SUPPLEMENTARY MATERIALS SUPPLEMENTARY ...

5 downloads 0 Views 404KB Size Report
Med12. Bethyl Laboratories. A300-774A. PolII. Santa Cruz Biotechnology. SC-8998. GATA1. Santa Cruz Biotechnology. SC-265. Rad21. Abcam ab992. SMC3.

SUPPLEMENTARY MATERIALS SUPPLEMENTARY TABLES

Table S1. 129 genome-specific CRISPR/Cas9 genome editing and genotyping primer sequences. F: Forward primer. R: reverse primer gRNA_ βmaj_top gRNA_ βmaj_bot gRNA_ βmaj_KLF1_top gRNA_ βmaj_KLF1_bot βmaj-DDΔ4/5 gRNA top βmaj-DDΔ4/5 gRNA bot βmaj_prom_gen F βmaj_prom_gen R EKLF_ βmaj_prom_gen F EKLF_ βmaj_prom_gen R

CACCGAGGGCAGAGCATATAAGGTG AAACCACCTTATATGCTCTGCCCTC CACCGGATTGGCCCTTACCAGGGTG AAACCACCCTGGTAAGGGCCAATCC CACCGTGGCTTAGGAGTCTCAGCTC AAACGAGCTGAGACTCCTAAGCCAC ACCCAGAGCTGAGACTCCTAAGCCAGTG GCCTCACCACCAACTTCATCGGAGTTCAC CAACCAATTCAGTAGTTGATTGAGCAAATG TAAGCAGACCTCTGTCTCCAAGCAC

Table S2. 129 genome-specific ChIP primer sequences. F: Forward primer. R: reverse primer. Genes mHS5 F mHS5 R mHS4 F mHS4 R mHS3 F mHS3 R mHS2 F mHS2 R mHS1 F mHS1 R ey pr F ey pr R βh1 pr F βh1 pr R βmaj promoter -200 F

Primer sequence AACTAGAGAAAAAGAATGAGGCGTTT CTGGAGAATCCACACACCTAGGT TTTCCCCACCCCTTTACTAGTCT ATTATCAGAGTCTTGGCAGGATCTC CAGCTATCAAGAAGGGTCACTTACAT CAGACTCCACCCTGAGCTGAA GGGTGTGTGGCCAGATGTTT CACCTTCCCTGTGGACTTCCT GGGCCTCCGTGAGATTGAG GGAGCAATGATGGGACAAAGA GAATGCCTCCATATCTAATGTGCAT CCTGACCCGTGGTCCTCAT CTTAGTGCAATGCTATCTAGACCTTACC GGACTCTGAGGCTATTGGTCAAG GTTGCCAAAAAGGATGCTTTAGA

βmaj promoter -200 R mHS26 F mHS26 R m3’HS1 F m3’HS1 R mCTCF Hba -45kb F mCTCF Hba -45kb R mEnh LMO2 -64kb F mEnh LMO2 -64kb R mCTCF LMO2 – 86kb F mCTCF LMO2 – 86kb R mEnh RUNX1 +23kb F mEnh RUNX1 +23kb F mCTCF RUNX1 -36kb F mCTCF RUNX1 -36kb F mNecdin F mNecdin R βmaj promoter F βmaj promoter R βmaj Intron 2 F βmaj Intron 2 R βmaj 3’UTR F βmaj 3’UTR R βmin promoter F βmin promoter R βmin start F βmin start R βmin 3’UTR F βmin 3’UTR R

TAGGAGTCTCAGCTCTGGGTA TGACCATAGTCAACAGCAGGT GCTCGTTCAAGCATCTCCAT GGAGAGGAGGGCGGAAATC TCATTTCTCTAATGATCCTGTTGCA CTGTGGCCGCTTCATTCTAC CTGGTAGTGCTATGCACCCT CCAGATCCCAGATGCTCACA TCAGATAACAGCAGGGAGCC AGCCCCTGACAGTCTTTTCT CAGGCTTTGGGATCTCAGGA CGAAAAATAAACCGGCAGTTGA CAAGCTGCCCACGTTATCAGT TTGCCTACAAAATCGGCTGT GTCCTGATAACAGCGAGCAA AGCTCATGTGGTACGTGTTGGT GCTGCCCATGACCTCTTTCA CAGGGAGAAATATGCTTGTCATCA GAGCAGATTGGCCCTTACCA TTCCTTTCCCTCAGTTCATTTCTT CTGAGCAAGTTACAAGGCAATATTTAA AACCCCCTTTCCTGCTCTTG TCATTTTGCCAACAACTGACAGA CACTCTGTCCTCTCTGAGGA TGTCTTAAGCCTGGGCCATA AGTCTGTTGTGTTGACTTGCACC AAGAGACACCAGACTTCTGAG AAGCCCCTTTTCTGCTATTGTCT TCTTCATCATTTCCCCACAATTG

Table S3. 129 genome-specific 3C primer sequences. 3C-Vb 3C-βmin

TGTTGGAGTAACTACCGTGATTTC GCTGATAACCTAACTAATAAGCGTTA

Table S4. 129 genome-specific RT-qPCR primer sequences. F: Forward primer. R: reverse primer. EKLF F EKLF R GATA1 F GATA1 R TAL1 F TAL1 R Alas2 F Alas2 R Gypa F Gypa R α-globin F α-globin R βmaj 3’UTR F βmaj 3’UTR R βmin 3’UTR F βmin 3’UTR R

ATCACGTGAGTCTGAAATCGG TCGGAACCTGGAAAGTTTGTAA CATTGGCCCCTTGTGAGGCCAGAGA ACCTGATGGAGCTTGAAATAGAGGC GGAACGATGGCGGCAGCAGA GTCTGGTGGGTGGGTGGGGA GCCCAACACTTCTCCGAGGCA TGGCCTGCAAGACACGAGGG ATTCATGTCTCAACTTATCACA CCAATGTGTGGTGAGACAGGCT GCTGAAGCCCTGGAAAGGAT GGCTTACATCAAAGTGAGGAAAGT AACCCCCTTTCCTGCTCTTG TCATTTTGCCAACAACTGACAGA AAGCCCCTTTTCTGCTATTGTCT TCTTCATCATTTCCCCACAATTG

Table S5. Antibodies Protein LDB1 GATA1 LMO2 TBP Med1 Med12 PolII GATA1 Rad21 SMC3 HA HA H3 H3S10ph KLF1

Company Santa Cruz Biotechnology Santa Cruz Biotechnology R&D system Abcam Bethyl Laboratories Bethyl Laboratories Santa Cruz Biotechnology Santa Cruz Biotechnology Abcam Abcam Millipore Sigma Abcam Abcam Active Motif

Cat. No. SC-11198 SC-1233 AF2726 ab63766 A300-793A A300-774A SC-8998 SC-265 ab992 ab9263 05-904 11867423001 ab1791 ab5176 61233

Table S6. Genome-wide data sets. Cell type/Antibody MEL/GATA1 MEL/Rad21 MEL/SMC3 MEL/Pol2 MEL/CTCF MEL K562/Rad21 K562/SMC3 K562 GM12878/Rad21 GM12878/SMC3 GM12878 H1-hES/Rad21 H1-hES HepG2/Rad21 HepG2/SMC3 HepG2 Ter119+ erythroblasts/Med1 MEL

Data type ChIP-seq ChIP-seq ChIP-seq ChIP-seq ChIP-seq ChromHMM ChIP-seq ChIP-seq ChromHMM ChIP-seq ChIP-seq ChromHMM ChIP-seq ChromHMM ChIP-seq ChIP-seq ChromHMM

E14.5 Fetal Liver

Capture HiC

ChIP-seq RNA-seq

File source/ Identifer ENCODE/ wgEncodeEM001945 ENCODE/ wgEncodeEM001966 ENCODE/ wgEncodeEM001978 ENCODE/ wgEncodeEM001949 ENCODE/ wgEncodeEM001928 Lee et al., 2016, manuscript in preparation ENCODE/ wgEncodeEH000649 ENCODE/ wgEncodeEH001845 ENCODE/ wgEncodeEH000790 ENCODE/ wgEncodeEH000749 ENCODE/ wgEncodeEH001833 ENCODE/ wgEncodeEH000784 ENCODE/ wgEncodeEH001836 ENCODE/ wgEncodeEH000785 ENCODE/ wgEncodeEH001803 ENCODE/ wgEncodeEH001861 ENCODE/ wgEncodeEH000789 Hay et al., 2016/ GEO GSM2077406 and GSM2077407 Krivega et al., 2014/ GEO GSE54549 Schoenfelder et al., 2015/ EBI ArrayExpress E-MTAB-2414

SUPPLEMENTARY FIGURE LEGENDS Figure S1. CRISPR/Cas9 genome editing of the βmaj globin gene promoter. (A) Sequence alignments of ΔCore, ΔCore/GATA and ΔCore/GATA/KLF1 genomic deletions. Yellow color marks coincidence in all sequences, blue – in two sequences. Red boxes mark promoter elements affected by deletions. (B) Sequencing results of the 5 top off-target sites located in expressed genes Arhdig, Mvk, Notch2, Sdha, and Zfp30 in ΔCore and ΔCore/GATA cells. 129 mouse strain wild type sequence at these sites is presented at the top of each panel. Results confirm that off-target sites’ nucleotide sequence was not affected by the βmaj globin promoter CRISPR/Cas9 deletions. Figure S2. Effect of deletions in βmaj globin gene promoter on transcription of genes important for erythroid differentiation. Expression of Klf1, Gata1, Tal1, Alas2 ,Gypa and α-globin genes was examined by RT-qPCR after deletion of Core, Core/GATA or Core/GATA/KLF1 elements in the βmaj globin gene promoter in induced MEL cells. Expression in induced Control MEL cells was set to 1. Error bars indicate SEM of 3 biological replicates. Figure S3. Mediator and cohesin occupancy in β-globin gene locus. (A) ChIP-seq signal and called peaks tracks of Med1 in Ter119+ erythroid cells over the β-globin gene locus. Med1 (B) and Med12 (C) occupancy at LCR HS2 and βmaj globin gene promoter in mouse E14.5 fetal liver cells. Rad21 (D) and SMC3 (E) occupancy at LCR HS2 and βmaj globin gene promoter in mouse E14.5 fetal liver cells. 3”HS1 served as positive control. Error bars indicate SEM of 3 biological replicates. Figure S4. GATA1 and LDB1 occupancy in the β-globin locus. GATA1 and LDB1 occupancy at the at the βmaj and βmin globin gene promoters in induced MEL cells determined by ChIP with antibodies to the proteins. Error bars indicate SEM of 3 biological replicates.

Figure S5. Weak overlap of cohesin with ChromHMM weak enhancers. Binary heat map depicting overlap of weak enhancers with GATA1 and cohesin occupancy in MEL cells

1

Figure S6. ChIP-qPCR validation of ENCODE cohesin ChIP-seq data at known erythroid enhancers. ChIP was used to determine Rad21 and SMC3 occupancy at erythroid enhancers. (A), (B) α and β-globin enhancers in induced MEL. (C), (D) Runx1 and Lmo2 enhancers in uninduced MEL cells. Known CTCF sites within each locus served as positive controls and necdin served as negative control. Error bars indicate SEM of 3 biological replicates.

Figure S7. Weak overlap of cohesin with LDB1 independent looped enhancers. (A) Rnf1, (B) Dhx12 and (C) Tmem106b. Black rectangle marks predicted active enhancers looped to the genes. ChIP-seq signal tracks are directly from ENCODE. Called peaks reported by ENCODE are shown below signal. Chromatin states called by ChromHMM are shown below ChIP-seq.

Figure S8. Weak overlap of cohesin with enhancers in human cells. Binary heat maps depicting overlap of enhancers with cohesin occupancy in (A) K562 cells, (B) GM12878 cells, (C) H1-hES cells and (D) HepG2 cells.

2

Krivega_FigS1 A Control ΔCore ΔCore/GATA ΔCore/GATA/EKLF KLF1

B

TATA box

GATA

+1

Start codon

Arhdig 129 wt

Mvk 129 wt

Notch2 129 wt

ΔCore

ΔCore

ΔCore

CTTCACCTTGTATTCAATGCCCT

ΔCore/GATA

Sdha 129 wt CTGCACCATATATGGTCTGCAGT

CTGCACCTTCTAGACTCTGACCT

ΔCore/GATA

Zfp30 129 wt

AAGGCTGAGAAGAGAAGGTGGAG

ΔCore

ΔCore

ΔCore/GATA

ΔCore/GATA

CTGCACCTTAATTTCTCTCCCCT

ΔCore/GATA

Krivega_FigS2 1.6

1.4

relative expression

1.2

Control 1

ΔCore ΔCore/GATA

0.8

ΔCore/GATA/KLF1

0.6

0.4

0.2

0

KLF1

GATA-1

TAL1

Alas2

Gypa

α-globin

Krivega_FigS3

A

B

C

Med1

0.07

0.06

0.06

enrichment

0.07

enrichment

0.05 0.04

IgG

0.03

Med1

0.05 0.04

IgG

0.03

Med12

0.02

0.02

0.01

0.01

0

0

HS2 HS2

β-majpr necdin necdin β-maj

HS2 HS2

D

β-maj necdin β-maj pr necdin

E

Rad21

0.35

SMC3

0.4 0.35

0.3

0.3

0.2

IgG Rad21

0.15

0.1

enrichment

0.25

enrichment

Med12

0.25

IgG

0.2

SMC3

0.15 0.1

0.05

0.05

0

0

3’HS1 3'HS1

HS2 HS2

β-maj pr necdin b-maj necdin

3’HS1 3'HS1

HS2 HS2

necdin β-maj pr necdin b-maj

Krivega_FigS4

GATA1

0.25

0.25 Control

0.2

ΔCore/GATA

0.15

Control

0.2

ΔCore

0.1 0.05

enrichment

enrichment

LDB1

ΔCore ΔCore/GATA

0.15 0.1 0.05

0

0 β-maj

β-min

necdin

β-maj

β-min

necdin

Krivega_FigS5

Krivega_FigS6 B

A

IMEL Rad21

IMEL SMC3 0.14

0.3

0.12

0.25

0.1

0.2 IgG

0.15

Rad21

0.1

enrichment

enrichment

0.35

IgG

0.06

SMC3

0.04 0.02

0.05

0

0

UMEL Rad21

C

UMEL SMC3

D

0.4

0.16

0.35

0.14

0.3

0.12

0.25

0.1

0.2

IgG

0.15

Rad21

enrichment

enrichment

0.08

IgG

0.08

SMC 3

0.06

0.1

0.04

0.05

0.02 0

0 LMO2 86CTCF

RUNX1 36CTCF

LMO2 64enh

RUNX1 +23enh

hGAPDH necdin

LMO2 86CTCF

RUNX1 36CTCF

LMO2 64enh

RUNX1 +23enh

hGAPDH necdin

Krivega_FigS7

A

B

C

Krivega_FigS8

K562

A

B

GM12878

C

ES

D

HepG2