Supporting Information for

5 downloads 0 Views 342KB Size Report
Enantioselective disturbance of chiral herbicide dichlorprop to nitrogen metabolism of Arabidopsis thaliana: Regular analysis and stable isotope attempt.

Supporting Information for Enantioselective disturbance of chiral herbicide dichlorprop to nitrogen metabolism of Arabidopsis thaliana: Regular analysis and stable isotope attempt Zunwei Chen, Jia Wang, Siyu Chen, Yuezhong Wen*

MOE Key Laboratory of Environmental Remediation & Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058, China

*

Corresponding author:

Tel.: +86-571-8898-2341. Fax: +86-571-8898-2341. E-mail address: [email protected] (Y.W.) 1

Text S1. Measurements of enzyme activities involved in nitrogen metabolism Nitrate Reductase (NR). Certain weight of Fresh A. thaliana seedlings were grounded under ice bath after adding 4 mL of extraction solution containing 25 mM PBS (pH 7.5), 5 mM cysteine and 5 mM EDTA-2Na. The extract was centrifuged at 4, 000 rpm for 15 min at 4°C. Taking 0.4 mL supernatant into a 1.6 mL-reaction system containing 1.2 mL of 0.1 M KNO3 and 0.4 mL of 2.0 mg/L NADH and the reaction was performed at 25°C for 30 min. After adding with 1 mL of 1% sulfanilamide in 3N HCl and 1 mL of 0.02% N-naphthylethylenediamine and mixed for 15 min then centrifugation (4, 000 rpm, 5 min), the supernatant was measured at 540 nm and the NO2- concentrations were read from a standard curve with known NO2- concentrations. The activity of NR was defined as the reduction of NO3- concentration in unit time with unit weight plant. Nitrite Reductase (NiR). 0.1 mL of enzyme extract was added into a 3 mLreaction system containing 0.1 M potassium phosphate buffer (pH 6.8), 0.4 mM NaNO3, 2.3 mM methyl viologen, 4.3 mM sodium dithionite in 100 mM NaHCO3. The reaction was performed at 27°C for 30 min, after which 1 mL of 1% sulfanilamide in 3N HCl and 1 mL of 0.02% N-naphthylethylenediamine were added. The reaction was stopped by vortexing and boiling for 1 min. The NO2- remained was determined at 540 nm as described above. One unit of NiR activity was defined as 1 mM NO2- reduced per mg protein in a unit time. Glutamine synthetase (GS). 0.1 mL enzyme extract was added into a 3 mLreaction system containing 50 mM Tris-HCl buffer (pH 7.6), 20 mM MgSO4, 8 mM 2

glutamic-Na, 6 mM hydroxylamine hydrochloride, 4 mM EDTA-2Na and 8 mM ATP. After 30 min at 30°C, the reaction was stopped by adding 0.12 M FeCl3, 0.5 M TCA and 2 N HCl. Then the mixture was centrifuged (13, 200 g, 5 min) and the supernatant was detected at 540 nm. One unit of GS activity was defined as the amount of enzyme needed to catalyze the formation of 1 μM glutamylhy-droxamate in unit time. Glutamate synthetase (GOGAT). As for the GOGAT, fresh samples were added into 3 mL of extraction solution, which contains 0.2 M PBS (pH 7.5), 2 mM EDTA, 50 mM KCl, 0.1% (v/v) mercaptoethanol and 0.5% (v/v) Triton X 100 and then homogenized. The mixture was then centrifuged (6, 000 g, 15 min, 4°C). A 3mL reaction solution containing 25 mM PBS (pH 7.3), 1 mM EDTA, 20 mM L-glutamine, 5 mM 2-oxoglutarate, 100 mM KCl. 1 mM NADH and 0.3 mL of enzyme extract. The GOGAT activity was calculated as the decrease in absorbance at 340 nm in 5 min. Glutamate dehydrogenase (GDH). GDH activity was detected in both aminating and deaminating direction. The reaction solution for aminating direction consists of 100 mM tris-HCl (pH 8), 1 mM CaCl2, 13 mM 2-oxoglutarate, 50 mM (NH4)2SO4 and 0.25 mM NADH. As for the deaminating direction, the solution contains 100 mM tris-HCl (pH 9), 1 mM CaCl2, 30 mM glutamic acid and 0.25 mM NAD. Both activities were determined spectrophotometrically at 30°C by consumption (amination) or appearance (deamination) of NADH at 340 nm.

3

Table S1 Primers for nitrogen related genes Gene function

Reference

Gene name

Primer sequence

NO3- Transporter

1

AtNRT1.1

Fwd: ATCAGGAAGCGGGAGTTACC Rev: ATGTCTCGGATTGTGCGACT Fwd: GCGAGTATGTCCGTGAGTCC Rev: AGTTAGTTGTGCCCGAGGAG Fwd: CAACTGAACAAGGGCTAACG Rev: CTGTGGAAGGAGGCAAGAAC Fwd: GACATTGGAAACGCTGGAGT Rev: ATCACAAGGAAGGCACAACC Fwd: ACTCGGCGTCACTTGTTGTC Rev: CGTTGTATGTGCCTGTCTCG Fwd: CGACTCCTACACCGACCTTG Rev: GTGCCCGAACTCTTGTCTTC Fwd: CCAGTCCCTTTCGTTCAGC Rev: AAACCTGCTATGCCACCAAC Fwd: GAAATCGCAAAGGAAGGTTG Rev: ACTGAATCATAGGCGGTGGT Fwd: AAGGGAGGAACTGGATGGTT Rev: CGGTACTGTATGCCCAACCT Fwd: GAAGCGATTCCTCTTGATGC Rev: CCGGTACAAGCAACTAAGCC Fwd: GACACCAAACCTTACTCTGAC Rev: CACCAAACATGATCACCTGCA Fwd: ATCATTCAAGAGCAGGTTGT Rev: GACAGTTGAAAGCAGTTATT Fwd: TACACATTTGATCGTGGTTT Rev: AATCGAAAACCCTTTCTTAA Fwd: CAAGGCTTTATGTGGGAGGA Rev: TGAGCCACACGATTAACACC Fwd: GGATTCATGTGGGAAGAGGA Rev: GCGACTCGGTTAACTCCAAG

AtNRT1.2 AtNRT2.1 AtNRT2.2 NH4+ Transporter

1

AtAMT1.1 AtAMT1.2 AtAMT1.3

Nitrate Reductase

2

AtNIA1 AtNIA2

Nitrite Reductase

3

ATNiR

Glutamine Synthetase (GS) GOGAT

4

AtGLN2

5

AtGLU1 AtGLU2

Glutamate Dehydrogenase

6

AtGDH1 AtGDH2

4

FIGURE CAPTIONS Figure S1. Effects of DCPP on the transcriptional levels of NO3- (A) and NH4+ (B) transporter genes in A. thaliana Figure S2. Effects of DCPP on amino acid concentrations in A. thaliana, (A) without obvious effects and one or two enantiomers did affect.

5

2.0

Relative transcriptional abundance

(A)

** *

Control (R)(S)-

**

(Rac)-

1.5

** **

1.0

* *

0.5

*

*

*

*

0.0

AtNRT1.1

Relative transcriptional abundance

5

AtNRT1.2

(B)

AtNRT2.1

AtNRT2.2

Control

** *

(R)(S)(Rac)-

4

3

2

** *

* *

** * * *

1

0

AtAMT1.1

AtAMT1.2

Figure S1

6

AtAMT1.3

Concentration of amino acids (mg/g plant)

3

Control (R)(S)(Rac)-

(A)

2

1

0

Gly

Ala

Met

Ile

Phe

2.0

Concentration of amino acids (mg/g plant)

1.5

His

*

Control (R)(S)(Rac)-

(B)

Lys

* *

*

1.0

*

0.5

0.0

Thr

Ser

Val

Figure S2

7

Leu

REFERENCES 1.

Sun, C.C., Jin, Y.J., He, H.F., Wang, W., He, H.W., Fu, Z.W., Qian, H.F., 2015. Two novel herbicide candidates affect Arabidopsis thaliana growth by inhibiting nitrogen and phosphate absorption. Pestic. Biochem. Phys. 123, 1-8.

2.

Konishi, M., Yanagisawa, S., 2011. The regulatory region controlling the nitrateresponsive expression of a nitrate reductase gene, NIA1, in Arabidopsis. Plant Cell Physiol. 52 (5), 824-836.

3.

North, K. A., Ehlting, B., Koprivova, A., Rennenberg, H., Kopriva, S., 2009. Natural variation in Arabidopsis adaptation to growth at low nitrogen conditions. Plant Physiol. Biochem. 47 (10), 912-918.

4.

Debouba, M., Dguimi, H. M., Ghorbel, M., Gouia, H., Suzuki, A., 2013. Expression pattern of genes encoding nitrate and ammonium assimilating enzymes in Arabidopsis thaliana exposed to short term NaCl stress. J Plant Physiol. 170 (2), 155-160.

5.

Potel, F., Valadier, M.H., Ferrario-Mery, S., Grandjean, O., Morin, H., Gaufichon, L., Boutet-Mercey, S., Lothier, J.; Rothstein, S. J.; Hirose, N.; Suzuki, A., 2009. Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana- roles of glutamate synthases and carbamoylphosphate synthetase in leaves. Febs Journal 276 (15), 4061-4076.

6.

Miyashita, Y., Good, A. G., 2008. NAD(H)-dependent glutamate dehydrogenase is essential for the survival of Arabidopsis thaliana during dark-induced carbon starvation. J Exp. Bot. 59 (3), 667-680. 8