Telomeric Repeat Containing RNA (TERRA): Aging and Cancer

Send Orders for Reprints to [email protected] CNS & Neurological Disorders - Drug Targets, 2015, 14, 000-000

1

Telomeric Repeat Containing RNA (TERRA): Aging and Cancer Sonam Sinha1, Samriddhi Shukla1, Sajid Khan1, Mohd. Farhan1, Mohammad A. Kamal3 and Syed Musthapa Meeran*,1,2 1

Laboratory of Cancer Epigenetics, Division of Endocrinology, CSIR-Central Drug Research Institute, Lucknow-226031, India 2

Academy of Scientific and Innovative Research (AcSIR), New Delhi, India

3

King Fahd Medical Research Center, King Abdulaziz University, P.O. Box 80216, Jeddah 21589, Kingdom of Saudi Arabia Abstract: Telomeric repeat containing RNAs (TERRA) are small RNA molecules synthesized from Musthapa Meeran telomeric regions which were previously considered as silent genomic domains. In normal cells, these RNAs are transcribed in a direction from subtelomeric region towards the chromosome ends, but in case of cancer cells, their expression remains limited or absent. Telomerase is a rate limiting enzyme for cellular senescence, cancer and aging. Most of the studies deal with the manipulation of telomerase enzyme in cancer and aging either by synthetic oligonucleotide or by natural phytochemicals. Here, we collected evidences and discussed intensely about the bio-molecular structure of TERRA, naturally occurring ligands of telomerase, and their genetic and epigenetic regulations in aging associated diseases. Due to their capability to act as naturally occurring ligands of telomerase, these RNAs can overcome the limitations possessed by synthetic oligonucleotides, which are aimed against telomerase. Drugs specifically targeting TERRA molecules could modulate telomerase-mediated telomere lengthening. Thus, targeting TERRA-mediated regulation of telomerase would be a promising therapeutic strategy against cancer and age-associated diseases.

Keywords: Aging, cancer, non-coding RNA, telomerase, telomere. INTRODUCTION Human telomerase, a ribonucleoprotein, plays a major role in cellular senescence by maintaining the chromosomal integrity. This enzyme consists of five components, which include human telomerase reverse transcriptase (hTERT), human telomerase RNA moiety (hTR), dyskerin, pontin and reptin. In this multimeric enzyme, hTERT is the catalytic subunit of telomerase, hTR is utilized by hTERT as RNA component, dyskerin attaches to hTR component and is required for telomerase maturation, and the two related proteins pontin and reptin facilitate telomerase assembly [1, 2]. The prime function of this enzyme is to add TTAGGG sequences to the ends of the chromosomes, which are known as telomeres. Telomeres contain these repetitive nucleotide sequences ending in a single 3’G strand overhang. In humans, ends of chromosomes are regulated and protected by a six membered protein complex known as sheltrin complex. Members forming this complex are essentially TRF1 and TRF2, and also by other significant factors TPP1, POT1, TIN2 and hRap1. As the name suggests, this set of specialized proteins shield the telomeric DNA from fusing into one another or from deterioration by the formation of Tloop structure at the 3’ end. This complex also aids the *Address correspondence to this author at the Laboratory of Cancer Epigenetics, Division of Endocrinology, CSIR-Central Drug Research Institute (CSIR-CDRI), JankipuramExtn., Sector-10, Sitapur Road, Lucknow-226 031, India; Tel: +91 522 2612411, Ext. 4491; Fax: +91 522 2623938; E-mail: [email protected] 1871-5273/15 $58.00+.00

telomeres to escape from being detected by the DNA repair machinery as single or double stranded nicks or breaks [3, 4]. Telomerase activity is high in germ line, embryonic and somatic stem cells, yet matured somatic cells lack its activity. However, the telomeres of these matured somatic cells shorten with consecutive cell divisions due to the “end replication problem” as described by James D. Watson. When the telomeres of these cells get extremely shortened, these mature somatic cells enter the process of replicative senescence after ‘Hayflick limit’ of almost an average of 52 cell divisions [5-7]. In contrast, approximately 85-90% of tumor cells escape this phenomenon by exhibiting higher telomerase activity and by maintaining substantial telomere length. The remaining 10-15% of cancer cells harbor another mechanism of telomere maintenance known as alternative telomeres lengthening (ALT) mechanism [8, 9]. Since most of the tumor cells utilize higher telomerase activity to evade cellular senescence, excessive telomerase activity is generally considered to be an essential step in occurrence of cancer and its progression. On the basis of chromosomal staining, TC Rodman described telomeric DNA as constitutive heterochromatic regions [10]. Many subsequent researches further strengthened this concept by successfully demonstrating the presence of inactive chromatin marks such as histone 3 trimethylated at lysine 9 (H3K9me3), histone 4 trimethylated at lysine 20 (H4K20me3) and abundance of heterochromatin protein 1 (HP1) on mammalian telomeres [11]. In addition to © 2015 Bentham Science Publishers

2

CNS & Neurological Disorders - Drug Targets, 2015, Vol. 14, No. 7

these histone modification marks, another heterochromatic mark, DNA methylation is also present at the mammalian sub-telomeric regions [12]. These heterochromatic marks results in transcriptional repression of telomerase. Recently, Azzalin et al. discovered that telomeres, which are considered as transcriptionally silent regions of mammalian chromosomes, are transcribed into TERRA molecules [13]. In this review, we will discuss about the structure and functions of TERRA molecules as well as their transcriptional regulation and their importance in the maintenance of telomeric lengths. We also gave special emphasis on TERRA as a novel therapeutic target in reference to cancer and other age-associated disorders. Transcription of TERRA Recently, a group of researchers reported a new member in the family of long non-coding functional RNAs, which they termed as TERRA or TelRNA in vertebrates [13-15]. TERRA molecules bear UUAGGG repeat sequences and vary in their length falling in the range of 100 bases up to at least or more than 9000 bases in mammals [13-14]. TERRA is synthesized in most of the organisms which includes T. brucei, S. cerevisiae, C. elegans, D. rerio, C. th. piger, M. musculus, H. sapiens [13-18]. In mammals, transcription of TERRA is mediated by RNA polymerase II (RNA pol II) from the centromeric region to the telomeric end, suggesting transcription start site to be present within the sub-telomeric domain. Inactivation of RNA pol II with α-amanitin did not completely inhibit TERRA synthesis indicating the involvement of some other RNA polymerases in TERRA transcription. Many recent studies have reported that TERRA molecules are exclusively noticeable in nuclear fractions co-localizing with part of telomeric DNA in interphase cells. Further, studies suggest the presence of TERRA at the chromosomal tips in metaphase cells [13-15]. The length of TERRA molecules is variable and this heterogeneous nature of TERRA is mainly due to different length of RNAs derived from subtelomeric regions. Human TERRA molecules bearing 5´-UUAGGG-3´ nucleotide repeats were found to have an average size of 200 bases [19]. Unlike other human mRNA transcripts synthesized by RNA pol II, only 7% of TERRA transcripts are 3’-polyadenylated. Poly (A)- and poly (A)+ are different from one-another as they possess different terminating sequences as well as differential stability. Poly (A)– TERRA are less stable with a half-life of approximately 3 h, as compared to poly (A)+ TERRA, which exhibit half-life of more than 8 h [19]. This suggests that TERRA bears sequences which are known to be polyadenylated by canonical poly (A) polymerase (PAP) in humans. Deletion of pap1 results in lower TERRA levels indicating that the poly (A) tail is required for TERRA stabilization [20]. Bio-Molecular Structure of TERRA Revealing higher order structure of TERRA molecule is important to understand its role in telomere machinery and diseases associated to telomeres. Recently, Xu et al. and two other independent groups of researchers demonstrated that human TERRA molecules, which contain G-rich sequences at their 3’end, fold to adopt G-quadruplex structure similar to

Sinha et al.

telomeric DNA quadruplexes. Telomeric DNA is well known to form G-quadruplex structure in order to protect itself. Using NMR technique, researchers reported that these G-quadruplexes are stable in Na+ and K+ solutions and display resistance against RNase treatment [21-23]. CD spectra and click chemistry studies suggest that human telomeres and TERRA RNA repeats also form DNA: RNA hybrid G-quartet structures [24]. Localization of TERRA Gquadruplex structure at chromosomal ends has suggested its potential association with telomeric DNA [21]. On the basis of these studies, it can be postulated that TERRA quadruplex and DNA quadruplex may dimerize and play essential role in maintaining telomeric length. Thus, focusing on these findings may lead into a better understanding of TERRA and its functional significance in telomere biology. Genetic and Epigenetic Regulators of TERRA Genetic and epigenetic regulators play active role in gene transcription, genome integrity, protein localization and degradation. TERRA promoters containing CpG rich regions and are reported to be hypermethylated by the action of DNA methyltransferases (DNMTs). This action of DNMTs negatively correlates with association of RNA pol II with TERRA promoters and eventually with the expression pattern of TERRA. In contrast, TERRA expression levels decrease in mouse embryonic stem cells, which are deficient for DNMTs. This could be likely due to the increase in histone inactive marks observed in the subtelomeric region. Mouse cells deficient for histone methyltransferases such as SUV39h and SUV4-20h displaying decreased repressive chromatin mark such as H3K9me3 and H4K20me3, resulted in a higher TERRA expression [15]. This indicates the direct influence of epigenetic patterns of mammalian telomeric DNA in the transcriptional levels of TERRA. Further, studies have revealed that depletion of TRF1, member of sheltrin complex, led to decreased abundance of TERRA but RNA pol II binding at telomeres remained unaffected, suggesting its role in initiation of TERRA transcription [15]. TERRA is known to be bound by different RNA binding proteins [25]. Among them, heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) might serve as a good candidate in TERRA regulation as it binds specifically to UAGGGA/U repeats, abundantly found in the different regions of TERRA. hnRNPA1 is phosphorylated by DNAdependent protein kinase catalytic subunit (DNA-Pkcs). Depletion of DNA-Pkcs kinase activity and hnRNPA1 resulted in an increased expression of TERRA. Similarly, their stimulation by hTR component of telomerase resulted in a decreased expression of TERRA at telomeres, indicating inhibitory role of hnRNPA1 in TERRA transcription [26]. According to the recent studies, hnRNPA1 interacts with TERRA as well as telomerase both in vitro and in vivo [27]. Adequate balance among the above three key players displays crucial role in regulation of TERRA and it’s binding at telomeres [27]. As far as the degradation of TERRA is concerned, members of nonsense-mediated RNA decay (NMD) machinery are the best players reported for removal of TERRA from telomeric regions. In yeast, regulation of TERRA by NMD machinery is still not known, however, it is fascinating that rendering NMD machinery inactive leads

Telomeric Repeat Containing RNA (TERRA)

to shorter telomeres in yeast [28, 29]. Unlike yeast, the human NMD machinery plays prime function in the removal of TERRA molecules from the telomeric region, where it is synthesized [13, 30]. Key members of this machinery include human Suppressors with Morphogenetic defects in Genitalia (SMG) proteins such as UPF1/SMG2, Ever Shorter Telomeres 1 protein (Est1p) -like proteins hEST1A/SMG6 and SMG1 proteins [31]. The depletion of these proteins by RNAi resulted in an increased expression of TERRA at telomeric regions, but it did not affect the total transcriptional levels of TERRA [13]. Since the proteins of human NMD machinery are found to be enriched at the telomeres, these proteins may associate directly with TERRA at these regions in vivo [13]. Collectively, it can be inferred that UPF1/SMG1/EST1A are either involved in the removal of TERRA molecules from telomeric regions, or in the degradation of TERRA molecules present at telomeric DNA. In both the scenarios, this machinery affects TERRA only locally; the transcriptional levels of TERRA remain unaltered. A better assessment of all these regulators and the regulatory mechanisms would play essential role in targeting the TERRA transcription at telomeric DNA. Role of TERRA in Heterochromatinization Heterochromatin is highly compact, inaccessible structures of DNA, involved mainly in gene repression and it contributes to the stability of mammalian chromosomes [32]. Formation of heterochromatin requires H3K9 and H3K27 trimethylation, which can be recognized through binding of heterochromatin proteins such as HP1 [33]. Studies have shown that the telomeric as well as subtelomeric regions of mammalian chromosomes contain the presence of H3K9trimethylation, H4K20-trimethylation and HP1 [11]. In addition, methylation of subtelomeric DNA by DNMTs in human also plays an important role in heterochromatin formation [34]. There are many non-coding RNAs such as Xist and Piwi, which have been proposed to be involved in heterochromatin formation as evidenced by the silencing of one of the two female X chromosomes [35, 36]. In accordance, TERRA molecules function similar to Xist, but rather than recruiting the heterochromatin marks to the female X chromosome, these molecules are involved in the recruitment of heterochromatin marks to the telomeric regions [15, 37]. Studies suggest that there is an association among the lengths of telomeric DNA, TERRA accumulation and telomeric heterochromatinization [15]. In accordance, studies have shown the association of TERRA with TRF1 and TRF2 which further promote interplay between TRF2 and origin recognition complex (ORC1). Further, enrichment of H3K9-trimethylation and ORC1 at telomeric DNA decreases upon siRNA-mediated silencing of TERRA, suggesting the role of TERRA in heterochromatization [38]. Further, TERRA was also found to be enriched with HP-α and H3K9me3 as evidenced by RNA-ChIP which again indicates that there is a strong relationship between TERRA and heterochromatization of telomeric DNA. In addition to TERRA, ARRET which is a reverse-strand of TERRA have been discovered in A. thaliana, S. cerevisiae and C. elegans [14, 39]. In plants, both TERRA and ARRET are mainly consisting of sequences derived from centromeric regions with portions of telomeric DNA. Another

CNS & Neurological Disorders -‐ Drug Targets, 2015, Vol. 14, No. 7 3

mechanism of heterochromatinization of chromatin involves RNA-dependent DNA methylation (RdDM) pathway in which TERRA and ARRET are processed into small interfering RNAs. These siRNAs help in the recruitment of heterochromatin marks at telomeric DNA. Thus, the role of TERRA in heterochromatin formation is well evidenced in plants as well [39]. These studies suggest that mammalian TERRA might also function as a recruiter of epigenetic modifying enzymes at telomeres to establish the heterochromatin environment. From the above information, we can infer that TERRA could also play essential role in heterochromatinization of telomeric DNA, which eventually leads into the shortening of the telomeres. Role of TERRA in Development Long noncoding RNAs are articulated in a developmentally controlled fashion and are known to exhibit crucial roles in higher-order chromosomal dynamics, subcellular structural organization, and telomere biology. Intriguingly, in undifferentiated embryonic stem (ES) cells, TERRA transcript can be found to be linked with both X chromosomes present in females and with both X and Y chromosomes in males [37]. Distribution of TERRA alters at the time of cellular differentiation, after which TERRA accumulation is found only with the heterochromatic sex chromosomes of each sex. Post differentiation, only one of the two sex chromosome is enriched with TERRA (Xi in females and Y in males,), specifying the notion that TERRA localization is developmentally controlled. In accordance, when differentiated fibroblasts are induced to form pluripotent stem cells with the reprogramming factors such as Oct3/4, Sox2, Klf4 and c-Myc, level of TERRA transcription is also highly induced [40]. Studies have shown that TERRA is found to be abundantly present in ES cells but with successive differentiation this abundance is lost, which is positively correlated with telomeric dysfunction and instability [15, 37, 40]. Further, studies have also shown that dysfunctional telomeres can trigger a DNA damage response leading to a phenotype in post mitotic neurons that identifies with cellular senescence in various features [41, 42]. TERRA is also reported to be involved in telomeric heterochromatization, displaying a role similar to Xist RNA, which plays an essential role in mammalian development [35, 36]. Collectively, we could infer that TERRA may be developmentally regulated and is itself involved in organism development. TERRA: As a Potent Regulator of Telomerase It has been proposed that TERRA inhibits telomerase, which functions to elongate telomeric DNA at the ends of the chromosomes. The 5’-UUAGGG-3’ sequences in mammalian TERRA molecules are complementary to the template region of hTR component of telomerase enzyme [43]. This complementarily between TERRA and hTR component indicate that they might bind to telomerase directly and modulate its activity. This supposition gets strengthened by the fact that TERRA molecules are found to be associated with human telomerase in cell extracts [43]. Further in vitro studies demonstrated that 5’UUAGGG-3’ nucleotide sequence of TERRA complementarily binds to

4


Sinha et al.

the hTR component of telomerase. Researchers gave concrete evidence that TERRA molecules also interact with hTERT, independent of hTR [43]. However, the exact site of contacts between these two telomeric components remains to be elucidated and this information could be of utmost importance to study the regulation of telomerase through TERRA molecule. Telomerase enzyme exhibits higher affinity for TERRA molecules as compared to telomeres. This fact is well evidenced as TERRA binds to telomerase and do not let telomerase bind to its naturally occurring substrate, telomere. In vitro studies demonstrated that TERRA displays a mixed kind of inhibition for telomeric DNA suggesting that it can bind to the catalytic subunit of telomerase even when it is attached to the telomeric DNA [43]. Different modes of telomerase inhibition by TERRA have been shown in Fig. (1).

at telomeres [13]. Among different proteins of NMD machinery, hEST1A/SMG6 plays a key role by physically interacting with telomerase. This information is held strong as this hEST1A/SMG6 shares homology with yeast Ever Shorter Telomeres 1 (Est1) which is a subunit of yeast telomerase [44-46]. Therefore, it can be postulated that human EST1A/SMG6 might influence telomerase through TERRA regulation. Not only in vitro but also in vivo studies have shown that the telomerase is, at least in part, regulated through TERRA [20, 27]. Redon et al. demonstrated that there should be an adequate balance between the production of TERRA, availability of telomerase and RNA binding protein hnRNPA1 and also free 3’ G-tail of telomeric DNA at a particular time. When the TERRA abundance is less than the hnRNPA1 production, hnRNPA1 gains access to 3’ end of telomeric DNA, inhibiting its extension by catalytic activity of telomerase rendering itunable to bind to the telomeres. However, when production of TERRA exceeds hnRNPA1

We discussed earlier that NMD machinery is required for the removal of human TERRA molecules which is also known to substantially interact with the chromatin structures

5’-azacytidine

Trichostatin A DNA methylation Histone acetylation

CEN

Poly A- TERRA

Telomere

Sub telomere

Poly A+ TERRA Increased TERRA transcription Telomerase

GUUAAAAAA

m7 G m7 G m7 G

hTR

UUAGG UUAGG

hTERT A.

C.

B.

BRACO-19

TEL

SUB

D. 3’

5’ SUB 3’

5’ 3’ Stabilization of Gquadruplex leads to displacement of hTERT from telomere

TERRA hinders telomerase binding to 3’-end of telomere

Displacement of telomerase from telomeric region

TEL

3’

5’ 3’ TERRA hinders action of telomere-bound telomerase

Shortened telomere length leads to senescence or apoptosis Anti-cancerous effect

Fig. (1). Different modes of telomerase inhibition by TERRA. 5-azacytidine decreases DNA methylation and Trichostatin increases histone acetylation of subtelomeric region which leads to up regulation of TERRA-transcription. This leads to increased expression level of TERRA in the cell nucleus. Four possible scenarios for telomerase inhibition are modeled. (A) Increased TERRA molecules form multimeric G-quadruplex structure at the telomeric region. This G-quadruplex structure could be stabilized by small molecule ligands such as BRACO19 which causes displacement of human Telomere Reverse Transcriptase hTERT from telomere, eventually leading to inhibition of telomerase. TERRA either complementarily base pairs with the human telomerase RNA template (hTR) or it interact with hTERT. (B) TERRA molecules, released from the subtelomeric region may get bound to the telomerase and thus they may inhibit telomerase from recruiting itself to telomere. (C) Telomere bound TERRA may bind and inhibit telomerase by preventing its access to the 3’ end of telomere. (D) Released TERRA molecules may bind to telomeric chromatin bound telomerase and prevents its action by refraining it from accessing the telomeric 3’ end. Inhibition of telomerase by any of the above mentioned mechanisms eventually leads to cancer cell senescence and induces apoptosis.


production, it binds to the telomerase in order to inhibit its catalytic activity. Telomerase effectively gains access to telomeric DNA only when TERRA and hnRNPA1 is equal in concentration at a given point of time at telomeric regions [27]. Hence, telomerase binding at telomeres is tightly regulated through TERRA. This is very important for various cellular physiological events which include cell cycle regulations. Notably, TERRA expression levels alter in different phases of cell cycle, being the lowest in S phase, where telomerase is highly active. Thus, TERRA inhibits highly active telomerase in all the phases except for S phase contributing to the cell-cycle regulatory ability of telomerase [19]. When telomeric DNA adopts quadruplex structure, it functions to inhibit the telomerase activity. Thus, this structure ensures that the 3´-end is not easily accessible to hybridize with the hTR which is required by the catalytic activity to occur [47]. Recently, TERRA molecules have been predicted to adopt dimeric as well as multimeric Gquadruplexes which inhibits telomerase accessibility to its natural substrate. Although aforementioned in vitro studies quite evidently suggest that TERRA, in general, functions as an inhibitor of telomerase, several other studies have challenged this hypothesis. Farnung et al. demonstrated an increased expression of telomerase despite the presence of a higher TERRA expression in some human cancer cells due to the absence of DNMT1 and DNMT3b [48]. In a different study, Arnoult et al. described reduced expression levels of TERRA upon telomerase-mediated-elongation of telomeres in fibrosarcoma cells, non-tumoral fibroblasts and lung-cancer cell lines. This study shows that telomere elongation results in reduced expression of TERRA through increased H3K9 trimethylation [49]. Similarly, no counter correlation between TERRA expression and telomere length was observed in several other human cancer cells [50, 51]. Recently, Cusanelli et al. have demonstrated that instead of telomerase inhibition, TERRA is able to recruit telomerase to the telomeres which require elongation, in budding yeast through live cell imaging [52]. Therefore, TERRA seems to behave as both negative as well as positive regulator of telomerase. Thus, to solve this puzzle, digging more into functional aspects of TERRA is required. ROLE OF TERRA AND TELOMERASE IN CANCER AND AGE-ASSOCIATED DISEASES Role of TERRA in Cancer In cancer cells, continuous telomere lengthening is required in order to proliferate in an immortalized fashion. Telomeres are crucial in the maintenance of genome integrity and regulation of replicative senescence. As aforementioned, cancer cells utilize either of the two telomere maintenance mechanisms for lengthening of their telomeres. The first and predominant mechanism includes telomerase-mediated telomere lengthening while the other less common mechanism known as alternative lengthening of telomeres (ALT). ALT utilizes homologous recombination, rolling circle replication, t-loop elongation etc. for increasing the telomere length. TERRA molecules


were found to be down-regulated in different telomerasepositive cancer cells but up-regulated in different cell lines which use ALT mechanism for telomere lengthening [13, 15]. Since, TERRA molecules are transcribed from subtelomeric regions of chromosome ends and these regions are highly methylated in telomerase-positive cells, TERRA transcriptional level was found to be diminished in these cells [53]. Further studies have shown that as compared to normal tissues, lower expression levels of TERRA are detected in some of the higher grades of laryngeal cancer, astrocytoma and colon cancer. This indicates that during the course of cancer progression, transcriptional levels of TERRA are greatly varied in their expression [15, 54]. Induced TERRA expression in cancer cells inhibits telomere lengthening and eventually leads to inhibition of telomerase activity as shown in Fig. (2). Recently, studies in medulloblastoma have shown abundance of TERRA molecules in highly proliferating progenitor neuron as well as cancer tissues indicating that these RNAs could behave as an essential marker for cancer associated dysregulation of telomeric DNA [54, 55]. The above studies indicate that the levels of TERRA expression in normal and cancer cells play an important regulatory role. TERRA-mediated regulation of telomere lengths might be more complicated, since there are different parameters which are to be taken in account such as the background of the patient, ALT phenotype of cancer cells, tumor grade and integrity of tumor tissue. We can come to a conclusion that expression of TERRA differs in normal and cancer cells. Thus altering the expression level of TERRA in cancer cells could be an effective strategy to begin with new therapeutic target in cancer. Role of TERRA in Age-Associated Diseases Role of telomeres and telomerase is well established in cancer but their role in other age-associated diseases still remains to be completely understood. Earlier studies have revealed that advancing age is the prime risk factor for the development of neurodegenerative disorders. Neurodegenerative diseases are those age-related diseases which are identified by the functional loss of neurons. Telomerase is highly active in developing brain and some specific regions of adult brain and has been shown to exhibit neuroprotective properties in experimental models of neurodegenerative disorders [56-59]. Studies suggest that reactivation of telomerase by genetically engineered methods reverses neurodegeneration in telomerase-deficient mice model [58]. Telomerase reactivation in late generation TERT-ER mice revitalizes mice. Activation of telomerase results in telomere elongation in neuronal cells and protects them from undergoing apoptosis and reverses neuronal degeneration. Role of telomerase in several age-related neurodegenerative diseases like Alzheimer’s disease (AD), Parkinson’s disease (PD), amyotrophic lateral sclerosis (ALS), Huntington diseases (HD) etc. have been demonstrated. Advancement in aging, telomere shortening in leukocytes and progression of AD has been consistently correlated in previous studies [59]. Studies have also revealed that AD patients bear leukocytes or T-cell with significantly shorter telomere lengths as compared to age-

6


Sinha et al.

CCCAATCCCAAT A.

GGGTTAGGGTTAGGGTTAGGGTTAGGGTTA Sub telomere

CAAUCCCAAUC hTR

Cancer cells

3’

hTERT

5’

CCCAATCCCAAT

B.

GGGTTAGGGTTAGGGTTAGGG Sub telomere

5’

3’ GUUAGGGUUAG CAAUCCCAAUC hTR

Cancer cells with increased TERRA production

3’

hTERT

5’

CCCAATCCCAAT

C.

GGGTTAGGGTTAGGGTTAGGG Sub telomere CAAUCCCAAUC hTR

Cancer cells with induced TERRA G-quadruplex structure 3’

hTERT

Fig. (2). TERRA inhibits telomere lengthening in cancer cells. (A) Telomerase is highly expressed in cancer cells. 3’-end of telomere is easily accessible to telomerase, whose (hTR) component complimentarily binds with the telomeric sequence, recruits itself and lengthens telomere. Hence cancer cells proliferate irregularly. (B) TERRA transcription takes place from subtelomeric region and complementarily binds to the (hTR) component of telomerase and hence inhibits telomerase from lengthening 3’ end of telomere in cancer cells. (C) In the presence of G-quadruplex ligands ( ), TERRA forms G-quadruplex structure and binds to telomeric region, which hinder the telomerase lengthening the telomere in cancer cells. Thus induction of TERRA inhibits telomerase activity in cancer cells.

matched controls [60-63]. Further studies suggest a significantly increased level of telomerase activity in phytohaemagglutinin-activated lymphocytes acquired from AD patients as compared to healthy controls which might be due to impairment in telomere functioning in AD patients. In addition, increased level of telomerase activity and the degree of neuronal damage was significantly correlated in AD patients. Parkinson’s disease (PD) is another disease which is identified with the progressive dopaminergic neuronal loss. Fewer studies have examined the relationship between telomere dysfunction and development of PD. Wang et al. provided evidences that men with shorter telomere length are less prone to this disease which is in contrast with the findings in other aging-related diseases [64]. A study including 28 Japanese male PD patients revealed abundance of leukocytes with mean telomere length shorter than 5 kb, suggesting accelerated telomere shortening in PD patients [65]. In addition, Maede et al. investigated the age-related changes in subtelomeric methylation levels in Japanese PD patients and revealed that there is an increase in the shorter telomeres with hypomethylated sub-telomeres in

healthy aged controls but there is no change in PD patients [66]. Amyotrophic lateral sclerosis is a rapidly incurable deteriorating disease characterized by the dysfunction of motor neurons in the cerebral cortex, Brain Stem and Spinal Cord [67, 68]. Amyotrophic lateral sclerosis (ALS) disease involves multiple factors but no definite cause of this disease in known yet. Telomerase activity has not been characterized in ALS patients but Bruna et al. in 2014, for the first time reported that telomerase activity is significantly lowered in blood sample and spinal cord from ALS patients as compared to healthy controls [69]. Activation of telomerase enzyme might prevent the neurons from degeneration delaying the progression of ALS [70]. Although there are multiple reports correlating the TERRA expression with telomerase activity in other diseases, in case of the ageassociated diseases discussed above, the relation of TERRA expression with telomerase activity is yet to be studied. Overall, above studies suggest the involvement of telomerase and enhanced telomere dysfunction in the progression of all these age-associated diseases. Recent


studies have largely focused to adopt strategies which deal with the manipulation of telomerase enzyme, which could possibly serve as a neuroprotectant against age-associated neurodegeneration [71, 72]. TERRA AS A THERAPEUTIC TARGET AGAINST CANCER AND AGING Higher telomerase activity is one of the very important characteristics of cancerous cells enabling them to survive beyond the general limit. Thus, targeting of telomerase activity either directly or indirectly might prove to be a potent therapeutic approach in treating a variety of cancers. In accordance, the inhibition of telomerase has been shown to be an effective therapeutic approach against various cancers [73-75]. Since TERRA molecules have been proposed to negatively regulate telomerase activity and several reports have also suggested their down-regulation in different cancers, these molecules can act as potential therapeutic target in order to inhibit telomerase. Similar to telomerase, TERRA is also shown to be epigenetically regulated and play an important role in telomeric heterochromatinization [15]. Cellular expression of TERRA could also be regulated by demethylating agents and histone deacetylase inhibitors. Recently, researchers have demonstrated that 5-azacytidine (5-AZC) treated U937 and K562 leukemic cells showed a considerable accumulation of TERRA at telomeric DNA. Moreover, TERRA expression levels significantly increased corresponding to the decrease of telomerase catalytic activity in U937 cells. In contrast, there was no effect of 5-AZC treatment on TERRA expressions and telomerase activity as observed in K562 cells. However, this may be due to phenotypic as well as genotypic differences in both the cell types. Thus, hypomethylation of DNA results in induction of TERRA expression along with decreased telomerase activity in human blood cancer cells [76]. In a similar manner, other demethylating agents can also be used as possible activators of TERRA and down regulators of telomerase. Treatment of HeLa cells with Trichostatin A (TSA), a histone deacetylase (HDACs) inhibitor, shows TERRA abundance in these cells [77]. TSA is a well-known synthetic HDACs inhibitor, which may possibly act on subtelomeric DNA contributing to the open structure of chromatin and promote telomeric transcription. In addition to synthetic inhibitors, there are multiple bioactive natural compounds that have also been used as potent DNMTs and HDACs inhibitors, which could also initiate TERRA-mediated telomerase inhibition in cancer. Recent researches reveal that hTR and hTERT are the two major components which are mostly used as a target for telomerase inhibition. Several approaches such as development of 2’-O-methyl-RNA (2’-O-meRNA) oligomers and 2-5A-ODN which complementarily binds to hTR, synthesis of negative mutant of hTERT i.e. DN-hTERT and Anti-hTERT ribozymes have been used from past few years for telomerase inhibition [78-84]. Although, these approaches were successful in inhibiting telomerase, however, they failed to produce remarkable effect on the tumor growth. In contrast, targeting telomerase by stabilizing G4 structure formed by TERRA overcomes this limitation by producing immediate effect on tumor growth. Currently


available small molecule drugs have the ability to stimulate telomeric 3’G tail to adopt quadruplex structure [85]. Molecular mechanism of such molecules showing inhibition of telomerase activity by stabilizing G4 structure was initially described with the help of disubstituted anthraquinone derivative [86]. In multiple tumor xenograft studies, different small molecule ligands have shown potential anticancer property. This indicates that these molecules might prove beneficial for the treatment of telomerase expressing cancer. Many G4-binding molecules have been studied till now [87-89]. Telomestatin was one such molecule which successfully exhibited telomerase inhibitory property and displayed high affinity for G4 structure [90]. Further studies have demonstrated that unlike telomestatin, non-conjugated compounds are more accessible to such structure and effectively inhibit telomerase [91, 92]. Small molecule ligands could possibly induce the formation of G4 structure and cause removal of hTERT and other related proteins from the telomeric region. This might trigger the inhibition of telomerase activity leading to decrease in length of telomeres thus causing senescence or apoptosis. Recently, TERRA molecules have been shown to interact with acridine molecules with loop involvement in definite conformations [93]. A large number of small molecules consisting of acridine molecules as their basis have been shown to bind to telomeric G4 structure. Such molecules can also bind to other G-quadruplexes like that of TERRA. BRACO-19, Telomestatin, Quarfloxin, RHPS4, TMPyP4, AS410 etc. are such small molecule ligands which possess anti-cancer potential and can be used to inhibit telomerase through TERRA [94, 95]. Several anti-cancer agents inducing TERRA-mediated regulation of telomerase activity are listed in Table 1. TERRA AS THERAPEUTIC TARGET AGAINST NEURODEGENERATIVE DISORDERS Studies have shown that age-associated diseases such as neurodegenerative disorders are characterized by telomeric dysfunction and displays involvement of telomerase enzyme in the disease progression [57-72]. In addition, growing body of evidences indicate that TERRA molecules play critical roles in telomere homeostasis, regulation of telomere length and telomerase activity [13-15, 43, 54-55, 77]. Although, there is no direct evidence for the involvement of TERRA molecules in age-associated neurodegenerative disorders but involvement of TERRA molecules in the suppression of cellular senescence and subsequent aging and age-associated diseases such as cancer are well established [76, 77, 96]. Therefore, modulations in the regulation of TERRA transcripts may play a critical role in maintaining genomic stability, delaying aging and treating age-associated diseases such as cancer, AD, PD, ALS and other neurodegenerative disorders. Hence, TERRA-mediated manipulation of telomerase can be used as an effective treatment strategy against telomere-associated diseases including neurodegenerative disorders. CONCLUSION Research in telomere biology has revealed that telomere dysfunction and telomerase regulation plays a major role in

8


Table 1.

Sinha et al.

TERRA-mediated regulation of telomerase activity induced by different natural and synthetic compounds used against cancer.

Name of the Compound

Structural Composition

Mode of Action

Effect on TERRA

In Vitro/In Vivo/In Silico Model

Refs.

Analogue of cytidine

Inhibits DNA methyltransferases and induces demethylation at subtelomeric region.

Increased subtelomeric transcription causing up-regulation of TERRA.

Human leukemia cell lines (U937, K562, and HL-60)

[76]

Synthetic compound

Inhibition of HDACs

Increased subtelomeric transcription causing up-regulation of TERRA.

Human cervical cancer cell line (HeLa cells)

[77]

Acridine molecule

Acridine molecule

Complex formation with Gquadruplex structures.

Interact with TERRA Gquadruplex (G4) structure with loop formation in definite conformations

in silico model

[93]

BRACO-19

Trisubstituted acridine compound

5-Azacytidine (5-AZC) Trichostatin A (TSA)

TMPyP4

Cationic porphyrin

Telomestatin

Naturally occurring product extracted from Streptomyces anulatus 3533-SV4

RHPS4

Quarfloxin

Pentacyclic acridinium salt

Tri-substituted acridine compound altered by substituents at position 9

Stabilizing

May stabilize TERRA G4 structure.*

G4 structure present at the 3’ G tail of telomeric DNA Interact and stabilize G4 structures formed in telomeres

May Induce formation or stabilization of TERRA G4 or TERRA RNA: DNA G4 structures.*

A431 human epithelial carcinoma, UXF1138L uterus carcinoma** PC-3 human prostate carcinoma, MX-1 mammary tumor **

Facilitate the formation or stabilization of G4 structures Interact with G4 structure of telomeres and promote damage at telomeric DNA.

Selectively cause depletion of nucleolin / rDNA G4 complexes

U937 human lymphoma**

Stabilization of G4 structure *

Stabilization of G4 structure *

[94]

M14, LP, LM melanoma, UXF1138L human uterine

[88]

[90]

[86, 87]

carcinoma** MIA PaCa-2 human Stabilization of G4 structure *

pancreatic cancer, MDA-MB-231 human

[95]

breast cancer **

*No direct evidence found, **in vivo Xenograft model.

age-related diseases including tumor development and advancement. The assumption that the chromosomal termini are not transcriptionally silent but transcribe into Telomeric Repeat containing RNA adds new dimensions and a new level of complexity to the telomere biology. This information proves to be of utmost importance and promise to foster new and exciting information. TERRA plays a crucial role in maintaining telomeric lengths, hetero-chromatin formation, telomerase regulation, tumorigenesis and age-associated disorders. Modulating expression of TERRA could be an effective approach towards telomerase regulation eventually inhibiting tumor cell proliferation and development in agerelated diseases. Telomerase is one of the most potential therapeutic targets for various cancers. Most accepted inhibitors of the telomerase are the chemically synthesized oligonucleotides which complementarily base pair with hTR component of telomerase. Major challenge faced by these inhibitors is the entry of the oligonucleotide into the cell nucleus and then to the vicinity of the enzyme without being degraded by nucleases. In contrast, TERRA molecules, synthesized inside the nucleus, have easy accessibility to telomerase. Another drawback in targeting telomerase includes the long holding time between suppression of telomerase and effects on tumor growth. Stabilizing G4

structures of TERRA could be one of the most promising approaches for inhibiting telomerase and hence inhibiting tumor growth. Small molecule ligands could either induce the formation of G-quadruplex structure of TERRA or stabilize these structures present at telomeric regions in order to inhibit telomerase and further generate immediate effect on proliferation of cancer cells. In this context, TERRA, a natural regulator for telomerase, could open up newer therapeutic option against cancer. Since alteration in long non coding RNA abundance in aging and neurodegenerative disorders have also been found, it would be interesting to identify direct role of TERRA in aging and age-related diseases and to perceive their biological aspects in telomere biology. Hence, we conclude that therapeutic approaches including TERRA-mediated modulation of telomerase activity can lead to the dawn of a new therapeutic era in telomere-related diseases including neurodegenerative disorders and cancer. LIST OF ABBREVIATIONS 5-AZC

=

5-Azacytidine

AD

=

Alzheimer’s Disease



ALS

=

Amyotrophic Lateral Sclerosis

[10]

ALT

=

Alternative Lengthening Of Telomeres

[11]

DNMT

=

DNA Methyltransferases

[12]

Est1

=

Ever Shorter Telomeres 1

HDAC

=

Histone Deacetylase

[13]

hnRNPA1 =

Heterogeneous Nuclear Ribonucleoprotein A1

[14]

HP1

=

Heterochromatin Protein 1

[15]

hTERT

=

Human Telomerase Reverse Transcriptase

hTR

=

Human Telomerase RNA

NMD

=

Nonsense-Mediated RNA Decay

ORC

=

Origin Recognition Complex

PD

=

Parkinson’s Disease

RdDM

=

RNA-Dependent DNA Methylation

SMG

=

Suppressors with Morphogenetic Defects in Genitalia

TERRA

=

Telomeric Repeat Containing RNA

TSA

=

Trichostatin A

CONFLICT OF INTEREST The authors confirm that this article content has no conflict of interest.

[16] [17] [18] [19]

[20]

[21] [22] [23]

ACKNOWLEDGEMENTS The work was supported with funds from the CSIREpiHeD-Network Scheme (BSC0118), Science & Engineering Research Board (SR/FT/LS-80/2011) and Department of Biotechnology-Twinning Programme (BCIL/NER-BPMC/2013/722), New Delhi, India. SS and SK acknowledge Senior Research fellowships from the Council of Scientific and Industrial Research (CSIR), Government of India, India. CSIR-CDRI communication Number-8940. REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9]

Feng J, Funk WD, Wang SS, et al. The RNA component of human telomerase. Science 1995; 269: 1236-41. Lingner J, Hughes TR, Shevchenko A, Mann M, Lundblad V, Cech TR. Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 1997; 276: 561-7. Griffith JD, Comeau L, Rosenfield S, et al. Mammalian telomeres end in a large duplex loop. Cell 1999; 97: 503-14. Blasco MA. Mammalian telomeres and telomerase: why they matter for cancer and aging, Eur J Cell Biol 2003; 82: 441-6. Greider CW, Blackburn EH. Telomeres, telomerase and cancer. Sci Am 1996; 274: 92-7. Shay JW, Wright WE. Hayflick, his limit, and cellular ageing. Nat Rev Mol Cell Biol 2000; 1: 72-6. Reddel RR. The role of senescence and immortalization in carcinogenesis. Carcinogenesis 2000; 21: 477-84. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994; 266: 2011-5. Bryan TM, Englezou A, Gupta J, Bacchetti S, Reddel RR. Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J 1995; 14: 4240-8.

[24] [25] [26] [27] [28] [29] [30] [31]

[32] [33] [34]

Rodman TC. Human chromosome banding by Feulgen stain aids in localizing classes of chromatin. Science 1974; 184: 171-3. Blasco MA. The epigenetic regulation of mammalian telomeres. Nat Rev Genet 2007; 8: 299-309. Gonzalo S, Jaco I, Fraga MF, et al. DNA methyltransferases control telomere length and telomere recombination in mammalian cells. Nat Cell Biol 2006; 8: 416-24. Azzalin CM, Reichenbach P, Khoriauli L, Giulotto E, Lingner J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 2007; 318: 798-801. Luke B, Lingner J. TERRA: telomeric repeat-containing RNA. EMBO J 2009; 28: 2503-10. Schoeftner S, Blasco MA. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nat Cell Biol 2008; 10: 228-36. Morcillo G, Barettino D, Carmona MJ, Carretero MT, Díez JL. Telomeric DNA sequences differentially activated by heat shock in two Chironomus subspecies Chromosoma 1988; 96: 139-44. Rudenko G, Van der Ploeg LH. Transcription of telomere repeats in protozoa, EMBO J 1989; 8: 2633-8. Solovei I, Gaginskaya ER, Macgregor HC. The arrangement and transcription of telomere DNA sequences at the ends of lampbrush chromosomes of birds Chromosome Res 1994; 2: 460-70. Porro A, Feuerhahn S, Reichenbach P, Lingner J. Molecular dissection of telomeric repeat-containing RNA biogenesis unveils the presence of distinct and multiple regulatory pathways. Mol Cell Biol 2010; 30: 4808-17. Luke B, Panza A, Redon S, Iglesias N, Li Z, Lingner J. The Rat1p 5' to 3' exonuclease degrades telomeric repeat-containing RNA and promotes telomere elongation in Saccharomyces cerevisiae. Mol Cell 2008; 32: 465-77. Xu Y, Kaminaga K, Komiyama M. G-quadruplex formation by human telomeric repeats-containing RNA in Na+ solution. J Am Chem Soc 2008; 130: 11179-84. Martadinata H, Phan AT. Structure of propeller-type parallelstranded RNA G-quadruplexes, formed by human telomeric RNA sequences in K+ solution. J Am Chem Soc 2009; 131: 2570-8. Randall A, Griffith JD. Structure of long telomeric RNA transcripts: the G-rich RNA forms a compact repeating structure containing G-quartets. J Biol Chem 2009; 284: 13980-6. Xu Y, Kimura T, Komiyama M. Human telomere RNA and DNA form an intermolecular G-quadruplex. Nucleic Acids Symp Ser 2008; 52: 169-70. López de Silanes I, Stagno d'Alcontres M, Blasco MA. TERRA transcripts are bound by a complex array of RNA-binding proteins. Nat Commun 2010; 1: 33. Le PN, Maranon DG, Altina NH, Battaglia CL, Bailey SM. TERRA, hnRNP A1, and DNA-PKcs Interactions at Human Telomeres. Front Oncol 2013; 3: 91. Redon S, Zemp I, Lingner J. A three-state model for the regulation of telomerase by TERRA and hnRNPA1. Nucleic Acids Res 2013; 41: 9117-28. Dahlseid JN, Lew-Smith J, Lelivelt MJ, et al. mRNAs encoding telomerase components and regulators are controlled by UPF genes in Saccharomyces cerevisiae. Eukaryot Cell 2003 2: 134-42. Enomoto S, Glowczewski L, Lew-Smith J, Berman JG. Telomere cap components influence the rate of senescence in telomerasedeficient yeast cells. Mol Cell Biol 2004; 24: 837-45. Chawla R, Azzalin CM. The telomeric transcriptome and SMG proteins at the crossroads. Cytogenet Genome Res 2008; 122: 194201. Behm-Ansmant I, Izaurralde E. Quality control of gene expression: a stepwise assembly pathway for the surveillance complex that triggers nonsense-mediated mRNA decay. Genes Dev 2006; 20: 391-8. Grewal SI, Moazed D. Heterochromatin and epigenetic control of gene expression. Science 2003; 301: 798-802. Lachner M, O'Carroll D, Rea S, Mechtler K, Jenuwein T. Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 2001; 410: 116-20. Yehezkel S, Segev Y, Viegas-Péquignot E, Skorecki K, Selig S. Hypomethylation of subtelomeric regions in ICF syndrome is associated with abnormally short telomeres and enhanced transcription from telomeric regions. Hum Mol Genet 2008; 17: 2776-89.

10 [35] [36] [37] [38]

[39] [40] [41] [42] [43] [44]

[45] [46] [47] [48] [49] [50]

[51] [52] [53]

[54]

[55]

[56] [57] [58] [59]

CNS & Neurological Disorders - Drug Targets, 2015, Vol. 14, No. 7 Bernstein E, Allis CD. RNA meets chromatin. Genes Dev 2005; 19: 1635-55. Masui O, Heard E. RNA and protein actors in X-chromosome inactivation. Cold Spring Harb Symp Quant Biol 2006; 71: 419-28. Zhang LF, Ogawa Y, Ahn JY, Namekawa SH, Silva SS, Lee JT. Telomeric RNAs mark sex chromosomes in stem cells. Genetics 2009; 182: 685-98. Deng Z, Norseen J, Wiedmer A, Riethman H, Lieberman PM. TERRA RNA binding to TRF2 facilitates heterochromatin formation and ORC recruitment at telomeres. Mol Cell 2009; 35: 403-13. Vrbsky J, Akimcheva S, Watson JM, et al. siRNA-mediated methylation of Arabidopsis telomeres. PLoS Genet 2010; 6: e1000986. Marion RM, Strati K, Li H, et al. Telomeres acquire embryonic stem cell characteristics in induced pluripotent stem cells. Cell Stem Cell 2009; 4: 141-54. Jurk D, Wang C, Miwa S, et al. Postmitotic neurons develop a p21dependent senescence-like phenotype driven by a DNA damage response. Aging Cell 2012; 11: 996-1004. Kamal MA. Linkage of neurodegenerative disorders with other health issues--volume II. CNS Neurol Disord Drug Targets 2014; 13: 1310-4. Redon S, Reichenbach P, Lingner J. The non-coding RNA TERRA is a natural ligand and direct inhibitor of human telomerase. Nucleic Acids Res 2010; 38: 5797-806. Reichenbach P, Höss M, Azzalin CM, Nabholz M, Bucher P, Lingner J. A human homolog of yeast Est1 associates with telomerase and uncaps chromosome ends when overexpressed. Curr Biol 2003; 13: 568-74. Snow BE, Erdmann N, Cruickshank J, et al. Functional conservation of the telomerase protein Est1p in humans. Curr Biol 2003; 13: 698-704. Lipps HJ, Rhodes D. G-quadruplex structures: in vivo evidence and function, Trends Cell Biol 2009; 19: 414-22. Zahler AM, Williamson JR, Cech TR, Prescott DM. Inhibition of telomerase by G-quartet DNA structures. Nature 1991; 350: 71820. Farnung BO, Brun CM, Arora R, Lorenzi LE, Azzalin CM. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One 2012; 7: e35714. Arnoult N, Van Beneden A, Decottignies A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1α. Nat Struct Mol Biol 2012; 19: 948-56. Smirnova A, Gamba R, Khoriauli L, Vitelli V, Nergadze SG, Giulotto E. TERRA Expression Levels Do Not Correlate with Telomere Length and Radiation Sensitivity in Human Cancer Cell Lines. Front Oncol 2013; 3: 115. Vitelli V, Falvo P, Khoriauli L, et al. More on the Lack of Correlation between Terra Expression and Telomere Length, Front Oncol 2013; 3: 245. Cusanelli E, Romero CA, Chartrand P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Mol Cell 2013; 51: 780-91. Ng LJ, Cropley JE, Pickett HA, Reddel RR, Suter CM. Telomerase activity is associated with an increase in DNA methylation at the proximal subtelomere and a reduction in telomeric transcription. Nucleic Acids Res 2009; 37: 1152-9. Sampl S, Pramhas S, Stern C, Preusser M, Marosi C, Holzmann K. Expression of telomeres in astrocytoma WHO grade 2 to 4: TERRA level correlates with telomere length, telomerase activity, and advanced clinical grade. Transl Oncol 2012; 5: 56-65. Deng Z, Wang Z, Xiang C, et al. Formation of telomeric repeatcontaining RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. J Cell Sci 2012; 125: 4383-94. Fossel M, Flanary B. Telomerase and human disease: the beginnings of the ends? Rejuvenation Res 2009; 12: 333-40. Harley CB. Telomerase therapeutics for degenerative diseases. Curr Mol Med 2005; 5: 205-11. Jaskelioff M, Muller FL, Paik JH, et al. Telomerase reactivation reverses tissue degeneration in aged telomerase-deficient mice. Nature 2011; 469: 102-6. Klapper W, Shin T, Mattson MP. Differential regulation of telomerase activity and TERT expression during brain development in mice. J Neurosci Res 2001; 64: 252-60.

Sinha et al. [60] [61] [62]

[63] [64] [65] [66] [67] [68] [69] [70] [71] [72] [73] [74]

[75] [76]

[77] [78]

[79]

[80] [81] [82] [83]

Panossian LA, Porter VR, Valenzuela HF, et al. Telomere shortening in T cells correlates with Alzheimer's disease status, Neurobiol Aging 2003; 24: 77-84. Zhang J, Kong Q, Zhang Z, Ge P, Ba D, He W. Telomere dysfunction of lymphocytes in patients with Alzheimer disease. Cogn Behav Neurol 2003; 16: 170-6. Lukens JN, Van Deerlin V, Clark CM, Xie SX, Johnson FB. Comparisons of telomere lengths in peripheral blood and cerebellum in Alzheimer's disease. Alzheimers Dement 2009; 5: 463-9. Eitan E, Hutchison ER, Mattson MP. Telomere shortening in neurological disorders: an abundance of unanswered questions. Trends Neurosci 2014; 37: 256-63. Wang H, Chen H, Gao X, et al. Telomere length and risk of Parkinson's disease. Mov Disord 2008; 23: 302-5. Guan JZ, Maeda T, Sugano M, et al. A percentage analysis of the telomere length in Parkinson's disease patients. J Gerontol A Biol Sci Med Sci 2008; 63: 467-73. Maeda T, Guan JZ, Oyama J, Higuchi Y, Makino N. Agingassociated alteration of subtelomeric methylation in Parkinson's disease. J Gerontol A Biol Sci Med Sci 2009; 64: 949-55. Boillée S, Vande Velde C, Cleveland DW. ALS: a disease of motor neurons and their nonneuronal neighbors. Neuron 2006; 52: 39-59. Nayak MS, Kim YS, Goldman M, Keirstead HS, Kerr DA. Cellular therapies in motor neuron diseases. Biochim Biophys Acta 2006; 1762: 1128-38. De Felice B, Annunziata A, Fiorentino G, et al. Telomerase expression in amyotrophic lateral sclerosis (ALS) patients. J Hum Genet 2014; 59: 555-61. Eitan E, Tichon A, Gazit A, Gitler D, Slavin S, Priel E. Novel telomerase-increasing compound in mouse brain delays the onset of amyotrophic lateral sclerosis. EMBO Mol Med 2012; 4: 313-29. Mattson MP. Emerging neuroprotective strategies for Alzheimer's disease: dietary restriction, telomerase activation, and stem cell therapy. Exp Gerontol 2000; 35: 489-502. Goldman SA, Windrem MS. Cell replacement therapy in neurological disease. Phil Trans R Soc Lond B Biol Sci 2006; 361: 1463-75. Meeran SM, Patel SN, Tollefsbol TO. Sulforaphane causes epigenetic repression of hTERT expression in human breast cancer cell lines, PLoS One 2010; 5: e11457. Kondo S, Kondo Y, Li G, Silverman RH, Cowell JK. Targeted therapy of human malignant glioma in a mouse model by 2-5A antisense directed against telomerase RNA. Oncogene 1998; 16: 3323-30. Kushner DM, Paranjape JM, Bandyopadhyay B, et al. 2-5A antisense directed against telomerase RNA produces apoptosis in ovarian cancer cells. Gynecol Oncol 2000; 76: 183-92. Ohyashiki JH, Umezu T, Ohyashiki M, Ohtsuki, Kobayashi C, Ohyashiki K. DNA demethylation induces upregulation of telomere repeat-containing RNA (TERRA) and downregulation of telomerase activity in human leukemia cells, abstract. In: Proceedings of the Second AACR International Conference on Frontiers in Basic Cancer Research; San Francisco, Sep 14-18, 2011. Azzalin CM, Lingner J. Telomeres: the silence is broken. Cell Cycle 2008; 7: 1161-5. Herbert B, Pitts AE, Baker SI, et al. Inhibition of human telomerase in immortal human cells leads to progressive telomere shortening and cell death. Proc Natl Acad Sci USA 1999; 96: 14276-81. Kondo Y, Kondo S, Tanaka Y, Haqqi T, Barna BP, Cowell JK. Inhibition of telomerase increases the susceptibility of human malignant glioblastoma cells to cisplatin-induced apoptosis. Oncogene 1998; 16: 2243-8. Kondo Y, Koga S, Komata T, Kondo S. Treatment of prostate cancer in vitro and in vivo with 2-5A-anti-telomerase RNA component. Oncogene 2000; 19: 2205-11. Zhang X, Mar V, Zhou W, Harrington L, Robinson MO. Telomere shortening and apoptosis in telomerase-inhibited human tumor cells. Genes Dev 1999; 13: 2388-99. Hahn WC, Stewart SA, Brooks MW, et al. Inhibition of telomerase limits the growth of human cancer cells. Nat Med 1999; 5: 116470. Yokoyama Y, Takahashi Y, Shinohara A, et al. The 5'-end of hTERT mRNA is a good target for hammerhead ribozyme to



[84]

[85] [86] [87]

[88]

[89]

suppress telomerase activity. Biochem Biophys Res Commun 2000; 273: 316-21. Qu Y, Liu SQ, Peng WZ, Liu BL. Inhibition of telomerase activity by ribozyme targeted to human telomerase transcriptase. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 2002; 34: 3238. Sun D, Thompson B, Cathers BE, et al. Inhibition of human telomerase by a G-quadruplex-interactive compound. J Med Chem 1997; 40: 2113-6. Salvati E, Leonetti C, Rizzo A, et al. Telomere damage induced by the G-quadruplex ligand RHPS4 has an antitumor effect. J Clin Invest 2007; 117: 3236-47. Leonetti C, Scarsella M, Riggio G, et al. G-quadruplex ligand RHPS4 potentiates the antitumor activity of camptothecins in preclinical models of solid tumors. Clin Cancer Res 2008; 14: 7284-91. Grand CL, Han H, Muñoz RM, et al. The cationic porphyrin TMPyP4 down-regulates c-MYC and human telomerase reverse transcriptase expression and inhibits tumor growth in vivo. Mol Cancer Ther 2002; 1: 565-73. De Cian A, Cristofari G, Reichenbach P, et al. Reevaluation of telomerase inhibition by quadruplex ligands and their mechanisms of action. Proc Natl Acad Sci USA 2007; 104: 17347-52.

Received: November 1, 2014

[90] [91] [92]

[93] [94]

[95] [96]

Drewe WC, Nanjunda R, Gunaratnam M, et al. Rational design of substituted diarylureas: a scaffold for binding to G-quadruplex motifs. J Med Chem 2008; 51: 7751-67. Rahman KM, Reszka AP, Gunaratnam M, et al. Biaryl polyamides as a new class of DNA quadruplex-binding ligands. Chem Commun 2009; 2009: 4097-9. Dash J, Shirude PS, Hsu ST, Balasubramanian S. Diarylethynyl amides that recognize the parallel conformation of genomic promoter DNA G-quadruplexes. J Am Chem Soc 2008; 130: 15950-6. Collie GW, Sparapani S, Parkinson GN, Neidle S. Structural basis of telomeric RNA quadruplex--acridine ligand recognition. J Am Chem Soc 2011; 133: 2721-8. Burger AM, Dai F, Schultes CM, et al. The G-quadruplexinteractive molecule BRACO-19 inhibits tumor growth, consistent with telomere targeting and interference with telomerase function. Cancer Res 2005; 65: 1489-96. Drygin D, Siddiqui-Jain A, O'Brien S, et al. Anticancer activity of CX-3543: a direct inhibitor of rRNA biogenesis. Cancer Res 2009; 69: 7653-61. Yu TY, Kao YW, Lin JJ. Telomeric transcripts stimulate telomere recombination to suppress senescence in cells lacking telomerase. Proc Natl Acad Sci USA 2014; 111: 3377-82.

Revised: February 6, 2015

Accepted: February 20, 2015