Supplementary Tables

31 downloads 0 Views 41KB Size Report
ybeZ KO construct. This work. pTOF24-. ybeYtetRA. ybeY KO construct. This work ... pTOF24-ybeZYtetRA aaaaa ctgcag gatatcatcgaagtgtatcgcgac. Ni-ybeZ.
Supplementary Table S1. Bacterial strains used in this study. Strain Description Source or reference ZAP193 E. coli O157:H7, Stx (Roe et al., 2003) negative, NCTC 12900, NalR/KanS/AmpS ZAP193 Translational fusion, Roe AJ (pers. comm.) lacZYAtir-lacZ random transposon mutagenesis recipient S17-1/pUTRandom transposon (De Lorenzo and Timmis, 1994) miniTn5Km2 mutagenesis donor, KanR/AmpR ZAP193 Random transposon This work lacZYAtir-lacZ mutagenesis ybeZ::Tn5 exconjugant, NalR/KanR/AmpS ZAP193 Allelic exchange with This work lacZYAtir-lacZ pTOF24-ybeZ(R), ybeZ::Tn5 rescue NalR/KanS ZAP193 Allelic exchange with This work lacZYAtir-lacZ pTOF24-ybeZtetRA, ybeZtetRA NalR/TetR ZAP193 Allelic exchange with This work lacZYAtir-lacZ pTOF24-ybeYtetRA, ybeYtetRA NalR/TetR ZAP193 Allelic exchange with This work lacZYAtir-lacZ pTOF24-ybeZYtetRA, ybeZYtetRA NalR/TetR ZAP193 tetRA removal with This work lacZYAtir-lacZ pCP20, NalR/TetS ybeZ ZAP193 tetRA removal with This work lacZYAtir-lacZ pCP20, NalR/TetS ∆ybeY ZAP193 tetRA removal with This work lacZYAtir-lacZ pCP20, NalR/TetS ∆ybeZY ZAP193 Allelic exchange with This work lacZYAtir-lacZ pTOF24-ybeY-HTF-tetRA, ybeY-HTF-tetRA NalR/TetR ZAP193 tetRA removal with This work lacZYAtir-lacZ pCP20, NalR/TetS ybeY-HTF

Supplmentary Table S2. Plasmids used in this study. Plasmid Description Source or reference pTOF24 Allelic exchange vector (Merlin et al., 2002) pTOF24-ybeZ(R) ybeZ::Tn5 rescue This work construct pAJR71 pACYC-LEE1-gfp (Roe et al., 2003) pAJR75 pACYC-LEE5-gfp (Stevens et al., 2004) pACYC184 Cloning vector pACYC184-ybeZY Entire operon plus native This work promoter pTOF24ybeZ KO construct This work ybeZtetRA pTOF24ybeY KO construct This work ybeYtetRA pTOF24ybeZY KO construct This work ybeZYtetRA pTOF24-YbeYybeY-HTF construct This work HTF-tetRA pTOF1-tetRA Source of tetRA cassette (Tree et al., 2014) pJET-HTF-tetRA Source of HTF-tetRA (Tree et al., 2014) cassette pCP20 tetRA cassette removal (Cherepanov and Wackernagel, 1995) Supplmentary Table S3. Oligonucleotides used in this study. Primer Used to construct Sequence plasmid Nt-ybeZ-SalI pTOF24-ybeZ(R) aaaaa gtcgac cagccgtaattctcaggcccgccg Ct-ybeZ-PstI pTOF24-ybeZ(R) aaaaa ctgcag atgcgcccagtgcgcctccagtgg Nt-ybeZY-XhoI pACYC184-ybeZY aaaaa ctcgag attctcaggcccgccgttccggtg Ct-ybeZY-HindIII pACYC184-ybeZY aaaaa aagctt cgttaatcaccaacggcggggacg No-ybeZ pTOF24-ybeZtetRA aaaaa ctgcag gatatcatcgaagtgtatcgcgac pTOF24-ybeZYtetRA Ni-ybeZ pTOF24-ybeZtetRA cgctcttgcggccgcttggaacgg caccggcctataaggaaattattc pTOF24-ybeZYtetRA Co-ybeZ pTOF24-ybeZtetRA aaaaa ctcgag tcagggtaatcatctgggagc Ci-ybeZ pTOF24-ybeZtetRA ccgttccaagcggccgcaagagcg aagaacaggaacaaaaatgagtc No-ybeY pTOF24-ybeYtetRA aaaaa ctgcag atcgaaccggaacagatccacc Ni-ybeY pTOF24-ybeYtetRA cgctcttgcggccgcttggaacgg gtaaatcgaggatcacctgactc Co-ybeY pTOF24-ybeYtetRA aaaaa ctcgag gtcgacttcttcatcgctaaagtg pTOF24-ybeZYtetRA Ci-ybeY pTOF24-ybeYtetRA ccgttccaagcggccgcaagagcg tttgccagccatttgactggcag pTOF24-ybeZYtetRA No-ybeY-HTF pTOF24-YbeY-HTFaaaaa ctgcag cgtacgctgaacgacgcatttatc tetRA Ni-ybeY-HTF pTOF24-YbeY-HTFcgctcttagatctttggaacgg ttctttctcggcaatgtacggatc tetRA Co-ybeY-HTF pTOF24-YbeY-HTFaaaaa ctcgag gtcgacttcttcatcgctaaagtg tetRA Ci-ybeY-HTF pTOF24-YbeY-HTFccgttccaaagatctaagagcg tttgccagccatttgactggcag tetRA TTGAGAAACACTTTGTAAATAGCTCGCCTG BS_EspD_NB espD northern blot

BS_RecA_NB

probe recA northern blot probe

ATACGGATCTGGTTGATGAAGATCAGCAGC