The Journal of Immunology
T Cell Repertoire Diversity Is Required for Relapses in Myelin Oligodendrocyte Glycoprotein-Induced Experimental Autoimmune Encephalomyelitis1 Nicolas Fazilleau,2,3* Ce´cile Delarasse,2† Iris Motta,† Simon Fillatreau,‡ Marie-Lise Gougeon,§ Philippe Kourilsky,*§ Danielle Pham-Dinh,¶ and Jean M. Kanellopoulos4† Comparison of TCR␣ repertoires of myelin oligodendrocyte glycoprotein (MOG)-specific T lymphocytes in C57BL/6 and TdTdeficient littermates (TdTⴚ/ⴚ) generated during experimental autoimmune encephalomyelitis (EAE) highlights a link between a diversified TCR␣ repertoire and EAE relapses. At the onset of the disease, the EAE-severity is identical in TdTⴙ/ⴚ and TdTⴚ/ⴚ mice and the neuropathologic public MOG-specific T cell repertoires express closely similar public V␣-J␣ and V-J rearrangements in both strains. However, whereas TdTⴙ/ⴙ and TdTⴙ/ⴚ mice undergo successive EAE relapses, TdTⴚ/ⴚ mice recover definitively and the lack of relapses does not stem from dominant regulatory mechanisms. During the first relapse of the disease in TdTⴙ/ⴚ mice, new public V␣-J␣ and V-J rearrangements emerge that are distinct from those detected at the onset of the disease. Most of these rearrangements contain N additions and are found in CNS-infiltrating T lymphocytes. Furthermore, CD4ⴙ T splenocytes bearing these rearrangements proliferate to the immunodominant epitope of MOG and not to other immunodominant epitopes of proteolipid protein and myelin basic protein autoantigens, excluding epitope spreading to these myelin proteins. Thus, in addition to epitope spreading, a novel mechanism involving TCR␣ repertoire diversification contributes to autoimmune progression. The Journal of Immunology, 2007, 178: 4865– 4875.
E
ncephalitogenic T cells play a major role in the development of autoimmune diseases including multiple sclerosis and its animal model, experimental autoimmune encephalomyelitis (EAE)5 (1). EAE is a disease of the CNS mediated by IL17-producing effector CD4⫹ T lymphocytes that acquire the Th17 phenotype in the presence of TGF- and IL-6 (reviewed in Ref. 2). EAE can be induced in genetically susceptible animals by immunization with myelin proteins such as the myelin basic protein (MBP) (3), the proteolipid protein (PLP) (4), or the myelin oligodendrocyte
*Institut National de la Sante´ et de la Recherche Me´dicale, Unite´ 277, Institut Pasteur, Paris, France; †University of Paris Sud, Institut de Biochimie et Biophysique Mole´culaire et Cellulaire, Unite´ Mixte de Recherche 8619, Centre National de la Recherche Scientifique, Orsay, France; ‡Immune Regulation Group, Deutsches RheumaForschungszentrum, Berlin, Germany; §Antiviral Immunity, Biotherapy and Vaccine Unit, Institut Pasteur, Paris, France; and ¶Unite´ Mixte de Recherche 546, Institut National de la Sante´ et de la Recherche Me´dicale, Paris, France Received for publication November 23, 2005. Accepted for publication February 1, 2007. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by grants from the Institut National de la Sante´ et de la Recherche Me´dicale, Centre National de la Recherche Scientifique, the Pasteur Institute, l’Association de Recherche contre le Cancer (to N.F. and J.M.K.), PasteurWeizmann (to N.F.), Association de Recherche sur la Scle´rose en Plaques (to C.D., D.P.-D., and J.M.K.), the European Leukodystrophy Association (to D.P.-D.), and European grant for AUTOROME STREP (to M.-L.G.). 2
N.F. and C.D. have contributed equally to this work.
3
Current address: Institute for Childhood and Neglected Diseases-120, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. 4 Address correspondence and reprint requests to Dr. Jean M. Kanellopoulos, Unite´ Mixte de Recherche, 8619 Centre National de la Recherche Scientifique, Universite´ Paris 11, Orsay, France. E-mail address:
[email protected] 5 Abbreviations used in this paper: EAE, experimental autoimmune encephalomyelitis; ID, immunodominant; LNC, lymph node cell; MBP, myelin basic protein; MOG, myelin oligodendrocyte glycoprotein; PLP, proteolipid protein; PPD, purified protein derivative; SD, subdominant; wt, wild type; SI, stimulation index.
Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 www.jimmunol.org
glycoprotein (MOG) (5). Notably, MOG is the only CNS myelin autoantigen known to initiate both a demyelinating autoantibody response and an encephalitogenic T cell response in EAE. Using MOGdeficient C57BL/6 mice, it was recently shown that MOG, albeit a very minor CNS myelin protein, is a major self-Ag target (6). Numerous studies have shown that epitope spreading is involved in the disease progression of T cell-mediated chronic autoimmune diseases (7). In (SJL ⫻ B10.PL)F1 mice immunized only with the immunodominant (ID) peptide of MBP and suffering from chronic EAE, determinant spreading to three subdominant (SD) peptides of MBP occurred (8). Immunization of SJL mice with the ID epitope of PLP also induced relapsing EAE. Although CD4⫹ T cells specific for the ID epitope of PLP persisted through the disease, T cells recognizing MBP and SD PLP epitopes emerged sequentially during the relapses (9, 10). Furthermore, tolerization with these epitopes decreased the incidence of relapses, suggesting that the spreading of the immune response to intramolecular and intermolecular determinants was required for the disease progression (9 –11). Epitope spreading seems to be a general mechanism aggravating autoimmune diseases, because it participates in the pathogenesis of autoimmune diabetes in NOD mice (12, 13). However, epitope spreading is not an absolute requirement for EAE relapses (14, 15). Indeed, in Biozzi ABH mice MOG-induced EAE relapses were not abolished by tolerization with the well-defined spreading epitopes such as PLP 56 –70 and MBP 12–26. In contrast, tolerization after the first peak of the disease with the initiating MOG epitope resulted in protection from relapses (16). Unraveling the mechanism(s) involved in EAE relapses, other than epitope spreading, should be of high interest for understanding autoimmune pathology. Whether or not a diminished repertoire affects EAE onset and EAE relapses is presently unknown. A diverse repertoire of heterodimeric ␣ TCRs for Ag is produced by the somatic recombination of separate DNA segments, V and J for the
4866
EAE-RELAPSES AS A CONSEQUENCE OF TCR␣ DIVERSITY
FIGURE 1. Encephalomyelitis in TdT-deficient mice. C57BL/6 TdT⫹/⫺ and TdT⫺/⫺ littermates (eight per group) were immunized with either the rMOG protein (A) or the MOG 35–55 peptide (B). Results from one representative experiment of two are shown for A and one of 10 for B. The same experiment was performed on TdT⫹/⫹ littermates and the results are similar to those observed with TdT⫹/⫺ mice (data not shown).
␣-chain and V, D, and J for the -chain, that yields the CDR3 of the TCR (17). During this process, TdT catalyzes the addition of template-independent nucleotides at the coding ends of V, (D), and J gene segments (18, 19). The repertoire of TdT-deficient mice (TdT⫺/⫺) is characterized by shorter CDR3s (20), and the ␣ TCR diversity is diminished by a factor of 10 –20 with no compensatory mechanism counterbalancing this decrease (21). Nonetheless, TdT⫺/⫺ mice are not immunodeficient (22) and respond to viruses and protein Ags (22, 23). Moreover, epitope immunodominance is unaltered in TdT⫺/⫺ animals (22). To delineate the potential role of TCR diversity in autoimmune diseases, we compared the T cell repertoires of C57BL/6 TdT⫹/⫹ and TdT⫺/⫺ littermates in the MOG-induced EAE model for several reasons: 1) this Th17-mediated disease is reproducible in C57BL/6 mice (2, 6, 24); 2) the autoantigen is well-defined compared with those involved in autoimmune-prone animals; 3) there is one ID peptide in C57BL/6 mice (MOG 35–55); and 4) a single MHC class II molecule, I-Ab, presents MOG 35–55. We have previously established that MOG 35–55-specific T lymphocytes express public rearrangements (25), i.e., common to all mice of the same MHC haplotype (26). These rearrangements, V␣9-J␣23, V␣9-J␣31, and V8.2-J2.1, have characteristic CDR3␣ and CDR3 sequences and are found in CNS-infiltrating cells during the disease and in MOG-stimulated lymph nodes cells (LNC) (25). In the CNS, these public MOG-specific T cells have an inflammatory phenotype, i.e., secreting IFN-␥ and TNF-␣ (25). In this work, we show that TdT⫺/⫺ and wild-type (wt) mice reproducibly develop EAE after immunization with the recombinant MOG protein or MOG 35–55 peptide. However, whereas TdT⫺/⫺ animals recover definitively after the first peak of EAE, TdT⫹ littermates undergo successive EAE relapses. The lack of EAE relapses in TdT⫺/⫺ is not due to regulatory mechanisms peculiar to this strain. T cell repertoire analyses at the onset of the disease show that the V repertoire of MOG-specific T lymphocytes in TdT⫺/⫺ mice is identical with its wt counterpart while V␣ rearrangements are closely similar. Interestingly, in the first EAE relapse the public V␣ and V rearrangements identified at the first
FIGURE 2. Encephalomyelitis in TdT-deficient mice previously injected with CD4⫹ T splenocytes from TdT⫹/⫹ and TdT⫺/⫺ mice. A and B, CD4⫹ T splenocytes from naive C57BL/6 CD45.1 animals were isolated as described in Materials and Methods. CD4⫹ CD45.1 T splenocytes (15 ⫻ 106) were injected i.v. in nonirradiated TdT⫺/⫺ CD45.2 recipient mice, EAE was induced in eight mice 14 days later, and the severity of the disease was monitored daily (A). Forty-five days after the induction of EAE, CNS-infiltrating cells were isolated by a Percoll gradient and analyzed by FACS. Shown is a histogram of CD45.1 staining of CD4-positive T cells for one representative mouse of five (B). C, CD4⫹ T splenocytes from TdT⫹/⫹ and TdT⫺/⫺ mice animals were isolated as described in Materials and Methods. CD4⫹ T splenocytes (15 ⫻ 106) were injected i.v. into nonirradiated TdT⫺/⫺ mice, EAE was induced in eight mice 14 days later, and the severity of the disease was monitored daily.
peak of the disease disappear in wt mice and new public MOGspecific V␣ and V rearrangements, the majority of which containing N additions, emerge. Thus, in the absence of obvious epitope spreading, MOG EAE relapse is linked to the highly diversified T cell repertoire of wt mice and results from the emergence of MOG-specific T cells bearing novel TCR rearrangements.
Materials and Methods Mice All mice used in this study were 8 wk old and were obtained from Pasteur Institute (Paris, France) housing facilities. Mice were housed under conventional conditions. TdT⫹/⫹, TdT⫹/⫺, and TdT⫺/⫺ littermates were used in EAE and immunological experiments. Mice were used in accordance to the Pasteur Institute’s guidelines.
The Journal of Immunology
4867
FIGURE 3. Encephalomyelitis in TdT⫹/⫺ and TdT⫺/⫺ mice after adoptive transfer. EAE was induced in both TdT⫹/⫺ and TdT⫺/⫺ littermates. Total splenocytes of some of these animals were recovered 30 days after the induction of EAE. These cells were depleted of CD11c⫹ and B220⫹ cells. Then, 15 ⫻ 106 B220⫺ CD11c⫺ splenocytes were injected in nonirradiated animals suffering form EAE (day 30). The mean of three different experiments (at least five mice per group) is presented.
Peptide and protein The MOG 35–55 (MEVGWYRSPFSRVVHLYRNGK), PLP 178 –191 (N TWTTCQSIAFPSK) (27), and MBP 54 –72 (SHHAARTTHYGSLPQKS QR) (28) are ID peptides in C57BL/6 mice. The MOG 113–127 (LKVE DPFYWVSPGVL), MOG 120 –134 (YWVSPGVLTLIALVP), MOG 183– 197 (FVIVPVLGPLVALII) have been described as potential SD peptides of MOG (6). All peptides were produced by NEOSYSTEM. Their purity was tested by HPLC. Murine recombinant MOG 1–116 was prepared as described in (6).
Induction and assessment of EAE TdT⫹/⫹, TdT⫹/⫺, and TdT⫺/⫺ littermates were immunized subcutaneously with 200 g of rMOG 1–118 or 100 g of murine MOG 35–55 in CFA containing 600 g of Mycobacterium tuberculosis H37RA (Difco Laboratories) according to a previously described protocol (6). For EAE induction, animals received additional i.v. injections of 200 ng of pertussis toxin (List Biological Laboratories) on days 0 and 2. Disease severity was monitored daily according to the following scale: 0, no disease; 1, flaccid tail; 2, hind limb weakness; 3, hind limb paralysis; 4, forelimb weakness; and 5, moribund.
Immunization and cell cultures Mice were immunized in the hind footpads with 10 nmol of MOG 35–55 peptide in CFA. Nine days later, LNC were cultured at 5 ⫻ 105 cells per well with different concentrations of the MOG 35–55 peptide for 4 days. All cultures were done in HL-1 medium (Cambrex) supplemented with glutamine (2 mM). The cultures were then pulsed with 1 Ci of [3H]thymidine (ICN Biomedicals) for the last 18 h of the 4-day culture.
Isolation of CNS-infiltrating cells Preparation of CNS-derived lymphocytes was performed using Percoll separation. Briefly, murine CNS was dissected out and homogenized in 4.5 ml of RPMI 1640 medium (Invitrogen Life Technologies) with collagenase at 400 U/ml and DNase at 100 U/ml (both from Sigma-Aldrich) for 45 min at 37°C and 5% CO2. The CNS homogenate was washed with RPMI 1640 and centrifuged in a 40 – 80% Percoll gradient. Lymphocytes were isolated and washed three times with RPMI 1640.
CFSE labeling, cell transfer, Abs, and cell sorting EAE-induced TdT⫹/⫹ mice were sacrificed 45 days after EAE induction and cells were collected from the CNS and the spleen. The splenocytes were labeled with 5 M CFSE. Cells were washed with ice-cold PBS and their proliferation was tested as described above using the MOG 35–55 peptide, another peptide of MOG, or the ID peptide of MBP or PLP. Using a FITC-CD4 mAb from BD Pharmingen, stimulated CFSElow CD4⫹ splenocytes were then sorted out on a FACStarPlus (BD Biosciences) at the flow cytometry unit of the Pasteur Institute. Cell purity after sorting was analyzed by flow cytometry and was ⬎96% in all samples. CD4⫹ T cell splenocytes from naive TdT⫹/⫹ CD45.1 mice were isolated using beads from Miltenyi Biotec. CD4⫹CD45.1⫹ T cells (15 ⫻ 106) were injected i.v. into nonirradiated TdT⫺/⫺ CD45.2 recipient mice. Fourteen
FIGURE 4. CDR3 size distribution among MOG 35–55-stimulated LNC and CNS-infiltrating T cells during EAE in TdT-deficient mice. A, TdT⫺/⫺ and wt mice were immunized in the hind footpads with 10 nmol of MOG 35–55 peptide in CFA. Nine days later, LNC were cultured with increasing concentrations (M) of peptide or with 10 g/ml PPD for 4 days. The cultures were then pulsed with 1 Ci of [3H]thymidine for the last 8 h. Data represent the mean of proliferative responses for five C57BL/6 mice and five TdT⫺/⫺ mice. SI Stimulation index (SI ⫽ [3H]thymidine cpm incorporated in lymphocytes stimulated by MOG or PPD/ [3H]thymidine cpm incorporated in unstimulated cells). B–D, TdT⫺/⫺ mice were immunized in the hind footpads with 10 nmol of MOG 35–55 peptide in CFA. Nine days later, LNC were cultured with either 30 M peptide or 20 g/ml PPD for 4 days. In addition, EAE was induced in TdT⫺/⫺ mice with MOG 35–55 peptide in CFA and pertussis toxin. Fifteen days later, mice were killed and CNS-infiltrating cells were recovered by a Percoll gradient as described in Materials and Methods. cDNA from MOG stimulated-LNC (B), PPD-recalled LNC (C), and CNS-infiltrating cells (D) was subjected to immunoscope analyses. Data represent CDR3␣ and  size distributions for two representative TdT⫺/⫺ mice. Rearrangements shown are V8.2-J2.1 and V␣9-C␣.
days later, EAE was induced using MOG 35–55 peptide as described above. Mice were sacrificed 45 days later and cells were collected from the CNS and the spleen. FACS analyses of CNS-infiltrating cells were performed using FITC-CD45.1 and PE-CD4 mAbs from BD Pharmingen. Splenocytes were labeled with 5 M CFSE and their proliferation was tested as described above.
Immunoscope analysis, cloning, and sequencing Total RNA from splenocytes, LNC, or CNS-infiltrating cells was extracted using an RNeasy mini kit from Qiagen and reverse transcribed into cDNA using oligo(dT) and SuperScript II (Invitrogen Life Technologies). Immunoscope analyses were performed as described elsewhere (29). Sequencing of CDR3 sequences was done using a TOPO Blunt cloning kit (Invitrogen Life Technologies). Briefly, a PCR amplification was performed on cloned bacteria followed by a second step of elongation using an ABI PRISM BigDye Terminator kit (Applied Biosystems). Reaction mixtures were then analyzed on a 48-capillary 3730 DNA Analyzer (Applied Biosystems).
EAE-RELAPSES AS A CONSEQUENCE OF TCR␣ DIVERSITY
4868
Table I. CDR3 sequences from MOG 35–55-specific T LNC (1–5) and from CNS-infiltrating cells during EAE (6 –10) in TdT⫺/⫺ mice (V8.2J2.1 rearrangement) CDR3 Length
3⬘ V End
P/D
5⬘ J Beginning
Deduced Amino Acid Sequences a
LNC 1
8 10
tgtgccagcggtg tgtgccagcggtga
ggactgggg gactgggggg
atgctgagcagttcttcgga aactatgctgagcagttcttcgga
GGTGDAEQ GETGGNYAEQ
LNC 2
8 10 10
tgtgccagcggtgatg tgtgccagcggtgatg tgtgccagcggtga
cagggg caggactgggg gactgggggg
atgctgagcagttcttcgga tatgctgagcagttcttcgga aactatgctgagcagttcttcgga
GDAGDAEQ GDAGLGYAEQ GETGGNYAEQ
LNC 3
8 8 10 10
tgtgccagcg tgtgccagcggtgatg tgtgccagcggtgatg tgtgccagcggtga
ccgggactgggg ctgggg cactggggg gactgggggg
atgctgagcagttcttcgga atgctgagcagttcttcgga actatgctgagcagttcttcgga aactatgctgagcagttcttcgga
AGTGDAEQ GDAGDAEQ GDALGDYAEQ GETGGNYAEQ
LNC 4
8 10 10
tgtgccagcg tgtgccagcggtga tgtgccagcggtgatg
ccgggactgggg gactgggggg cactggggggg
atgctgagcagttcttcgga aactatgctgagcagttcttcgga tatgctgagcagttcttcgga
AGTGDAEQ GETGGNYAEQ GDALGGYAEQ
LNC 5
8 10
tgtgccagcggtg tgtgccagcggtga
ggactgggg gactgggggg
atgctgagcagttcttcgga aactatgctgagcagttcttcgga
GGTGDAEQ GETGGNYAEQ
CNS 6
8 10
tgtgccagcggtg tgtgccagcggtga
ggacagggg gactgggggg
atgctgagcagttcttcgga aactatgctgagcagttcttcgga
GGTGDAEQ GETGGNYAEQ
CNS 7
8 10 10
tgtgccagcggtgatg tgtgccagcggtga tgtgccagcggtgatg
ctgggg gactgggggg cactggat
atgctgagcagttcttcgga aactatgctgagcagttcttcgga aactatgctgagcagttcttcgga
GDAGDAEQ GETGGNYAEQ GDALDNYAEQ
CNS 8
8 8 10
tgtgccagcg tgtgccagcggt tgtgccagcggtga
ccgggactgggg ggacagggg gactgggggg
atgctgagcagttcttcgga atgctgagcagttcttcgga aactatgctgagcagttcttcgga
AGTGDAEQ GGTGDAEQ GETGGNYAEQ
CNS 9
8 10
tgtgccagcg tgtgccagcggtga
ccgggactgggg gactgggggg
atgctgagcagttcttcgga aactatgctgagcagttcttcgga
AGTGDAEQ GETGGNYAEQ
CNS 10
10 10
tgtgccagcggtga tgtgccagcggtgatg
gactgggggg cactggggg
aactatgctgagcagttcttcgga actatgctgagcagttcttcgga
GETGGNYAEQ GDALGDYAEQ
a Boldface letters indicate the 10-aa-long GETGGNYAEQ CDR3 sequence that is found in all TdT⫺/⫺ animals, in agreement with the public CDR3 previously identified in C57BL/6 mice.
Results EAE relapses occur in wt mice only We have induced EAE in TdT⫺/⫺, TdT⫹/⫺, and TdT⫹/⫹ littermates by immunization with rMOG or the MOG ID peptide 35–55. Approximately 85% of the animals developed EAE in 17 days following immunization (88.3% of incidence and mean day onset of 17.12 ⫾ 2.27 in wt mice, 86.95% of incidence and mean day onset of 17.34 ⫾ 1.76 in TdT⫺/⫺ mice). We established a mean maximal clinical score of 3.21 ⫾ 1.01 and 3.36 ⫾ 1.15 in wt and TdT⫺/⫺ animals, respectively. Importantly, whereas all mice suffered from EAE, relapses occurred only in TdT⫹/⫺ (Fig. 1) and TdT⫹/⫹ animals (data not shown). Similar EAE-profiles have been obtained twice with rMOG (Fig. 1A) and 10 times with MOG 35–55 (Fig. 1B). Relapses never occurred in TdT⫺/⫺ mice. Absence of EAE relapses is not due to regulatory mechanisms specific of the TdT⫺/⫺ strain The lack of relapse in TdT⫺/⫺ animals may be due to dominant regulatory mechanisms such as regulatory T cells. Alternatively, it could reflect holes in the T cell repertoires of TdT⫺/⫺ mice. To determine whether dominant regulatory mechanisms prevent relapse in TdT⫺/⫺ mice, we transferred CD4⫹ T lymphocytes from naive C57BL/6 animals bearing CD45.1 as a marker for grafted cells into TdT⫺/⫺ mice. After 2 wk, EAE was induced in these animals. As shown in Fig. 2, all mice developed the disease and
presented a relapse. At the peak of the relapse, five animals were sacrificed and CNS-infiltrating cells were analyzed by flow cytometry. The vast majority of CNS-infiltrating CD4⫹ cells bear CD45.1 (mean of 80.71 ⫾ 3.14%), indicating that they are of donor origin (Fig. 2). Therefore, the lack of relapse in TdT⫺/⫺ mice is recessive and can be complemented by the transfer of wt CD4⫹ T cells. However, one could argue that regulatory T cells need to be amplified in TdT⫺/⫺ mice during the course of the disease to inhibit the relapses. Thus, we collected the splenocytes from TdT⫹/⫹, TdT⫹/⫺, and TdT⫺/⫺ littermates 30 days after the induction of EAE. B220⫹ and CD11c⫹ cells were eliminated and the remaining cells were injected in nonirradiated TdT⫹/⫹, TdT⫹/⫺, and TdT⫺/⫺ animals suffering from EAE (day 30). The cells from TdT⫺/⫺ mice did not inhibit the relapses in either TdT⫹/⫹ and TdT⫹/⫺ animals (Fig. 3). In summary, the absence of EAE relapses cannot be attributed to T cell-mediated regulatory mechanisms specific to the TdT⫺/⫺ strain. We thus investigated whether relapses were due to the diminished T cell repertoire of TdT⫺/⫺ animals. T cell repertoires against the ID peptide of the murine MOG in TdT⫺/⫺ mice LNC derived from rMOG or MOG 35–55-immunized TdT⫺/⫺, TdT⫹/⫺ and TdT⫹/⫹ littermates proliferated equally well upon
The Journal of Immunology
4869
Table II. CDR3␣ sequences from MOG 35–55-specific T LNC (1–5) and CNS-infiltrating lymphocytes during EAE (6 –10) in TdT⫺/⫺ animals
LNC 1
V␣
J␣
3⬘ V␣ End
P
9 9 9 9
23 23 31 31
tgtgctgtgagcg tgtgctgtgagcg tgtgctgtgagc tgtgctgtgagcg
c
9 9 9
23 23 31
tgtgctgtgagc tgtgctgtgagcg tgtgctgtgagc
9 9 9
23 31 31
9 9
5⬘ J␣ Beginning
Deduced Amino Acid Sequencesa
c c
ttataaccaggggaagcttatctttgga attataaccaggggaagcttatctttgga ggaatagcaataacagaatcttctttggt gaatagcaataacagaatcttctttggt
SAYNQGKL SDYNQGKL SRNSNNRI SANSNNRI
c
aattataaccaggggaagcttatctttgga attataaccaggggaagcttatctttgga ggaatagcaataacagaatcttctttggt
SNYNQGKL SDYNQGKL SRNSNNRI
tgtgctgtgagc tgtgctgtgagcg tgtgctgtgagcg
c
aattataaccaggggaagcttatctttgga ggaatagcaataacagaatcttctttggt gaatagcaataacagaatcttctttggt
SNYNQGKL SGNSNNRI SANSNNRI
23 23
tgtgctgtgag tgtgctgtgagcg
c
gaattataaccaggggaagcttatctttgga ttataaccaggggaagcttatctttgga
RNYNQGKL SAYNQGKL
9 9 9
23 23 31
tgtgctgtgagc tgtgctgtgagcg tgtgctgtgagc
c
aattataaccaggggaagcttatctttgga attataaccaggggaagcttatctttgga ggaatagcaataacagaatcttctttggt
SNYNQGKL SDYNQGKL SRNSNNRI
CNS 6
9 9
23 23
tgtgctgtgagc tgtgctgtgag
aattataaccaggggaagcttatctttgga gaattataaccaggggaagcttatctttgga
SNYNQGKL RNYNQGKL
CNS 7
9 9
23 31
tgtgctgtgagcg tgtgctgtgagcg
ttataaccaggggaagcttatctttgga ggaatagcaataacagaatcttctttggt
SAYNQGKL SGNSNNRI
CNS 8
9
23
tgtgctgtgagc
aattataaccaggggaagcttatctttgga
SNYNQGKL
CNS 9
9 9 9
23 23 31
tgtgctgtgag tgtgctgtgagc tgtgctgtgagc
c
gaattataaccaggggaagcttatctttgga aattataaccaggggaagcttatctttgga ggaatagcaataacagaatcttctttggt
RNYNQGKL SNYNQGKL SRNSNNRI
9 9
23 23
tgtgctgtgagc tgtgctgtgagcg
c
aattataaccaggggaagcttatctttgga Ttataaccaggggaagcttatctttgga
SNYNQGKL SAYNQGKL
LNC 2
LNC 3
LNC 4 LNC 5
CNS 10 a
c
The SNYNQGKL sequence, set in boldface, is found in seven animals of 10.
challenge with MOG 35–55 or with a purified protein derivative (PPD) (Fig. 4A). We have previously determined that C57BL/6 mice express V␣ and V public repertoires in response to the MOG 35–55 (25). We then analyzed the repertoire of TdT⫺/⫺ MOG-specific T lymphocytes using the immunoscope method (29). LNC from TdT⫺/⫺ mice immunized with MOG 35–55 were recalled in vitro with MOG 35–55 or PPD and collected. Their RNAs were extracted and reverse transcribed into cDNA. Aliquots were amplified by PCR with the 24 V- and C-specific primers or the 21 V␣ and C␣-specific primers. A single peak corresponding to a CDR3␣ of 8 aa was amplified with V␣9-C␣ specific primers in all TdT⫺/⫺ animals (Fig. 4B). For the V, only the V8.2 segment was amplified in all mice and MOG 35–55-stimulated T cells used preferentially the V8.2-J2.1 rearrangement with CDR3s of 8 and 10 aa (Fig. 4B). Immunoscope analyses performed on CFA-stimulated LNC recalled in vitro with PPD revealed bell-shaped curves for V8.2-J2.1 and V␣9-C␣ rearrangements characteristic of polyclonal repertoires without oligoclonal expansions (Fig. 4C). Therefore, the V8.2-J2.1 and V␣9-C␣ amplifications reflect the expansion of MOG-specific T cells rather than cells reactive to Ags of the CFA. These findings were corroborated by immunoscope analyses of CNS-infiltrating cells from five different TdT⫺/⫺ mice on day 18 after immunization with MOG 35–55. Oligoclonal expansions are observed for V␣9-C␣ and V8.2J2.1 rearrangements with CDR3 lengths identical with those found in LNC (Fig. 4D). To further define the recurrent CDR3 identified in TdT⫺/⫺ mice, the V␣9-C␣ and V8.2-J2.1 PCR products were cloned and se-
quenced. A CDR3 of 10 aa with the GETGGNYAEQ sequence is found in all TdT⫺/⫺ animals (Table I, boldface letters), in agreement with the public CDR3 previously identified in C57BL/6 mice (25). In C57BL/6, eight different nucleotide sequences encode this public CDR3 among which seven contain N diversity (25). One sequence lacking N addition was found in both strains. Shorter CDR3 sequences are also found in LNC and cells infiltrating the CNS of TdT⫺/⫺ mice: GGTGDAEQ (two of five for LNC and two of five for CNS-infiltrating cells), GDAGDAEQ (two of five and one of five) and AGTGDAEQ (two of five and two of five). These shorter CDR3 sequences are characteristic of TdT⫺/⫺ rearrangements as reported for naive T lymphocytes (21, 30) and T cells specific for various protein epitopes (22, 23, 31). As previously observed for wt mice, two rearrangements, V␣9J␣23 (10 animals of 10) and V␣9-J␣31 (7 of 10 animals), are preferentially used in TdT⫺/⫺ animals (Table II). Three different CDR3␣ sequences are encoded by the V␣9-J␣23. The SNYN QGKL sequence is found in 7 animals of 10 (Table II, boldface letters) and the SAYNQGKL sequence is found in four mice (TdT⫺/⫺ mice nos. 1, 4, 7, and 10) while the SDYNQGKL sequence is observed in mice nos. 1, 2, and 5. Thus, SxYNQGKL is the V␣9-J␣23 CDR3␣ consensus sequence. For the V␣9-J␣31 combination, two sequences are observed: SRNSNNRI in four mice (Table II, italic letters) and SANSNNRI in TdT⫺/⫺ mice nos. 1 and 3. In summary, MOG-reactive T cells from C57BL/6 and TdT⫺/⫺ mice carry the same public CDR3 sequence (GETGGNYAEQ) and their repertoires for the TCR␣-chain are very similar. Indeed, the V␣9-J␣31 CDR3␣ sequence SRNSNNRI, which is public in
EAE-RELAPSES AS A CONSEQUENCE OF TCR␣ DIVERSITY
4870
Table III. CDR3 sequences from CNS-infiltrating cells during EAE-relapse in C57BL/6 TdT⫹/⫹ mice (V8.3-C rearrangement) Deduced Amino Acid Sequences
J
CDR3 Length
3⬘ V End
N/P/Da
CNS 11
1.1 1.1 2.3 2.3
8 8 10 10
tgtgccagcagtgatg tgtgccagcagtga tgtgccagcagtgatg tgtgccagcagtga
gtcagggg ccgcagggg cttgggggg cggctggggggtg
acagaagtcttctttggt cacagaagtcttctttggt gtgcagaaacgctgtattttggc gcagaaacgctgtattttggc
SDGQGTEV SDRRGTEV SDAWGGAETL SDGWGVAETL
CNS 12
1.1 1.1 2.3 2.3
8 8 10 10
tgtgccagcagt tgtgccagcagtgatg tgtgccagcagtga tgtgccagcagtgatg
ttcagggag gggggggg aggggggggc cactggggg
aacacagaagtcttctttggt acagaagtcttctttggt agtgcagaaacgctgtattttggc gtgcagaaacgctgtattttggc
SFRENTEV SDGGGTEV SEGGGSAETL SDALGGAETL
CNS 13
1.1 1.1 2.3 2.3 2.3
8 8 10 10 10
tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtga tgtgccagcagtgatg tgtgccagcagtgatg
ggggcgg gggggggg cggctggggggtg cactggggg tactgggt
cacagaagtcttctttggt acagaagtcttctttggt gcagaaacgctgtattttggc gtgcagaaacgctgtattttggc agtgcagaaacgctgtattttggc
SDGGGTEV
CNS 14
1.1 2.3 2.3
8 10 10
tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtgatg
gggggggg cactggggg cttgggggg
acagaagtcttctttggt gtgcagaaacgctgtattttggc gtgcagaaacgctgtattttggc
SDGGGTEV SDALGGAETL SDAWGGAETL
CNS 15
1.1 2.3
8 10
tgtgccagcagtgatg tgtgccagcagtgatg
gtcagggg tactgggt
acagaagtcttctttggt agtgcagaaacgctgtattttggc
SDGQGTEV SDVLGSAETL
a
5⬘ J Beginning
SDGWGVAETL SDALGGAETL SDVLGSAETL
Underlined nucleotides are due by TdT activity.
wt mice, was found in 4 of 10 TdT⫺/⫺ animals. The public V␣9J␣23 rearrangement generating the CDR3␣ (RSYNQGKL) in wt mice is replaced in TdT⫺/⫺ animals by CDR3␣ sharing the consensus sequence SxYNQGKL. Altogether, these data show that TdT-deficiency does not impair the development of the encephalitogenic MOG-specific public T cell repertoires, consistent with the similar disease course observed in the two strains. Thus, TdT deficiency does not impact on the first stage of the disease.
T cell repertoires in first EAE relapse in wt mice We have excluded the possibility that the lack of relapses in TdT⫺/⫺ mice was due to an increase in T-regulatory cells or to a distinctive first phase of the disease. Altogether, our results suggest that it may reflect the limited T cell repertoire of TdT⫺/⫺ mice, resulting in an inability to activate an encephalitogenic TCR repertoire specifically responsible for the relapses. Should that be
Table IV. CDR3␣ sequences of CNS-infiltrating T cells from EAE-induced C57BL/6 TdT⫹/⫹ mice during EAE relapse (V␣4-C␣ rearrangement)
V␣
J␣
3⬘ V␣ End
CNS 11
4 4 4 4 4
18 18 18 42 42
tgtgctgctgag tgtgctgctgagg tgtgctgctgagg tgtgctgctgagg tgtgctgctgagg
CNS 12
4 4 4 4 4
18 18 42 42 42
4 4 4 4
CNS 13
CNS 14
CNS 15
a
P/Na
5⬘ J␣ Beginning
Deduced Amino Acid Sequencesb
agg gt at ca c
ggttcagccttagggaggctgcattttgga ggttcagccttagggaggctgcattttgga ggttcagccttagggaggctgcattttgga ggaggaagcaatgcaaagctaaccttcggg tggaggaagcaatgcaaagctaaccttcggg
ERGSALGRL EGGSALGRL EDGSALGRL EAGGSNAKL EAGGSNAKL
tgtgctgctgag tgtgctgctga tgtgctgctgagg tgtgctgctgagg tgtgctgctgagg
cg c cgagg
agaggttcagccttagggaggctgcattttgga tagaggttcagccttagggaggctgcattttgga ggaggaagcaatgcaaagctaaccttcggg tggaggaagcaatgcaaagctaaccttcggg ggaagcaatgcaaagctaaccttcggg
ERGSALGRL DRGSALGRL EAGGSNAKL EAGGSNAKL EARGSNAKL
18 42 42 42
tgtgctgctga tgtgctgctgagg tgtgctgctgagg tgtgctgctgagg
cgcgg ca c
tagaggttcagccttagggaggctgcattttgga ggaagcaatgcaaagctaaccttcggg ggaggaagcaatgcaaagctaaccttcggg tggaggaagcaatgcaaagctaaccttcggg
DRGSALGRL EARGSNAKL EAGGSNAKL EAGGSNAKL
4 4 4 4
18 18 42 42
tgtgctgctgag tgtgctgctga tgtgctgctgagg tgtgctgctgagg
agg c ca
ggttcagccttagggaggctgcattttgga tagaggttcagccttagggaggctgcattttgga tggaggaagcaatgcaaagctaaccttcggg ggaggaagcaatgcaaagctaaccttcggg
ERGSALGRL DRGSALGRL EAGGSNAKL EAGGSNAKL
4 4 4
18 42 42
tgtgctgctgagg tgtgctgctgagg tgtgctgctgagg
at c cg
ggttcagccttagggaggctgcattttgga tggaggaagcaatgcaaagctaaccttcggg ggaggaagcaatgcaaagctaaccttcggg
EDGSALGRL EAGGSNAKL EAGGSNAKL
Underlined nucleotides are due to TdT activity. Three 9-aa-long public CDR3␣ sequences are set in special type. ERGSALGRL, which is encoded by two different nucleotide sequences containing or not containing N additions, is set in boldface type and italics. The DRGSALGRL encoding sequence has no N additions and is set in italics with underlining. EAGGSNAKL is produced by two different sequences containing N or P additions and is set in boldface type only. b
The Journal of Immunology
4871
FIGURE 5. Ag specificity of splenocytes from EAE-induced C57BL/6 TdT⫹/⫹ mice during EAE relapse. A, Forty-five days after the induction of EAE in TdT⫹/⫹ mice, the animals were killed and cells were collected from either the spleen or the CNS. Splenocytes were labeled with CFSE, cultured for 4 days with various epitopes of the myelin, and their proliferation was tested. Data represent SI of TdR incorporation (cpm) from triplicate cultures of three different mice. SI (SI ⫽ [3H]thymidine cpm incorporated in lymphocytes stimulated by MOG, MBP, or PLP peptides/ [3H]thymidine cpm incorporated in unstimulated cells). B, Stimulated CFSE-labeled CD4⫹ splenocytes were sorted out and immunoscope analyses were performed.
the case, the repertoire involved in the relapse in C57BL/6 mice should be different from the one identified in the first disease phase and should display some clear features of TdT dependency. To determine the repertoire responsible for EAE relapses, we induced EAE with MOG 35–55 and collected the splenocytes and CNSinfiltrating cells from TdT⫹/⫹ mice at the maximum disease severity of the relapse. In all animals, CNS-infiltrating cells exhibit oligoclonal expansions using V8.3 and J1.1 or J2.3 segments (CDR3 lengths of 8 and 10 aa, respectively) and V␣4-C␣ (CDR3␣ length of 9 aa) (data not shown). Most CDR3 are coded by two consensus sequences: SDGxGTEV and SDxxGxAETL (Table III). Most of the CDR3 sequences contain N additions (16 of 19). Importantly, V8.2-C and V8.2-J2.1 PCR products were not found in the brains of the relapsing mice. Therefore, the rearrangements used during the first peak of the disease are not involved in the relapse. Concerning V␣ usage, oligoclonal expansions of V␣4 and J␣18 or J␣42 segments but not V␣9-C␣ ones were found in CNS-infiltrating cells of all mice (data not shown). Three 9-aa-long public CDR3␣ sequences were identified: ERG SALGRL, DRGSALGRL, and EAGGSNAKL (Table IV). ERG SALGRL is encoded by two different nucleotide sequences containing or not containing N additions whereas the DRGSALGRL encoding sequence has no N additions. EAGGSNAKL is produced by two different sequences containing N or P additions. To determine whether these V␣ and V public rearrangements were specific for one of the myelin epitopes, splenocytes from mice nos. 11, 12, and 13 were isolated, labeled with CFSE, and recalled in vitro with the ID peptides of MOG, MBP, PLP, and three different potential SD peptides of MOG (6). Splenocytes from EAE-suffering mice responded strongly to MOG 35–55 only (Fig. 5A). Proliferating CD4⫹ splenocytes (CFSElow) were purified (Fig. 5B) and their RNA extracted for immunoscope analyses and sequencing. The public V␣4-J␣18, V␣4-J␣42,
Table V. CDR3 sequences of CD4⫹ CFSE-labeled MOG35–55-stimulated T splenocytes from EAE-induced C57BL/6 TdT⫹/⫹ mice during EAE relapse (V8.3-C rearrangement) Deduced Amino Acid Sequences
J
CDR3 Length
3⬘ V End
N/P/Da
11
1.1 1.1 1.1 2.3 2.3 2.3
8 8 8 10 10 10
tgtgccagcagtgatg tgtgccagcagt tgtgccagcagtg tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtga
gtcagggg acagggt ggacag cttgggggg cgggacagggg cggctggggggtg
acagaagtcttctttggt caaacacagaagtcttctttggt caaacacagaagtcttctttggt gtgcagaaacgctgtattttggc gcagaaacgctgtattttggc gcagaaacgctgtattttggc
SDGQGTEV STGSNTEV SGTANTEV SDAWGGAETL SDAGQGAETL SDGWGVAETL
12
1.1 1.1 1.1 1.1 2.3 2.3 2.3 2.3 2.3
8 8 8 8 10 10 10 10 10
tgtgccagcagt tgtgccagcagtg tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtga tgtgccagcagtgat tgtgccagcagtgatg
ttcagggag ggactg gggggggg ggggcgg cttgggggg cactggggg aggggggggc ccggggggcgcac cgggacagggg
aacacagaagtcttctttggt caaacacagaagtcttctttggt acagaagtcttctttggt cacagaagtcttctttggt gtgcagaaacgctgtattttggc gtgcagaaacgctgtattttggc agtgcagaaacgctgtattttggc cagaaacgctgtattttggc gcagaaacgctgtattttggc
SFRENTEV SGTANTEV SDGGGTEV SDGGGTEV SDAWGGAETL SDALGGAETL SEGGGSAETL SDPGGAPETL SDAGQGAETL
13
1.1 1.1 1.1 2.3 2.3 2.3 2.3 2.3 2.3 2.3
8 8 8 10 10 10 10 10 10 10
tgtgccagcagt tgtgccagcagtgatg tgtgccagcagtga tgtgccagcagtga tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtga tgtgccagcagt tgtgccagcag tgtgccagcagtgat
acagggt gggggggg ccgcagggg aggggggggc cttgggggg cactggggg cggctggggggtg cgactggggcct gggactggggggc ccggggggcgcac
caaacacagaagtcttctttggt acagaagtcttctttggt cacagaagtcttctttggt agtgcagaaacgctgtattttggc gtgcagaaacgctgtattttggc gtgcagaaacgctgtattttggc gcagaaacgctgtattttggc agtgcagaaacgctgtattttggc gtgcagaaacgctgtattttggc cagaaacgctgtattttggc
STGSNTEV SDGGGTEV SDRRGTEV SEGGGSAETL SDAWGGAETL SDALGGAETL SDGWGVAETL SRLGPSAETL RGLGRRAETL SDPGGAPETL
a
Underlined nucleotides are due to TdT activity.
5⬘ J Beginning
EAE-RELAPSES AS A CONSEQUENCE OF TCR␣ DIVERSITY
4872
Table VI. CDR3␣ sequences of CD4⫹ CFSE-labeled MOG 35–55-stimulated T splenocytes from EAE-induced C57BL/6 TdT⫹/⫹ mice during EAE relapse (V␣4-C␣ rearrangement)
V␣
J␣
3⬘ V␣ End
4 4 4 4
18 18 42 22
tgtgctgctgag tgtgctgctga tgtgctgctgagg tgtgctgc
4 4 4 4 4 4
18 18 42 42 17 58
tgtgctgctga tgtgctgctgagg tgtgctgctgagg tgtgctgctgagg tgtgctgctgag tgtgctgctgagg
4 4 4 4 4 4
18 18 18 42 27 37
tgtgctgctgag tgtgctgctgag tgtgctgctga tgtgctgctgagg tgtgctgctgagg tgtgctgctga
11
12
13
5⬘ J␣ Beginning
Deduced Amino Acid Sequencesb
ca ccccg
ggttcagccttagggaggctgcattttgga tagaggttcagccttagggaggctgcattttgga ggaggaagcaatgcaaagctaaccttcggg catcttctggcagctggcaactcatctttgga
ERGSALGRL DRGSALGRL EAGGSNAKL PASSGSWQL
at ca c agggg ccac
tagaggttcagccttagggaggctgcattttgga ggttcagccttagggaggctgcattttgga ggaggaagcaatgcaaagctaaccttcggg tggaggaagcaatgcaaagctaaccttcggg cagtgcagggaacaagctaacttttgga aggcactgggtctaagctgtcatttggg
DRGSALGRL EDGSALGRL EAGGSNAKL EAGGSNAKL ERGSAGNKL EATGTGSKL
ggttcagccttagggaggctgcattttgga agaggttcagccttagggaggctgcattttgga tagaggttcagccttagggaggctgcattttgga ggaagcaatgcaaagctaaccttcggg ccaatacaggcaaattaacctttggg acaggcaataccggaaaactcatctttgga
ERGSALGRL ERGSALGRL DRGSALGRL EARGSNAKL EATANTGKL DGTGNTGKL
P/Na
agg
agg
cgcgg cgacgg cggg
a
Nucleotides underlined are due to TdT activity. Three 9-aa-long public CDR3␣ sequences are set in special type. ERGSALGRL, which is encoded by two different nucleotide sequences containing or not containing N additions, is set in boldface type and italics. The DRGSALGRL encoding sequence has no N additions and is set in italics with underlining. EAGGSNAKL is produced by two different sequences containing N or P additions and is set in boldface type only. b
V8.3-J1.1, and V8.3-J2.3 oligoclonal expansions were found in the sorted CD4⫹ population of the three mice, whereas V8.2-C, V8.2-J2.1, and V␣9-C␣ PCR products were undetectable. All CDR3␣ and  sequences found in the CNS were also identified in CFSElowCD4⫹ splenocytes (Tables V and VI). The consensus CDR3 sequence SDGxGTEV, found in the brain of mice nos. 11, 12, and 13, was also present in MOG 35–55-proliferating T cells (Table V). Three sequences, SDAWGGAETL, SDGWGVAETL, and SDALGGAETL, identified in CNS, were also found in spleens from at least two mice. However, 9 of 24 splenocyte CDR3 sequences were absent in the CNS. Importantly, unique CDR3 sequences found in the CNS of mice nos. 11
(SDRRGTEV) and 12 (SFRENTEV) were present in the splenocytes of animals nos. 13 and 12, respectively. Concerning the three public CDR3␣ sequences observed in CNS-infiltrating T cells, they were also found in CFSElowCD4⫹ T splenocytes from at least two of three animals (Table VI). These results strongly suggest that the CNS-public rearrangements are borne by MOG 35–55-specific T lymphocytes. We also determined which repertoire was expressed by CNSinfiltrating lymphocytes during the first relapse occurring in TdT⫺/⫺ mice (Fig. 2) that have received CD4⫹ T lymphocytes from naive C57BL/6 animals before EAE-induction. Public V8.3-J1.1 and V8.3-J2.3 rearrangements, previously found
Table VII. CDR3 sequences of CNS-infiltrating cells and of CD4⫹ CFSE-labeled, MOG35–55-stimulated T splenocytes during EAE relapse from two various TdT⫺/⫺ mice in which CD4⫹ T cells from wt animals were previously transferred (V8.3-C rearrangement)
5⬘ J Beginning
Deduced Amino Acid Sequences
gggggggg cttgggggg aggggggggc
acagaagtcttctttggt gtgcagaaacgctgtattttggc agtgcagaaacgctgtattttggc
SDGGGTEV SDAWGGAETL SEGGGSAETL
tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtgat
ggggcgg gtcagggg cttgggggg cactggggg ccggggggcgcac
cacagaagtcttctttggt acagaagtcttctttggt gtgcagaaacgctgtattttggc gtgcagaaacgctgtattttggc cagaaacgctgtattttggc
SDGGGTEV SDGQGTEV SDAWGGAETL SDALGGAETL SDPGGAPETL
8 8 10 10 10
tgtgccagcagtgatg tgtgccagcagtga tgtgccagcag tgtgccagcagtga tgtgccagcagtgatg
gggggggg ccgcagggg gggactggggggc aggggggggc cttgggggg
acagaagtcttctttggt cacagaagtcttctttggt gtgcagaaacgctgtattttggc agtgcagaaacgctgtattttggc gtgcagaaacgctgtattttggc
SDGGGTEV SDRRGTEV RGLGRRAETL SEGGGSAETL SDAWGGAETL
8 8 8 8 10 10 10
tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagt tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtga tgtgccagcagtgat
gggggggg ggggcgg ttcagggag gtcagggg cactggggg cggctggggggtg ccggggggcgcac
acagaagtcttctttggt cacagaagtcttctttggt aacacagaagtcttctttggt acagaagtcttctttggt gtgcagaaacgctgtattttggc gcagaaacgctgtattttggc cagaaacgctgtattttggc
SDGGGTEV SDGGGTEV SFRENTEV SDGQGTEV SDALGGAETL SDGWGVAETL SDPGGAPETL
J
CDR3 Length
3⬘ V End
CNS 16
1.1 2.3 2.3
8 10 10
tgtgccagcagtgatg tgtgccagcagtgatg tgtgccagcagtga
CNS 17
1.1 1.1 2.3 2.3 2.3
8 8 10 10 10
Spleen 16
1.1 1.1 2.3 2.3 2.3
Spleen 17
1.1 1.1 1.1 1.1 2.3 2.3 2.3
a
Underlined nucleotides are due to TdT activity.
N/P/Da
The Journal of Immunology in the relapsing C57BL/6 mice, were strongly expressed in the brains of individual recipient animals (Table VII) and were similar to those described in Table III. To ascertain that in this experimental setting EAE relapse is not due to epitope spreading, the splenocytes from these mice were stimulated with the same peptides as those used in Fig. 5A. T cells responded to MOG 35–55 only (data not shown). Additionally, splenocytes from two mice (nos. 16 and 17) were labeled with CFSE before stimulation and the CFSElowCD4⫹ T lymphocytes were isolated after 4 days in culture. TCR rearrangements were sequenced and revealed CDR3 sequences identical with those found previously (Table VII). Taken together, our results indicate that the first and second disease peaks involve two independent waves of MOG-reactive T cells. This suggests that the lack of relapse in TdT⫺/⫺ mice is primarily caused by an inability of these animals to mount the second autoreactive wave and that no regulatory mechanisms preclude the appearance of MOG-specific T cells expressing the V8.3-J1.1 and V8.3-J2.3 public rearrangements. Do T lymphocytes found in the brain of relapsing mice expand during the first peak of the disease? We determined whether the public rearrangements (V8.3-J1.1 and V8.3-J2.3) found in the first relapse were generated early in the immune response against MOG 35–55. LNC from wt mice were collected 9 days after immunization and recalled in vitro for 4 days with MOG 35–55. The public V8.2-J2.1 CDR3 sequence GETGGNYAEQ was found in all mice, whereas the V8.3-C amplification was productive in five of nine mice (data not shown). After sequencing, the public CDR3 sequences SDAWGGAETL and SDGGGTEV, characteristic of the first relapse, were observed in two mice only (data not shown). Similar amplifications were performed on cDNA from CNS-infiltrating cells during the first peak of the disease in eight wt mice. We found that one mouse expressed the public CDR3 SDGGGTEV only and another one expressed SDGGGTEV and the private SDAGQ GAETL, also found in the splenocytes of two mice (nos. 11 and 12) (Table V and data not shown). This suggests that the public rearrangements found in the first relapse are expressed by T lymphocytes that emerge progressively during the initiation of the disease and become predominant while T cells bearing the V8.2J2.1 rearrangement disappear.
Discussion
In the present study, we have used TdT⫹ and TdT⫺/⫺ littermates to investigate the impact of TCR␣ diversity on the occurrence of MOG-induced EAE relapse. At the onset of the disease, the severity of MOG-induced EAE is identical in both strains and their public T cell repertoire is highly homologous. However, the course of the disease is dramatically different depending on the strain because EAE relapses occur in TdT⫹ mice only. The lack of EAE relapses in TdT⫺/⫺ mice is in agreement with the decrease in the incidence of clinical symptoms in TdT-deficient, autoimmuneprone animals. Indeed, when the TdT-deficiency was backcrossed onto autoimmune disease-prone backgrounds, these mice were less susceptible to autoimmune nephritis (32), insulitis and diabetes (20, 33), and lupus disease (33, 34). It was suggested that the lack of N additions and/or the decrease in diversity of the T and B cell repertoires due to TdT deficiency might be responsible for the delayed onsets of different autoimmune diseases and for the less severe clinical and biological symptoms at the end stages of these diseases. In addition, it was recently shown that in C57BL/6 mice immunization with recombinant murine MOG does not generate pathogenic B cells or demyelinating Abs (35). Thus, anti-MOG B cells do not play a major pathogenic role in this EAE model. In this
4873 report, we show that failure to relapse in TdT⫺/⫺ mice does not stem from dominant regulatory mechanisms. Importantly, relapse in wt animals is not due to epitope spreading but to MOG-specific T lymphocytes expressing new public V␣ and V rearrangements containing N additions. As reported for various ID epitopes (22, 23), MOG 35–55-specific public T cell repertoires of TdT⫹ and TdT⫺/⫺ littermattes are closely similar. Wt and TdT⫺/⫺ mice share the public CDR3 sequence GETGGNYAEQ (Ref. 25) and this work, suggesting a strong bias for this amino acid sequence encoded by eight different nucleotide sequences. Concerning the V␣-chain, the public V␣9J␣23 rearrangement generating the CDR3␣ (RSYNQGKL) in wt mice is replaced in TdT⫺/⫺ animals by CDR3␣ sharing the consensus sequence SxYNQGKL. Moreover, the V␣9-J␣31 CDR3␣ SRNSNNRI is public in wt mice and is found in four of 10 TdT⫺/⫺ animals. It is worth noticing that MOG-specific public T cell repertoires from CNS-infiltrating cells and stimulated LNC in TdT⫺/⫺ mice are identical. Thus, in the two strains the first peak of EAE involves encephalitogenic MOG-specific CD4⫹ T cells that express highly homologous public TCR rearrangements. In contrast, new V␣ and V public rearrangements, most of which contain N additions, are found in CNS-infiltrating T cells of wt mice undergoing the first EAE relapse. CD4⫹ T splenocytes bearing these rearrangements and derived from these mice proliferate to MOG 35–55 and not to other ID peptides of PLP and MBP autoantigens. ID epitopes of MBP and PLP are immunogenic in TdT⫹ and TdT⫺/⫺ animals and the ID epitope of PLP is encephalitogenic in both strains (data not shown), whereas C57BL/6 mice are known to be resistant to MBP-induced EAE. Thus, the absence of relapse in TdT⫺/⫺ mice is not related to holes in their T cell repertoires, and in wt mice the first EAE relapse is not due to epitope spreading of the T cell response even though we cannot rule out the implication of other myelin autoantigens. Thus, EAE relapse predominantly involves MOG-specific T cells bearing public N diversified rearrangements. Strikingly, public T lymphocytes emerging during the first peak of the disease are undetectable by PCR in wt mice during the relapse and thus do not participate in it. This suggests that these public T lymphocytes are not anergic or do not acquire a protective Th2 phenotype and are probably eliminated. Many hypotheses could explain this phenomenon: 1) autoreactive T cells can be deleted through activation induced cell death; 2) Fas-FasL and/or TNF-TNF-R1 interactions are responsible for EAE remissions as shown in different antigenic models (36 –38); and 3) various regulatory T cells inhibit encephalitogenic responses in EAE. Indeed, in B10.PL, MBP-induced EAE results from the expansion of CD4⫹ T cells expressing predominantly the public V8.2 CDR3 DAGGGY. These encephalitogenic lymphocytes are deleted or their activity is suppressed by regulatory CD4⫹ T cell clones specific for framework 3 of the V8.2 gene segment (39) and CD8⫹ T cell clones specific for the V8.2 peptide 42–50 (40). Other studies have provided evidence that Qa1-restricted CD8⫹ T cells can modulate EAE (41– 43). These regulatory T cells specifically interact through their ␣ TCR with Qa-1/V peptides complexes present on autoimmune CD4⫹ T cells (44 – 46). Recently, the importance of this regulatory pathway was evidenced in Qa-1-deficient mice (47). In the absence of Qa-1-restricted CD8⫹ T cells capable of inhibiting PLP-specific CD4 T cells, these Qa-1deficient mice were susceptible to EAE relapses after secondary and tertiary immunization with PLP while wt animals became resistant (47). Transfer experiments using CD4⫹ T splenocytes from naive wt mice as donor cells and naive TdT⫺/⫺ mice as recipients clearly establish that no regulatory mechanisms in TdT⫺/⫺ animals inhibit
4874 the expansion of autoreactive T cells. Indeed, wt CD4⫹ T cells induce EAE relapse in TdT⫺/⫺ mice and express the characteristic public V8.3-J1.1/V8.3-J2.3 rearrangements. Nevertheless, regulatory T cells could emerge in TdT⫺/⫺ mice during the course of the disease and inhibit relapses. Because various subsets of T cells endowed with regulatory properties have been described, we transferred purified T splenocytes from EAE-recovered TdT⫺/⫺ and TdT⫹/⫺ littermates into EAE-recovered TdT⫺/⫺ and TdT⫹/⫺ mice. As shown in Fig. 3, no suppressive activity peculiar to the TdT⫺/⫺ strain could explain the absence of relapses. The emergence of MOG-specific T lymphocytes bearing the new public V rearrangements during the first EAE relapse led us to investigate whether these T cells were present at the onset of the disease. The public CDR3 sequences were only present in stimulated-LNC from two of nine mice and in CNS-infiltrating cells from two of eight mice. This suggests that T cells bearing these CDR3 sequences expand progressively and become predominant as the public V8.2-J2.1 T lymphocytes from the initial EAE peak disappear. The sequential emergence of these public repertoires against a single epitope during EAE may be explained by the following: 1) higher avidity and/or higher precursors frequency of the public V8.2-J2.1-bearing T lymphocytes as compared with public V8.3-J1.1/V8.3-J2.3 T cells; and 2) specific elimination of V8.2-J2.1 T cells by yet undefined mechanisms. Interestingly, in PLP 139 –151-induced EAE, Targoni et al. (48) showed that the vast majority of PLP 139 –151-specific CD4 T cells that appear at the onset of the disease and persist during clinical EAE are eliminated without acquiring a Th2 phenotype. The first relapse is due to intramolecular epitope spreading of the immune response characterized by the expansion of PLP 78 –191pecific T lymphocytes (48). In this model, the preferential expansion of PLP 178 –191 CD4 T cells in the CNS during the first EAE relapse may be explained by a repertoire of PLP 139 –151-specific T lymphocytes less diversified than the MOG 35–55 T cell repertoire or to higher affinity of the TCRs specific for PLP 178 –191 when compared to the low-affinity PLP 139 –151-specific T lymphocytes remaining after remission. Determinant spreading occurring during ongoing autoimmune diseases involves the sequential emergence(s) of autoreactive T cells recognizing self-epitopes different from the disease-inducing self-determinant (7). The public repertoire-bearing encephalitogenic T lymphocytes from the second peak of the disease are specific for the MOG 35–55 peptide like those of the first peak, indicating that no epitope spreading happens in our MOG-induced EAE model. Thus, the absence of spreading to the ID determinant of MPB and PLP could be due to the following nonexclusive reasons: 1) predominant Ag processing and presentation of MOG 35–55 vs ID epitopes of MBP and PLP; 2) persistence of a large T cell repertoire against MOG 35–55 (indeed, comparing MOG⫹/⫹ and MOG⫺/⫺ mice, we have previously shown (25) that MOG is unable to impact on the public MOG-specific T cell repertoire); and 3) lower avidity and/or lower frequencies of PLP- and MBP-specific T cells remaining after tolerance induction. Our studies in TdT⫺/⫺ and TdT⫹ mice have unraveled major modifications of the T cell repertoire that impact upon the evolution of MOG-induced EAE. If these observations can be generalized to other organ-specific autoimmune diseases, one can speculate that successive waves of pathogenic T lymphocytes expressing different repertoires lead to progressive destruction of tissues. Thus, one wave of autoimmune T lymphocytes that arises is eventually eliminated or down-regulated but, in the highly diversified T cell repertoire of TdT⫹ individual, another subset of specific T cells expands and leads to relapse. Our works show that during the natural course of an organ-specific autoimmune disease a highly
EAE-RELAPSES AS A CONSEQUENCE OF TCR␣ DIVERSITY adaptable T cell repertoire is able to induce relapses against a single autoantigen without obvious epitope spreading. Thus, it would be of high interest to determine the relative role played by autoantigen spreading vs the fine tuning of pathogenic T cell repertoires in organ-specific autoimmune diseases.
Acknowledgments We thank Drs. M. L. Albert, S. Anderton, P. Bousso, F. Lemmonier, and N. A. Mitchison for their comments on the manuscript.
Disclosures The authors have no financial conflict of interest.
References 1. Lassmann, H. 2004. Experimental autoimmune encephalomyelitis. In Myelin Biology and Disorders. R. A. Lazzarini, ed. Elsevier Academic Press, San Diego, pp. 1039 –1071. 2. Weaver, C. T., L. E. Harrington, P. R. Mangan, M. Gavrieli, and K. M. Murphy. 2006. Th17: an effector CD4 T cell lineage with regulatory T cell ties. Immunity 24: 677– 688. 3. Zamvil, S. S., D. J. Mitchell, A. C. Moore, K. Kitamura, L. Steinman, and J. B. Rothbard. 1986. T-cell epitope of the autoantigen myelin basic protein that induces encephalomyelitis. Nature 324: 258 –260. 4. Tuohy, V. K., Z. Lu, R. A. Sobel, R. A. Laursen, and M. B. Lees. 1989. Identification of an encephalitogenic determinant of myelin proteolipid protein for SJL mice. J. Immunol. 142: 1523–1527. 5. Kerlero de Rosbo, N., I. Mendel, and A. Ben-Nun. 1995. Chronic relapsing experimental autoimmune encephalomyelitis with a delayed onset and an atypical clinical course, induced in PL/J mice by myelin oligodendrocyte glycoprotein (MOG)-derived peptide: preliminary analysis of MOG T cell epitopes. Eur. J. Immunol. 25: 985–993. 6. Delarasse, C., P. Daubas, L. T. Mars, C. Vizler, T. Litzenburger, A. Iglesias, J. Bauer, B. Della Gaspera, A. Schubart, L. Decker, et al. 2003. Myelin/oligodendrocyte glycoprotein-deficient (MOG-deficient) mice reveal lack of immune tolerance to MOG in wild-type mice. J. Clin. Invest. 112: 544 –553. 7. Vanderlugt, C. L., and S. D. Miller. 2002. Epitope spreading in immune-mediated diseases: implications for immunotherapy. Nat. Rev. Immunol. 2: 85–95. 8. Lehmann, P. V., T. Forsthurber, A. Miller, and E. E. Sercarz. 1992. Spreading of T-cell autoimmunity to cryptic determinants of an autoantigen. Nature 358: 155–157. 9. McRae, B. L., C. L. Vanderlugt, M. C. Dal Canto, and S. D. Miller. 1995. Functional evidence for epitope spreading in the relapsing pathology of experimental autoimmune encephalomyelitis. J. Exp. Med. 182: 75– 85. 10. Vanderlugt, C. L., K. L. Neville, K. M. Nikcevich, T. N. Eagar, J. A. Bluestone, and S. D. Miller. 2000. Pathologic role and temporal appearance of newly emerging autoepitopes in relapsing experimental autoimmune encephalomyelitis. J. Immunol. 164: 670 – 678. 11. Yu, M., J. M. Johnson, and V. K. Tuohy. 1996. A predictable sequential determinant spreading cascade invariably accompanies progression of experimental autoimmune encephalomyelitis: a basis for peptide-specific therapy after onset of clinical disease. J. Exp. Med. 183: 1777–1788. 12. Kaufman, D. L., M. Clare-Salzler, J. Tian, T. Forsthuber, G. S. Ting, P. Robinson, M. A. Atkinson, E. E. Sercarz, A. J. Tobin, and P. V. Lehmann. 1993. Spontaneous loss of T-cell tolerance to glutamic acid decarboxylase in murine insulin-dependent diabetes. Nature 366: 69 –72. 13. Tisch, R., X.-D. Yang, S. M. Singer, R. S. Liblau, L. Fugger, and H. O. Mc Devitt. 1993. Immune response to glutamic acid decarboxylase correlates with insulitis in non-obese diabetic mice. Nature 366: 72–75. 14. Takacs, K., and D. M. Altmann. 1998. The case against epitope spread in experimental allergic encephalomyelitis. Immunol. Rev. 164: 101–110. 15. Jones, R. E., D. Bourdette, N. Moes, A. Vandenbark, A. Zamora, and H. Offner. 2003. Epitope spreading is not required for relapses in experimental autoimmune encephalomyelitis. J. Immunol. 170: 1690 –1698. 16. Smith, P. A., M. Morris-Downes, N. Heijmans, G. Pryce, E. Arter, K. O’Neill, J. B. t Hart, D. Baker, and S. Amor. 2005. Epitope spread is not critical for the relapse and progression of MOG 8 –21 induced EAE in Biozzi ABH mice. J. Neuroimmunol. 164: 76 – 84. 17. Wilson, R. K., E. Lai, P. Concannon, R. K. Barth, and L. E. Hood. 1988. Structure, organization and polymorphism of murine and human T-cell receptor ␣ and  chain gene families. Immunol. Rev. 101: 149 –172. 18. Gilfillan, S., A. Dierich, M. Lemeur, C. Benoist, and D. Mathis. 1993. Mice lacking TdT: mature animals with an immature lymphocyte repertoire. Science 261: 1175–1178. 19. Komori, T., A. Okada, V. Stewart, and F. W. Alt. 1993. Lack of N regions in antigen receptor variable region genes of TdT-deficient lymphocytes. Science 261: 1171–1175. 20. Gilfillan, S., C. Benoist, and D. Mathis. 1995. Mice lacking terminal deoxynucleotidyl transferase: adult mice with a fetal antigen receptor repertoire. Immunol. Rev. 148: 201–219. 21. Cabaniols, J. P., N. Fazilleau, A. Casrouge, P. Kourilsky, and J. M. Kanellopoulos. 2001. Most ␣/ T cell receptor diversity is due to terminal deoxynucleotidyl transferase. J. Exp. Med. 194: 1385–1390.
The Journal of Immunology 22. Gilfillan, S., M. Bachmann, S. Trembleau, L. Adorini, U. Kalinke, R. Zinkernagel, C. Benoist, and D. Mathis. 1995. Efficient immune responses in mice lacking N-region diversity. Eur. J. Immunol. 25: 3115–3122. 23. Fazilleau, N., J. P. Cabaniols, F. Lemaitre, I. Motta, P. Kourilsky, and J. M. Kanellopoulos. 2005. V␣ and V public repertoires are highly conserved in terminal deoxynucleotidyl transferase-deficient mice. J. Immunol. 174: 345–355. 24. Malipiero, U., K. Frei, K. S. Spanaus, C. Agresti, H. Lassmann, M. Hahne, J. Tschopp, H. P. Eugster, and A. Fontana. 1997. Myelin oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis is chronic/relapsing in perforin knockout mice, but monophasic in Fas- and Fas ligand-deficient lpr and gld mice. Eur. J. Immunol. 27: 3151–3160. 25. Fazilleau, N., C. Delarasse, C. H. Sweenie, S. M. Anderton, S. Fillatreau, F. A. Lemonnier, D. Pham-Dinh, and J. M. Kanellopoulos. 2006. Persistence of autoreactive myelin oligodendrocyte glycoprotein (MOG)-specific T cell repertoires in MOG-expressing mice. Eur. J. Immunol. 36: 533–543. 26. Cibotti, R., J. P. Cabaniols, C. Pannetier, C. Delarbre, I. Vergnon, J. M. Kanellopoulos, and P. Kourilsky. 1994. Public and private V T cell receptor repertoires against hen egg white lysozyme (HEL) in nontransgenic versus HEL transgenic mice. J. Exp. Med. 180: 861– 872. 27. Tompkins, S. M., J. Padilla, M. C. Dal Canto, J. P. Ting, L. Van Kaer, and S. D. Miller. 2002. De novo central nervous system processing of myelin antigen is required for the initiation of experimental autoimmune encephalomyelitis. J. Immunol. 168: 4173– 4183. 28. Shaw, M. K., C. Kim, H. W. Hao, F. Chen, and H. Y. Tse. 1996. Induction of myelin basic protein-specific experimental autoimmune encephalomyelitis in C57BL/6 mice: mapping of T cell epitopes and T cell receptor V gene segment usage. J. Neurosci. Res. 45: 690 – 699. 29. Pannetier, C., M. Cochet, S. Darche, A. Casrouge, M. Zoller, and P. Kourilsky. 1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor  chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90: 4319 – 4323. 30. Feeney, A. J. 1991. Junctional sequences of fetal T cell receptor  chains have few N regions. J. Exp. Med. 174: 115–124. 31. Gavin, M. A., and M. J. Bevan. 1995. Increased peptide promiscuity provides a rationale for the lack of N regions in the neonatal T cell repertoire. Immunity 3: 793– 800. 32. Conde, C., S. Weller, S. Gilfillan, L. Marcellin, T. Martin, and J. L. Pasquali. 1998. Terminal deoxynucleotidyl transferase deficiency reduces the incidence of autoimmune nephritis in (New Zealand Black ⫻ New Zealand White)F1 mice. J. Immunol. 161: 7023–7030. 33. Robey, I. F., M. Peterson, M. S. Horwitz, D. H. Kono, T. Stratmann, A. N. Theofilopoulos, N. Sarvetnick, L. Teyton, and A. J. Feeney. 2004. Terminal deoxynucleotidyltransferase deficiency decreases autoimmune disease in diabetes-prone nonobese diabetic mice and lupus-prone MRL-Faslpr mice. J. Immunol. 172: 4624 – 4629. 34. Feeney, A. J., B. R. Lawson, D. H. Kono, and A. N. Theofilopoulos. 2001. Terminal deoxynucleotidyl transferase deficiency decreases autoimmune disease in MRL-Faslpr mice. J. Immunol. 167: 3486 –3493.
4875 35. Marta, C. B., A. R. Oliver, R. A. Sweet, S. E. Pfeiffer, and N. H. Ruddle. 2005. Pathogenic myelin oligodendrocyte glycoprotein antibodies recognize glycosylated epitopes and perturb oligodendrocyte physiology. Proc. Natl. Acad. Sci. USA 102: 13992–13997. 36. Sabelko-Downes, K. A., A. H. Cross, and J. H. Russell. 1999. Dual role for Fas ligand in the initiation of and recovery from experimental allergic encephalomyelitis. J. Exp. Med. 189: 1195–1205. 37. Dittel, B. N., R. M. Merchant, and C. A. Janeway, Jr. 1999. Evidence for Fasdependent and Fas-independent mechanisms in the pathogenesis of experimental autoimmune encephalomyelitis. J. Immunol. 162: 6392– 6400. 38. Bachmann, R., H. P. Eugster, K. Frei, A. Fontana, and H. Lassmann. 1999. Impairment of TNF-receptor-1 signaling but not Fas signaling diminishes T-cell apoptosis in myelin oligodendrocyte glycoprotein peptide-induced chronic demyelinating autoimmune encephalomyelitis in mice. Am. J. Pathol. 154: 1417–1422. 39. Kumar, V., and E. E. Sercarz. 1993. The involvement of T cell receptor peptidespecific regulatory CD4⫹ T cells in recovery from antigen-induced autoimmune disease. J. Exp. Med. 178: 909 –916. 40. Madakamutil, L. T., I. Maricic, E. Sercarz, and V. Kumar. 2003. Regulatory T cells control autoimmunity in vivo by inducing apoptotic depletion of activated pathogenic lymphocytes. J. Immunol. 170: 2985–2992. 41. Koh, D. R., W. P. Fung-Leung, A. Ho, D. Gray, H. Acha-Orbea, and T. W. Mak. 1992. Less mortality but more relapses in experimental allergic encephalomyelitis in CD8⫺/⫺ mice. Science 256: 1210 –1213. 42. Jiang, H., S. I. Zhang, and B. Pernis. 1992. Role of CD8⫹ T cells in murine experimental allergic encephalomyelitis. Science 256: 1213–1215. 43. Jiang, H., R. Ware, A. Stall, L. Flaherty, L. Chess, and B. Pernis. 1995. Murine CD8⫹ T cells that specifically delete autologous CD4⫹ T cells expressing V8 TCR: a role of the Qa-1 molecule. Immunity 2: 185–194. 44. Jiang, H., H. Kashleva, L. X. Xu, J. Forman, L. Flaherty, B. Pernis, N. S. Braunstein, and L. Chess. 1998. T cell vaccination induces T cell receptor V-specific Qa-1-restricted regulatory CD8⫹ T cells. Proc. Natl. Acad. Sci. USA 95: 4533– 4537. 45. Jiang, H., N. S. Braunstein, B. Yu, R. Winchester, and L. Chess. 2001. CD8⫹ T cells control the TH phenotype of MBP-reactive CD4⫹ T cells in EAE mice. Proc. Natl. Acad. Sci. USA 98: 6301– 6306. 46. Jiang, H., S. Curran, E. Ruiz-Vazquez, B. Liang, R. Winchester, and L. Chess. 2003. Regulatory CD8⫹ T cells fine-tune the myelin basic protein-reactive T cell receptor V  repertoire during experimental autoimmune encephalomyelitis. Proc. Natl. Acad. Sci. USA 100: 8378 – 8383. 47. Hu, D., K. Ikizawa, L. Lu, M. E. Sanchirico, M. L. Shinohara, and H. Cantor. 2004. Analysis of regulatory CD8 T cells in Qa-1-deficient mice. Nat. Immunol. 5: 516 –523. 48. Targoni, O. S., J. Baus, H. H. Hofstetter, M. D. Hesse, A. Y. Karulin, B. O. Boehm, T. G. Forsthuber, and P. V. Lehmann. 2001. Frequencies of neuroantigen-specific T cells in the central nervous system versus the immune periphery during the course of experimental allergic encephalomyelitis. J. Immunol. 166: 4757– 4764.
