Superparamagnetic Nanoparticles Direct ...

Copyright © 2014 American Scientific Publishers All rights reserved Printed in the United States of America

Journal of Biomaterials and Tissue Engineering Vol. 4, 1–7, 2014

Superparamagnetic Nanoparticles Direct Differentiation of Embryonic Stem Cells Into Skeletal Muscle Cells Tannaz Norizadeh-Abbariki1 † , Omid Mashinchian2 † , Mohammad Ali Shokrgozar1 , Nooshin Haghighipour1 ∗ , Tapas Sen3 4 , and Morteza Mahmoudi5 6 ∗ 1

National Cell Bank, Pasteur Institute of Iran, Tehran, Iran Department of Medical Nanotechnology, School of Advanced Technologies in Medicine (SATiM), Tehran University of Medical Sciences, Tehran, Iran 3 Centre for Materials Science, School of Forensic and Investigative Sciences, University of Central Lancashire, Preston, United Kingdom 4 Institute of Nanotechnology and Bioengineering, University of Central Lancashire, Preston, United Kingdom 5 Department of Nanotechnology and Nanotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran 6 Current Address: Division of Pediatric Cardiology, Department of Pediatrics, Stanford University School of Medicine, Stanford, California 94305-5101, United States 2

Keywords: SPION, Embryonic Stem Cell, Myogenesis.

1. INTRODUCTION During the last decade, stem cells offered immense potential as a source for personalized and regenerative medicine with few successful attempts at (pre) clinical evaluations.1–4 These cells reside in discrete environments inside the body, i.e., niches, which orchestrate the fascinating procedure of developmental tissue growth or morphogenesis.5–8 Due to the extensive demands in clinical setting and laboratories together with the incapability of present treatment approaches, an innovative medical procedure based on stem cell implantation have been establishing.9 10 In this regard, selectively controlling of the stem cell fate differentiation into desirable cell types, in both in vitro and in vivo conditions, emerged a new theme so-called as “regenerative medicine.”11–14 This technology is recognized as one of the most promising strategy which can facilitate the processes of tissue repairing, specifically in skeletal muscle tissue engineering and represent substitutable naturally/artificially synthesized muscle fibers for ∗ †

Authors to whom correspondence should be addressed. These two authors contributed equally to this work.

J. Biomater. Tissue Eng. 2014, Vol. 4, No. xx

transplantation/replacement therapy.15–17 Moreover, such engineered tissues would be indispensable in treating a plethora, which mostly affect the skeletal muscle.15 18 The regeneration processing requires numerous numbers of progenitor cells with the ability of contribution to the formation of functional skeletal muscle.19 In that respect, among the various types of stem cells, embryonic stem cells (ESCs) have a superior capability to grow and divide in an undifferentiated state over a prolonged period which may represent a tremendous potential cell source for cell therapy of a variety of degenerative skeletal muscle disease.20 Studies over the past decade have revealed that the early steps in embryonic myogenesis take place during the embryoid body differentiation.21–24 In this context, the complete process of skeletal muscle differentiation is controlled by some specific transcription factors including MyoD, Myf5, Myf6, myogenin (MyoG), and sarcomeric myosin heavy chain (MyHC) which provided the foundation for a regulatory molecular cascades. Furthermore, gene knockouts of each myogenic regulatory factors (MRFs) demonstrated the fact that each specific factor may play a unique role in skeletal muscle differentiation.25

2157-9083/2014/4/001/007

doi:10.1166/jbt.2014.1205

1

RESEARCH ARTICLE

Dextran coated superparamagnetic iron oxide nanoparticles with positive, negative and neutral surfaces have been used for labeling embryo stem cells (ESCs) for efficient cell-based therapies toward the formation of functional skeletal muscle. Dramatic effects in specific gene expression (e.g., MyoG and Myh2) pattern of labeled cells, under pulsed electromagnetic field, were found. More specifically, the highest expression levels of MyoG and Myh2 were detected in the labeled cells with positive dextran coated SPIONs. Therefore, significant effects of magnetic fields on directing the superparamagnetic labeled stem cells toward skeletal muscle cells have been confirmed.

Superparamagnetic Nanoparticles Direct Differentiation of Embryonic Stem Cells Into Skeletal Muscle Cells

various surface characteristics on the differentiation fate of Embryo Stem Cells (ESCs) (ESC line, Royan C4, Royan Institute, Tehran, Iran) were investigated. In addition, the effects of external magnetic field (Helmholtz coil system) on the differentiation of SPIONs-labeled-ESCs were examined. The cells were exposed to pulsed electromagnetic field (PEMF) 6 h per day during 5 days differentiation period.34 The applied field consisted of 0.1 mT intensity and 12 Hz frequency. More specifically, chemical factors including, dimethyl sulfoxide (DMSO) (ICN Biomedicals, NY, USA), horse serum (Gibco, NY, USA) and SPIONs

RESEARCH ARTICLE

In particular, a major amount of efforts has been invested in designing the biomaterial-based approaches to fabricate the detailed platform in order to elicit the specific behaviors from differentiated stem cells.26–31 Recently, considerable amount of researches have demonstrated that the magnetic nanoparticles (MNPs) possess of numerous advantages for stem cell-based regenerative medicine application.32 33 In the present study, an individual and mixture effects of specific myogenic transcription factors and/or ultra-small superparamagnetic iron oxide nanoparticles (SPIONs) with

Abbariki et al.

Fig. 1. (A 1-2): EBs in culture at day 4 show the dense center core which is a specific characteristic of early EB formation (A3) DAPI staining. These EBs were generated by hanging drop methodology.35 (A4): MTT assay results for SPIONs coated samples on ECS after 24, 48, and 72 incubating hours; Prussian blue staining (SPIONs are blue sites) of the SPIONs-labeled-ESCs (the ESCs were incubated with of negative (b1-2), positive (c3-4) and (d5-6) neutral dextran-coated SPIONs for 24 h and 5 day respectively).

2

J. Biomater. Tissue Eng. 4, 1–7, 2014

Abbariki et al.



Table I.

The sequences of primers used in Real-time PCR.

Sample Myh2 MyoG TBP (TATA binding protein)

Sequences Fw Re Fw Re Fw Re

5 TGCTGCTGATCACCACGAAC3 5 GCACTATCAGTGGCCATCA-3 5 CCAACCCAGGAGATCATTTGC-3 5 -TTGGGCATGGTTTCGTCTG-3 5 AAGGGAGAATCATGGACCAGAAC-3 5 GGTGTTCTGAATAGGCTGTGGAG-3

Notes: Fw: Forward; Re: Reverse.

and the obtained results for the unlabeled cells, revealed the highest expression level of MyoG (36 ± 11 fold) and Myh2 (78 ± 004 fold) in either chemical or magnetic field differentiation group (CH + P group) compared to other test groups (Figs. 2(a) and (b)). Furthermore, exposition to PEMF (P group) led to an enhanced expression of the myogenic genes under myogenic differentiation of ESCs. From these findings, one can suggest that the external magnetic field can affect the differentiation of ESCs into

RESEARCH ARTICLE

with various surface coatings (i.e., negative (carboxylateddextran), neutral (dextran), and positive (amine conjugatedextran)) have been employed. In this study, as a control methodology of EB formation, a hanging drop culture was utilized.35 The full characterization of the employed SPIONs, with the size of 20 nm and various surface coatings, were provided in our previous report.36 The SPIONs with various surface characteristics, at concentration of 20 g/ml, were incubated with the ESCs for 24, 48 and 72 h and their compatibility were checked by MTT (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide) assay.37 According to the results, the high concentration of the dextran coated SPIONs (20 g/ml) was highly compatible to the cells (Fig. 1, A1-4). Previous studies demonstrated that the incubating the cells with 25 g/ml of SPIONs could achieve almost 100% labeling rate, but higher concentration (e.g., > 50 g/ml), could cause cell death which might be mediated by changes in the intracellular ROS level.38 39 In order to probe the SPIONs inside the cell, the Prussian blue staining method was employed.40 The blue sites in the cytoplasm of the SPIONs-labeled-ESCs (Fig. 1) showed the existing of the SPIONs surrounding the nucleus. The staining procedure was repeated 5 times and analyzed after 24 h and 5 days (required time for complete cellular differentiation process). However, it is worth to note that the engineered nanoparticles interactions with the cells and the other biological outcomes can alter significantly in the presence/absence of a preformed corona (i.e., corona is a very selective layer of numerous proteins and biomolecules, which strongly adsorbs on the surface of the nanoparticles) in serum.41–45 In previous research findings, it has been demonstrated that the efficiency of nanoparticles uptake is known to depend on many chemical and physical factors,46–48 such as, surface chemistry, but the influence of this factors on the cell fate are not recognized systematically. In order to deeply clarify the underlying gene expression levels (i.e., skeletal myogenic specific markers), the SPIONs-labeled and unlabeled ESCs, which were exposed to PEMF and chemical supplements were examined in diverse experimental groups ((U): untreated ESCs; (CH): chemical differentiation group; (P): PEMF differentiation group; (S): labeled stem cells with different SPIONs).49 In this regard, SYBER green-based real-time PCR primers were designed using primer express software (version 2.5) and related sequences have been shown in Table I. Accordingly, two specific markers, MyoG and Myh2 were figured out as skeletal myogenic indicators and TBP was utilized as housekeeping gene to normalize the gene expression results. In each chemical analyzed groups, DMSO and horse serum were employed for induction of skeletal muscle differentiation.50 In the real-time PCR experiment, five days after induction, the levels of Myh2 and MyoG mRNAs were assessed

Fig. 2. The amount of (a) Myh2 and (b) MyoG expressions were measured and analyzed in the cells which labeled with negative, positive, and neutral dextran-coated SPIONs (S) and unlabeled cells, respectively. In the chemical group (CH), cells were stimulated with DMSO and horse serum, in PEMF group (P), the cells were applied by magnetic fields with 0.1 mT intensity and 10 Hz frequency and in the PEMF+ chemical group (CH + P), the cells coincidentally exposed to electromagnetic field and induction medium. Moreover, the mentioned groups were experimented on SPIONs labeled cells, which are indicated with +S. Untreated cells (U) was selected as negative control.

3

RESEARCH ARTICLE


skeletal muscle cells, which can be recognized as a single differentiation factor. But in the labeled cells with positive dextran coated SPIONs (containing serum medium initial uptake), which cultured in supplemented medium with myogenic differentiation factors (CH + S group), the most enhancement was observed in the expression of either MyoG (93 ± 04 fold) or Myh2 (156 ± 01 fold) (Figs. 2(a) and (b)). However, exposition of positive SPIONs labeled cells to PEMF (P + S group), led to an upregualtion of MyoG (27 ± 31 fold) and Myh2 (55 ± 101 fold) expression. Interestingly, in the last studied group (CH + P + S), the relative expression levels of this genes were higher compared to PEMF differentiation group (P + S group). In addition, no important changes were observed for the labeled cells with positive dextran coated SPIONs (S group). In the all of the considered groups, the expression levels of the specific genes in positive SPIONs labeled cells were higher than the same groups in unlabeled ones. In the labeled cells with neutral dextran coated SPIONs (containing serum medium initial uptake), the expression of Myh2 (48 ± 14 fold) and MyoG (105 ± 003 fold) were higher in chemical differentiation group (CH + S group) than the other studied groups (Figs. 2(a) and (b)). Similar to the previous results (positive SPIONs labeled cells), exposition the neutral-labeled cells to magnetic fields (P + S group) led to an enhanced expression for the selected markers. Nevertheless, in magnetic + chemical differentiation group (CH+P+S), we found an increase in the expression of genes, whereas this specific marker expression levels were very low in the incubated labeled cells with positive dextran coated SPIONs without additional treatment (S group) compared to other groups. This indicates that the neutral SPIONs, as a single factor, could have no effect on myogenic differentiation. Furthermore, the expression level of MyoG marker in all of the labeled cells with neutral dextran coated SPIONs differentiation group was higher than unlabeled cells (Fig. 2(a)). In the labeled cells with negative dextran coated SPIONs (containing serum medium initial uptake), MyoG (59 ± 17 fold) expression was increased in chemical differentiation group (CH + S group) as compared to other test groups (Fig. 2(a)). There were no changes in the analyzed markers expression on negative labeled cells without any treatment (S group). This indicates the fact that the negative SPIONs, as a single factor, have no effect on myogenic specific genes. In order to examine the effects of serum free medium in the labeled cells, the expression level of Myh2 (skeletal muscle specific marker) was evaluated after the chemical factor treatment and exposure with PEMF. A decreased expression in this marker was observed in the entire experimental group. 4

Abbariki et al.

Fig. 3. The effects of serum free medium in the labeled cells with negative, positive and neutral dextran-coated SPIONs was evaluated by Myh2 expression level analyzing after the treatment with chemical factors and PEMF exposure. A high decrease in Myh2 expression can be seen in cells, which was labeled without serum.

In the labeled cells with positive dextran coated SPION (serum free medium initial uptake), the most transcription of Myh2 (40 ± 16 fold) was detected in the cells, in which chemical supplement was added to PEMF stimulation (CH + P + S group) (Fig. 3). In the labeled cells with neutral dextran coated SPION (serum free medium initial uptake), the high level of this specific transcription factor (45 ± 11 fold) expression was observed in the chemical+magnetic (CH + P + S group) differentiation group. In the other groups (S group and P + S group), Myh2 expression showed no significant changes. Finally, in the labeled cells with the negative dextran coated SPION (serum free medium initial uptake), the most transcription of Myh2 was detected in the cells, which just exposed to the PEMF (Fig. 3). Previous studies demonstrated that the biophysical cues including pulsed electro-magnetic fields (PEMF) had considerable effects on embryonic stem cell differentiation.51–54 Additionally, it was well recognized that, PEMF accelerated the differentiation of skeletal muscle precursors and embryonic stem cells, which induced cell condensation required for stem cell differentiation.54–56 The obtained real-time PCR results indicated the fact that the highest expression of Myogenin in all of the chemical differentiation of the labeled SPIONs (containing serum proteins) test groups rather than the other studied groups. The expression of Myh2 in positive and neutral SPIONs labeled chemical differentiation groups had also highest amount compared to other groups. The achieved highest expression of the Myh2 was probably caused by the functional group of DMSO (sulfur and oxygen), which could interact with the surface of SPIONs followed by their stabilization in effective manner.57 Interestingly, the data-driven results varies among experiments and after application of 0.1 mT intensity and 12 Hz frequency for 6 hours/days, in the PEMF test groups, the increase of mRNA level could be observed on the SPIONs labeledand unlabeled-ESCs. Consequently, myogenin and myh2 J. Biomater. Tissue Eng. 4, 1–7, 2014

Abbariki et al.


RESEARCH ARTICLE Fig. 4. The proposed mechanism for muscle specific gene activation by SPIONs nanoparticles. Myocyte enhancer factor-2 (MEF2): A family of transcription factors which activates the muscle-specific genes. HDAC: Histone deacetylase. PGC-1: Peroxisome proliferator-activated receptor-gamma coactivator-1. NFAT: Nuclear factor of activated T cells. AMPK: AMP -activated protein kinase. RCAN1: The regulator of the calcineurin 1.

expression levels in SPIONs labeled ESCs under exposition to PEMF were higher than unlabeled ESCs. On the basis of these results, the myogenic differentiation of the labeled ESCs may be enhanced by the tight growth density of the labeled ESCs which accumulated over the J. Biomater. Tissue Eng. 4, 1–7, 2014

area of high-density magnetic fields.58 Besides, a recent study indicated that the penetrating of magnetic particles inside the cells, could enhanced the cell sensitivity to the magnetic field.58 59 Evidence from previous reports revealed that the cell membrane has crucial role in 5

RESEARCH ARTICLE


regulation of the myogenic differentiation (the hyperpolarization of cells membrane, could upregulate the myogenic markers).60 61 The myogenic processes and muscle regeneration is known to be calcium dependent during the initial phase of myogenic differentiation.62 Moreover the hyperpolarization of the plasma membrane, can also lead to activation of voltage-gated calcium channels which induces the influx of Ca2+ and activates numerous myogenic transcription factors (Fig. 4).62–64 A stimulation of transduction pathways on osteoblastic cell proliferation can be made by PEMF, which caused considerable raise in cytosolic Ca2+ and calmodulin activation.65 Furthermore, PEMF was shown to quickly activate the mTOR signaling pathway, signifying that PEMF exposure was able to act as growth factors.66 67 In summary, we hypothesized that the combined effects of external magnetic-field, chemical agents, and/or ultrasmall SPIONs with various surface characteristics, could enhance the differentiation of stem cells into myogenic, rather than individual stimulus. Consequently targeted SPIONs-labeled-ESCs stimulation with PEMF in vitro could be considered as foundation for in vivo muscle development that may support skeletal muscle tissue regeneration. In our experiments, highest expression levels of MyoG and Myh2 were detected in the labeled cells with positive dextran coated SPIONs (containing serum medium initial uptake) which cultured in myogenic differentiation medium (CH + S group). Also, the effects of serum free medium in the labeled cells with negative, positive and neutral dextran-coated SPIONs was evaluated; in this case, it was found that the most transcription factor of Myh2 was achieved in CH + P + S group. Based on the obtained evidence, one can conclude that the induced PEMF stimulation, by SPIONs, can increase the voltagegated calcium ion channels by membrane hyperpolarization and stimulated the myogenic-specific gene expression.

References and Notes 1. C. van den Bos, R. Keefe, C. Schirmaier, and M. McCaman, Therapeutic Human Cells: Manufacture for Cell Therapy/Regenerative Medicine, edited by D. Eibl and R. Eibl, Springer Berlin Heidelberg (2013), Vol. 138, pp. 61–97. 2. Y. Sasai, Cell Stem Cell 12, 520 (2013). 3. A. C. Piscaglia, World J. Gastroenterol. 14, 4273 (2008). 4. L. M. Ferreira and M. A. Mostajo-Radji, Gene 520, 1 (2013). 5. R. E. Hynds and A. Giangreco, Stem Cells 31, 417 (2013). 6. P. Pastides, M. Chimutengwende-Gordon, N. Maffulli, and W. Khan, Osteoarthr. Cartil. 21, 646 (2013). 7. Z. Zhu and D. Huangfu, Development 140, 705 (2013). 8. D. Bilder and L. E. O’Brien, Annu. Rev. Cell Dev. Biol. 29, 107 (2013). 9. R. H. Miller and L. Bai, Neurosci. Lett. 519, 87 (2012). 10. S. Yamanaka, Cell 137, 13 (2009). 11. K. R. Chien, Nature 498, 439 (2013). 12. M. May, Nature 503, S7 (2013). 13. S. Koutsoumbelis and D. A. Grande, Nat. Rev. Rheumatol. 9, 265 (2013). 14. S. Liao, S. Ramakrishna, and M. Ramalingam, J. Biomater. Tissue Eng. 1, 111 (2011).

6

Abbariki et al.

15. M. Juhas and N. Bursac, Curr. Opin. Chem. Biol. 24, 5 (2013). 16. F. S. Tedesco, A. Dellavalle, J. Diaz-Manera, G. Messina, and G. Cossu, J. Clin. Invest. 120, 11 (2010). 17. N. A. Trujillo and K. C. Popat, J. Biomater. Tissue Eng. 3, 542 (2013). 18. J. M. Fishman, A. Tyraskis, P. Maghsoudlou, L. Urbani, G. Totonelli, M. Birchall, and P. de Coppi, Tissue Eng. Part B Rev. 19, 6 (2013). 19. S. B. P. Chargé and M. A. Rudnicki, Physiol. Rev. 84, 209 (2004). 20. J. A. Thomson, J. Itskovitz-Eldor, S. S. Shapiro, M. A. Waknitz, J. J. Swiergiel, V. S. Marshall, and J. M. Jones, Science 282, 1145 (1998). 21. R. Darabi, K. Gehlbach, R. M. Bachoo, S. Kamath, M. Osawa, K. E. Kamm, M. Kyba, and R. C. Perlingeiro, Nat. Med. 14, 134 (2008). 22. T. Barberi, M. Bradbury, Z. Dincer, G. Panagiotakos, N. D. Socci, and L. Studer, Nat. Med. 13, 642 (2007). 23. S. Biressi, C. R. Bjornson, P. M. Carlig, K. Nishijo, C. Keller, and T. A. Rando, Dev. Biol. 379, 195 (2013). 24. Y. Hadjal, O. Hadadeh, C. Yazidi, E. Barruet, and B. Binétruy, Cell Death. Dis. 4, 737 (2013). 25. P. Londhe and J. K. Davie, Skel. Musl. 4, 1 (2011). 26. A. Higuchi, Q.-D. Ling, Y. Chang, S.-T. Hsu, and A. Umezawa, Chem. Rev. 113, 3297 (2013). 27. A. C. Wan and B. C. Tai, Biotech. Adv. 31, 1776 (2013). 28. S. Khetan, M. Guvendiren, W. R. Legant, D. M. Cohen, C. S. Chen, and J. A. Burdick, Nat. Mat. 12, 458 (2013). 29. M. Mahmoudi, S. Bonakdar, M. A. Shokrgozar, H. Aghaverdi, R. Hartmann, A. Pick, G. Witte, and W. J. Parak, ACS Nano 7 , 8379 (2013). 30. J. R. Glossop, L. A. Hidalgo-Bastida, and S. H. Cartmell, J. Biomater. Tissue Eng. 1, 166 (2011). 31. R. Balint, N. J. Cassidy, L. A. Hidalgo-Bastida, and S. Cartmell, J. Biomater. Tissue Eng. 3, 212 (2013). 32. M. Mahmoudi, H. Hosseinkhani, M. Hosseinkhani, S. Boutry, A. Simchi, W. S. Journeay, K. Subramani, and S. Laurent, Chem. Rev. 111, 253 (2010). 33. B. Shah, P. T. Yin, S. Ghoshal, and K. B. Lee, Angew. Chem. 125, 6310 (2013). 34. J. M. Fishman, A. Tyraskis, P. Maghsoudlou, L. Urbani, G. Totonelli, M. Birchall, and P. de Coppi, Tissue Eng. Part B Rev. 19, 6 (2013). 35. N. Terada, T. Hamazaki, M. Oka, M. Hoki, D. M. Mastalerz, Y. Nakano, E. M. Meyer, L. Morel, B. E. Petersen, and E. W. Scott, Nature 416, 542 (2002). 36. H. Amiri, L. Bordonali, A. Lascialfari, S. Wan, M. P. Monopoli, I. Lynch, S. Laurent, and M. Mahmoudi, Nanoscal. 21, 8656 (2013). 37. R. Pieters, D. Huismans, A. Leyva, and A. Veerman, Brit. J. Cancer. 59, 217 (1989). 38. M.-X. Yu, W.-L. Chen, Q. Zhou, and P. Gao Exp. Biol. Med. 235, 1053 (2010). 39. D. L. Thorek and A. Tsourkas, Biomaterials 29, 3583 (2008). 40. N. Butoescu, C. A. Seemayer, M. Foti, O. Jordan, and E. Doelker, Biomaterials 30, 1772 (2009). 41. I. Lynch, A. Salvati, and K. A. Dawson, Nat Nanotechnol. 4, 546 (2009). 42. M. P. Monopoli, F. B. Bombelli, and K. A. Dawson, Nat Nanotechnol. 6, 11 (2010). 43. M. P. Monopoli, D. Walczyk, A. Campbell, G. Elia, I. Lynch, F. B. Bombelli, and K. A. Dawson, JACS 133, 2525 (2011). 44. Y. Zhu, W. Li, Q. Li, Y. Li, Y. Li, X. Zhang, and Q. Huang, Carbon 47, 1351 (2009). 45. A. Lesniak, F. Fenaroli, M. P. Monopoli, C. Åberg, K. A. Dawson, and A. Salvati, ACS Nano 6, 5845 (2012). 46. J. Rejman, V. Oberle, I. Zuhorn, and D. Hoekstra, Biochem. J. 377, 159 (2004). 47. B. D. Chithrani and W. C. Chan, Nano Lett. 7, 1542 (2007). 48. M. R. Lorenz, V. Holzapfel, A. Musyanovych, K. Nothelfer, P. Walther, H. Frank, K. Landfester, H. Schrezenmeier, and V. Mailänder, Biomaterials 27, 2820 (2006).


Abbariki et al.


49. P. García-Parra, N. Naldaiz-Gastesi, M. Maroto, J. F. Padín, M. Goicoechea, A. Aiastui, J. C. Fernández-Morales, P. GarcíaBelda, J. Lacalle, and J. I. Álava, Tissue Eng. Part C Methods 20, 28 (2013). 50. J. Rohwedel, V. Maltsev, E. Bober, H.-H. Arnold, J. Hescheler, and A. Wobus, Dev. Biol. 164, 87 (1994). 51. S. Hashimoto, S. Mochizuki, Y. Morita, H. Tsutsui, M. Yoshiura, K. Akazawa, M. Ohsuga, S. Uto, H. Otani, and T. Fujisato, Environmental Design for Muscle Cell Culture with Magnetic Field. Proceedings of the digital ecoSystems and technologies conference dEST’07. inaugural ieee-ies, IEEE, Cairns, Australia February (2007). 52. W. L. Haisler, D. M. Timm, J. A. Gage, H. Tseng, T. Killian, and G. R. Souza, Nat. Protoc. 8, 1940 (2013). 53. C. F. Adams, M. R. Pickard, and D. M. Chari, Nanomed. Nanotech. Biol. Med. 9, 737 (2013). 54. D. Fayol, G. Frasca, C. Le Visage, F. Gazeau, N. Luciani, and C. Wilhelm, Adv. Mater. 25, 18 (2013). 55. P. M. Govey, A. E. Loiselle, and H. J. Donahue, Curr. Osteoporos. Rep. 11, 83 (2013). 56. M. S. Markov, Electromagn. Biol. Med. 26, 1 (2007). 57. D. Guin, S. V. Manorama, S. Radha, and A. Nigam, Bull. Mater. Sci. 29, 617 (2006).

58. R. Schäfer, R. Bantleon, R. Kehlbach, G. Siegel, J. Wiskirchen, H. Wolburg, T. Kluba, F. Eibofner, H. Northoff, and C. Claussen, BMC Cell Biol. 11, 22 (2010). 59. M. Hofmann-Amtenbrink, B. Von Rechenberg, and H. Hofmann, Superparamagnetic nanoparticles for biomedical applications, Transworld Research Network, edited by M. C. Tan (2009), Vol. 119, pp. 119–149. 60. M. Louis, N. Zanou, M. Van Schoor, and P. Gailly, J. Cell Sci. 121, 3951 (2008). 61. S. Sundelacruz, M. Levin, and D. L. Kaplan, PLoS One 3, e3737 (2008). 62. B. L. Black and E. N. Olson, Annu. Rev. Cell Dev. Biol. 14, 167 (1998). 63. F. M. Ashcroft and P. Rorsman, Nat Rev Endocrinol. 9, 660 (2013). 64. A.-S. Borowiec, G. Bidaux, N. Pigat, V. Goffin, S. Bernichtein, and T. Capiod, Eur. J. Pharmacol. 13, 00887 (2013). 65. J. K.-J. Li, J. C.-A. Lin, H.-C. Liu, J.-S. Sun, R.-C. Ruaan, C. Shih, and W. H.-S. Chang, Ultrasound Med. Biol. 32, 769 (2006). 66. T. E. Patterson, Y. Sakai, M. D. Grabiner, M. Ibiwoye, R. J. Midura, M. Zborowski, and A. Wolfman, Bioelectromagnetics 27, 535 (2006). 67. H. Sauer, G. Rahimi, J. Hescheler, and M. Wartenberg, J. Cell Biochem. 75, 710 (1999).

Received: XX Xxxxx XXXX. Accepted: XX Xxxxx XXXX

RESEARCH ARTICLE


7