtually nonfunctional. FIG. 5. Indirect immunofluorescence microscopy using an anti-human Hex B antibody of untransfected CHO cells (A) or CHO cells co-transfected with cDNAs encoding wild type prepro-a and -b polypeptides (B), cDNAs encoding wild type a- and b-Asp208 3 Asn polypeptides (C), or cDNAs encoding wild type aand b-Pro504 3 Ser polypeptides (D).

FIG. 6. Graphical representation of the percentage of various b-proteins: wild type (WT) or containing either a Asp208 3 Asn (D208N) or a Pro504 3 Ser (P504S) substitution (x axis) in either the ER or endosome/lysosome in permanently transfected CHO cells. Bars represent the S.D. of each value obtained from the analyses of 50 cells/experimental group.

either the 16-kb deletion allele or in 100 normal HEXB alleles we examined, indicating that it is the single cause of the patients’ biochemical and clinical phenotypes. This conclusion was strengthened by studies of the b-Pro504 3 Ser mutant Hex A and Hex B isozymes produced in CHO cells permanently transfected with the wild type a- and/or mutant b-cDNAs. The mutant b-subunit produced isozymes with decreased heat stability (Table II) and increased retention in the ER, 60 6 10% as compared with 15 6 5% for the wild type (Figs. 5 and 6). The latter data indicate that the mutation reduces the b-containing Hex isozyme content in lysosomes by 30 – 60%. These data are also consistent with the effects of other mutations producing the chronic phenotype, i.e. a-Gly269 3 Ser (15, 45) a-Tyr180 3 His (16), b-Arg505 3 Gln (43), and b-Ala543 3 Thr (42). Dlott et al. (38) characterized the HEXB mutation associated

with clinically asymptomatic individuals whose biochemical phenotype of low levels of residual Hex A and undetectable levels of Hex B, i.e. Hex A1/Hex B2, had previously been designated as “Hexosaminidase Paris” (46). In the same report, they characterized another mutation associated with subacute Sandhoff disease, which was also characterized by the Hex A1/Hex B2 biochemistry. Both of these patients were also heterozygous for the D16kb allele; thus, their biochemical phenotype was due to their second allele (26). In both cases, the second allele produced a partial splicing defect in the HEXB gene encoding an elongated b-polypeptide, i.e. a duplication of bp 216 to 12 of IVS-13 3 exon 14 (asymptomatic) and g-26a IVS-12 (subacute) (38). It was also shown that the residual activity present in these patients’ samples was from a small amount of properly spliced b-mRNA encoding the wild type protein. Activity measurements indicated that the asymptomatic individuals had twice as much residual Hex A activity as the subacute patients, 10 and 5% respectively (38). In this and other reports (26, 27, 47), we have included the cell line from the above subacute patient (g-26a IVS-12; D16kb) in our analyses. In our hands, the residual Hex A activity in this line is 2–3% of normal, using artificial substrates (Table I) (27, 47). This would suggest that Hex A levels of 4 – 6% of normal should prevent GM2 storage and disease. This estimate is close to that set as the “critical threshold” by Sandhoff and colleagues (5, 37). Given this critical threshold and our previous Hex A activity data, it has been difficult to explain why our two patients present with chronic GM2 gangliosidosis. Two possibilities were considered: first, that the b mutation is somehow affecting the a active site, lowering its activity toward MUGS and GM2, e.g. a new type of B1-variant; second, the mutant b-subunit is affecting the ability of Hex A to bind the GM2 activator-GM2 ganglioside complex. We now report the reexamination of residual Hex A* activities using the a-specific MUGS substrate (Table I) and the evaluation of both a- and b-CRM levels in patients’ cells using an anti-Hex A antiserum (Fig. 3 and 4). These analyses confirmed our previous data, particularly that the levels of MUGS activity from Hex A* are 9 –23% of normal, and the b-CRM present in the cell line from the aforementioned subacute patient is much less than half that present in cells from our patient (Fig. 3). Thus, this substitution does not appear to

21392


specifically affect the a active site, e.g. through some induced conformational change. However, to fully eliminate this possibility, we determined the Km of Hex A* for both the MUG and MUGS substrates. These were found to be normal (Table II). Finally, we assessed the ability of the Hex A* produced in transfected CHO cells and semipurified from one of our patient’s fibroblasts to hydrolyze its natural substrate, the GM2 activator-GM2 ganglioside complex (Fig. 7, Table II). These data demonstrate that the b-Pro504 3 Ser mutation reduces the ability of the Hex A* to hydrolyze ganglioside in the presence of human activator by 3-fold (Table II). If this 3-fold reduction in the specific activity of Hex A* toward GM2 ganglioside, but not MUG or MUGS, is factored into our residual Hex A activity measurement (Table I), the patients’ Hex A* activity is reduced to 3–9% of normal. This is very close to the critical threshold values we discussed above and is consistent with the chronic phenotype observed in the patients. Recently, we (48) and others (49) have reported the characterization of a-b fusion proteins. Although some of our conclusions differed, both studies concluded that the C terminus of the b-polypeptide is important for the correct binding of the activator-ganglioside complex. The characterization of this novel, naturally occurring mutation strengthens these conclusions and identifies the region surrounding Pro504 as the area in the C terminus most likely to be responsible for this function.

14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32.

Acknowledgment—We thank A. Leung for excellent technical assistance and I. B. Warren for preparing the 50 normal DNA samples used to screen for the C1510T substitution.

33.

REFERENCES

35.

1. Nakai, H., Byers, M. G., Nowak, N. J., and Shows, T. B. (1991) Cytogenet. Cell Genet. 56, 164 –164 2. Bikker, H., Meyer, M. F., Merk, A. C., de Vijlder, J. J., and Bolhuis, P. A. (1988) Nucleic Acids Res. 16, 8198 – 8198 3. Heng, H. H. Q., Xie, B., Shi, X.-M., Tsui, L.-C., and Mahuran, D. J. (1993) Genomics 18, 429 – 431 4. Gravel, R. A., Clarke, J. T. R., Kaback, M. M., Mahuran, D., Sandhoff, K., and Suzuki, K. (1995) in The Metabolic and Molecular Bases of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., eds) Vol. 2, 7th Ed., pp. 2839 –2879, McGraw-Hill Inc., New York 5. Leinekugel, P., Michel, S., Conzelmann, E., and Sandhoff, K. (1992) Hum. Genet. 88, 513–523 6. Kytzia, H.-J., and Sandhoff, K. (1985) J. Biol. Chem. 260, 7568 –7572 7. Hou, Y., Tse, R., and Mahuran, D. J. (1996) Biochemistry 35, 3963–3969 8. Li, S. C., Wu, Y. Y., Sugiyama, E., Taki, T., Kasama, T., Casellato, R., Sonnino, S., and Li, Y. T. (1995) J. Biol. Chem. 270, 24246 –24251 9. Sandhoff, K., Harzer, K., and Fu¨rst, W. (1995) in The Metabolic Basis of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., eds) Vol. 2, 7th Ed., pp. 2427–2441, McGraw-Hill Inc., New York 10. Wu, Y. Y., Lockyer, J. M., Sugiyama, E., Pavlova, N. V., Li, Y.-T., and Li, S.-C. (1994) J. Biol. Chem. 269, 16276 –16283 11. Meier, E. M., Schwarzmann, G., Fu¨rst, W., and Sandhoff, K. (1991) J. Biol. Chem. 266, 1879 –1887 12. Fu¨rst, W., and Sandhoff, K. (1992) Biochim. Biophys. Acta 1126, 1–16 13. Sandhoff, K., Conzelmann, E., Neufeld, E. F., Kaback, M. M., and Suzuki, K.

34.

36. 37. 38. 39. 40. 41. 42.

43. 44. 45. 46. 47. 48. 49. 50.

(1989) in The Metabolic Basis of Inherited Disease (Scriver, C. V., Beaudet, A. L., Sly, W. S., and Valle, D., eds) Vol. 2, 6th Ed., pp. 1807–1839, McGraw-Hill Inc., New York Mahuran, D. J. (1991) Biochim. Biophys. Acta 1096, 87–94 Brown, C. A., and Mahuran, D. J. (1993) Am. J. Hum. Genet. 53, 497–508 De Gasperi, R., Gama Sosa, M. A., Battistini, S., Yeretsian, J., Raghavan, S., Zelnik, N., Leshinsky, E., and Kolodny, E. H. (1996) Neurology 47, 547–552 Ohno, K., and Suzuki, K. (1988) J. Neurochem. 50, 316 –318 Tanaka, A., Ohno, K., Sandhoff, K., Maire, I., Kolodny, E. H., Brown, A., and Suzuki, K. (1990) Am. J. Hum. Genet. 46, 329 –339 Fernandes, M., Kaplan, F., Natowicz, M., Prence, E., Kolodny, E., Kaback, M., and Hechtman, P. (1992) Hum. Mol. Genet. 1, 759 –761 Kytzia, H. J., Hinrichs, U., Maire, I., Suzuki, K., and Sandhoff, K. (1983) EMBO J. 2, 1201–1205 Brown, C. A., and Mahuran, D. J. (1991) J. Biol. Chem. 266, 15855–15862 Brown, C. A., Neote, K., Leung, A., Gravel, R. A., and Mahuran, D. J. (1989) J. Biol. Chem. 264, 21705–21710 Tse, R., Vavougios, G., Hou, Y., and Mahuran, D. J. (1996) Biochemistry 35, 7599 –7607 Tews, I., Perrakis, A., Oppenheim, A., Dauter, Z., Wilson, K. S., and Vorgias, C. E. (1996) Nat. Struct. Biol. 3, 638 – 648 Rubin, M., Karpati, G., Wolfe, L. S., Carpenter, S., Klavins, M. H., and Mahuran, D. J. (1988) J. Neurol. Sci. 87, 103–119 Neote, K., McInnes, B., Mahuran, D. J., and Gravel, R. A. (1990) J. Clin. Invest. 86, 1524 –1531 McInnes, B., Potier, M., Wakamatsu, N., Melancon, S. B., Klavins, M. H., Tsuji, S., and Mahuran, D. J. (1992) J. Clin. Invest. 90, 306 –314 Hou, Y., Vavougios, G., Hinek, A., Wu, K. K., Hechtman, P., Kaplan, F., and Mahuran, D. J. (1996) Am. J. Hum. Genet. 59, 52–58 Anson, D. S., Taylor, J. A., Bielicki, J., Harper, G. S., Peters, C., Gibson, G. J., and Hopwood, J. J. (1992) Biochem. J. 284, 789 –794 Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265–275 Laemmli, U. K. (1970) Nature 227, 680 – 685 Novak, A., Lowden, J. A., Gravel, Y. L., and Wolfe, L. S. (1979) J. Lipid Res. 20, 678 – 680 Smiljanic-Georgijev, N., Rigat, B., Xie, B., Wang, W., and Mahuran, D. J. (1997) Biochim. Biophys. Acta 1339, 192–202 Klima, H., Klein, A., Van Echten, G., Schwarzmann, G., Suzuki, K., and Sandhoff, K. (1993) Biochem. J. 292, 571–576 Redonnet-Vernhet, I., Mahuran, D., Salvayre, R., Dubas, F., and Levade, T. (1996) Biochim. Biophys. Acta 1317, 127–133 Hinek, A., Molossi, S., and Rabinovitch, M. (1996) Exp. Cell Res. 225, 122–131 Kytzia, H. J., Hinrichs, U., and Sandhoff, K. (1984) Hum. Genet. 67, 414 – 418 Dlott, B., d’Azzo, A., Quon, D. V. K., and Neufeld, E. F. (1990) J. Biol. Chem. 265, 17921–17927 Hasilik, A., and Neufeld, E. F. (1980) J. Biol. Chem. 255, 4937– 4945 d’Azzo, A., Proia, R. L., Kolodny, E. H., Kaback, M. M., and Neufeld, E. F. (1984) J. Biol. Chem. 259, 11070 –11074 Ashkenas, J., and Byers, P. H. (1997) Am. J. Hum. Genet. 61, 267–272 De Gasperi, R., Gama Sosa, M. A., Grebner, E. E., Mansfield, D., Battistini, S., Sartorato, E. L., Raghavan, S. S., Davis, J. G., and Kolodny, E. H. (1995) Biochem. Mol. Med. 56, 31–36 Bolhuis, P. A., Ponne, N. J., Bikker, H., Baas, F., and Vianney de Jong, J. M. B. (1993) Biochim. Biophys. Acta 1182, 142–146 Proia, R. L., d’Azzo, A., and Neufeld, F. (1984) J. Biol. Chem. 259, 3350 –3354 Navon, R., and Proia, R. L. (1989) Science 243, 1471–1474 Dreyfus, J. C., Poenaru, L., Vibert, M., Ravise, N., and Boue, J. (1977) Am. J. Hum. Genet. 29, 287–293 O’Dowd, B. F., Klavins, M. H., Willard, H. F., Gravel, R., Lowden, J. A., and Mahuran, D. J. (1986) J. Biol. Chem. 261, 12680 –12685 Tse, R., Wu, Y. J., Vavougios, G., Hou, Y., Hinek, A., and Mahuran, D. J. (1996) Biochemistry 35, 10894 –10903 Pennybacker, M., Liessem, B., Moczall, H., Tifft, C. J., Sandhoff, K., and Proia, R. L. (1996) J. Biol. Chem. 271, 17377–17382 Mahuran, D. J. (1990) J. Biol. Chem. 265, 6794 – 6799