SUPPLEMENTARY DATA Supplementary Table 1 ...

2 downloads 3 Views 113KB Size Report
MCAD. Medium chain acyl-coenzyme A dehydrogenase. AGGGTTTAGTTTTGAGTTGACGG. CCCCGCTTTTGTCATATTCCG. MCD. Malonyl-CoA decarboxylase.

SUPPLEMENTARY DATA  

Supplementary Table 1. qRT-PCR Primers for Quantification of mRNA Gene Expression.

Gene COX-1 Cytochrome c oxidase subunit I COX-2 Cytochrome c oxidase subunit I CS Citrate synthase CytC Cytochrome C ERRa Estrogen receptor related receptor α MCAD Medium chain acyl-coenzyme A dehydrogenase MCD Malonyl-CoA decarboxylase MHCI Myosin heavy chain 1 mtTFA Mitochondrial transcription factor A

Primers 5’-3’ ATGAGTCGAAGGAGTCTCTCG GCACGGATAGTAACAACAGGGA TTCAACACACTCTATCACTGGC AGAAGCGTTTGCGGTACTCAT CCATCCATAGTGACCATGAG CTTTGCCAACTTCCTTCTGT TCCATCAGGGTATCCTCTCC GGAGGCAAGCATAAGACTGG CTCAGCTCTCTACCCAAACGC CCGCTTGGTGATCTCACACTC AGGGTTTAGTTTTGAGTTGACGG CCCCGCTTTTGTCATATTCCG GCACGTCCGGGAAATGAAC GCCTCACACTCGCTGATCTT GCGAATCGAGGCTCAGAACAA GTAGTTCCGCCTTCGGTCTTG ATTCCGAAGTGTTTTTCCAGCA TCTGAAAGTTTTGCATCTGGGT

Ndufa-2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 2

TTGCGTGAGATTCGCGTTCA ATTCGCGGATCAGAATGGGC

NRF-1 nuclear respiratory factor 1 NRF-2 nuclear respiratory factor 2

AGCACGGAGTGACCCAAAC TGTACGTGGCTACATGGACCT CCAAGTCCTGCATTGGGTGG GCAAAAACTGCCATAGTTGG

PARP-1 Poly (ADP-ribose) polymerase family, member 1

GGCAGCCTGATGTTGAGGT GCGTACTCCGCTAAAAAGTCAC

PARP-2 Poly (ADP-ribose) polymerase family, member 1

GCAACAGAAGACGACTCTCCT CAGCCATAGGCCCTTTTCTCT

PGC-1α Peroxisome proliferator-activated receptor gamma, coactivator 1α

TATGGAGTGACATAGAGTGTGCT CCACTTCAATCCACCCAGAAAG

POLG-1 Mitochondrial DNA polymerase subunit gamma-1

GAGCCTGCCTTACTTGGAGG GGCTGCACCAGGAATACCA

 

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-1364/-/DC1

SUPPLEMENTARY DATA  

POLG-2 Mitochondrial DNA polymerase subunit gamma-2 SDH Succinate dehydrogenase Sirt-1 Sirtuin 1 SSBP-1 Stranded DNA binding protein 1 Tropn-1 Troponin I UCP-1 Uncoupling protein 1 UCP-2 Uncoupling protein 2

GAGGCGCTGGTAGACCTCT GAGGCTAGGTTCTTTCGTAACTC GAA CTG CAC ACA GAC CTG C GAC TGG GTT AAG CCA ATG CTC GCTGACGACTTCGACGACG TCGGTCAACAGGAGGTTGTCT CAACAAATGAGATGTGGCGATCA ACGAGCTTCTTACCAGCTATGA CCAGCACCTTCAGCTTCAGGTCCTTGAT TGCCGGAAGTTGAGAGGAAATCCAAGA T AGGCTTCCAGTACCATTAGGT CTGAGTGAGGCAAAGCTGATTT ATGGTTGGTTTCAAGGCCACA CGGTATCCAGAGGGAAAGTGAT

 

Supplementary Table 2. Primers for mtDNA Determination.  

Primers 5’-3’ CCGCAAGGGAAAGATGAAAGAC-3’ mtDNA specific 5’-TCGTTTGGTTTCGGGGTTTC-3’ nuclear specific GCCAGCCTCTCCTGATTTTAGTGT GGGAACACAAAAGACCTCTTCTGG Gene

       

Supplementary Table 3. miRNA Probe Sequences for RNase protection assays.  

Probe (5’-3’)

 

miR-21 mmu-miR-466

TCAACATCAGTCTGATAAGCTATCAACATCAGTCTGATAAGCTA GTCTTATGTGTGCGTGTATGTAGTCTTATGTGTGCGTGTATGTA

 

mmu-miR-467a mmu-miR-467b

GTGTAGGTGTGTGTATGTATATGTGTAGGTGTGTGTATGTATAT GTGTTGGTGTGTGTATGTATATGTGTTGGTGTGTGTATGTATAT

mmu-miR-706 mmu-miR-713 mmu-miR-149

TTTTTTGAGACAGGGTTTCTCTTTTTTTGAGACAGGGTTTCTCT GCTGTGTGCCTTCAGTGCAGCTGTGTGCCTTCAGTGCA AGTGAAGACACGGAGCCAGAAGTGAAGACACGGAGCCAGA

mmu-miR-712-3p

TACCGCCCGGGTGAAGGATACCGCCCGGGTGAAGGA

miRNA

   

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-1364/-/DC1

         

SUPPLEMENTARY DATA  

Supplementary Figure 1. Transfection of miR-712-3p mimic did not alter mitochondrial biogenesis in cultured myotubes. C2C12 myotubes were transfected with NS or miR-712-3p mimic. Total RNA was isolated after 24 h transfection. A: NAD+ levels in myotubes were determined by calorimetric method. B mRNA expression of genes involved in mitochondrial biogenesis in the total RNA was examined by RT-qPCR. Each bar indicates mean ± SEM (n=3). White and black bars indicate NS (non-specific) and miR-712-3p mimic, respectively.

   

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-1364/-/DC1