Systemic Delivery of Stable siRNA-Encapsulating Lipid Vesicles ...

Article pubs.acs.org/molecularpharmaceutics

Systemic Delivery of Stable siRNA-Encapsulating Lipid Vesicles: Optimization, Biodistribution, and Tumor Suppression Ghulam Hassan Dar, Vijaya Gopal,* and N. Madhusudhana Rao* CSIRCentre for Cellular and Molecular Biology, Uppal Road, Hyderabad 500007, Andhra Pradesh, India S Supporting Information *

ABSTRACT: Lipid-based nanoparticles are considered as promising candidates for delivering siRNA into the cytoplasm of targeted cells. However, in vivo efficiency of these nanoparticles is critically dependent on formulation strategies of lipid−siRNA complexes. Adsorption of serum proteins to lipid−siRNA complexes and its charge determine siRNA degradation and serum half-life, thus significantly altering the bioavailability of siRNA. To address these challenges, we developed a formulation comprising dihydroxy cationic lipid, N,N-di-n-hexadecyl-N,N-dihydroxyethylammonium chloride (DHDEAC), cholesterol, and varying concentrations of 1,2-distearoryl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol-2000)] (DSPEPEG 2000). Using an ethanol dilution method, addition of these lipids to siRNA solution leads to formation of stable and homogeneous population of siRNA-encapsulated vesicles (SEVs). Biodistribution of these SEVs, containing 5 mol % of DSPEPEG 2000 in xenograft mice, as monitored by live animal imaging and fluorescence microscopy, revealed selective accumulation in the tumor. Remarkably, four intravenous injections of the modified vesicles with equimolar amounts of siRNA targeting ErbB2 and AURKB genes led to significant gene silencing and concomitant tumor suppression in the SK-OV-3 xenograft mouse model. Safety parameters as evaluated by various markers of hepatocellular injury indicated the nontoxic nature of this formulation. These results highlight improved pharmacokinetics and effective in vivo delivery of siRNA by DHDEAC-based vesicles. KEYWORDS: RNAi therapeutics, cationic lipid, siRNA delivery, cholesterol, xenograft tumor, DSPE-PEG (2000), gene silencing, pharmacokinetics

■

INTRODUCTION The ability of siRNA to silence the expression of specific genes, particularly whose end products are not amenable to conventional therapies, has acquired worldwide attention as a new type of therapy in treating diseases as complex as cancer.1 However, due to the anionic nature of siRNA, delivery of siRNA into the cytoplasm of targeted cells is considered as the most critical factor in realizing the therapeutic potential of RNAi. To facilitate the entry of siRNA into the cells, a large number of carriers including organic polymers,2 lipids,3 aptamers,4 fusion proteins,5 and metal nanoparticles6 were tested with varying success. Among these, cationic lipids represent one of the well-studied classes of synthetic materials for nucleic acid delivery.7,8 Lipids have the advantage of biocompatibility, low immunogenicity, ease in synthesis, and potent transfection efficiency.9,10 Besides forming selfassembled nanoparticles with the nucleic acids, the chemical © 2014 American Chemical Society

structure of these lipids can be modified by attaching different functional groups such as polyethylene glycol, sugar residues, antibodies, and peptides.11 Additionally, cationic lipids possess the unique ability to destabilize the lipid membrane by forming non-bilayer lipid structures with anionic endosomal phospholipids, which facilitates release of nucleic acids into the cytoplasm of the cells.12 However, intravenously administered cationic liposomes are susceptible to aggregation and nonspecific adsorption of serum proteins, resulting in rapid extravasation by the reticuloendothelial system (RES).13 Incorporation of various hydrophilic molecules into the cationic liposomal formulation has improved their application Received: Revised: Accepted: Published: 610

October 8, 2014 December 24, 2014 December 29, 2014 December 29, 2014 DOI: 10.1021/mp500677x Mol. Pharmaceutics 2015, 12, 610−620

Article

Molecular Pharmaceutics for in vivo delivery of drugs. Among several hydrophilic molecules, inclusion of polyethylene glycol (PEG) molecule in the composition of the liposomes has significantly contributed toward stabilization of the liposomes in the circulatory system.14 This hydrophilic and inert polymer imparts a steric barrier to the absorption of proteins onto the surface of liposomes and minimizes their uptake by the RES.15 Moreover, the improved pharmacokinetics and stealth property of PEGylated vesicles enhance their biodistribution in the tumor tissues, which is characterized by leaky vasculature and lack of effective drainage system, an effect known as enhanced permeability and retention effect (EPR).16,17 Several approved liposomal formulations such as PEGylated liposomal doxorubicin (Doxil/Caelyx) are available in the market for treatment of several types of carcinomas.18,19 However, the use of PEGylated liposomes as siRNA carrier is complicated by the fact that PEG molecules prevent efficient encapsulation of siRNA resulting in unstable complexes, which provide insufficient protection to siRNA in serum. The amount of PEG in the formulation is known to play a critical role since lesser amounts do not provide enough cover to the liposomal surface. In contrast, excess PEG-lipid destabilizes the liposomes and reduces the cellular uptake drastically.20 Therefore, parameters such as size and amount of PEG need to be carefully titrated to generate robust lipid−siRNA complexes. Recently, a novel formulation strategy of siRNA−lipid complexes termed as wrapsomes was reported that efficiently entrapped high amounts of siRNA.21 siRNA present in the core of these wrapsomes is protected from degradation and elimination pathways. Here, we have investigated two different strategies for preparing the liposomes with three different PEG amounts to identify the best possible formulation that leads to efficient in vivo gene silencing. We have employed a nontoxic, monocationic and highly efficient cationic lipid, N,N-di-n-hexadecylN,N-dihydroxyethylammonium chloride (DHDEAC) with cholesterol as the colipid. By using the ethanol dilution method and DSPE-PEG 2000 at 2.5 to 8 mol %, we encapsulated ∼80% of siRNA in the vesicles (henceforth referred to as siRNAencapsulated vesicles, SEVs). These vesicles were highly stable and did not form any aggregates during the storage for several weeks. Intravenous administration of SEV in mice composed of DHDEAC:Chol:DSPE-PEG 2000 at 50:45:5 mol ratio (designated as SEV-5), was found to selectively accumulate in xenograft tumor tissues, which reflected enhanced serum stability and pharmacokinetics of SEV-5. A mixture of two siRNAs, against human ErbB2 and AURKB, entrapped within these vesicles effectively silenced ErbB2 and AURKB gene expression leading to significant suppression of tumor growth.

mole percent of DHDEAC, cholesterol, and DSPE-PEG 2000 respectively. For encapsulating 200 μg of siRNA, Table 1 shows the amounts of DHDEAC, cholesterol, and DSPE-PEG 2000 that were dissolved in 200 μL of 90% ethanol. Table 1. Amounts of the Lipids Used To Prepare Different Types of siRNA Encapsulating Vesicles (SEVs)a types of SEV

DHDEAC (mg)

cholesterol (mg)

DSPE-PEG 2000 (mg)

SEV-2.5 SEV-5 SEV-8

2.14 2.14 2.14

1.35 1.28 1.19

0.5 1.0 1.6

a

SEV-2.5: Vesicles containing 2.5 mol % of DSPE-PEG-2000. SEV-5: Vesicles containing: 5 mol % of DSPE-PEG-2000. SEV-8: Vesicles containing 8 mol % of DSPE-PEG-2000. Numbers in the rows indicate the amount of DHDEAC, cholesterol, and DSPE-PEG 2000 used to prepare the corresponding vesicles.

siRNA was solubilized in 10 mM citrate buffer, pH 3.0, and the solution was incubated at 37 °C for 20 min. The lipids were then added dropwise to an equivalent volume of siRNA solution, undergoing rapid and continuous mixing by vortexing. The solution was immediately diluted with PBS to a final ethanol concentration of 25%. Liposomes were then extruded through 100 nm polycarbonated filters several times. Ethanol was subsequently removed by dialysis with PBS, pH 7.5. Encapsulation efficiency of these liposomal preparations, i.e., the total amount of encapsulant (siRNA) found in the liposome solution versus the total initial input of encapsulant, was found to be 78.6% (107 μg out of 136 μg of siRNA was found in the final liposomal preparation). For visualizing the localization of particles, tissue distribution, and pharmacokinetics, Lissamine Rhodamine B 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (Rhodamine-DHPE from Invitrogen) was added to the formulation at 0.5 mol % of the total lipid. Determination of siRNA Entrapment Efficiency by Ribogreen Displacement Assay. Entrapment efficiency of siRNA was determined by Ribogreen (Invitrogen) displacement assay as described previously by Jeffs et al.23 Briefly, samples as well as Ribogreen stock were diluted separately with TE buffer, pH 7.5 (10 mM Tris·HCl, 1 mM EDTA), to 1:200. The solutions were mixed either in the presence or in the absence of Triton X-100 (0.5% final concentration). Ribogreen fluorescence was measured with a spectrophotometer (Fluorolog 3-22 fluorescence spectrophotometer, Jobin Yvon, USA), using excitation and emission wavelengths of 480 and 525 nm, respectively. Flourescence intensity of Ribogreen in the presence of Triton X-100 was considered as total fluorescence emanating due to interaction of siRNA (both entrapped and free siRNA) with Ribogreen dye. Similarly, fluorescence intensity emanating from Ribogreen, added to SEV in the absence of Triton X-100, was considered as due to interaction of Ribogreen with free siRNA, which might have not been entrapped during the process. The percentage of entrapment was calculated by using the following equation:

■

MATERIALS AND METHODS Preparation of siRNA-Encapsulated Vesicles (SEVs): siRNA Encapsulation for in Vivo Delivery. For all in vivo experiments, SEVs were prepared by encapsulating siRNA into cationic liposomes using the ethanol dilution method that was further modified.22,23 Briefly, SEVs were prepared with cationic lipid DHDEAC, cholesterol, and DSPE-PEG-2000 (Avanti Polar lipids) at three different mole ratios (2.5, 5, and 8 mol %). Lipid powder dissolved in chloroform was mixed in a glass tube and air-dried by using a stream of nitrogen gas. After complete removal of chloroform, the lipids were dissolved in 90% absolute ethanol. The final lipid concentration was maintained at 10 mM, containing (50:47.5:2.5), (50:45:5), and (50:42:8)

percentage of entrapment =

[Ip − Ia] [Ip]

× 100

where Ip is the intensity of the Ribogreen fluorescence in the presence of Triton X-100 and Ia is the intensity of the Ribogreen fluorescence in the absence of the Triton X-100. To determine the total amount of entrapped siRNA, we multiplied 611

DOI: 10.1021/mp500677x Mol. Pharmaceutics 2015, 12, 610−620

Article

Molecular Pharmaceutics

In Vitro Cell Scratch Assay. Equal amounts (25 nM) of ErbB2 and AURKB siRNA were complexed with DHDEAC:Chol cationic vesicles at 6:1 N/P charge ratio and added to adherent SK-OV-3 cells, seeded in 60 mm3 tissue culture plates (Corning). After 48 h, the cells were scratched in the middle of each dish with a plastic tip of 3 mm diameter. Cells were washed with fresh DMEM medium containing 10% serum and imaged under the 10× objective lens of an axiovert inverted microscope (Zeiss) with the chamber maintained at 37 °C and 5% CO2. The images were acquired after every 10 min for 30 h. The distance covered by cells was measured by subtracting the total distance between two layers at nth time from the distance between the cells measured at the zero hour of the experiment. Multispectral in Vivo Fluorescence Imaging. All animal experiments were conducted in accordance with approval from Institute of Animal Ethics Committee (IAEC) (vide IAEC project # 03/11). Athymic nu/nu mice of 3−4 weeks were maintained in a pathogen-free environment. Their cages, bedding, food, and water were autoclaved. To assess the tumor targeting of the SEV, SK-OV-3 tumor xenografts were developed on the left flank of the nude mice by injecting intradermally 4 × 106 of SK-OV-3 cells resuspended in Matrigel (BD Matrigel, Basement Membrane Matrix, BD Biosciences) at a 3:1 ratio. After tumors had grown to a palpable size, Rhodamine-labeled SEV encapsulating siRNA was administered intravenously via tail vein. At regular intervals, the anesthetized mice were placed in an in vivo multispectral imaging system (Carestream Molecular Imaging), equipped with a rotating chamber using 570/600 nm as excitation and emission filters. Mice were sacrificed 24 h post injection, and images of different organs were acquired and analyzed. Immediately after the animals were euthanized, the organs were snap frozen in liquid nitrogen and stored at −80 °C. The stored organs were further processed for cryosectioning followed by incubation in isopropanol for 5 min. After removal of the solvent, the sections (5 μm) were stained with Hoechst and visualized under a fluorescence microscope. Silencing of Tumor Oncogenes in Tumor Suppression Assays. For tumor suppression studies, xenograft mice were developed subcutaneously in nude mice as described in the earlier section. After the tumors attained a size of ∼50 mm3, mice were randomly distributed into four groups of five animals each. The volume of the tumor was calculated by using the formula V(mm3) = (1/2)(smaller diameter)2(larger diameter). SEVs encapsulating validated ErbB2 (Dharmacon) and AURKB (Qiagen) siRNAs were injected into the animals at a dosage of 2 mg/kg body weight. The sequences of the AURKB and ErbB2 siRNA provided by the company are given below: AURKB sense: 5′-r(GGAGGAUCUACUUGAUUCUAGAG)dTdA-3′ AURKB antisense: 5′-r(UACUCUAGAAUCAAGUAGAUCCUCCUC)-3′ ErbB2 sense: 5′-r(AGACGAAGCAUACGUGAUAA)-3′ ErbB2 antisense: 5′-r(AUCACGUAUGCUUCGUCUAA)-3′ Single dose injections were given every 2 days, and the size of the tumor was measured manually with vernier caliper. The treatment lasted until the size of tumors in the control animals, receiving either PBS alone or SEVs containing scrambled siRNA (Sc.siRNA), attained a dimension of ∼1300 mm3. At the end of the experiment, the animals were euthanized. Tumor tissues were harvested and further analyzed for knockdown of ErbB2 and AURKB genes by quantitative real-time PCR. Total

the amount of siRNA present in the SEV formulation to the percentage of the entrapment. The total amount of siRNA was determined by measuring the absorbance of the SEV solution at 260 nm. Briefly, 200 μL of PBS containing SEV at a 1:10 v/v ratio was added to 800 μL of a 2.5:1 mixture of methanol:chloroform. Addition of methanol and chloroform at a given ratio resulted in the formation of a single clear phase, resulting in release of all the siRNA by solubilizing the vesicles. The absorbance at 260 nm was measured, and siRNA concentration was determined by using the Lambert−Beer equation. The extinction coefficient of the siRNA was calculated by the nearest-neighbor model. Dynamic Light Scattering, Zeta Potential, and Transmission Electron Microscopy. All dynamic light scattering (DLS) and zeta potential experiments were performed at 25 °C in an SZ-100 NEXTGEN (HORIBA) instrument equipped with a diode-pumped solid-state laser at λ 532 nm. The instrument was kept in a dust-free room, and disposable cuvettes provided with the instrument were thoroughly washed with double distilled water. 3 mL of PBS solution containing 20 μM SEV was carefully added to the cuvette and incubated for 10 min in the instrument. The instrument was programmed to take 5 measurements each of 60 s. Measurements taken with PBS buffer alone were analyzed for absence of autocorrelation before further experiments were carried out. The software SZ100, provided with the instrument, was used to analyze the data. For determining the surface charge of SEVs, different concentrations of SEVs such as 20 μM, 100 μM, and 500 μM were prepared in PBS buffer and analyzed for the zeta potential. For TEM studies, 3 μL of 20 μM SEV was applied on 300 mesh carbon coated copper (Cu) grids for 2 min followed by blotting of excess liquid. The grid was washed 3 times with distilled water before staining with 2% uranyl acetate for 20 s. The grid was air-dried for 3 h under vacuum and visualized under the electron microscope at 120 kV and a magnification ranging from 75000× to 135000×. Digital images were taken using the instrument software. Cell Culture. Cells were maintained in a growth medium composed of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) with 10% fetal bovine serum (Invitrogen), 50 μg/ mL penicillin, 60 μg/mL streptomycin, and kanamycin100 μg/ mL (Sigma). SK-OV-3 cells were maintained in DMEM/F12 medium (Invitrogen) supplemented with 10% fetal bovine serum. All cells were grown and maintained at 37 °C and 5% CO2. Flow Cytometry and Confocal Microscopy. HeLa cells were grown to 60% confluence in 6-well plates 1 day before treatment. Carboxyfluorescein-labeled siRNA (siRNAFAM) encapsulated in SEV was added to the cells. After 3 h of incubation, the cells were washed with PBS, containing 20 U/ mL heparin sulfate to remove the cell surface associated particles. The cells were detached by trypsinization and collected in 1.5 mL eppendorf tubes. After 2 additional washes with PBS containing 1% fetal calf bovine serum, the cells were analyzed for fluorescence on a FACS Calibur with Cell Quest software (Becton Dickson). For intracellular distribution, HeLa and SK-OV-3 cells were seeded on coverslips to attain 60% confluency. SEVs encapsuating siRNAFAM were added to the cells and incubated for 1 h. Prior to fixing with 4% formaldehyde, the nuclei were stained with Hoechst and coverslips were mounted on the glass slides for visualizing under the fluorescence microscope (63× oil based objective lens, Leica LAS-AF-TCS-SP5). 612


Article


Figure 1. Effect of DSPE-PEG 2000 on siRNA binding and cellular uptake by DHDEAC:Chol vesicles: (A) Agarose gel electrophoresis image of siRNA complexed with PEGylated vesicles (DH:Cho:DSPE PEG 2000) at varying concentrations of DSPE-PEG 2000. 50 pmol of siRNA was mixed with the PEGylated vesicles at 6:1 N/P charge ratios. siRNA alone was used as a negative control whereas DHDEAC:Chol vesicles, containing 0 mol % DSPE-PEG 2000, were used as positive control for binding. All complexes were made at 6:1 N/P charge ratios. (B) In vitro uptake of FAM labeled siRNA in HeLa cells by flow cytometry: PEGylated vesicles, containing different mole % of DSPE-PEG 2000, were added to 20 pmol of FAMlabeled siRNA at 6:1 N/P charge ratio. Cells treated with siRNA-lipoplexes containing 0 mol % DSPE-PEG 2000 showed maximum uptake, which decreased significantly at higher concentration of DSPE-PEG 2000 in the PEGylated vesicles.

ALP, ALT, and AST, markers of hepatocellular injury, were measured directly as per the manufacturer’s instructions (Dimension Xpand Plus, Siemens). Statistical Analysis. Data was expressed as mean ± standard deviation, and Student’s unpaired t test was used to calculate two-tailed P value, using Microsoft Excel to estimate the statistical significance of differences between treated and untreated groups. For in vitro studies, the data was considered significant when P < 0.01, and for animal studies, data was considered significant when p < 0.05.

RNA from the tissues stored in RNA storage buffer (RNA later from Ambion) were extracted by using TRIzol reagent (Life Technologies). 2 μg of total RNA was used to synthesize cDNA, using SuperScript III First Strand Synthesis system for RT-PCR (Invitrogen) and oligo dT. 1 μL of cDNA coresponding to 20 ng of total RNA was used for qRT-PCR by using Solaris gene specific probes (Dharmacon). The experiment was performed in triplicate and repeated independently three times. The data was analyzed by using the ΔΔCt method. Mean values of ErbB2 and AURKB mRNA were normalized with β-actin mRNA level. The expression level of ErbB2 and AURKB in the PBS treated group was considered as 100% and was used as a control for determining the level of gene expression in other animal groups. In Vivo Cytotoxicity Assay of SEV. Male Swiss albino balb/c mice weighing 25−30 g were assigned randomly into 3 groups each containing 5 mice. siRNA entrapped in SEVs was injected intravenously at 2 mg/kg or 4 mg/kg body weight. Injections of normal saline served as controls. After 48 h, blood was collected by retro-orbital bleeding to measure serum levels of alkaline phosphatase (ALP), alanine transaminase (ALT), and aspartate transaminase (AST). Serum concentration of the

■

RESULTS Entrapment of siRNA into the Vesicles Results in Nonaggregated Vesicles. DHDEAC (16-carbon alkyl chain length) is a cationic amphiphile with hydroxyethyl groups directly attached to the positively charged quaternized nitrogen atom. The chemistry and detailed characterization of the lipid has already been reported.24 The rationale behind using this lipid for in vivo delivery of siRNA is based on its excellent transfection properties and also its low cellular toxicity compared to commercial transfection agents. Cationic vesicles made of DHDEAC and cholesterol (colipid) were found to 613


Article


Figure 2. In vitro characterization of SEV: (A) Hydrodynamic diameter (upper row) and zeta potential (bottom row) of SEV in PBS buffer, pH 7.6. 20 μL of 10 mM SEV was added to 2 mL of PBS buffer and analyzed by dynamic light scattering for size measurements. The experiment was repeated thrice in duplicate. For calculating zeta potential, 100 μM SEVs were added to the cuvette and analyzed for surface charge at 25 °C. (B) Entrapment of siRNA by SEV formulated using 2.5, 5.0, and 8 mol % of DSPE-PEG 2000. The percentage of entrapment was analyzed by Ribogreen fluorescence assay. SEVs were mixed with the Ribogreen dye either in the presence or in the absence of 1.0% Triton X-100. Fluorescence intensity of the dye added either to TE buffer alone or to TE buffer containing 1.0% Triton X-100 was used to normalize the data. Inset represents the agarose gel image of siRNA, which was extracted from SEV-5 by treatment with 1% Triton X-100. Lane labeled with 0% Triton X-100 represents unencapsulated siRNA. (C) Flow cytometry based analysis of siRNA uptake in HeLa cells. SEVs containing entrapped siRNAFAM were added to HeLa cells and after 3 h of incubation, and cells were analyzed to quantitate uptake levels. Graph depicts the quantitative uptake of fluorescently labeled siRNA, encapsulated in SEV. The quantitation of FACS data was carried out by using Cell Quest software provided with the instrument. Data is shown as mean ± SD of three experiments carried out independently. (D) Confocal microscopy of HeLa and SK-OV-3 cells treated with SEV-5. 4 μL of SEV-5 containing ∼40 pmol of siRNA was added to the cells and fixed after 3 h of treatment. Nuclei were counterstained with Hoechst (Blue). siRNA encapsulated into SEV-5 was labeled with carboxyfluorescein (FAM) dye. (E) Endogenous ErbB2 gene silencing in SK-OV-3 cells treated with increasing concentration of SEV-5. The gene expression was assessed by qRT-PCR, using SYBR green chemistry. Gene expression in SK-OV-3 cells treated with PBS was taken as 1, and gene expression in treated cells was determined with respect to it by comparative ΔΔCt method. Expression of beta actin was used as an internal control. Cells treated with SEV-5 encapsulating oligo DNA (mock) were used as a negative control. The data is plotted as mean ± SD of three independently repeated experiments (**p < 0.05 and ***p < 0.005 were considered statistically significant with respect to control PBS treated cells).

we observed significant decrease in cellular uptake of these complexes. PEGylated vesicles containing more than 2.5 mol % DSPE-PEG 2000 showed drastic reduction in cellular uptake when compared to siRNA-lipoplexes prepared with nonPEGylated vesicles (Figure 1B). Based on these results, we attempted to modify the protocol by encapsulating siRNA within the cationic vesicles by premixing the components in ethanol. A previous report on antisense oligonucleotide encapsulation has shown that addition of lipids dissolved in ethanol to an aqueous solution containing antisense oligonucleotide resulted in the formation of small multilamellar liposomes, trapping oligonucleotide efficiently without forming aggregates.27 Using the ethanol dilution method, we assessed the encapsulation efficiency of siRNA in the liposomes formulated with DSPE-PEG 2000 at 2.5, 5.0, and 8 mol %. To reduce the destabilizing effect of ethanol, the solution was

carry siRNA efficiently into different cell types, resulting in >80% gene silencing (see Supporting Information). As anticipated, these simple ionic complexes are sufficient to deliver siRNA efficiently in vitro. However, at concentrations of siRNA required for in vivo studies, the complexes were unstable and resulted in rapid aggregation. To overcome the stability issues, we incorporated a biocompatible amphiphile, distearoylphosphatidylethanolamine polyethylene glycol (DSPE-PEG 2000), to reconstitute cationic vesicles (PEGylated vesicles). PEG is known to increase the colloidal stability of the particles besides prolonging circulation time.14,25 However, preparations of complexes by mixing siRNA with PEGylated vesicles led to a drastic decrease in the siRNA entrapment efficiency (Figure 1A). The decrease in binding efficiency could be due to PEG molecules, which prevents siRNA from sandwiching between the stacks of lipid bilayers due to steric hindrance.26 Moreover, 614


Article


Figure 3. In vivo biodistribution of SEV-5 in live animals harboring SK-OV-3 tumor xenograft. (A) Live whole body animal imaging of nude mice systemically injected with Rhodamine labeled SEV-5. A single dose of 1 μmol of labeled SEV-5 was injected via tail vein and imaged in real time by optical imaging using a reflective imaging system equipped with rotatory module. (B) Mice were sacrificed 24 h after a single dose, and various organs were isolated and imaged. Symbols in the figure represent K = kidney, L = liver, S = spleen, Ln = lungs, T = tumor. (C) Tissue sections depicting intracellular fluorescence (red dots) of Rhodamine labeled-SEV-5. The animals receiving a single dose of SEV-5 were sacrificed after 24 h of incubation, and organs isolated were cryosectioned (4 μm). The sections were counterstained with Hoechst to stain nuclei (blue) and visualized under fluorescence microscope (64× magnification). White arrows indicate the localization of Rhodamine fluorescence (red dots). (D) Quantitative fluorescence associated with various sections (n = 5) of tissues from respective organs. Fluorescent signals were quantitated as pixel sum from each section using LAS software from Leica confocal microscopy.

(Supplementary Figure 1 in the Supporting Information). To determine the percentage of siRNA entrapment, we measured the fluorescence intensity of Ribogreen added to the solution containing either intact SEV (for siRNA bound to outside) or SEV lysed with Triton X-100 (represent total siRNA). The data analyzed showed efficient entrapment of siRNA by the SEV. Entrapment efficiency of SEV-2.5, -5, and -8 was found to be 60%, 80%, and 92%, respectively (Figure 2B). The increase in entrapment efficiency and decrease in the size of the SEV with increasing concentration of DSPE-PEG 2000 could probably be due to the stabilizing effect of PEG that prevents formation of large aggregated complexes. Interestingly, we did not find any significant change in either size of the vesicles or their siRNA entrapment efficiency upon storage at lower temperature (4−8 °C) for several weeks, reflecting colloidal stability of these vesicles (data not shown). To determine whether these vesicles could carry the siRNA into the cells, we carried out flow cytometry and confocal microscopic studies on HeLa and SK-OV-3 cells. Fluorescently labeled siRNA (siRNAFAM) was used to make SEVs. After 3 h

rapidly mixed by high speed vortexing. The siRNA-encapsulated vesicles (SEVs) were dialyzed in PBS buffer to remove the last traces of ethanol followed by centrifugation at high speed (18000g) to remove any aggregated particles. To determine the size of these vesicles, we performed dynamic light scattering experiments that revealed a uniform size of SEV with polydispersity index (PI) below 0.2. Moreover, the size of SEV decreased with increasing mole % of DSPE-PEG 2000. Hydrodynamic diameter of SEV containing 8 mol % of DSPEPEG 2000 (designated as SEV-8) was observed to be 80 nm while the sizes of SEV containing 5 mol % (designated as SEV5) and 2.5 mol % (designated as SEV-2.5) were 114 and 142 nm, respectively. (Figure 2A, top row). We also determined the zeta potential of these vesicles in PBS buffer, which revealed slighlty negative charge on SEV-5 (−1.8 mV) and SEV-8 (−3.6 mV). However, the electrostatic charge on SEV-2.5 was slightly cationic (0.4 mV) in nature (Figure 2A, bottom row). To assess the morphology of SEV, we analyzed transmission electron microscopic images of SEV-5, which indicated the formation of nonaggregated spherical vesicles with an average size of 100 nm 615


Article


Figure 4. Suppression of tumor growth in animals treated with ErbB2 and AURKB siRNA: (A) Representative images of tumor organs isolated from control (PBS and SEV-5 entrapping ScsiRNA) and treatment group (SEV-5 entrapping ErbB2 and AURKB siRNA). The images were taken at the end of the experiment by sacrificing the animals. (B) Representative graph showing size of tumors of various groups (n = 5) at indicated time points. The volume of tumor was calculated by measuring the dimensions of the tumor by vernier caliper. Data is presented as means ± SD of various animals of each group. (C) mRNA expression of AURKB and ErbB2 genes in treated tumor tissues. Tumor tissues from animals of control (PBS and SEV-5: ScsiRNA) and treatment groups (SEV-5ErbB2+AURKB) were analyzed for expression of mRNA levels of AURKB and ErbB2 genes. The expression levels of genes were determined by using probe-based qRT-PCR. The data was analyzed by the ΔΔCt method, and results are shown as mean ± SD (**p < 0.005 were considered statistically significant when compared to PBS control group). (D) In vivo cytotoxicity assay of SEV-5 injected into male Swiss albino balb/c. After 48 h of treatment, serum levels of alanine transaminase (ALT), aspartate transaminase (AST), and alkaline phosphatase (ALP) were determined in control (PBS treated) and treated animals. Data of each group containing 5 animals was analyzed by using Origin software and is represented as mean ± SD.

of treatment, the cells were washed with heparin sulfate to remove any surface-bound particles and analyzed for uptake by flow cytometry. We observed efficient uptake of SEV by HeLa cells treated with SEV-2.5 and SEV-5. However, the uptake decreased significantly in cells treated with SEV-8, which could probably be due to the hydrophilic nature and steric hindrance of PEG that prevented interaction of the complexes with the cell surface (Figure 2C). In addition, confocal microscopy and endogenous gene silencing experiments in HeLa and SK-OV-3 cells treated with SEV-5 resulted in efficient uptake and knockdown of ErbB2 genes. (Figures 2D and 2E). Biodistribution of Systemically Delivered siRNAEncapsulated Vesicles. The promising results optimized in vitro with SEV-5 motivated us to assess the in vivo siRNA carrying ability of these vesicles upon systemic administration. We chose SEV-5 to assess the pharmacokinetics in animal models as these vesicles showed efficient encapsulation and cellular uptake when compared to SEV-8 and SEV-2.5. To visualize SEV-5 in the animal body after systemic administration, we labeled SEV-5 with 0.2 mol % of RhodamineDHPE in the final lipid composition besides encapsulating FAM-labeled siRNA in the these vesicles. Labeled SEV-5 was administered intravenously into the tail vein of SK-OV-3 tumor

xenograft mice followed by live whole animal imaging. To rule out any background fluorescence of the animals, we normalized the instrument with the fluorescence emanating from animals injected with PBS alone. To our surprise, within 6 h of administration, we observed the fluorescence signal around the tumor region that became concentrated within the tumor region with time (Figure 3A and Supplementary Figure 2 in the Supporting Information). To further confirm this, the mice were euthanized, following which the individual organs and tumors were collected and visualized. On merging the X-ray and fluorescence images, we observed the emission of fluorescence from the tumors alone, thus confirming accumulation of the labeled SEV-5 (Figure 3B). To ascertain whether this SEV-5 accumulated in the tumor or resided in the interstitial tissue matrix, the organs were cryosectioned and anlayzed by fluorescence microscopy, which revealed significant accumulation of the SEV-5 in the cells of the tumor tissues. However, we did not observe any significant fluorescence in either the liver, spleen, or lungs that are a major source of RES (Figure 3C). Absence of fluorescence in the liver was surprising as a majority of systemically delivered nanoparticles are taken up by the liver and spleen tissues by mononuclear phagocytic system.28−30 Poor binding of opsonins 616


Article


lack of efficient gene silencing in vivo and toxicity at higher charge ratios.36−38 Therefore, substantial efforts are needed in designing new type of formulations that are less toxic and can deliver nucleic acids into the targeted tissues. In this study, we have tested a novel cationic lipid formulation for the delivery of siRNA. Interestingly, this lipid works efficiently with cholesterol as colipid. Cholesterol has also been reported earlier as an efficient colipid that enhances the transfection efficiency of cationic lipids in vitro and in vivo.39 Cationic vesicles prepared with DHDEAC:Chol led to efficient binding and delivery of siRNA to a wide range of cell lines, resulting in potent endogenous gene silencing. However, the same vesicles were found ineffective for in vivo applications due to conspicuous aggregation and serum instability. Interaction of cationic lipoplexes with serum have been found to lead to a variety of undesirable effects from adsorption of opsonizing proteins to lipoplex disintegration eventually leading to nucleic acid degradation.40−42 Enhanced serum stability and longer blood residence time have been found to depend substantially on size, composition, and surface modification of formulations. Due to net positive charge, nanoparticles including lipids and lipid-like materials are more predisposed to adsorption of serum proteins such as lipoproteins, albumin, proteins of the complement system, and immunoglobulins that have been known to alter the biodistribution of the nanoparticles.43 Delaying of opsonization of serum proteins has been shown to substantially enhance the circulation half-life of these nanoparticles.44 Due to ease in modifications of lipids and lipid-like materials, various hydrophilic molecules have been conjugated to the lipids for enhancing their serum stability in the vascular system. Among the hydrophilic molecules, PEG has been extensively used to modify the surface of the lipid nanoparticles.45 Besides providing colloidal stability to the particles, PEG reduces nonspecific interaction of nanoparticles with serum proteins through its hydrophilicity and steric repulsion effects.14,25 However, the extent and disposition of the PEG, its chain length, and the rate at which the particle loses PEG in the serum play an important role in pharmacokinetics of the nanoparticles. Studies by Gref et al. on PLG−PEG nanoparticles have shown drastic reduction of protein adsorption on the nanoparticles containing 5 wt % of PEG (2−5 kDa).46 Similarly, SNALP nanoparticles in which PEG has been attached to anchoring lipid, containing alkyl chain length of 14 to 16 carbons, demonstrated superior efficacy when compared to formulation containing a 10- to 12-carbon alkyl chain length of PEG anchoring lipid. This is due to less hydrophobicity of shorter alkyl chains that are unable to maintain high molecular weight PEG chains on the surface of the nanoparticles.47 For preparing SEV, we selected a PEG of 2 kDa molecular weight attached to lipid containing 18-carbon alkyl chain length that decreases rate of PEG erosion. Higher circulation half-life of nanoparticles is important for delivering effective doses of nanoparticle−drug conjugates to the cancerous tissues, where blood supply is significantly less as compared to first pass organs such as liver, spleen, and lungs. During preparation of SEVs, we used varying concentrations of DSPE-PEG 2000 to determine the maximum loading capacity of siRNA with good colloidal stability. We did not use DSPEPEG 2000 beyond 8 mol % as liposomes greater than 10 mol % of PEG are reported to be unstable and have poor transfection efficiency.48 The vesicles were formed by mixing ethanolic solution of the lipids to acidic aqueous solution of siRNA.

to SEV-5 due to the presence of PEG corona would enhance the serum half-lives. Longer circulation may eventually lead to the accumulation of the liposomes in tumor tissue due to the EPR effect. However, further studies need to be done to identify the serum proteins bound to SEV-5. Systemic Administration of SEV-5 Loaded with ErbB2 and AURKB Suppresses Tumor Growth in Xenograft Nude Mice. To investigate the therapeutic potential of siRNA delivered by SEV-5 into the tumor tissues, we selected siRNAs against ErbB2 and AURKB oncogenes. These genes have received a lot of attention during the past two decades due to their overexpression in various carcinomas such as breast, ovarian, prostate, and gastric cancers.31−33 Recently, a study by Addepalli et al. on combinatorial silencing of AURKB and epidermal growth factor receptor (EGFR) by siRNA has shown synergistic effect on suppression of prostate tumor growth in xenograft mouse model.34 To assess whether silencing of AURKB and ErbB2 (due to its high expression in SK-OV-3) genes has any effect on growth kinetics of SK-OV-3 cells, we performed in vitro cell scratch assay. Noticeably, we observed significant retardation in the proliferation rate of SK-OV-3 cells treated with a mixture of ErbB2 and AURKB siRNAs (Supplementary Figure 3 in the Supporting Information). Based on these findings, we developed SK-OV-3 xenograft mouse models. After the tumor size attained an average dimension between 50 and 100 mm3, the animals were randomly grouped and the formulations were administered intravenously via tail vein. Animals that received PBS and SEV5 encapsulating scrambled siRNA were used as a negative control for assessing the extent of tumor suppression. SEV-5 containing encapsulated ErbB2 and AURKB siRNA were injected into a separate group of (n = 5) animals for assessing the effect of the siRNAs on specific gene silencing. The animals were injected every 2 days, and the volume of the tumor was measured manually by using a vernier caliper. During the experiment, we observed significant suppression of tumor growth in animals treated with SEV-5 encapsulating ErbB2 and AURKB siRNA. However, the size of the tumors in control animals rapidly grew larger (Figures 4A and 4B). To determine whether suppression of the tumor is due to the silencing of ErbB2 and AURKB genes, we quantified the mRNA level of the tumor tissues isolated from control and treatment groups that reflected significant silencing of these two genes (Figure 4C). Taken together, the results confirmed efficient uptake of the SEV-5 by tumor tissues, resulting in significant silencing of oncogenes. We also assessed the serum to ascertain the levels of alkaline phosphatase, alanine transaminase, and aspartate transaminase of mice injected with siRNA-loaded SEV. Levels of these enzymes, markers of hepatocellular injury, were not significantly altered, thus indicating that intravenous injection of SEV did not indicate any stress on liver functions (Figure 4D).

■

DISCUSSION Cationic liposomes represent one of the most widely studied nonviral vectors for the delivery of negatively charged nucleic acids.7 Liposomes can be used to transfer both DNA and RNA and are technically simple, are easy to formulate, have low immunogenicity, and are readily available commercially.35 Over the past years, a large number of cationic lipids and polymers have been synthesized for DNA and siRNA transfection. However, based on our own empirical knowledge and several other reports, a major drawback of cationic liposomes is the 617


Article


immunoglobulins against PEG present in the first injection.56 Tagami et al. also noticed similar observations after systemic administration of siRNA-PEG coated lipoplexes. Interestingly, when the siRNA was encapsulated within the lipid bilayer, the level of anti-PEG IgM decreased drastically.57,58 It is also important to appreciate that the serum half-lives of liposomes are species and strain dependent.59 The relative contribution of all these parameters in the overall efficacy of siRNA delivery by liposomes is still being investigated. In our study tight distribution of the SEV sizes along with optimized composition and dosage may have played an important role in bringing about significant tumor suppression. The advantage of RNAi is that it can be utilized to silence a large number of different genes simultaneously by using a pool of siRNAs. This is particularly important for a disease like cancer where major cellular pathways have been altered. Earlier Love et al. have demonstrated silencing of five metabolic genes of cholesterol metabolism simultaneously by administering a single dose of a pool of siRNAs to the mice.60 We have chosen AURKB and ErbB2 oncogenes as potential targets for halting the tumor growth. AURKB plays an important role as a constituent of passenger strand complexes (PSC). Silencing of AURKB gene expression has been shown to disrupt the assembly of PSC resulting in inhibition of cell growth.61 The epidermal growth factor receptor 2 (ErbB2) is a member of the HER/ErbB family of receptor kinases. Many human epithelial cancers overexpress ErbB2, and the dysregulated ErbB2 signaling is associated with uncontrolled cell proliferation, inhibition of apoptosis, stimulation of angiogenesis, tissue invasion, and metastasis.62 Interestingly, it has been observed that blocking the activity of AURKB and ErbB2 resulted in retarded tumor growth due to arrest of cells at G0/G1 phase and induction of apoptosis. Moreover, combinatorial silencing of these genes has been shown to have a synergistic effect on suppression of tumor growth.34 Our study further highlights the importance of silencing these genes in suppression of tumor growth.

Ethanol is a destabilizing agent that modulates the structural integrity of the lipid bilayer, which in turn increases the entrapment efficiency of the siRNA. However, it is important to use optimal amounts of ethanol as high percentage causes rapid aggregation of the liposomes.20 Ethanol has been successfully used to encapsulate siRNA into the lipidoid nanoparticles.47 Mixing the components in ethanol and slow removal facilitates more favorable interactions between lipids and siRNA molecules. Based on Triton X-100 solubilization, SEV prepared by ethanol dilution method, as in this study, showed efficient encapsulation. Both fluorescence and gel-based assays corroborate the encapsulation efficiency. Interestingly, mixing of cationic lipid and siRNA simultaneously did not cause formation of any heterogeneous particles as confirmed by their hydrodynamic radii. siRNA delivery by liposomes is achieved by either passive or active targeting. Active targeting involves incorporation of a targeting ligand into the liposomes. A large number of targeting ligands such as monoclonal antibodies, peptides, transferrin, folic acid, etc. were successfully tested.49,50 The choice of ligand depends on the prior information on the abundance of corresponding receptors on the cancer cells. Another way of delivering nanoparticles to target tissues is by adsorbing natural ligands present in the circulation to the nanoparticles after systemic administration. Conjugation of siRNA to cholesterol, bile fatty acids, and vitamin A has enabled delivery to the liver tissues via binding to serum components.51 Comprehensive studies on recently developed SNALP nanoparticles for liver targeted delivery of siRNA have shown that binding of LDL and HDL particles to SNALP molecules in the blood is responsible for uptake by liver parenchymal cells.52,53 Passive targeting does not involve targeting molecules and is also simpler in design. Avoiding the elimination pathways and relying on altered vasculature of the tumors achieve more targeting. The blood vessels in the tumor are irregular in shape, are dilated, and have defective basement membrane, and the endothelial cells are poorly aligned with large fenestrations. Also, the tumor tissues lack an effective lymphatic drainage system. This phenomenon, called enhanced permeability and retention effect, is responsible for uptake of major liposomal formulations that are currently used to treat various kinds of lymphomas.18,19 Serum stability of PEGylated and nonPEGylated liposomes was extensively studied earlier.10,54 From these studies it is apparent that the overall liposomal presentation, or lack of it, to the serum components critically depends on the size, net charge, surface coverage of the polymer chains, and polymer chain anchorage in the liposome. Size and neutral charge of SEV-5, as in this study, might explain their tumor tropic effect, but detailed study about presentation of PEG molecules on the surface of SEV-5, entrapping >80% siRNA, needs to be addressed to understand the specific advantage of our formulation. Dosage of the liposomes and dosage frequency are important in predisposing the complement system for elimination of liposomes. Recently various studies have reported an association of the components of complement systems such as C3b and immunoglobulins on the surface of PEGylated nanoparticles. However, it is still unclear whether such opsonins are associated with the PEG molecules or other components of the nanoparticles.55 Detailed studies by Judge et al. have demonstrated that multiple administration of plasmid containing liposomes reduced transgene expression drastically at the tumor level. The reduced expression was found to be due to the production of IgM and IgG

■

CONCLUSIONS Cationic amphiphile (DHDEAC) formulated with cholesterol using conventional methods mediates efficient siRNA delivery in vitro but not in vivo siRNA delivery. A method that entails inclusion of DSPE-PEG 2000 in the formulation using a modified ethanol dilution protocol, as opposed to conventional preparations, led to high entrapment of siRNA. Intravenous administration of SEV-5 at 5 mol % PEG in ovarian cancer xenograft mouse model confirmed the stability and nontoxic nature of the formulation. Importantly, delivery of therapeutic siRNA mediated by loaded SEV-5 led to significant tumor tropism and efficient gene silencing. Tumor suppression observed in this study is a consequence of simultaneous silencing of two genes, important in cell proliferation, and highlights the efficiency of DHDEAC-based SEV as siRNA carriers.

■

ASSOCIATED CONTENT

* Supporting Information S

Supplementary Figure 1: Transmission electron microscopy image of SEV-5. Supplementary Figure 2: In vivo biodistribution of dual-labeled SEV-5. Supplementary Figure 3: In vitro scratch assay of SK-OV-3 cells. This material is available free of charge via the Internet at http://pubs.acs.org. 618


Article


■

(15) Otsuka, H.; Nagasaki, Y.; Kataoka, K. PEGylated nanoparticles for biological and pharmaceutical applications. Adv. Drug Delivery Rev. 2003, 55, 403−19. (16) Iyer, A. K.; Khaled, G.; Fang, J.; Maeda, H. Exploiting the enhanced permeability and retention effect for tumor targeting. Drug Discovery Today 2006, 11, 812−8. (17) Lee, H.; Lytton-Jean, A. K.; Chen, Y.; Love, K. T.; Park, A. I.; Karagiannis, E. D.; et al. Molecularly self-assembled nucleic acid nanoparticles for targeted in vivo siRNA delivery. Nat. Nanotechnol. 2012, 7, 389−93. (18) Northfelt, D. W.; Martin, F. J.; Working, P.; Volberding, P. A.; Russell, J.; Newman, M.; et al. Doxorubicin encapsulated in liposomes containing surface-bound polyethylene glycol: pharmacokinetics, tumor localization, and safety in patients with AIDS-related Kaposi’s sarcoma. J. Clin. Pharmacol. 1996, 36, 55−63. (19) Muggia, F.; Hamilton, A. Phase III data on Caelyx in ovarian cancer. Eur. J. Cancer 2001, 37 (Suppl. 9), S15−8. (20) Buyens, K.; De Smedt, S. C.; Braeckmans, K.; Demeester, J.; Peeters, L.; van Grunsven, L. A.; et al. Liposome based systems for systemic siRNA delivery: stability in blood sets the requirements for optimal carrier design. J. Controlled Release 2012, 158, 362−70. (21) Yagi, N.; Manabe, I.; Tottori, T.; Ishihara, A.; Ogata, F.; Kim, J. H.; et al. A nanoparticle system specifically designed to deliver short interfering RNA inhibits tumor growth in vivo. Cancer Res. 2009, 69, 6531−8. (22) Maurer, N.; Wong, K. F.; Stark, H.; Louie, L.; McIntosh, D.; Wong, T.; et al. Spontaneous entrapment of polynucleotides upon electrostatic interaction with ethanol-destabilized cationic liposomes. Biophys. J. 2001, 80, 2310−26. (23) Jeffs, L. B.; Palmer, L. R.; Ambegia, E. G.; Giesbrecht, C.; Ewanick, S.; MacLachlan, I. A scalable, extrusion-free method for efficient liposomal encapsulation of plasmid DNA. Pharm. Res. 2005, 22, 362−72. (24) Banerjee, R.; Das, P. K.; Srilakshmi, G. V.; Chaudhuri, A.; Rao, N. M. Novel series of non-glycerol-based cationic transfection lipids for use in liposomal gene delivery. J. Med. Chem. 1999, 42, 4292−9. (25) Pasut, G.; Veronese, F. M. PEG conjugates in clinical development or use as anticancer agents: an overview. Adv. Drug Delivery Rev. 2009, 61, 1177−88. (26) Li, S. D.; Huang, L. Stealth nanoparticles: high density but sheddable PEG is a key for tumor targeting. J. Controlled Release 2010, 145, 178−81. (27) Semple, S. C.; Klimuk, S. K.; Harasym, T. O.; Dos Santos, N.; Ansell, S. M.; Wong, K. F.; et al. Efficient encapsulation of antisense oligonucleotides in lipid vesicles using ionizable aminolipids: formation of novel small multilamellar vesicle structures. Biochim. Biophys. Acta 2001, 1510, 152−66. (28) Lin, Q.; Chen, J.; Zhang, Z.; Zheng, G. Lipid-based nanoparticles in the systemic delivery of siRNA. Nanomedicine (London) 2014, 9, 105−20. (29) Akinc, A.; Zumbuehl, A.; Goldberg, M.; Leshchiner, E. S.; Busini, V.; Hossain, N.; et al. A combinatorial library of lipid-like materials for delivery of RNAi therapeutics. Nat. Biotechnol. 2008, 26, 561−9. (30) Morrissey, D. V.; Lockridge, J. A.; Shaw, L.; Blanchard, K.; Jensen, K.; Breen, W.; et al. Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs. Nat. Biotechnol. 2005, 23, 1002−7. (31) Kawa, S.; Matsushita, H.; Ohbayashi, H.; Semba, K.; Yamamoto, T. A novel mouse monoclonal antibody targeting ErbB2 suppresses breast cancer growth. Biochem. Biophys. Res. Commun. 2009, 384, 329− 33. (32) Baselga, J.; Swain, S. M. Novel anticancer targets: revisiting ERBB2 and discovering ERBB3. Nat. Rev. Cancer 2009, 9, 463−75. (33) Hynes, N. E.; Lane, H. A. ERBB receptors and cancer: the complexity of targeted inhibitors. Nat. Rev. Cancer 2005, 5, 341−54. (34) Addepalli, M. K.; Ray, K. B.; Kumar, B.; Ramnath, R. L.; Chile, S.; Rao, H. RNAi-mediated knockdown of AURKB and EGFR shows

AUTHOR INFORMATION

Corresponding Authors

*(V.J.) E-mail: [email protected]; [email protected]. Tel: 91-40-27192545; 91-40-27192504. Fax: 91-40-27160591. *(N.M.R.) E-mail: [email protected]. Tel: 91-40-27192545; 91-40-27192504. Fax: 91-40-27160591. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors gratefully acknowledge funding from CSIR Network Project BSC0112. G.H.D. is a recipient of CSIRSenior Research Fellowship. We thank Drs. Arabinda Chaudhuri, S. Ramakrishna, and S. Manorama of CSIR-IICT for synthesis of the lipid, zetasize/potential, and TEM measurements, respectively. We also thank Dr. Mahesh, Nandini Rangaraj, and Avinash for help with nude mice, confocal microscopy, and cryosectioning, respectively. We are grateful to Dr. S. Ramakrishna, IICT, for help with the liver toxicity studies.

■

REFERENCES

(1) Dykxhoorn, D. M.; Lieberman, J. Knocking down disease with siRNAs. Cell 2006, 126, 231−5. (2) Davis, M. E. The first targeted delivery of siRNA in humans via a self-assembling, cyclodextrin polymer-based nanoparticle: from concept to clinic. Mol. Pharmaceutics 2009, 6, 659−68. (3) Ziraksaz, Z.; Nomani, A.; Soleimani, M.; Bakhshandeh, B.; Arefian, E.; Haririan, I.; et al. Evaluation of cationic dendrimer and lipid as transfection reagents of short RNAs for stem cell modification. Int. J. Pharm. 2013, 448, 231−8. (4) McNamara, J. O., 2nd; Andrechek, E. R.; Wang, Y.; Viles, K. D.; Rempel, R. E.; Gilboa, E.; et al. Cell type-specific delivery of siRNAs with aptamer-siRNA chimeras. Nat. Biotechnol. 2006, 24, 1005−15. (5) Yao, Y. D.; Sun, T. M.; Huang, S. Y.; Dou, S.; Lin, L.; Chen, J. N.; et al. Targeted delivery of PLK1-siRNA by ScFv suppresses Her2+ breast cancer growth and metastasis. Sci. Transl. Med. 2012, 4, 130ra48. (6) Goldberg, M. S.; Xing, D.; Ren, Y.; Orsulic, S.; Bhatia, S. N.; Sharp, P. A. Nanoparticle-mediated delivery of siRNA targeting Parp1 extends survival of mice bearing tumors derived from Brca1-deficient ovarian cancer cells. Proc. Natl. Acad. Sci. U.S.A. 2011, 108, 745−50. (7) Han, S. E.; Kang, H.; Shim, G. Y.; Suh, M. S.; Kim, S. J.; Kim, J. S.; et al. Novel cationic cholesterol derivative-based liposomes for serum-enhanced delivery of siRNA. Int. J. Pharm. 2008, 353, 260−9. (8) Lu, J. J.; Langer, R.; Chen, J. A novel mechanism is involved in cationic lipid-mediated functional siRNA delivery. Mol. Pharmaceutics 2009, 6, 763−71. (9) Nabel, E. G.; Gordon, D.; Yang, Z. Y.; Xu, L.; San, H.; Plautz, G. E.; et al. Gene transfer in vivo with DNA-liposome complexes: lack of autoimmunity and gonadal localization. Hum. Gene Ther. 1992, 3, 649−56. (10) Torchilin, V. P. Recent advances with liposomes as pharmaceutical carriers. Nat. Rev. Drug Discovery 2005, 4, 145−60. (11) Balazs, D. A.; Godbey, W. Liposomes for use in gene delivery. J. Drug Delivery 2011, 2011, 326497. (12) Hafez, I. M.; Maurer, N.; Cullis, P. R. On the mechanism whereby cationic lipids promote intracellular delivery of polynucleic acids. Gene Ther. 2001, 8, 1188−96. (13) Alexis, F.; Pridgen, E.; Molnar, L. K.; Farokhzad, O. C. Factors affecting the clearance and biodistribution of polymeric nanoparticles. Mol. Pharmaceutics 2008, 5, 505−15. (14) Ryan, S. M.; Mantovani, G.; Wang, X.; Haddleton, D. M.; Brayden, D. J. Advances in PEGylation of important biotech molecules: delivery aspects. Expert Opin. Drug Delivery 2008, 5, 371−83. 619


Article

Molecular Pharmaceutics enhanced therapeutic efficacy in prostate tumor regression. Gene Ther. 2010, 17, 352−9. (35) Schmidt-Wolf, G. D.; Schmidt-Wolf, I. G. Non-viral and hybrid vectors in human gene therapy: an update. Trends Mol. Med. 2003, 9, 67−72. (36) Gjetting, T.; Arildsen, N. S.; Christensen, C. L.; Poulsen, T. T.; Roth, J. A.; Handlos, V. N.; et al. In vitro and in vivo effects of polyethylene glycol (PEG)-modified lipid in DOTAP/cholesterolmediated gene transfection. Int. J. Nanomed. 2010, 5, 371−83. (37) Madry, H.; Reszka, R.; Bohlender, J.; Wagner, J. Efficacy of cationic liposome-mediated gene transfer to mesangial cells in vitro and in vivo. J. Mol. Med. (Berlin) 2001, 79, 184−9. (38) Dokka, S.; Toledo, D.; Shi, X.; Castranova, V.; Rojanasakul, Y. Oxygen radical-mediated pulmonary toxicity induced by some cationic liposomes. Pharm. Res. 2000, 17, 521−5. (39) Bennett, M. J.; Nantz, M. H.; Balasubramaniam, R. P.; Gruenert, D. C.; Malone, R. W. Cholesterol enhances cationic liposomemediated DNA transfection of human respiratory epithelial cells. Biosci. Rep. 1995, 15, 47−53. (40) Zelphati, O.; Uyechi, L. S.; Barron, L. G.; Szoka, F. C., Jr. Effect of serum components on the physico-chemical properties of cationic lipid/oligonucleotide complexes and on their interactions with cells. Biochim. Biophys. Acta 1998, 1390, 119−33. (41) Felber, A. E.; Bayo-Puxan, N.; Deleavey, G. F.; Castagner, B.; Damha, M. J.; Leroux, J. C. The interactions of amphiphilic antisense oligonucleotides with serum proteins and their effects on in vitro silencing activity. Biomaterials 2012, 33 (25), 5955−65. (42) Simberg, D.; Weisman, S.; Talmon, Y.; Faerman, A.; Shoshani, T.; Barenholz, Y. The role of organ vascularization and lipoplex-serum initial contact in intravenous murine lipofection. J. Biol. Chem. 2003, 278, 39858−65. (43) Yu, B.; Hsu, S. H.; Zhou, C.; Wang, X.; Terp, M. C.; Wu, Y.; et al. Lipid nanoparticles for hepatic delivery of small interfering RNA. Biomaterials 2012, 33, 5924−34. (44) Romberg, B.; Hennink, W. E.; Storm, G. Sheddable coatings for long-circulating nanoparticles. Pharm. Res. 2008, 25, 55−71. (45) Tam, Y. Y.; Chen, S.; Cullis, P. R. Advances in Lipid Nanoparticles for siRNA Delivery. Pharmaceutics 2013, 5, 498−507. (46) Gref, R.; Luck, M.; Quellec, P.; Marchand, M.; Dellacherie, E.; Harnisch, S.; et al. ’Stealth’ corona-core nanoparticles surface modified by polyethylene glycol (PEG): influences of the corona (PEG chain length and surface density) and of the core composition on phagocytic uptake and plasma protein adsorption. Colloids Surf., B 2000, 18, 301− 313. (47) Akinc, A.; Goldberg, M.; Qin, J.; Dorkin, J. R.; Gamba-Vitalo, C.; Maier, M.; et al. Development of lipidoid-siRNA formulations for systemic delivery to the liver. Mol. Ther. 2009, 17, 872−9. (48) Stuart, D. D.; Kao, G. Y.; Allen, T. M. A novel, long-circulating, and functional liposomal formulation of antisense oligodeoxynucleotides targeted against MDR1. Cancer Gene Ther. 2000, 7, 466−75. (49) Cardoso, A. L.; Simoes, S.; de Almeida, L. P.; Pelisek, J.; Culmsee, C.; Wagner, E.; et al. siRNA delivery by a transferrinassociated lipid-based vector: a non-viral strategy to mediate gene silencing. J. Gene Med. 2007, 9, 170−83. (50) Low, P. S.; Antony, A. C. Folate receptor-targeted drugs for cancer and inflammatory diseases. Adv. Drug Delivery Rev. 2004, 56, 1055−8. (51) Zimmermann, T. S.; Lee, A. C.; Akinc, A.; Bramlage, B.; Bumcrot, D.; Fedoruk, M. N.; et al. RNAi-mediated gene silencing in non-human primates. Nature 2006, 441, 111−4. (52) Semple, S. C.; Akinc, A.; Chen, J.; Sandhu, A. P.; Mui, B. L.; Cho, C. K.; et al. Rational design of cationic lipids for siRNA delivery. Nat. Biotechnol. 2010, 28, 172−6. (53) Wolfrum, C.; Shi, S.; Jayaprakash, K. N.; Jayaraman, M.; Wang, G.; Pandey, R. K.; et al. Mechanisms and optimization of in vivo delivery of lipophilic siRNAs. Nat. Biotechnol. 2007, 25, 1149−57. (54) Patel, H. M.; Moghimi, S. M. Serum-mediated recognition of liposomes by phagocytic cells of the reticuloendothelial system - The concept of tissue specificity. Adv. Drug Delivery Rev. 1998, 32, 45−60.

(55) Moghimi, S. M.; Szebeni, J. Stealth liposomes and long circulating nanoparticles: critical issues in pharmacokinetics, opsonization and protein-binding properties. Prog. Lipid Res. 2003, 42, 463−78. (56) Judge, A.; McClintock, K.; Phelps, J. R.; Maclachlan, I. Hypersensitivity and loss of disease site targeting caused by antibody responses to PEGylated liposomes. Mol. Ther. 2006, 13, 328−37. (57) Tagami, T.; Nakamura, K.; Shimizu, T.; Ishida, T.; Kiwada, H. Effect of siRNA in PEG-coated siRNA-lipoplex on anti-PEG IgM production. J. Controlled Release 2009, 137, 234−40. (58) Price, M. E.; Cornelius, R. M.; Brash, J. L. Protein adsorption to polyethylene glycol modified liposomes from fibrinogen solution and from plasma. Biochim. Biophys. Acta 2001, 1512, 191−205. (59) Liu, D.; Hu, Q.; Song, Y. K. Liposome clearance from blood: different animal species have different mechanisms. Biochim. Biophys. Acta 1995, 1240, 277−84. (60) Love, K. T.; Mahon, K. P.; Levins, C. G.; Whitehead, K. A.; Querbes, W.; Dorkin, J. R.; et al. Lipid-like materials for low-dose, in vivo gene silencing. Proc. Natl. Acad. Sci. U.S.A. 2010, 107, 1864−9. (61) Keen, N.; Taylor, S. Aurora-kinase inhibitors as anticancer agents. Nat. Rev. Cancer 2004, 4, 927−36. (62) Faltus, T.; Yuan, J.; Zimmer, B.; Kramer, A.; Loibl, S.; Kaufmann, M.; et al. Silencing of the HER2/neu gene by siRNA inhibits proliferation and induces apoptosis in HER2/neu-overexpressing breast cancer cells. Neoplasia 2004, 6, 786−95.

620
