Supplementary Table 1. Summary of the T-UCR microarray data. The geometric mean of intensities, ratio of geometric means, presence of CpG island and methylation status are represented.
Supplementary Table 2. Primer sequences
Primers for bisulfite genomic sequencing: BS-160+-s Sense BS-160+-as Antisense BS-283+A-s Sense BS-283+A-as Antisense BS-283+A2-s Sense BS-283+A2-as Antisense BS-346+-s Sense BS-346+-as Antisense BS-346+2-s Sense BS-346+2-as Antisense BS-282+A3-s Sense BS-282+A3-as Antisense BS-392+A-s Sense BS-392+A-as Antisense BS-469+A3-s Sense BS-469+A3-as Antisense
Primers for MSP (Methylation Specific PCR): TATCGAGTTAACGCGGGATAC MSP-160-ms Sense ACTTAAATCCCTCGACGCAT MSP-160-mas Antisense TTATATTGAGTTAATGTGGGATAT MSP-160-us Sense AAAACTTAAATCCCTCAACACAT MSP-160-uas Antisense AGGTTTTCGGTTGTTTTGTC MSP-283-ms Sense AAAAACTTCCGCTCGTTT MSP-283-mas Antisense GAAAGGTTTTTGGTTGTTTTG MSP-283-us Sense ACAAAAACTTCCACTCATTT MSP-283-uas Antisense GTTTTTTCGAAGGATCGC MSP-346-ms Sense ACGAATTACCCCGAATACTTT MSP-346-mas Antisense GTTTTTTGAAGGATTGT MSP-346-us Sense ACAAATTACCCAAATACTTT MSP-346-uas Antisense Primers for quantitative RT-PCR: U6-s Sense U6-as Antisense GAPDH-rt-s Sense GAPDH-rt-as Antisense Uc.160-rt-s Sense Uc.160-rt-as Antisense Uc.283-rt-s Sense Uc.283-rt-as Antisense Uc.346-rt-s Sense Uc.346-rt-as Antisense Primers for ChIP:
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
Primers for MspI sensitivity assay: Nucleo-160-s Sense Nucleo-160-as Antisense Nucleo-283-s Sense Nucleo-283-as Antisense Nucleo-346-s Sense Nucleo-346-as Antisense
Supplementary Table 3. Genomic context of the identified CpG island hypermethylated T-UCRs. The chromosomal location, the start and the end of the ultraconserved region of the transcript, the transcribed strand and the closest upstream and downstream protein-coding genes are represented (in parenthesis the distance between the probe and the transcription start site of the genes is shown).