ISSN 1068-1620, Russian Journal of Bioorganic Chemistry, 2007, Vol. 33, No. 6, pp. 614–616. © Pleiades Publishing, Inc., 2007. Original Russian Text © E.V. Kostina, V.A. Ryabinin, G.A. Maksakova, A.N. Sinyakov, 2007, published in Bioorganicheskaya Khimiya, 2007, Vol. 33, No. 6, pp. 661–663.
LETTERS TO THE EDITOR
TaqMan Probes Based on Oligonucleotide–Hairpin Minor Groove Binder Conjugates E. V. Kostina1, V. A. Ryabinin, G. A. Maksakova, and A. N. Sinyakov Novosibirsk Institute of Chemical Biology and Fundamental Medicine, Siberian Division, Russian Academy of Sciences, pr. Akademika Lavrent’eva 8, Novosibirsk, 630090 Russia Received May 30, 2007; in final form, June 1, 2007
Abstract—Hybridization of TaqMan probes derived from oligonucleotides containing fluorophores (fluorescein, FAM, or tetramethylrhodamine, (Tamra)), fluorescence quenchers (BHQ1 or BHQ2), and a conjugated hairpin binder (MGB) composed of two tripyrrolcarboxamide residues connected through an aminobutyric acid residue were proposed for discrimination of single base mismatch using the real time PCR technique. Identification of A/C mismatch was shown to be highly specific for hepatitis C virus subtypes 1a and 1b with two variants of the probe (5'-3'): Tamra-ATTGAGCGGGTTTAp-BHQ2–MGB for subtype 1a and FAMATTGAGCGGGTTGAp-BHQ1–MGB for subtype 1b. Perfect duplexes (A·T- and G·C pairs) increase fluorescence in the process of amplification, whereas imperfect duplexes (A·G- and T·C pairs) induce no fluorescence changes. This phenomenon enables simultaneous genotyping of hepatitis C virus subtypes 1a and 1b.
Key words: conjugates, hybridization probes, minor groove binder, oligonucleotides, single base mismatch, real time PCR
DOI: 10.1134/S1068162007060143
Recently, the real time PCR technique with TaqMan probes based on the utilization of 5'-exonuclease activity of Taq polymerase has been widely used.2 However, the discrimination of the DNA targets that differ only by single base mismatch by the use of TaqMan probes is low-effective, since the difference between the duplex melting temperatures for the probes of the common lengths (25–30 bp) formed by the probes with match and mismatch templates is usually small and insufficient for unambiguous identification of mutations. Melting temperatures of shorter probes that display the higher specificities are too low for the PCR experiments. The use of short oligonucleotide conjugates with minor groove binders (MGB) as hybridization probes helps solve these problems. The incorporation of the binder into the perfect duplex probe—template is known to significantly increase the duplex melting temperature, which enables the use of probes of 12–18 nt long [1]. A small length of the probe oligonucleotide part provides a higher specific1
Corresponding author; phone: +7 (3832) 330-4652; e-mail:
[email protected]. 2 Abbreviations: BHQ1 and BHQ2, fluorescence quenchers; FAM, fluorescein; MGB, minor groove binder composed of two tripyrrolcarboxamide residues connected via an aminobutyric acid residue; and Tamra, tetramethylrodamine.
ity for the discrimination single base mismatches [2, 3]. Such an approach was used for the tricarboxamide on the basis of dihydropyrroloindole bound to the minor groove AT tract via a double-stranded DNA [1, 2]. In this work, we describe the possibility of using a hairpin binder derived from oligopyrrolcarboxamide. We used as model the hepatitis C virus subtypes 1a and 1b, whose discrimination is questionable because of the insignificant difference in the nucleotide sequences of their most conserved 5'-nontranslated genomic regions. The routine TaqMan probes of 27 nt long with a melting temperature of 65°ë were insufficiently specific for determination of single base mismatches and an increase in fluorescence level due to probe degradation with Taq polymerase in the process of amplification was observed for both subtype 1a and 1b. To solve this problem, we synthesized and studied TaqMan probes on the basis of oligonucleotides containing a fluorophore (FAM or Tamra), fluorescence quencher (BHQ1 or BHQ2), and an AT-specific hairpin binder (MGB) composed of two tripyrrolcarboxamide residues connected with an aminobutyric acid spacer.
614
TaqMan PROBES
615
R3 BHQ1: R1 = Me; R2 = NO2; R3 = Me
R2 N MeO
BHQ2: R1 = OMe; R2 = H; R3 = NO2
N R1
N N
N BHQ–MGB = O
O OPN OH
H N O Me
H N O Me
The AT enriched region containing AT tract with nucleotide A/C mismatch in the DNA (5'–3') under study were chosen for discrimination: ~GATAAACCCGCTCAATGCCT ~ (subtype 1a) and ~GATëAACCCGCTCAATGCCT ~ (subtype 1b). MGB-bearing probes were selected in the way so that the mutation point was near the sequence end from the binder side. This would allow the binder to be incorporated into the minor groove of the probe–template duplex and stabilize it. The of subtypes 1a and 1b were determined using the probes Tamra-ATTGAGCGGGTTTApBHQ2–MGB (1) and FAM-ATTGAGCGGGTTGApBHQ1–MGB (2), respectively. They were synthesized from TaqMan probes bearing a phosphate group at 3'end to which a hairpin binder was attached using the procedure described in [4]. Melting of oligonucleotides duplexes and the PCR procedure with detection of the fluorescent signal at the annealing stage were achieved on an BioRad iCycler (United States). The composition of the mixture for melting (50 µl) was as follows: a Qiagen PCR buffer (1.5 mM MgCl2, KCl, (NH4)2SO4, and Tris-HCl, pH 8.7), MgCl2 up to 5 mM concentration, 300 nM hybridization probe, and 500 nM complementary oligonucleotide or an oligonucleotide bearing a single base mismatch. The PCR reaction mixture contained 200 nM dNTP (each), 10x Qiagen buffer, MgCl2 up to a concentration of 5 mM, 15 pmol of each primer, 0.6 U Taq polymerase Qiagen, 10 pg of DNA, and 300 nM hybridization probe up to the final concentration of 300 nM. The amplification temperature profile was: 15 min at 95°ë, then 35 cycles 15 s at 95°C and 1 min at 58–60°C. Plasmids pGEM containing cDNA fragments of the nontranslated genomic region of subtypes 1a and 1b were used as templates. A comparative analysis of melting of conjugates with match and mismatch model oligonucleotides showed that the minor groove binder increases the stability of both perfect and imperfect duplexes. The melting temperatures for duplexes containing A·T-, G·C-, RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
H N O
H N
H N Me
O
O
Me
H N O Me
H N O Me
H N O
Me N
Me
A·G-, and T·C pairs were 65, 62, 58, and 52°C, respectively. It is known that the hairpin binder used in the work binds to the duplex AT tract with a high specificity [5]. However, it also stabilizes the G·C-pair-containing site. For imperfect duplexes, the ligand stabilizing effect is even less pronounced. The use of various fluorophores (FAM and Tamra) provides simultaneous genotyping of hepatitis virus C subtypes 1a and 1b: for perfect duplexes (A·T or G·C pairs) increased fluorescence is observed in the process of amplification, whereas, in the case of imperfect duplexes (A·G- and
Vol. 33
Fluorescence level (‡) 120 100 Subtype 1a 80 60 40 Subtype 1b 20 0 (b)
100 80
Subtype 1b
60 40 20
Subtype 1a
0 10
20 30 Number of cycles
Figure 1. The real time PCR pattern for determination of subtypes 1a and 1b using hybridization probes (a) TamraATTGAGCGGGTTTAp-BHQ2–MGB and (b) FAMATTGAGCGGGTTGAp-BHQ1–MGB. No. 6
2007
616
KOSTINA et al.
T·C pairs), no changes in the fluorescence level occur (see the figure). This example suggests that the use of hairpin binders with increased site specificity (oligopyrrolcarboxamides on the basis of N-methylimidazole, β-alanine, and N-methylpyrrol [5]) would enhance the efficacy and selectivity of TaqMan probes. ACKNOWLEDGMENTS We are grateful to E.V. Generozov for a kind gift of plasmids. The work was supported by CRDF (project N 2652NO-05) and Russian Foundation for Basic Research (project no. 05-08-01465-a).
REFERENCES 1. Kutyavin, I.V., Afonina, I.A., Mills, A., Gorn, V., Lukhtanov, E.A., Belousov, E.S., Singer, M.J., Walburger, D.K., Lokhov, S.G., Gall, A.A., Dempcy, R., Reed, M.W., Meyer, R.B., and Hedgpeth, J., Nucleic Acids Res., 2000, vol. 28, pp. 655–661. 2. Afonina, I.A., Reed, M.W., Lusby, E., Shishkina, I.G., and Belousov, E.S., BioTechniques, 2002, vol. 32, pp. 940–944. 3. Salmon, M.A., Vendrame, M., Kummert, J., and Lepoivre, P., J. Vir. Meth., 2002, vol. 104, pp. 99–106. 4. Ruabinin, V.A., Butorin, A.S., Elen, K., Denisov, A.Yu., Rushnui, D.V., and Sinyakov, A.N., Bioorg. Khim., 2005, vol. 31, pp. 159–166; Rus. J. Bioorg. Chem., 2005, vol. 31, pp. 146–152. 5. Dervan, P.B. and Edelson, B.S., Curr. Opin. Struct. Biol., 2003, vol. 13, pp. 284–299.
RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
Vol. 33
No. 6
2007
