Temporal dynamics of the cellular, humoral and

Avian Pathology

ISSN: 0307-9457 (Print) 1465-3338 (Online) Journal homepage: http://www.tandfonline.com/loi/cavp20

Temporal dynamics of the cellular, humoral and cytokine responses in chickens during primary and secondary infection with Salmonella enterica serovar Typhimurium R. K. Beal , C. Powers , P. Wigley , P. A. Barrow & A. L. Smith To cite this article: R. K. Beal , C. Powers , P. Wigley , P. A. Barrow & A. L. Smith (2004) Temporal dynamics of the cellular, humoral and cytokine responses in chickens during primary and secondary infection with Salmonella enterica serovar Typhimurium, Avian Pathology, 33:1, 25-33, DOI: 10.1080/03079450310001636282 To link to this article: http://dx.doi.org/10.1080/03079450310001636282

Published online: 08 Jun 2010.

Submit your article to this journal

Article views: 443

View related articles

Citing articles: 39 View citing articles

Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=cavp20 Download by: [149.154.64.225]

Date: 28 January 2016, At: 11:32

Avian Pathology (February 2004) 33(1), 25 /33

Temporal dynamics of the cellular, humoral and cytokine responses in chickens during primary and secondary infection with Salmonella enterica serovar Typhimurium R. K. Beal1, C. Powers1, P. Wigley2, P. A. Barrow2 and A. L. Smith1* Enteric Immunology Group, Division of Immunopathology and 2Division of Environmental Microbiology, Institute for Animal Health, Compton, Berkshire RG20 7NN, UK

Downloaded by [149.154.64.225] at 11:32 28 January 2016

1

Salmonella enterica serovar Typhimurium (S. Typhimurium) infections cause systemic disease in the young chick, whereas in the older chicken the infection is mainly restricted to the intestine. Chickens infected orally with S. Typhimurium (F98) at 6 weeks of age and re-infected 10 weeks later were monitored for antibody production, T-cell proliferation and production of selected cytokines (interferon-g, interleukin-1b and transforming growth factor-b4). A strong coordinated antigen-specific humoral and cellular immune response was temporally linked to resolution of the primary infection. Enhanced levels of mRNA encoding the cytokines, interleukin-1b, transforming growth factor-b4 and interferon-g were also evident during early phases of primary infection. Secondary infection was restricted to the intestine and of shorter duration than primary infection. Splenic immune responses were not further enhanced by secondary infection; indeed, antigen-specific proliferation was significantly reduced at 1 day after secondary infection, which may be interpreted as the trafficking of reactive T cells from the spleen to the gut.

Introduction Poultry represent a major source of Salmonella enterica food poisoning in man, typically associated with the Typhimurium (S. Typhimurium) and Enteritidis (S. Enteritidis) serovars. In young chicks ( B 2 days old) infection with these serovars results in a severe systemic disease associated with high mortality (Gast & Beard, 1989). By contrast, in older chickens ( 2 to 3 days old) infection results in only minor invasion of systemic organs, with Salmonella persisting within the gastro-intestinal tract for many weeks without causing clinical disease (Smith & Tucker, 1980; Barrow et al., 1988). A number of strategies aimed at reducing infection of chickens by these serovars have been /

/

employed to varying effect, including increased standards of hygiene, improved husbandry and the use of antibiotics and vaccines (Zhang-Barber et al., 1999). Of the three, vaccination best fulfils the requirement for practical anti-Salmonella intervention without many of the risks or difficulties associated with other control measures. Vaccination of poultry using live, attenuated and killed Salmonella have given varied results depending on the model systems employed (Barrow et al., 1990; Feberwee et al., 2000; Woodward et al., 2002). Killed vaccines stimulate strong immune responses but offer a relatively low degree of protection compared with vaccination with live attenuated organisms (Barrow et al., 1990) and are considered relatively expensive and difficult to

*To whom correspondence should be addressed. Tel: / 44 1635 578 411. Fax: /44 1635 577 236. E-mail: [email protected] Received 5 June 2003. Provisionally accepted 28 July 2003. Accepted 16 September 2003 ISSN 0307-9457 (print)/ISSN 1465-3338 (online)/04/10025-09 # 2004 Houghton Trust Ltd DOI: 10.1080/03079450310001636282


26 R.K. Beal et al.

apply to large flocks. Chickens vaccinated with live attenuated Salmonella, including DNA adenine methylase (Dam) mutants (S. Typhimurium), aroA mutants (S. Enteridis and S. Typhimurium) and undefined rough mutants (S. Typhimurium) have been shown to be protected against subsequent wild-type challenge (Barrow et al., 1990; Cooper et al., 1993; Dueger et al., 2001). However, the immunology of protection is still poorly understood and attenuated Salmonella often provide lower levels of protection than prior infection with virulent Salmonella (Barrow et al., 1990). A greater understanding of the immune mechanisms that underpin clearance of virulent Salmonella provides a more rational basis for the development of effective vaccination strategies for chickens. Most previous research has concentrated on the kinetics of the humoral immune response (reviewed in Zhang-Barber et al., 1999), with much less emphasis on cellular immune responses. While many researchers have reported increased antibody levels, primarily immunoglobulin (Ig)Y and IgA (Hassan et al., 1990, 1991; Barrow, 1992; Brito et al., 1993), the relative roles of antibodies and B cells in protective immunity to Salmonella remains unclear. Infections in bursectomized chickens have provided conflicting results concerning the clearance of Salmonella from the chicken gut (Brownwell et al., 1970; Corrier et al., 1991; Desmidt et al., 1998). Cell-mediated immune responses have been less well studied but have included reports of increased delayed type hypersensitivity response to Salmonella antigens (Lee et al., 1983; Hassan & Curtiss, 1994) and changes in the distribution of T-cell and B-cell subsets during infection (Berndt & Methner, 2001). Increased percentages of CD4 and TCR1 (TCRgd) CD8 T cells were observed in peripheral blood during infection of 1-day-old chicks with S. Typhimurium. The role of T cells has also been examined using cyclosporin A to suppress T-cell activity (Corrier et al., 1991), which did not affect caecal numbers at 10 days postinfection with an S. Typhimurium infection initiated at 7 days post-hatch. However, 7-day-old chickens are immunologically immature and S. Typhimurium does not naturally resolve for up to 6 weeks in chickens infected at this age (Smith & Tucker, 1980; Gast & Beard, 1989; Beal, Wigley & Smith, unpublished work). Thus, the 10-day time point chosen in these studies is probably too early to determine T-cell dependence of clearance. Previous work has demonstrated effective protection after ‘immunizing’ challenge with wild type S. Typhimurium (quicker resolution of secondary infection) (Barrow et al., 1990). The aim of the present study was to simultaneously examine the temporal patterns of humoral, cellular and cytokine responses throughout the course of both primary and secondary challenge infections.

Materials and Methods Bacterial strains A nalidixic acid-resistant strain (Nalr) and a spectinomycin-resistant (Spcr) mutant of S. Typhimurium phage Type 14, strain F98 (S. Typhimurium F98) were used (Smith & Tucker, 1980). Bacteria were cultured in Luria Bertani (LB) broth at 378C in an orbital incubator (150 r.p.m.). For inoculating cultures, bacteria from LB agar slopes were inoculated into 10 ml LB medium (in 20 ml glass universal bottles and cultured for 18 h) from which 100 ml was used to inoculate a second volume of 10 ml LB medium. Enumeration of viable bacteria was carried out on LB agar. Experimental animals Male and female specific pathogen free inbred White Leghorn Line N chickens, bred and maintained at the Institute for Animal Health (Compton, UK) were used. The chickens were reared in wire cages and a vegetable protein-based feed (SDS, Witham, UK) and water were available ad libitum . Enumeration of bacteria Organs were removed aseptically in the following order: spleen, liver and caeca. Samples of the spleen and liver and the contents of the caeca were homogenized individually with phosphate-buffered saline (PBS) in a Stomacher 80 Biomaster (Seward, London, UK). Serial decimal dilutions were made and bacteria were enumerated on Brilliant Green agar (CM263; Oxoid, Basingstoke, UK) supplemented with either 1 mg/ ml novobiocin and 20 mg/ml sodium nalidixate (primary challenge) or 50 mg/ml spectinomycin (secondary challenge), allowing enumeration to a sensitivity of 100 colony forming units (cfu) per gram. In addition all samples were mixed with an equal volume of 2 /sodium selenite broth and incubated overnight at 378C. Salmonella -positive samples were counted as 99 cfu/g and negative samples as 0 cfu/g. Swabs were taken from the cloaca regularly throughout the experiment and were vortexmixed in 2 ml sodium selenite broth (CM0395/LP0121; Oxoid) and plated out onto Brilliant Green agar (as earlier). The swabs were then incubated overnight at 378C and the enriched swabs were plated onto Brilliant Green agar. All of the samples were plated onto agar and incubated overnight at 378C before the colonies were enumerated or scored as positive or negative (swabs). Production of soluble Salmonella lysate antigen Overnight cultures (prepared as already described) were used to inoculate 250 ml Erlenmyer flasks containing 100 ml LB medium and incubated overnight at 378C in an orbital incubator (150 r.p.m.). Bacterial cells were pelleted by centrifugation at 4080 / g for 25 min at 48C and washed twice with an equal volume of PBS followed by resuspension in 20 ml PBS. The bacterial suspension was subjected to three freeze /thaw cycles in liquid nitrogen before sonication (9 /20 sec bursts with 1 min cooling between bursts) in 10 ml volumes on ice at an amplitude of 15 mm using a Soniprep 150 (MSE Scientific Instruments, Crawley, UK). The suspension was clarified by centrifugation at 4080 / g for 20 min at 48C followed by centrifugation at 30 000 /g for 20 min at 48C to remove insoluble fractions. Protein concentrations of the soluble antigen preparation (STAgP) were measured using the Bradford protein determination kit (Merck, Poole, UK) and aliquots were frozen (/208C) until used. T-cell proliferation assays Single cell suspensions of splenocytes were prepared by passing spleens through a Falcon cell strainer (BD Biosciences, Oxford, UK) in RPMI 1640 (GibcoBRL, Paisley, UK) supplemented with 100 U/ml penicillin, streptomycin (1 mg/ml) and 5% foetal calf serum. The majority of red blood cells were removed by centrifugation at 35 /g for 10 min. The supernatant (retaining the lymphocytes and accessory cells) was adjusted to a concentration of 107 cells/ml in RPMI 1640 containing 5% foetal calf serum and added to wells of U-bottom microtitre plates (100 ml/well). Where required Salmonella STAgP in RPMI (100 ml/well) at a concentration of 16.2 mg/ml was added to the cell suspensions. After

Immune response to S. Typhimurium infection incubation at 418C in an atmosphere of 5% CO2 for 24 h, the cultures were pulsed with 1 mCi 3H-thymidine (Amersham, Little Chalfont, UK) per well for 18 h. Plates were harvested on a Tomtec Mach IIIM cell harvestor (Receptor Technologies, Banbury, UK) and incorporation of 3 H-thymidine determined on a 1450 Microbeta Trilux scintillation counter (Perkin-Elmer, Beaconsfield, UK).


Enzyme-linked immunosorbent assay Enzyme-linked immunosorbent assay plates were coated with Salmonella STAgP (16.2 mg/ml) in 100 ml/well of carbonate /bicarbonate buffer (pH 9.6) overnight and washed three times in PBS Tween-20 (0.05%) (PBS-T). Plates were pre-blocked with a blocking buffer consisting of PBS-T supplemented with 3% skimmed milk powder (Oxoid) for 1 h at 378C, after which the plates were washed in PBS-T. Serum samples were diluted 1:25 (for IgA) or 1:100 (for IgY and IgM) and titrated out on the plates in doubling dilutions in blocking buffer. Plates were incubated at 378C for 1 h and washed three times in PBS-T. S. Typhimurium F98-specific antibodies were detected by incubating with horseradish peroxidase-conjugated rabbit anti-chicken IgY (1:2000) (Sigma) or goat anti-chicken IgA (1:20 000) (Serotec, Oxford, UK) in blocking buffer for 1 h at 378C. Visualization was with 0.4 mg o phenylenediamide in citrate buffer (Kemeny & Challacombe, 1988) incubated in the dark at room temperature (218C). After 30 min the reaction was stopped with 2 M sulphuric acid and absorbance read at 490 nm on a Benchmark microplate reader (Biorad, Hemel Hempstead, UK). Quantitative analysis of cytokine mRNA Cytokine levels were quantified by a real-time reverse transcriptionpolymerase chain reaction (RT-PCR) using the ABI Prism 7700 Sequence Detection System (TaqMan† ; PE Applied Biosystems, Warrington, UK) as described by Moody et al. (2000) and Kaiser et al. (2000). Total RNA from samples of spleen and caecal tonsil that had been snap frozen in liquid nitrogen was prepared using the RNeasy mini kit (Qiagen, Crawley, UK) following the manufacturer’s instructions. Primers and probes for both cytokine and 28S RNA-specific amplification have been described previously (Kaiser et al. , 2000; Kogut et al. , 2003) but for clarity are presented in Table 1. RT-PCR was performed using the RT qPCR mastermix kit (Oswell Research Products Ltd, Southampton, UK). The reaction mixture consisted of 2 / reaction buffer (including a passive reference buffer), magnesium chloride, RNase inhibitor, dNTPs, forward and reverse primers, labelled probe, Hot Goldstar DNA polymerase, Moloney murine leukaemia virus reverse transcriptase, 5 ml diluted RNA sample (1:100 for 28S and 1:10 for all others) and made up to 25 ml with RNase-free water. Amplification and detection of specific products were performed using the ABI PRISM 7700 Sequence Detection System (PE

Table 1. RNA target 28S Probe Forward Reverse IFN-g Probe Forward Reverse IL-1b Probe Forward Reverse TGF-b4 Probe Forward Reverse

27

Applied Biosystems) with the following cycle profile: one cycle of 508C for 2 min, 968C for 5 min, 608C for 30 min and 958C for 5 min, and 40 cycles of 948C for 20 sec followed by 598C for 1 min. Experimental protocol Chicks (1 day old) were inoculated orally with approximately 1 /108 cfu of a culture of caecal flora obtained from an adult specific pathogen free chicken, as described previously (Barrow et al ., 2003) in order to standardize the gut flora of all individual chickens. At 6 weeks of age the birds were divided into two groups and housed in separate diseasesecure rooms. Group 1 were infected orally with 1.6 /108 cfu S. Typhimurium F98 Nalr in LB at 6 weeks of age and given a secondary infection (2.6 /108 cfu S. Typhimurium F98 Spcr in LB) at 16 weeks of age. Group 2 remained uninfected until 16 weeks of age when they were orally infected with 2.6 /108 cfu S. Typhimurium F98 Spcr in LB. Birds were euthanized and tissues were used for bacteriological and immunological analysis. Group 1 birds (five per time point) were euthanized 0, 1, 6, 13, 27, 34 and 69 days post primary infection (d.p.p.i.) and 1, 3, 6, 9 and 15 days post secondary infection (d.p.s.i.). Five birds from group 2 were euthanized 9 and 21 d.p.p.i. and three birds were euthanized immediately prior to infection. Statistics Statistical analysis between groups was carried out using Students t test on Microsoft Excel. Differences between experimental groups were considered significant for P B/0.05.

Results Biology of infection The number of viable S. Typhimurium F98 Nalr in the caecal contents peaked at 6 d.p.p.i. (107 cfu/g) after the primary challenge, with the infection resolving between 21 and 27 d.p.p.i. (Figure 1a). Although the caecal contents were free of Salmonella, some chickens (6/27) were still positive by cloacal swab after enrichment at the point of rechallenge (67 d.p.p.i.; data not shown). On rechallenge fewer Salmonella bacteria were detected over a shorter period than in parallel, primaryinfected age-matched birds, demonstrating en-

Quantitative RT-PCR probes and primers

Sequence (5? to 3?)

Accession number (genomic DNA)

(VIC)-AGGACCGCTACGGACCTCCACCA-(TAMRA) GGCGAAGCCAGAGGAAACT GACGACCGATTTGCACGTC

X59733

(FAM)-TGGCCAAGCTCCCGATGAACGA-(TAMRA) GTGAAGAAGGTGAAAGATATCATGGA GCTTTGCGCTGGATTCTCA

Y07922

(FAM)-GCTCTACATGTCGTGTGTGATGAG-(TAMRA) TGTCGATGTCCCGCATGA CCACACTGCAGCTGGAGGAAGCC

Y15006

(FAM)-AGGATCTGCAGTGGAAGTGGAT-(TAMRA) CCCCGGGTTGTGTTGGT ACCCAAAGGTTATATGGCCAACTTCTGCAT

M31160

28 R.K. Beal et al.


The temporal pattern of immune responses T-cell proliferation. Antigen (STAgP)-specific proliferation of splenic T cells was examined at regular intervals during primary and secondary infection. Strong antigen-specific proliferation was observed after infection (Figure 2), with an early peak between 6 and 14 d.p.p.i. followed by a brief period of reduced response seen at the 20 d.p.p.i. sample point (although proliferation was still significantly above that seen in uninfected chickens). At 27 and 35 d.p.p.i. antigen-specific proliferation increased after clearance of detectable Salmonella from the intestine. The STAgP-specific proliferative response remained elevated in all birds for at least 60 days following primary infection, although there was high bird-to-bird variation. Following re-challenge, the antigen-specific lymphoproliferative response remained higher than uninfected birds although reduced levels were consistently detected at 3, 7 and 13 d.p.s.i. compared with 35 and 67 d.p.p.i. The pattern of STAgP-specific proliferation in the age-matched primary-infected birds was comparable with that seen during primary infection with the younger birds (data not shown). Figure 1. Viable Salmonella (cfu/g) in caecal contents (1a), liver (1b) and spleen (1c) from birds challenged with S. Typhimurium F98. Group 1 birds were challenged at 6 weeks of age and re-challenged 69 days later. Group 2 birds were challenged only once on the same day birds from group 1 were re-challenged. Error bars represent the standard error (n/5). DPPI/Days post primary infection.

hanced clearance at secondary infection. No viable Salmonella were detected in the caecal contents of previously primed birds at 15 d.p.s.i., whereas primary infected birds did not begin to clear until 21 d.p.p.i.. All of the re-challenged birds were negative by cloacal swab at 13 d.p.s.i., whereas Salmonella were detected on cloacal swabs from 60% of age matched-primary infected birds. Viable Salmonella were consistently detected (5/5 birds) in the liver and spleen after primary infection (Figure 1b, c). The highest counts were observed from 6 to 13 d.p.p.i. (spleen) and 6 to 20 d.p.p.i. (liver), with counts between 102 and 103 cfu/g. At 20 d.p.p.i. viable Salmonella were detected in spleen and liver samples from a proportion of the birds tested (1/5 and 2/5, respectively). No viable Salmonella were detected in either tissue taken after 27 d.p.p.i.. Overall, the numbers of Salmonella detected in spleen and liver tissues were low, never greater than 5 103 cfu/g. Almost no Salmonella were detected in the systemic tissues of secondary challenged birds (1/25 birds with 1.7 103 and 3 102 cfu/g in the liver and spleen, respectively), whereas all of the parallel primary-infected birds were Salmonella-positive at 9 d.p.p.i..

Humoral immune responses. Serum taken from chickens at postmortem was used to measure levels of STAgP-specific IgM, IgY and IgA antibodies. The level of serum IgM reactive against STAgP increased shortly after primary infection, peaking at 13 d.p.p.i. followed by a steady decline to levels not significantly above uninfected birds (Figure 3a). On re-challenge a rise in Salmonella-reactive IgM was not detected, although a substantial increase in antigen-specific serum IgM was observed in chickens undergoing parallel primary infection. Salmonella-specific serum IgY (Figure 3b) and IgA (Figure 3c) were both detected during primary infection, peaking at 13 d.p.p.i. Following this initial rise there was a temporary reduction in the

/

/

/

Figure 2. Proliferation of lymphocytes taken from splenocytes of Line N chickens against a whole cell lysate of S. Typhimurium F98. Group 1 birds were challenged at 6 weeks of age initially and re-challenged 69 days after. Error bars represent the standard error (n/5). DPPI /Days post primary infection.


Immune response to S. Typhimurium infection

Figure 3. Serum IgM (3a) IgY (3b) and IgA (3c) from Line N chickens specific for Salmonella serovar Typhimurium F98 cell lysate. Group 1 birds were challenged at 6 weeks of age initially and re-challenged 69 days after. Group 2 birds were challenged only once on the same day birds from group 1 were re-challenged. Error bars represent the standard error (n/5). DPPI /Days post primary infection.

29

immunity. The amount of IFN-g mRNA in the spleen increased following primary challenge with levels significantly above uninfected chickens at 13 and 27 d.p.p.i. sample points (37-fold and 24-fold, respectively; Figure 4a). Immediately prior to infection (69 d.p.p.i.) levels of IFN-g mRNA had fallen significantly and were equivalent to those detected in uninfected chickens. After re-challenge infection, levels of IFN-g mRNA in the spleen did not increase significantly above levels seen in uninfected birds. As expected, substantial increases were observed in the age matched primary infection controls (data not shown). In the caecal tonsils levels of IFN-g mRNA did not significantly change at any time point following primary or secondary challenge (Figure 5a). However, uninfected chickens produced relatively high amounts of IFN-g mRNA in the caecal tonsil compared with the spleen, and small differences would be difficult to detect above such a baseline. Nonetheless, although not statistically significant, there was a suggestion of a small (mean increase, three-fold) increase in IFN-g mRNA at 20 d.p.p.i.; increases were seen in two of three individual birds (4.65 and 3.70). Dramatic increases in the pro-inflammatory cytokine, IL-1b mRNA (125,000-fold change over

levels of anti-Salmonella serum IgY at 28 d.p.p.i., followed by a sharp increase and maintenance of high levels of specific IgY for at least 69 days. This pattern was similar with anti-Salmonella IgA but without the 28 d.p.p.i. reduction in levels of circulating specific antibody. Significant levels of anti-STAgP IgA were detected throughout the post-clearance period. Following re-challenge there was no significant increase in either IgY or IgA, whereas in age-matched primary-infected birds high levels of both isotypes were stimulated by primary infection. Analysis of cytokine mRNA levels Cytokine mRNA levels in the spleen and caecal tonsils of chickens were measured with real-time quantitative RT-PCR using the TaqMan† . Cytokine mRNA levels were expressed as the fold change above the mean of those observed in the uninfected group (2(expt. sample uninfected control)). Three cytokines; interferon-g (IFN-g), interleukin1b (IL-1b) and transforming growth factor-b4 (TGF-b4) were chosen for this analysis, representing different aspects of the immune response. IFN-g is produced by many cell types including natural killer cells, CD4 and CD8 T cells, and is best characterized as a component of cell-mediated

Figure 4. Changes in cytokine mRNA in the spleen measured by TaqMan† for IFN-g (4a), IL-1b (4b) and TGF-b4 (4c). Group 1 birds were challenged at 6 weeks of age initially and rechallenged 69 days after. Each point represents the mean of 3 samples. * Significant difference over chickens before infection (PB/0.05). DPPI /Days post primary infection.

30 R.K. Beal et al.

observed during the initial infection or following re-challenge (Figure 5c).


Discussion

Figure 5. Changes in cytokine mRNA in caecal tonsils measured by TaqMan† for IFN-g (5a) IL-1b (5b) and TGF-b4 (5c). Group 1 birds were challenged at 6 weeks of age initially and re-challenged 69 days after. Each point represents the mean of three samples. * Significant difference over chickens before infection (PB/0.05). DPPI /days post primary infection.

uninfected birds) were detected 13 d.p.p.i. in the spleen, before levels rapidly returned to those seen with uninfected chickens (Figure 4b). No significant increases in splenic IL-1b mRNA were observed on re-challenge. In contrast, substantial increases in IL-1b message were detected in agematched primary-infection controls (data not shown). No changes in IL-1b mRNA were detected in caecal tonsils at any time point following primary or secondary infection (Figure 5b). As with IFN-g mRNA, the level of IL-1b mRNA in the caecal tonsils of uninfected chickens was much higher than in the spleen, posing similar constraints on detection of significant changes in message levels. TGF-b4 is a cytokine produced by a wide range of cell types that is involved in regulation of immune responses and the class switching of B cells to IgA production. Levels of splenic TGF-b4 mRNA increased significantly with a sharp peak 13 d.p.p.i., rapidly returning to levels comparable with those found with uninfected chickens. Following rechallenge no increases in TGF-b4 mRNA were observed (Figure 4c). In the caecal tonsils, high levels of TGF-b4 mRNA were detected in the uninfected birds but no increases in TGF-b4 were

Infection of chickens with S. Typhimurium clearly induces strong adaptive immune responses. In the present study we demonstrate the co-ordinate stimulation of a wide range of responses following infection with S. Typhimurium, and that resolution of enteric infection coincides with these strong responses. Oral infection of 6-week-old chickens with S. Typhimurium led to the appearance of bacteria in systemic tissues, although the majority were restricted to the intestine (less than 104 cfu/g in the spleen and liver, and up to 107 cfu/g in the caecal contents). Interestingly, upon secondary challenge Salmonella were almost completely restricted to the intestine with none detected in the spleen or liver of most chickens (24/25). These changes in systemic distribution of Salmonella were coupled with a more rapid clearance from the gut indicating the influence of adaptive immunity on infection biology. Nonetheless, clearance of Salmonella in anatomically disparate sites would require a diverse immune response to remove bacteria from the gut lumen and in the tissues (presumably in both intracellular and extracellular niches). Thus, the temporal patterns of humoral and cellular immune responses may indicate the types of response that mediate clearance of primary infection and the enhanced clearance seen with secondary challenge. Salmonella-specific serum antibody responses follow a classical pattern with a rise in levels of specific IgM preceding the rises in IgY and IgA as documented in previous reports (Hassan et al., 1990; Barrow, 1992). The contributions of systemic and enteric Salmonella in the stimulation of antibody production are unknown but all of these isotypes are documented to have been stimulated by another enterocyte-restricted pathogen, Eimeria tenella (Mockett & Rose, 1986). Elevated levels of serum IgA have been shown to correlate well with increases in secretory IgA in the gut lumen (Rose et al., 1981; Brito et al., 1993) and constitute a possible mechanism of Salmonella clearance from the gut lumen. However, studies using B-celldeficient, bursectomized chickens have provided conflicting results, suggesting that B cells are required (Brownwell et al., 1970; Desmidt et al., 1998) or are not required (Corrier et al., 1991) for efficient control of enteric Salmonella. To our knowledge this is the first detailed study of the temporal pattern of T-cell responses during S. Typhimurium infection in the chicken. During primary infection, changes in the level of antigenspecific splenic proliferation coincided with clearance of Salmonella from the caecal contents. A transient dip in lymphoproliferation was observed


Immune response to S. Typhimurium infection

in the spleen as the infection resolved, which would be consistent with trafficking of reactive lymphocytes from the spleen to the site of infection (the intestine). Coincident with a decrease in both T-cell proliferation and IFN-g mRNA in the spleen 20 d.p.p.i., there was an increase in IFN-g mRNA in the caecal tonsils (although this was not statistically significant). In this case, increased IFN-g mRNA indicates T-cell activity rather than a direct role for IFN-g in clearance of enteric bacteria. However, since IFN-g is essential in clearance of systemic Salmonella in murine models (Mastroeni et al., 1992; Hess et al., 1996; Bao et al., 2000), this may be one of the mechanisms of systemic clearance in the chicken. It is not possible to suggest that the chicken response was Th1 dominated because Th2 lymphokines have yet to be described in the chicken. Changes in numbers and proportion of immune cell types in the caecum, spleen, thymus and bursa of Fabricius have been reported with S. Typhimurium and S. Enteritidis infections (Sasai et al., 1997; Berndt & Methner, 2001). Increased numbers of CD4 cells were observed in the caeca but not in the bursa of Fabricius or spleen, and increased numbers of CD8 cells were observed in the caeca, bursa of Fabricius and spleen. Increased delayed type hypersensitivity responses were reported at 5 weeks after oral infection of chickens with S. Typhimurium (Lee et al., 1983). Interestingly, in murine models (where S. Typhimurium is largely systemic) delayed type hypersensitivity responses were negatively correlated with immunity (Hormaeche et al., 1981; Killar & Eisenstein, 1984; 1986). During secondary infection Salmonella clearance was more rapid than primary infection, consistent with previous reports (Hassan et al., 1991). Rapid resolution of infection did not correspond with measurable increases in T-cell proliferation, specific antibody production or cytokine mRNA. However, proliferation of T cells from the spleen, which had remained relatively high following primary infection, was transiently depressed following re-infection. While the reduction was not statistically significant (due to high birdto-bird variation) the data would be consistent with trafficking of Salmonella-reactive T cells from the spleen to the intestine. Lower levels of proliferation in the spleen during secondary infection may result from reduced systemic stimulation due to the absence of Salmonella in the spleen (only one of 25 birds being positive). Lower levels of IFN-g and IL-1b mRNA during secondary infections indicate a reduced inflammatory response during re-infection that might also be a result of the reduced/ absence of infection in the systemic tissues. While it is well established that IFN-g is produced by T cells and natural killer cells, recent reports suggest that other immune cell subsets, including chicken het-

31

erophils, can produce significant amounts of IFN-g mRNA (Kogut et al., 2003). Further studies are required to identify the source of IFN-g in this system. The resolution of systemic and enteric infection with S. Typhimurium correlates with strong Salmonella-specific adaptive immune responses and the production of high levels of cytokines in the spleen. While the cytokine responses returned rapidly to pre-infection levels, the antibody responses remained high for a prolonged period postresolution of infection. Interestingly, the antigenspecific T-cell response was also maintained above that of uninfected birds, suggesting the continued presence of Salmonella antigen within the host. However, the T-cell responses were highly variable between individual birds and complicated the examination of secondary responses. Persistent antibody responses, particularly of IgA, are consistent with reduced numbers of S. Typhimurium in the gut lumen after secondary challenge infection. An increased understanding of the importance of different arms of the immune response in controlling Salmonella infections in chickens will facilitate the rational design of enhanced vaccination strategies.

Acknowledgements The authors wish to thank the staff of the production and experimental units, and the Biotechnology and Biological Sciences Research Council UK for funding this research (grant no. 8/BFP11365).

References Bao, S., Beagley, K.W., France, M.P., Shen, J. & Husband, A.J. (2000). Interferon-gamma plays a critical role in intestinal immunity against Salmonella typhimurium infection. Immunology, 99 , 464 /472. Barrow, P.A. (1992). ELISAs and the serological analysis of Salmonella infections in poultry: a review. Epidemiology and Infection , 109 , 361 / 369. Barrow, P.A., Bumstead, N., Marston, K., Lovel, M.A. & Wigley, P. (2003). Faecal shedding and colonisation of Salmonella enterica in in-bred chickens; the effect of host-genetic background. Epidemiology and Infection (in press). Barrow, P.A., Hassan, J.O. & Berchieri, A., Jr. (1990). Reduction in faecal excretion of Salmonella typhimurium strain F98 in chickens vaccinated with live and killed S. typhimurium organisms. Epidemiology and Infection , 104 , 413 /426. Barrow, P.A., Simpson, J.M. & Lovell, M.A. (1988). Intestinal colonization in the chicken of food-poisoning Salmonella serotypes; microbial characteristics associated with faecal excretion. Avian Pathology, 17 , 571 /588. Berndt, A. & Methner, U. (2001). Gamma/delta T cell response of chickens after oral administration of attenuated and non-attenuated Salmonella typhimurium strains. Veterinary Immunology and Immunopathology, 78 , 143 /161. Brito, J.R., Hinton, M., Stokes, C.R. & Pearson, G.R. (1993). The humoral and cell mediated immune response of young chicks to Salmonella typhimurium and S. kedougou . British Veterinary Journal , 149 , 225 /234.


32 R.K. Beal et al. Brownwell, J.R., Sadler, W.W. & Fanelli, M.J. (1970). Role of Bursa of Fabricius in chicken resistance to Salmonella typhimurium . Avian Diseases , 14 , 142 /152. Cooper, G.L., Venables, L.M., Nicholas, R.A., Cullen, G.A. & Hormaeche, C.E. (1993). Further studies of the application of live Salmonella enteritidis aroA vaccines in chickens. Veterinary Record , 133 , 31 /36. Corrier, D.E., Elissalde, M.H., Ziprin, R.L. & DeLoach, J.R. (1991). Effect of immunosuppression with cyclophosphamide, cyclosporin, or dexamethasone on Salmonella colonization of broiler chicks. Avian Diseases , 35 , 40 /45. Desmidt, M., Ducatelle, R., Mast, J., Goddeeris, B.M., Kaspers, B. & Haesebrouck, F. (1998). Role of the humoral immune system in Salmonella enteritidis phage type four infection in chickens. Veterinary Immunology and Immunopathology, 63 , 355 /367. Dueger, E.L., House, J.K., Heithoff, D.M. & Mahan, M.J. (2001). Salmonella DNA adenine methylase mutants elicit protective immune responses to homologous and heterologous serovars in chickens. Infection and Immunity, 69 , 7950 /7954. Feberwee, A., de Vries, T.S., Elbers, A.R. & de Jong, W.A. (2000). Results of a Salmonella enteritidis vaccination field trial in broilerbreeder flocks in The Netherlands. Avian Diseases, 44 , 249 /255. Gast, R.K. & Beard, C.W. (1989). Age-related changes in the persistence and pathogenicity of Salmonella typhimurium in chicks. Poultry Science, 68 , 1454 /1460. Hassan, J.O., Barrow, P.A., Mockett, A.P. & McLeod, S. (1990). Antibody response to experimental Salmonella typhimurium infection in chickens measured by ELISA. Veterinary Record , 126 , 519 / 522. Hassan, J.O., & Curtiss, R., 3rd (1994). Virulent Salmonella typhimurium -induced lymphocyte depletion and immunosuppression in chickens. Infection and Immunity, 62 , 2027 /2036. Hassan, J.O., Mockett, A.P., Catty, D. & Barrow, P.A. (1991). Infection and reinfection of chickens with Salmonella typhimurium : bacteriology and immune responses. Avian Diseases , 35 , 809 /819. Hess, J., Ladel, C., Miko, D. & Kaufmann, S.H. (1996). Salmonella typhimurium aroA - infection in gene-targeted immunodeficient mice: major role of CD4/ TCR-alpha beta cells and IFN-gamma in bacterial clearance independent of intracellular location. Journal of Immunology, 156 , 3321 /3326. Hormaeche, C.E., Fahrenkrog, M.C., Pettifor, R.A. & Brock, J. (1981). Acquired immunity to Salmonella typhimurium and delayed (footpad) hypersensitivity in BALB/c mice. Immunology, 43 , 547 /554. Kaiser, P., Rothwell, L., Galyov, E.E., Barrow, P.A., Burnside, J. & Wigley, P. (2000). Differential cytokine expression in avian cells in response to invasion by Salmonella typhimurium , Salmonella enteritidis and Salmonella gallinarum . Microbiology, 146 , 3217 /3226. Kemeny, D.M. & Challacombe, S.J. (1988). ELISA and Other Solid Phase Immunoassays. Chichester: John Wiley and Sons Ltd. Killar, L.M. & Eisenstein, T.K. (1984). Differences in delayed-type hypersensitivity responses in various mouse strains in the C3H lineage infected with Salmonella typhimurium , strain SL3235. Journal of Immunology, 133 , 1190 /1196. Killar, L.M. & Eisenstein, T.K. (1986). Delayed-type hypersensitivity and immunity to Salmonella typhimurium . Infection and Immunity, 52 , 504 /508. Kogut, M.H., Rothwell, L. & Kaiser, P. (2003). Differential regulation of cytokine gene expression by avian heterophils during receptormediated phagocytosis of opsonized and non-opsonized Salmonella enteritidis. Journal of Interferon and Cytokine Research , 23 , 319 / 327. Lee, G.M., Jackson, G.D. & Cooper, G.N. (1983). Infection and immune responses in chickens exposed to Salmonella typhimurium . Avian Diseases , 27 , 577 /583. Mastroeni, P., Villarreal-Ramos, B. & Hormaeche, C.E. (1992). Role of T cells, TNF alpha and IFN gamma in recall of immunity to oral challenge with virulent salmonellae in mice vaccinated with live attenuated aro - Salmonella vaccines. Microbial Pathogenesis, 13 , 477 /491. Mockett, A.P. & Rose, M.E. (1986). Immune responses to eimeria : quantification of antibody isotypes to Eimeria tenella in chicken serum and bile by means of the ELISA. Parasite Immunology, 8 , 481 /489.

Moody, A., Sellers, S. & Bumstead, N. (2000). Measuring infectious bursal disease virus RNA in blood by multiplex real-time quantitative RT-PCR. Journal of Virological Methods, 85 , 55 /64. Rose, M.E., Orlans, E., Payne, A.W. & Hesketh, P. (1981). The origin of IgA in chicken bile: its rapid active transport from blood. European Journal of Immunology, 11 , 561 /564. Sasai, K., Yoshimura, K., Lillehoj, H.S., Withanage, G.S., Fukata, T., Baba, E. & Arakawa, A. (1997). Analysis of splenic and thymic lymphocyte subpopulations in chickens infected with Salmonella enteritidis. Veterinary Immunology and Immunopathology, 59 , 359 / 367. Smith, H.W. & Tucker, J.F. (1980). The virulence of Salmonella strains for chickens: their excretion by infected chickens. Journal of Hygeine, 84 , 479 /488. Woodward, M.J., Gettinby, G., Breslin, M.F., Corkish, J.D. & Houghton, S. (2002). The efficacy of Salenvac, a Salmonella enterica subsp. Enterica serotype Enteritidis iron-restricted bacterin vaccine, in laying chickens. Avian Pathology, 31 , 383 /392. Zhang-Barber, L., Turner, A.K. & Barrow, P.A. (1999). Vaccination for control of Salmonella in poultry. Vaccine, 17 , 2538 /2545.

RE´SUME´ Dynamiques temporelles des re´ponses cytokine, humorale et cellulaire chez des poulets apre`s une infection primaire et secondaire par Salmonella enterica serovar Typhimurium Les infections a` Salmonella enterica serovar Typhimurium (S. Typhimurium ) entraıˆnent une maladie syste´mique chez les jeunes poulets, alors que chez des sujets plus aˆge´s l’infection est principalement restreinte a` l’intestin. Les poulets inocule´s par voie orale avec S. Typhimurium (F98) a` l’aˆge de 6 semaines puis reínocule´s 10 semaines plus tard, ont fait l’objet d’un suivi de la production des anticorps, de la prolife´ration des cellules T et de la production de certaines cytokines (IFN-g, IL-1b et TGF-b4). Une re´ponse immunitaire forte et coordonneé d’origine cellulaire et d’origine humorale spećifique de l’antige`ne a e´te´ temporairement lieé a` la re´solution de l’infection primaire. L’augmentation des taux d’ARNm codant les cytokines, IL-1b, TGFb4 et IFN-g a e´galement e´te´ mise en e´vidence durant les premie`res phases de l’infection primaire. L’infection secondaire, n’a concerne´ que l’intestin et a e´te´ de dureé plus courte que l’infection primaire. Les re´ponses immunes spleńiques n’ont pas e´te´ augmenteés par l’infection secondaire ; en effet la re´ponse spećifique de l’antige`ne a e´te´ re´duite significativement apre`s l’infection secondaire (un jour), ce qui peut eˆtre interpre´te´ comme la circulation des cellules T reáctives de la rate vers l’intestin.

ZUSAMMENFASSUNG Zeitliche Dynamik der zellula¨ren, humoralen und Zytokinantworten in Hu¨hnern nach Prima¨r- und Sekunda¨rinfektion mit Salmonella enterica Serovar typhimurium Salmonella enterica Serovar typhimurium (S. typhimurium )-Infektionen verursachen in jungen Hu¨hnerku¨ken eine systemische Erkrankung, wa¨hrend die Infektion in a¨lteren Hu¨hnern meistens auf den Darm beschra¨nkt ist. Hu¨hnerku¨ken, die im Alter von 6 Wochen oral mit S. typhimurium (F98) infiziert und 10 Wochen spa¨ter reinfiziert wurden, wurden auf Antiko¨rperbildung, T-Zellproliferation und Produktion von bestimmten Zytokinen (IFN-g, IL-1b und TGF-b4) untersucht. Eine streng koordinierte Antigen-spezifische humorale und zellula¨re Immunantwort war zeitlich mit der Sta¨rke der Prima¨rinfektion verbunden. Wa¨hrend der Fru¨hphase der Prima¨rinfektion waren erho¨hte Konzentrationen der fu¨r die Zytokine IL-1b, TGF-b4 und IFN-g kodierenden mRNS erkennbar. Die Sekunda¨rinfektion war auf den Darm beschra¨nkt und war von ku¨rzerer Dauer als die Prima¨rinfektion. Die Immunantworten der Milz wurden durch die Sekunda¨rinfektion nicht weiter versta¨rkt; de facto wurde die Antigen-spezifische Proliferation einen Tag nach der Infektion signifikant reduziert, was als eine Verlagerung der reaktiven T-Zellen von der Milz in den Darm interpretiert werden kann.

Immune response to S. Typhimurium infection RESUMEN Dina´mica temporal de las respuestas celular, humoral y de citoquinas en pollos durante la infeccioń primaria y secundaria por Salmonella enterica serovar Typhimurium


Las infecciones por Salmonella enterica serovar Typhimurium (S. Typhimurium) producen una enfermedad siste´mica en pollos jo´venes, mientras que en pollos de mayor edad la infeccioń queda restringida principalmente al tracto intestinal. Se monitorizaron la produccioń de anticuerpos, la proliferacioń de ce´lulas T y la produccioń de citoquinas seleccionadas (IFN-, IL-1b y TGF-b4) en pollos infectados oralmente con S. Typhimurium (F98) a las 6 semanas de edad y reinfectados 10

33

semanas ma´s tarde. Una respuesta inmune humoral y celular fuertemente coordinada y especı´fica frente al antı´geno se hizo frente a la infeccioń primaria. Durante las primeras fases de la infeccioń primaria tambień se evidencio´ un aumento en los niveles del mARN que codifica para las citoquinas, IL-1b, TGF-b4 y IFN-g. La infeccioń secundaria quedo´ restringida a nivel intestinal y fue de menor duracioń que la infeccioń primaria. La infeccioń secundaria no aumento´ las respuestas inmunes espleńicas; en realidad, la proliferacioń antı´geno especı´fica se redujo de forma significativa en el dıá 1 tras la infeccioń secundaria, lo cual podrıá interpretarse como una circulacioń de ce´lulas T reactivas desde el bazo al intestino.