Supplementary Information for TAp73 CONTRIBUTES TO THE OXIDATIVE STRESS RESPONSE BY REGULATING PROTEIN SYNTHESIS Alberto Marini1,*, Barak Rotblat1,2, *, Thomas Sbarrato1 , Maria Victoria Niklison-Chirou1,3, John R.P. Knight1, Kate Dudek1, Carolyn Jones1, Martin Bushell1, Richard A. Knight1, Ivano Amelio1, Anne E. Willis1,§, and Gerry Melino1,4,§ 1
Medical Research Council, Toxicology Unit, University of Cambridge, Leicester LE1 9HN, United Kingdom Department of Life Sciences, Ben-Gurion University of the Negev, Beer Sheva, 8410501 Israel 3 Blizard Institute, Barts and the London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT, United Kingdom 4 Department of Experimental Medicine and Surgery, IDI-IRCCS (Istituto Dermopatico dell’Immacolata-Istituto di Ricovero e Cura a Carattere Scientifico), University of Rome Tor Vergata, Rome 00133, Italy 2
*
Equally contributing authors.
§
Correspondence to GM or AEW: MRC Toxicology University of Cambridge, Hodgkin Building, Lancaster Road, PO box 138, Leicester, LE1 9HN. Email GM:
[email protected], AEW:
[email protected]
This PDF includes: • • •
Material and Methods Fig.S1 to S9 References for SI citations
Other supplementary materials for this manuscript include: •
Dataset S1 to S2
www.pnas.org/cgi/doi/10.1073/pnas.1718531115
MATERIALS AND METHODS Cell culture and transfection HEK293T and NCI-H1299 cells were obtained from ATCC. HEK293T cells were cultured in DMEM (Gibco) supplemented with 10% FBS (Sigma-Aldrich) and penicillin/streptomycin (1U/mL) (Gibco). H1299 cells were maintained in RPMI 1640 medium (Gibco) supplemented with 10% FBS and penicillin/streptomycin (1U/mL). The A549 cell line was cultured in DMEM (Gibco) supplemented with 10% FBS and penicillin/streptomycin (1U/mL). For siRNA KD experiments, cells were transfected with the following siRNAs using RNAiMAX (Invitrogen), according to the manufacturer’s instructions: Scr (cat. 4390844, Ambion), siTAp73-1 (cat. 115665, Ambion), siTAp73-2 (cat. 2580, Ambion), sip53 (cat. s605, Ambion), sieEF2K (cat. s26676, Ambion), siUTP18 (cat. s27416, Ambion), siXPO1 (cat. s14937, Ambion). Treatments Oxidative stress was induced by using H2O2 (Sigma-Aldrich, cat. H1009) or Doxorubicin (Sigma-Aldrich, cat. D2975000). Doses and timings were detailed in figure legends. Cell death analysis Cell death was evaluated by staining attached and detached cells with propidium iodide (PI) prior analysis by flow cytometry, as previously described (1). Alternatively, sub-G1 population was evaluated (2). Briefly, attached and detached cells were collected by centrifugation (1200rpm for 10min) and then stained with PI prior analysis by flow cytometry. Determination of protein synthesis rates Cells in methionine-cysteine-free medium (Sigma-Aldrich, cat. D0422) were pulsed with 1.11 MBq/ml [35S]-labelled methionine-cysteine (Hartman Analytical, cat. SCIS103/185) for 30 min, washed with cold PBS, lysed in PLB buffer (Promega) and then trichloroacetic acid (TCA) was added to a final concentration of 12.5%. Insoluble proteins were captured on glass microfiber filter papers (Whatmann), and radioactivity was determined by scintillation counting (National Diagnostics) and normalized to the total protein content determined using a Bradford assay (Bio-Rad). Sucrose density gradient ultracentrifugation and polysome profiling Cycloheximide (100μg/mL) was added to the culture medium before ~3×107 cells were harvested. Following lysis in 750 μL of ice-cold lysis buffer [15 mM Tris (pH 7.5), 15 mM MgCl2, 300 mM NaCl, 1% Triton X-100, 100 μg/mL cycloheximide, 1 mg/mL heparin, and 500 U/ml SUPERase-In (Life Technologies)], lysates were centrifuged and the supernatants were layered onto a 10% to 50% sucrose gradient, followed by centrifugation at 38,000 rpm for 2 hours in a Beckman SW40 rotor. Gradients were then separated by a live 254nm UV spectrometer (Isco) and plots analysed using ImageJ software (NIH, https://imagej.nih.gov/ij/). RNA was extracted from each fraction using guanidine HCL/ethanol and successively precipitated with ethanol/sodium acetate and lithium chloride, as described in a previous study (3). Harringtonine run-off analysis Cells were treated with 2μg/ml harringtonine (Santa Cruz Biotechnology) for 0, 90 and 120s before treatment with 100μg/ml cycloheximide for 5 min. At each time point, cells were processed by sucrose density gradient ultracentrifugation. Areas under the curve were calculated using ImageJ. Microarray Total RNA was extracted from cells using an RNeasy column (Qiagen). Alternatively, RNA samples from polysomal and sub-polysomal fractions were pooled, fluorescently labelled with either Cy3 or Cy5, and hybridised as previously described (4). Data obtained from three independent experiments performed twice (label swapped) were normalized using RT-qPCR values for GAPDH and PABP in the individual fractions. A gene ontology analysis was performed using bioprofiling.de (5). As a cut off, we used ratios above 1.5 and below 0.5 that exhibited significant changes in both the RANKPROD and SAM analysis.
Western blot Cells were lysed in RIPA buffer (1% NP-40, 0.1% SDS, 150 mM NaCl, 50 mM Tris-HCl, pH 7.5, and 0.5% sodium deoxycholate) containing phosphatase inhibitors (PhosSTOP Phosphatase Inhibitor Cocktail; Roche), and protease inhibitors (cOmplete Protease Inhibitor Cocktail; Roche). Equal amounts of proteins were separated on SDS-PAGE gels, transferred to PVDF membranes (GE Healthcare) and probed with the following antibodies. Cell Signaling Technology: Phospho-eEF2 (Thr56), cat. 2331; eEF2, cat. 2332; Phospho-eEF2K (Ser366), cat. 3691; eEF2K, cat. 3692; Phospho-AMPKα (Thr172), cat .2535; AMPKα, cat. 5831; Phospho-Acetyl-CoA Carboxylase (Ser79), cat. 11818; Acetyl-CoA Carboxylase, cat. 3676; 4E-BP1, cat. 9644, Phospho-4E-BP1 (S65), cat. 9451; Phospho-S6 Ribosomal Protein (Ser235/236), cat.4857; S6 Ribosomal Protein cat.2217; Phospho eIF2α (Ser51) cat.3398; eIF2α cat. 9722; Phospho-p70 S6 kinase (Thr389), cat. 9205; p70 S6 kinase, cat. 2708; eIF4E, cat. 9742. Santa Cruz Biotechnology: β Tubulin, cat. sc-9104; Actin, cat. sc-1615; XPO1, cat. sc-5595; p53, cat. sc-126. Bethyl Laboratories: p73, cat. A300-126A. SigmaAldrich: GAPDH, cat. G8795; UTP18, cat. HPA052378. m7-GTP pull down assay Cell pellets were resuspended in Buffer A [50mM MOPS/KOH, pH 7.2, 50mM NaCl, 2mM EGTA, 5mM EDTA, 7mM 2-mercaptoethanol, phosphatase inhibitors (PhosSTOP Phosphatase Inhibitor Cocktail; Roche), protease inhibitors (cOmplete Protease Inhibitor Cocktail; Roche), 1.5% NP40 and 1.5% Triton X100], vortexed and incubated on ice for 5 minutes to facilitate lysis. Cell extracts were clarified by centrifugation (15000rpm for 3 minutes) and incubated with 50μL of 50% (v/v) m7-GTP resin (Jena Bioscence) for 25 minutes at 4°C on a shaker to isolate eIF4E and associated proteins. Beads were separated by centrifugation at 4°C and washed three times with 200μL of Buffer A w/o detergents. Proteins were recovered in SDS Sample Buffer and analysed by SDS-PAGE. ATP and ROS measurements ATP levels were measured using Enliten kit (Promega), according to the manufacturer’s instructions. ROS levels were measured using CM-DCFDA (Invitrogen), as previously described (1) or alternatively MitoSOX (Invitrogen) (6). RT-qPCR The cDNA templates were generated using RevertAid H Minus Reverse Transcriptase and oligo(dT) primers (Thermo Scientific). Equal volumes of cDNAs were used for qPCR performed in an ABI PRISM 7000 Sequence Detection System (Applied Biosystems) with SYBR green ready mix (Applied Biosystems) and specific primers. TAp73 forward: CAGACAGCACCTACTTCGACCTT, reverse: CCGCCCACCACCTCATTA. DNp73 forward: ATGCTGTACGTCGGTGACCC, reverse: GTGCTGCTCAGCAGATTGAAC PABP forward: GCAGCTATCCCACAGACTCAGA, reverse: AGCGAGGACTTGGTCTTAGTTGA. GAPDH forward: AATCCCATCACCATCTTCCA, reverse: TGGACTCCACGACGTACTCA. TBP forward: TCAAACCCAGAATTGTTCTCCTTAT, reverse: CCTGAATCCCTTTAGAATAGGGTAGA. NDUFS3 forward: TGTGGCTGAAATCTTGCCCAA, reverse: AGTTGAAGCGCAGAGACAACA. NDUFB8 forward: CCGCCAAGAAGTATAATATGCGT, reverse: TATCCACACGGTTCCTGTTGT. NDUFB9 forward: GGGGCACCTCCTATGAGAGAT, reverse: TCCCTCCGCAGTTTCTTCCA. NDUFS8 forward: CCATCAACTACCCGTTCGAGA, reverse: CCGCAGTAGATGCACTTGG. ΔΔCT values were used for relative quantifications.
Mitochondrial activity Cells were transfected with siRNAs for 72 hours and then treated with 150µM H2O2 for 3 hours. Cell pellets were collected and respiration was measured using Oroboros, as previously described (7). rRNA processing Cells were transfected with siRNAs for 72 hours, lysed and total RNA was extracted using RNeasy column (Qiagen). Subsequently, equal quantities of RNA were resolved on agarose-MOPS formaldehyde gels and passively transferred to Zeta Probe membrane (Bio-Rad) and UV crosslinked. rRNA was detected as previously described (8) using DNA oligonucleotide probes (Sigma) labelled with 32P ɣ-ATP (Hartmann) by the polynucleotide kinase enzyme (Promega). Oligonucleotide sequences are listed below and were previously published (9): ITS1–5’-CCTCGCCCTCCGGGCTCCGTTAATGATC-3’; ITS2–5’-CCGGGGCGATTGATCGGCAAGCGAC-3’; 18S–5’-TTTACTTCCTCTAGATAGTCAAGTTCGACC-3’; 28S-5’-CCCGTTCCCTTGGCTGTGGTTTCGCTAGATA-3’; 5.8S–5’-CAATGTGTCCTGCAATTCAC-3’. rRNA abundances were quantified by densitometry using ImageJ (NIH). Statistical analyses In all figures, data are presented as mean values, with standard deviations (SDs) indicated by error bars. Unpaired two-tailed Student’s t-test was used for all statistical analyses. p-values less than 0.05 were considered significant.
A
HEK293T TAp73 CT mean±SD: 23.9±4.35E-15
∆Np73 CT mean±SD: 32.5±0.06
H1299 TAp73 CT mean±SD: 25.3±0.06
∆Np73 CT mean±SD: 32.9±0.15
B
Figure S1. A. RT-qPCR of TA and ∆N isoforms of p73 performed in total RNA from HEK293T and H1299 cell lines. TBP was used as endogenous control. B. HEK293T cells were transfected for 72h with the indicated siRNAs and treated with H2O2 as indicated. Treated cells were washed, incubated with CM-DCFDA and ROS levels were determined by using flow cytometer. Representative plots of our method are shown.
A
% of cells with high DCFDA
B
30
500nM Doxo
*
25 20 15 10 5 0 Scr
*
200
*
150 100 50 0
r Sc
p TA i s
-1 73
p TA i s
-2 73
3 2.5 2
n.s. n.s. n.s.
500nM Doxo
1.5 1 0.5 0
S si TA cr p si 73TA 1 p7 32
D
500nM Doxo
S si TA cr p si 73TA 1 p7 32
250
Fold change of % sub-G1 events
Mean intensity
C
siTAp73-1
Figure S2. A. Cell death analysis of HEK293T transfected with siRNA targeting TAp73 or scrambled control for 72h and then challenged with 300μM H2O2 for 8 hours. Cell death was determined using PI staining and flow cytometry. Representative plots are shown. B, C. ROS analysis of HEK293T cells transfected for 72h with the indicated siRNAs and then treated with 500nM Doxorubicin for 18h. ROS were revealed by using CM-DCFDA (B) or MitoSOX (C) (mean ± SD, n=3, *p
