SUPPLEMENTARY DATA Supplementary Table 1 ... - Diabetes

3 downloads 4 Views 231KB Size Report
Name. Source (catalog number). Dilution. XBP1. Santa Cruz (sc-7160). 1:1,000. IRE1α. Cell Signaling (3294). 1:1,000. CREB. Dr. Marc Montminy (Salk).

SUPPLEMENTARY DATA  

Supplementary Table 1. Antibodies Used for Western blots. Name

Source (catalog number)

Dilution

XBP1

Santa Cruz (sc-7160)

1:1,000

IRE1α

Cell Signaling (3294)

1:1,000

CREB

Dr. Marc Montminy (Salk)

1:10,000

Adiponectin

Sigma (A6354)

1:10,000

GRP78

Santa Cruz (sc-1051)

1:1,000

PDI

Assay Design (SPA-890)

1:5,000

DsbA-L

PhosphoSolutions (465-DsbA-L)

1:10,000

ERp44

Cell signaling (2886)

1:1,000

HSP90

Santa Cruz (sc-7947)

1:10,000

p-Ser473 AKT

Cell Signaling (9271)

1:2,000

AKT

Cell Signaling (9272)

1:5,000

Goat anti-mouse IgG HRP

BioRad (170-6516)

1:10,000

 

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-1067/-/DC1

SUPPLEMENTARY DATA  

Supplementary Table 2. Primer Sequences Used for RT-PCR, qPCR and ChIP.

RT-PCR

Gene HA-Xbp1s L32

Forward ATTACGCCATGGAATTCTGC GAGCAACAAGAAAACCAAGCA

Reverse GGACCGGGTACCATGAGC TGCACACAAGCCATCTACTCA

qPCR

Xbp1

ACATCTTCCCATGGACTCTG

TAGGTCCTTCTGGGTAGACC

Xbp1s Xbp1u

GAGTCCGCAGCAGGTG GAAGAGAACCACAAACTCCAGC

Tnfa Grp78 Pdia6 DsbA-L Erp44 Ero1l Chop Adipoq aP2

TCAGCCGATTTGCTATCTCATA TGTGGTACCCACCAAGAAGTC TGGTTCCTTTCCTACCATCACT GCCCATGTGGATGGTAAAAC AGAATTCCATCACGGACCTG CGGACCAAGTTATGAGTTCCA ATATCTCATCCCCAGGAAACG GGAACTTGTGCAGGTTGGAT AGCATCATAACCCTAGATGG

TCCAGAATGCCCAAAAGG GCAGAGGTGCACATAGTCTGA G AGTACTTGGGCAGATTGACCTC TTCAGCTGTCACTCGGAGAAT ACTTTCACTGCTGGAAAACTGC GAAGTAAAGGCAGGCACAGC ACGTAAGCCTCTGCTGGTGT TCAGAGAGATTCTGCCCTTCA TCTTCCTTGCTCTTCCTCCTC GCTTCTCCAGGCTCTCCTTT TCACGCCTTTCATAACACAT

Grp78

ATTGGTGGCCGTTAAGAATG

TGAAGTCGCTACTCGTTGGA

Pdia6

GGTCCACGTTTGCCTTACTC

TCCTCCTCCTCACATGAACC

Erp44 3’UTR

CACAGGGCTTACTGGGAAAG GAGCTGGAGCAAGAGTCCAC

CCTCTCACGCCCTCACTTC TGGGAATGCAGAATTTAAGG

ChIP

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-1067/-/DC1

SUPPLEMENTARY DATA  

Supplementary Figure 1. Gene expression and glucose tolerance test in moderate adipocyte XBP1s transgenic mice. A: qPCR analysis of XBP1s target gene Erdj4, P58ipk and Edem, and non-target gene Chop in WAT of WT (n = 6) and TGm mice (n = 3). B: Body weights of 37-week-old WT (n = 7) and TGm (n = 5) male mice. C: Glucose tolerance test. Blood glucose concentrations of mice in (B) were measured at indicated time points post i.p. 2 g glucose/kg body weight. Right, area under the curve (AUC) analysis. Data are mean ± s.e.m. N.S., not significant by Student’s t test.  

B 1.5

WT TGm

Body weight (g)

mRNA levels (a.u.)

A

1.0 0.5

40 30 20 10 0

0.0 Erdj4 P58ipk Edem Chop

WT TGm

500 400 300 200 100 0

0

30

60

90 120

AUC (×104 mg/dlmin)

Blood glucose (mg/dl)

C

WT TGm

5

N.S.

4 3 2 1 0

WT TGm

Time post i.p. (min)      

 

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-1067/-/DC1

SUPPLEMENTARY DATA  

Supplementary Figure 2. Overexpression of XBP1s promotes adiponectin multimerization in 3T3-L1 adipocytes. Fully differentiated 3T3-L1 adipocytes were transfected with GFP (CON) or XBP1s plasmids by electroporation. 24 h later, cells and medium were collected for further analyses. A: Representative Western blot analysis of adiponectin complexes secreted by 3T3-L1 adipocytes following sucrose gradient fractionation. Right: quantitation of the ratio of HMW to LMW adiponectin from three independent experiments. B: Q-PCR analysis of aP2 expression, normalized to ribosomal gene L32. C: Q-PCR analysis in 3T3-L1 adipocytes transfected with GFP (CON) or XBP1s. Gene expression was normalized to ribosomal gene L32. Data are mean ± s.e.m. *p < 0.05 by Student’s t test. a.u., arbitrary unit. D: Western blot analysis in 3T3-L1 adipocytes transfected with GFP (CON) or XBP1s

Fraction

1

2

3

4

5

6

7

8

9 10 11 12 13

CON XBP1s LMW

* 1.5 1.0

1.0 1.4

0.5 0.0

HMW

PDI 50 50

0.5

C O N X B P 1 s

0.0

ERp44

2.0 1.5 1.0

CON XBP1s

* *

1.0 1.2 100

*

DsbA-L

25

HSP90

*

0.5 0.0

G rp 7 8 P d ia 6 E R p 4 4 D sb A -L E ro 1 l

1.0

1.0 1.2

1.0 1.5

mRNAlevels (a.u.)

1.5

GRP78

75

C aP2 mRNA(a.u.)

B

D

2.0

C O N X B P 1 s

Adiponectin in media

C O N X B P 1 s

HMW/LMWADPN (a. u.)

A

  Supplementary Figure 3. Knockdown of DsbA-L attenuates the effect of XBP1s on adiponectin multimerization in 3T3-L1 adipocytes. 3T3-L1 adipocytes at day 7 were transfected with XBP1s or XBP1s together with DsbA-L RNAi (DsbA-Li) plasmids by electroporation. 48 h later, cells and medium were collected for further analyses. A: DsbA-L mRNA levels determined by qPCR. Bars represent mean ± s.e.m. *p < 0.05 by Student’s t test. B: Western blot analysis of adiponectin complexes secreted by 3T3-L1 adipocytes following sucrose gradient fractionation. Quantitation of HMW/LMW adiponectin shown on the right of the blots.

 

 

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-1067/-/DC1

SUPPLEMENTARY DATA  

Supplementary Figure. 4. Transient knockdown of Xbp1 has no effect on adiponectin multimerization in 3T3-L1 adipocytes. 3T3-L1 adipocytes at day 7 were transfected with control RNAi (CONi) or XBP1 RNAi (XBP1i) plasmids for 24 h by electroporation; cells and medium were collected for further analyses. A: Western blots of nuclear extracts (of cells treated with Tg for 6 h) or total cell lysates (cells were untreated). Bottom: quantitation of protein levels normalized to HSP90. *, a non-specific band. B: Representative Western blot analysis of adiponectin complexes secreted by 3T3-L1 adipocytes following sucrose gradient fractionation (three repeats). Quantitation of triplicates from one experiment shown below. Bars represent mean ± s.e.m. *p < 0.05 by Student’s t test.

 

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db13-1067/-/DC1