Thank you,…, for introducing me so nicely, and…Good morning ...

JBC Papers in Press. Published on July 5, 2011 as Manuscript M111.249359 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M111.249359

1 RNA Folding in Transcription Elongation Complex: Implication for Transcription Termination Running title: Co-transcriptional RNA folding and its effect on transcription termination Lucyna Lubkowska1, Anu S. Maharjan2,3,4,5, and Natalia Komissarova1,2,4,6* 1

NCI Center for Cancer Research, Frederick Cancer Research and Development Center, Frederick, MD, 21702 2 National Institute of Child Health and Human Development, National Institutes of Health, 6 Center Drive, Bethesda, MD 20892 3 Smith College, Northampton, MA 01063 4 Current Graduate Program: Rice University, Houston, TX 77005 5 Present address: Texas A&M University, College Station, TX 77843 6 Present address: NCI, 37 Convent Drive, Bethesda, MD 20892 * Correspondence: [email protected] other time sensitive co-transcriptional processes in pro- and eukaryotes. RNA is involved in nearly every aspect of gene expression, and the formation of specific three-dimensional structures is often crucial for RNA functionality. Among other biological processes, RNA conformation is important for translation (1,2), plasmid replication (3,4), RNA splicing (5), RNAi-induced gene silencing (6-8), gene control by riboswitches (9), transcription pausing, antitermination, and termination (10-14). In the cell, folding of RNA occurs cotranscriptionally. This fact dictates the folding pathway because the upstream part of RNA can fold before the downstream part is synthesized by RNA polymerase (RNAP) 1 , (15-17). Such sequential folding leads to accumulation of metastable folding intermediates, which can prevent or delay refolding of the RNA into the thermodynamically favorable and functional conformation upon completion of the transcript synthesis. Such kinetic traps can be affected by variation in the rate of RNA elongation. For example, transcription of bacterial ribosomal RNA genes, or of a replication primer for ColE1 plasmid, by a foreign RNAP from phage T7 results in formation of non-functional RNAs, presumably because T7 RNAP is faster than the cognate E.coli RNAP (18,19). A delay in RNA folding into functionally active conformation can 1

The abbreviations used are: RNAP, RNA polymerase; EC, elongation complex; TH, termination hairpin; TB, transcription buffer

Copyright 2011 by The American Society for Biochemistry and Molecular Biology, Inc.

Downloaded from http://www.jbc.org/ by guest on December 11, 2017

Intrinsic transcription termination signal in DNA consists of a short inverted repeat followed by a T-rich stretch. Transcription of this sequence by RNA polymerase (RNAP) results in formation of a “termination hairpin” (TH) in the nascent RNA and in rapid dissociation of the transcription elongation complex (EC) at termination points located 7-8 nt downstream of the base of TH stem. RNAP envelops 15 nt of the RNA following RNA growing 3’ end, suggesting that folding of the TH is impeded by a tight protein environment when RNAP reaches the termination points. To monitor TH folding under this constraint, we halted E. coli ECs at various distances downstream from a TH and treated them with single-strand specific RNase T1. The EC interfered with TH formation when halted at 6, 7, and 8, but not 9, nt downstream from the base of the potential stem. Thus, immediately before termination, the downstream arm of the TH is protected from complementary interactions with the upstream arm. This protection makes TH folding extremely sensitive to the sequence context, because the upstream arm easily engages in competing interactions with the rest of the nascent RNA. We demonstrate that by de-synchronizing TH formation and transcription of the termination points, this subtle competition significantly affects the efficiency of transcription termination. This finding can explain previous puzzling observations that sequences far upstream of the TH or point mutations in the terminator that preserve TH stability affect termination. These results can help understand

2 (34), at other terminators, TH does not shift the enzyme (35). In the latter scenario, it is hard to conceive how, at the termination point, the left arm of the hairpin can reach the ninth nucleotide from the RNA 3’ end, which is buried deeply inside RNAP (Fig. 1A, B). Note, that hairpin formation brings together four chains of the RNA: the 3’ proximal RNA, the double stranded hairpin stem, and the upstream RNA. Here, we studied the TH folding pathway in the context of the EC in order to understand how the EC affects this folding. More importantly, we wanted to investigate the consequences of any EC-imposed constraint on the folding and functioning of the nascent RNA. To monitor TH folding, we stopped RNAP translocation at various distances downstream from the hairpin and measured the extent of base pairing by probing the RNA with single-strand specific RNase T1. By utilizing different sequences, we created a comprehensive picture of TH hairpin folding pathway. Our results provide an explanation of previous observations that the efficiency of terminators strongly depends on sequence context (36-39) and have broader implications for understanding co-transcriptional folding of the RNA. EXPERIMENTAL PROCEDURES Transcription templates and transcription reactions - The transcribed sequences of the templates are shown in the Figures. The promoter region was either the 71 bp sequence of the A1 promoter of bacteriophage T7 or the 121 bp sequence of the GalP1 promoter of E.coli (for tR2/T/GalP1 template of Fig. S6). The GalP1 promoter template, in which the -10 element was brought to consensus, was a gift of Dr. K. Severinov. The templates were obtained by PCR and purified using a PCR purification kit (Qiagen). RNAP carrying a hexahistidine tag at the β’ subunit was purified from the RL916 strain (obtained from Dr. R. Landick) as described (40). Transcription was initiated by incubation of 2 pmols of RNAP with 2 pmols of template in 5 µl of transcription buffer (TB; 20 mM Tris-HCl [pH7.9], 40 mM KCl, 5 mM MgCl2, 1 mM βmercaptoethanol) for 5 min at 37oC followed by the addition of 100 µM triribonucleotide RNA primer ApUpC and 20 µM GTP, CTP, and UTP


give a time window for regulation of time sensitive biological processes, in which RNA structure is involved. Among these processes are translation (20), ribosome assembly (21,22), and alternative splicing (5,23,24). Time sensitive processes that are tightly coupled with transcription, including RNA splicing, transcription pausing, termination, and antitermination are expected to be particularly sensitive to the kinetic traps. To understand the effect of RNA folding on the co-transcriptional processes, one should keep in mind that folding occurs in the context of the elongation complex (EC), the highly stable ternary complex formed by RNAP, DNA, and nascent RNA. The stable EC falls apart during termination. In prokaryotes, intrinsic termination is triggered by a short stem-loop structure formed by the nascent RNA (“termination hairpin”, TH) followed by a run of U residues (Fig. 1A, 25). RNA synthesis stops and the EC dissociates at the termination points, typically located at the 7th and 8th U of the run (henceforward called the h+7 and h+8 positions, respectively, Fig. 1A). In elongation, RNAP (consisting of five subunits, α2β’βω) forms a clamp embracing the DNA and the RNA (Fig. 1B). The 3’ end of the RNA is kept at the catalytic center of the enzyme positioned on the bottom of the clamp (26-28). The two DNA strands are separated in the region of the hybrid, forming transcription bubble (29). RNAP covers 20 nt of the DNA downstream and 15 nt upstream from the catalytic center (26). Eight 3’-proximal nt of the RNA are base-paired to the template DNA strand forming RNA:DNA hybrid (30,31). Beyond the 8 nt, the RNA is segregated from the template into a narrow cylindrical channel on the interface of the two largest subunits, β’ and β (28). This RNA exit channel encloses 7 bases of the single stranded RNA (28,32). Only RNA residues located further than 15 nt from the 3’ end are extruded from RNAP as evidenced by their accessibility to RNases (32). RNA exit channel is formed by flap (a flexible loop of β subunit) as well as by rudder and lid loops and Zn-finger domain of β’ subunit (Fig. 1B). Formation of a complete TH is essential for termination (33). Although it has been proposed that at some terminators TH formation is accompanied by forward translocation of RNAP

3 For the experiment with free RNA, ECh+5 or ECh+7 were separated by denaturing PAGE, the radioactive RNA band was cut from the gel, RNA was extracted from the gel twice by incubation with TB and treated with RNase T1 as described above. Transcription termination - For the termination test, the immobilized ECs were incubated with four NTPs in 10 µl TB containing 300 mM KCl (except in Fig. S4) for 3 min, then combined with gel loading buffer and analyzed by PAGE. In the experiments of Figs. 5D, 6B, and supplemental Fig. S4, the immobilized ECs were incubated with 4 NTPs in the indicated conditions in 20 µl TB, briefly vortexed and centrifuged, 10 µl of the supernatant were removed and combined with 10 µl gel loading buffer (S fraction), the remaining 10 µl of the supernatant and pellet were also combined with 10 µl gel loading buffer (P fraction). The fractions were analyzed by PAGE. Transcription termination after RNase T1 cleavage - ECh-36 obtained using template tT2/T/long and labeled in the twelfth C from transcription start site was incubated for 5 min with 5 mg/ml RNaseA or with 5,000 U/ml RNase T1, washed ten times with TB, then incubated with indicated concentrations of four NTPs in 10 μl TB containing 300 mM KCl and analyzed by PAGE. RESULTS Templates used to study terminator hairpin folding - To address hairpin folding, we created a series of templates mimicking the tR2 terminator of phage lambda, a well-studied intrinsic transcription terminator (33,34,38,39,4143), which does not support forward translocation of RNAP (35). The tR2 terminator consists of a hairpin, which has a 7 bp stem and an 8 nt loop, followed by an oligoU track (Fig. 1A). Since we chose to assess the hairpin folding employing RNase T1, which cleaves RNA on the 3’ side of unpaired G residues, we substituted all but one G in the left (i.e., the upstream) arm of the stem and in the loop of tR2 hairpin with other residues, while correspondingly changing the right arm so as to preserve the base pairing. In different templates, we varied the position of this single G within the left arm. The transcribed sequences of templates G1, G3, G5, and G7 are shown in Fig. 2A. We refer to the residues in the left arm of the


for another 5 min. For template G3S, the added nucleotides were GTP, CTP, and ATP; for template tR2/T/long the nucleotides were GTP and ATP. The procedures that follow were done at 25oC. The formed EC was immobilized on 20 µl of Ni-NTA agarose beads (Qiagen) prewashed with TB. After 5 min incubation, the immobilized EC was washed five times by resuspending the beads in 1 ml TB and brief centrifugation. The immobilized ECs were walked to the desired position of the templates by incubation with 5 µM NTP subsets in 20 µl TB for 3 min followed by washing. The transcript was labeled in the Ah+1 and Ah+2 positions in ECh+2 , in the Ah+4 position in ECh+5, h+6, h+7, h+8, h+9 by incubation with 40 μCi [α-32P]ATP (New England Nuclear, 3000 Ci/mmol). For termination experiments on templates G1, G1/T, G3/T, G1L/T, tR2/T, the transcript was labeled in the A position of the loop; for termination experiments on template tR2/T/long, the transcript was labeled in the twelfth C from the transcription start site by incubation with 40 µCi [α-32P]CTP (New England Nuclear, 3000 Ci/mmol). The ECs were cleaved with RNase T1 or chased with four NTPs (as described below) and separated by denaturing urea PAGE. The gels were exposed to X-ray film or scanned on Phoshoimager and analyzed by Image Quant software. Cleavage of the RNA with RNase T1- The immobilized ECs were incubated in 50 µl TB with 500 U/ml RNase T1 (Boeringer Mannheim). Ten microliter aliquots were taken at the time points indicated in the Figures, combined with 3 µl of phenol and vortexed immediately for 5 sec. The last samples in the kinetics were washed with 1 ml TB, volume was brought back to 10 μl, 3 µl of phenol were added. Each sample was combined with 10 μl of gel loading buffer (50 mM EDTA, 10 N urea) and analyzed by denaturing PAGE. We previously demonstrated that using high concentrations of ribonucleases produces misleading results regarding the state of the nascent transcript in the ECs (32). This artifact occurs because the treatment used to inactivate the RNase causes the disintegration of the EC before the RNase loses its activity, and the RNase cleaves the transcript released from the denatured EC. However, RNase T1 does not cause this artifact when used at a concentration of 500 U/ml (32).

4 extensively cleaved (Fig. 2B, lanes 1-12; Fig. S1 clarifies the results presented in Fig. 2B). This sensitivity of G1 to RNase T1 demonstrates that the last base pair of the stem was not formed in these complexes even though the stem-encoding sequence (and a few more nt) had been synthesized. This result shows that EC interferes with the hairpin formation. Indeed, in the free RNA isolated from ECh+5, G1 was protected by the TH from cleavage with RNase T1 (Fig. 2C, lanes 1-5). To confirm that our conditions discriminated between paired and unpaired G residues, we treated with RNase T1 transcripts isolated from ECh+5 made on templates G1 and G1/mis. G1/mis template contained substitutions that kept G1 and C2 of the left arm of the hairpin unpaired (see Fig. 2A, C). After 20 min incubation of the free RNA with RNase T1, the fully complementary hairpin remained intact but the mismatched hairpin was cleaved at the G1 position (Fig. 2C, lanes 5 and 10). In ECh+6 and ECh+7, G1 remained sensitive to RNase T1 (Fig. 2B, lanes 13-24), demonstrating the lack of base pairing in these complexes. Tr2 hairpin destabilizes ECh+7 most strongly of all downstream ECs (33 and supplemental Fig. S2A, B). Correspondingly, in ECh+7, we observed two products of cleavage: one product was removed by washing the beads while the other remained bound to the EC (Fig. 2B, lanes 23 and 24). The former product resulted from the cleavage of the RNA released from the unstable ECh+7. This released RNA was cleaved at Gh+5, as confirmed by the cleavage of the free h+7 RNA in lanes 25-29 (see also supplemental Fig. S1). In ECh+8 and ECh+9, by contrast, G1 became resistant to cleavage (lanes 30-41). In these complexes, G1 can be protected by formed hairpin stem, by RNAP, or by both. To distinguish among these possibilities, we tested cleavage of G1 in the ECs obtained on G1/mis template. In ECh+8 obtained using this template, G1 was resistant to cleavage (Fig. 2D, lanes 11-15), presumably because the bottom part of the hairpin was brought inside RNAP despite the fact that it could not form base pairs. We speculate that in ECh+8 obtained using template G1, which generated fully complementary TH, the hairpin was formed fully inside RNAP. In other words, the protection of the base of the TH in ECh+8 (Fig. 2B, lanes 30-35)


hairpin according to their position relative to the beginning of the hairpin sequence. In template G1, the single G, G1, was located at the very base of the stem (see also schemes in Fig. 2C and 7A). In template G7, the single G, G7, was the farthest one from the base of the stem and the closest one to the loop. All the experiments were done with a Histagged RNAP from E. coli immobilized on NiNTA agarose beads to allow step-wise “walking” of RNAP along the template (40) by alternately using incomplete sets of nucleoside triphosphates (NTPs). To stall the ECs at any position downstream from the hairpin, we substituted the oligoT track of the tR2 terminator with a sequence that allowed walking in single nucleotide steps by NTP omission. In addition, this new downstream sequence provided a stronger RNA:DNA hybrid to stabilize the ECs halted downstream of the hairpin against hairpin-induced dissociation (33). We refer to the halted ECs according to the location of the RNA 3’ ends relative to the end of the hairpin sequence. For example, ECh+5 has been halted 5 nt from the base of the stem. The templates contained the strong phage T7A1 promoter; three nt at the start site of transcription (AUC) were retained as in the wt T7A1 sequence in order to maintain accurate start site selection and efficient initiation. Cleavage of the base of the TH with RNase T1 - First, we probed with RNaseT1 a series of ECs halted two to nine nt downstream from the TH of template G1. In this, and in all other RNase cleavage experiments, the RNA was labeled at the 3’ end in Ah+1, h+2 positions in ECh+2 and in Ah+4 position in ECh+5 through ECh+9. Labeling in A h+4 position was equivalent to the 3’ end labeling for these ECs, because 14-16 3’ proximal nt are normally protected by RNAP (32). For the same reason, G residues in the right arm of the hairpin were expected not to be cleaved. Therefore, G1 residue was the only G potentially accessible by RNase T1 (see supplemental Fig. S1 for clarification). The ECs were treated with 500 U/ml RNase T1 for various time periods. Since RNA hairpins render the ECs unstable (33,44), the samples taken at the last point of each kinetics were washed to distinguish the RNA cleaved in the EC from the RNA cleaved after release from the EC. In ECh+2 and h+5, residue G1 was

5 but the 3’ ends ranged from position h-7 to h0. While no strong alternative structures were found for three of the templates, G3 produced two structures with similar free energies, when four downstream nt of the hairpin were excluded from the folding (i.e., when the 3’ end of the folded sequence was at h-4, Fig. 4B). The first structure was a predecessor of the TH; in the second, more stable structure, G3 was paired with a C residue that would be located in the loop of the TH. This situation would arise if the EC prevented the ten 3’-proximal nt of the transcript from participation in the folding. To see if the predicted alternative structure explains the lack of RNase T1 cleavage in ECh+6 obtained using template G3, we changed the sequence of this template in the ways that selectively weakened the alternative structure (templates G3S and G3L [named so for substitutions in the stem and the loop]; Figs. 4C and D and supplemental Fig. S3). In h+6 complexes obtained using these templates, G3 regained sensitivity to RNase T1, indicating that it was not paired with the right arm of TH. ECh+7 obtained on either template efficiently dissociated and the free RNA was cleaved at Gh+5 residue. In ECh+8, there was no cleavage, which confirmed the formation of the hairpin in this complex. We concluded that the predicted alternative structure accounts for the RNase resistance of residue G3 in ECh+6. Alternative structures affect termination Taken together, the results of RNase T1 cleavage of ECs halted downstream from the hairpins modeled after the tR2 terminator suggest that the TH formation starts when RNAP transcribes at 7 nt downstream from the stem and completes at 8 nt downstream from the stem (as shown schematically in Fig. 7A). These positions represent two termination points of the tR2 terminator. The TH formed during transcription of template G1 supported efficient termination when the template was modified to include an oligoT track (template G1/T, Fig. 5 A and 5B, lanes 1,2). Even in the absence of an oligoT track (template G1), RNAP terminated transcription at positions h+7 and h+8 and released RNA, although with a much reduced efficiency (supplemental Fig. S4). The ability of RNAP to terminate accurately in template G1 validates our using this template to address TH formation in the experiments described above.


was caused by both hairpin stem formation and by RNAP. We think that the bottom of the stem was brought inside RNAP during a major structural transformation, which occurred in the EC when the enzyme translocated from the h+7 to the h+8 position. We make this conclusion because, unlike in ECh+8, in ECh+7 formed on the mismatched template, G1 was sensitive to RNaseT1 (Fig. 2D, lanes 6-10). We tested the formation of the top of the hairpin in the next experiment. Probing the entire left arm of the hairpin To probe base-pairing at the other positions of the stem, we tested the RNase sensitivity of a series of complexes obtained using templates G3, G5, and G7 (Fig. 3). In ECh+2 and ECh+5, residues G3, G5, and G7 were cleaved, indicating that not a single base pair of the hairpin was formed as RNAP transcribed up to five nt downstream from the stem. In ECh+6, an unexpected pattern of cleavage was observed: G5 and G7 were cleaved but G3 was not. This result suggests an unusual RNA structure in ECh+6, which is addressed in the next section. In ECh+7, G3, G5, and G7 were protected from cleavage suggesting the formation of the upper portion of the hairpin. Note that the RNA released from ECh+7 was cleaved at position Gh+5, as expected. In ECh+8, none of the G residues in the left arm were cleaved, indicating full hairpin formation. However, even in ECh+8, the EC still impedes the hairpin folding as will be discussed later. Importantly, the protection of the left arm in ECh+8 was not caused by backtracking of RNAP to that region (45) because in ECh+8 obtained on tR2 template, which encoded G residues in the loop of the hairpin, the G residues of the loop were sensitive to RNaseT1 (supplemental Fig. S2A, C). Hairpin formation in ECh+6 - In ECh+6, G3 was protected from RNase T1 (Fig. 3A) while G1, G5, and G7 were cleaved (Figs. 2B, 3B and C), which suggested an unlikely RNA conformation in the EC (see Fig. 4A). However, the formation of a structure alternative to the TH by the portion of the RNA extruded from the EC could also explain this result. In search of such a structure, we computationally mimicked co-transcriptional folding using four series of RNA sequences corresponding to each of the four templates (46). Each RNA began at the start site of transcription,

6 compared to 52% on the long template; in 10 μM NTPs, the lower concentration that increases termination, the readthrough is 2% and 13% (Fig. 6B). The addition of an oligonucleotide complementary to the first 30 nt of the transcript increased termination efficiency on the tR2/T/long template (supplemental Fig. S5), which pointed to the existence of a secondary structure competing with the TH. Computer-assisted folding of the terminated RNA (ending at h+7 position) did not reveal any structure strong enough to compete with the TH (46). However, when ten 3’ proximal nt of the transcript were excluded from the folding, the 5’ end of the RNA showed a potential to base pair with the most upstream residues of the terminator stem (Fig. 6C). To test if these interactions indeed inhibited termination on the tR2/T/long template, we walked RNAP to 20 nt from the start site to form ECh-36. We treated the complex with either pyrimidine-specific RNase A, which cleaved off three 5’ terminal nt, or with Gspecific RNase T1, which cleaved off six 5’ terminal nt (Fig. 6D and E). The rest of the transcript was protected from the RNases by RNAP (32). After washing off the RNases, we chased the truncated complex. The removal of just three 5’ terminal nt significantly increased the relative amount of terminated product, and the removal of six nt caused a further increase (Fig. 6E). DISCUSSION Fig. 7A depicts the pathway of TH formation in the context of the EC based on RNase T1 cleavage patterns. In ECh+5, RNase T1 cleaved the RNA at all G residues of the left arm of the hairpin. In ECh+6, residues G1, G5, and G7 were also cleaved. Residue G3 was cleaved in two of the three templates (G3L and G3S), but not in template G3, where it was protected by an alternative secondary structure. Thus, in ECh+5 and ECh+6, the TH had not yet formed. In ECh+7, treatment with RNase T1 revealed two fractions, which reflected the pronounced tendency of the TH to dissociate the complex. In one fraction of ECh+7, G1 but not G3, G5, and G7 were cleaved by RNase T1, suggesting the formation of the “top” part of the hairpin. The completion of the hairpin is prevented by both


The results obtained with ECh+6 point to the ease, with which the exposed portion of RNA forms secondary structures that compete with the TH. This tendency revealed in static halted ECs should strongly affect termination efficiency in a dynamic setting. We detected competing structures structures in halted ECs formed using template G3 but not G1. Correspondingly, during uninterrupted transcription in the presence of all four NTPs, termination was less efficient on G3/T template than it was on G1/T template (Figs. 5A and B). However, the G3 hairpin was slightly weaker than the G1 hairpin, a difference that could contribute to reduced termination. To further test the hypothesis that a transient alternative RNA structure can affect termination efficiency, we designed another hairpin, G1L, that had the same calculated free energy of formation as the G1 hairpin but contained two substitutions in the loop (template G1L, Figs. 5A and C). In ECh+8 obtained using the G1L template, an alternative secondary structure, in which the G1 residue is not basepaired, is possible when 10 nt of the 3’ end are excluded from folding (Fig. 5C). Indeed, we found that residue G1 was RNase-sensitive in ECh+8 obtained on G1L, unlike its resistance in template G1 (Fig. 2B, lanes 30-35, and Fig. 5C, lanes 7-12). This result shows that despite the fact that the TH can form in ECh+8, the EC still impedes the folding. In ECh+9, the RNA was resistant to RNase T1 on both templates because a greater portion of the hairpin is free from RNAP, and this is expected to disfavor the alternative structure. In agreement with the existence of the alternative structure competing with the TH in the static conditions, termination, probed in dynamic conditions, was much weaker on the G1L/T template than on G1/T template (Figs. 5A and D). Sequence context affects termination efficiency via weak transient competing interactions - The propensity of the left arm of the hairpin to participate in competitive interactions makes termination highly dependent on sequence context, even when the TH itself is not changed at all. In template tR2/T, the tR2 terminator is closer to the start site of transcription than in template tR2/T/long: the hairpin sequence begins at 3 and 34 nt downstream from the start site, respectively (Fig. 6A). In 100 μM NTPs, 17 % of the ECs read through tR2 terminator on the short template, as

7 melting of the adjacent base-pairs of the RNA:DNA hybrid (33). Shortening of the hybrid destabilized the EC and also contributed to termination of transcription. We propose that similar rearrangements occur in ECh+7 as well, but they cannot be detected because of immediate dissociation of the complex upon completion of the hairpin. Our finding that the EC interferes with the formation of the TH can explain some previous observations. All termination models agree that hairpin formation is necessary and sufficient for cessation of RNA synthesis and RNA release, if the hairpin is followed by a U-rich sequence. The stability of the hairpin but not its particular sequence is believed to affect termination efficiency. This view is supported by the fact that a great variety of the hairpins function in E.coli as the components of intrinsic terminators (50). At the same time, it was reported that some mutations that did not alter or even increased the stability of the hairpin decreased termination efficiency (38,39). These results suggested that the sequence the hairpin is important for elongation-termination choice, due to specific interactions of the hairpin with RNAP (38). In addition, it was found that the same terminators controlled by different promoters function with different efficiency (36,37). These results led to models, in which promoter-proximal sequences affected termination capacity of RNAP by modifying the conformation of the enzyme (36,37). However, such RNAP conformations have never been specifically characterized. The authors (36,37) considered an alternative explanation, in which some segment of promoterproximal sequences linked to these various promoters could anneal to the left arm of the TH because of extensive homology to it by a mechanism similar to transcription attenuation in bacteria (11). However, computer assisted folding did not find the expected base pairing in vast majority of the constructs. EC interference with folding of the hairpin, reported here, significantly broadens the range of base pairing opportunities that can affect termination (Fig. 7B). On many sequences, in the absence of EC interference, no structure strong enough to complete with the TH can form (Fig. 7B, top scheme). However, since RNAP sequesters the right arm of the TH, the left arm of the hairpin is highly susceptible to minor competitive interactions, which delay the


RNAP protein and RNA:DNA hybrid. The other fraction of ECh+7 was not cut at any of these Gs but it dissociated in the course of the treatment with RNase T1. We think that in this fraction, full TH formed and it instantly dissociated the EC. Because of this exceptional instability of ECh+7 (supplemental Fig. S2B), the full hairpin could not be detected with RNase T1 in this complex. ECh+8 was the first complex where protection of all the G residues was detected at mos templates, revealing the formation of the full hairpin. At some sequences, RNAP still impeded hairpin folding and enabled formation of alternative structures. The proposed pathway of TH formation clarifies important details of the intrinsic termination mechanism. First, our data show that in ECh+7 (the position corresponding to the first termination point) the hairpin is partially formed in a way that mimics a pausing hairpin (Fig. 7A). This finding supports the idea that hairpindependent pausing is a part of the termination process (33,47). Second, the results of G1 cleavage in ECh+7 and ECh+8 on G1/mis template suggest a major structural rearrangement of the EC occurring between these two positions. Current models of termination imply that hairpin formation destabilizes the EC by causing forward translocation of the RNAP, shearing of the RNA:DNA hybrid, or major changes in RNAP conformation (33,34,48,49). In the ECs formed on G1/mis template, the sequence allowed formation of five base pairs at the top of the stem but did not allow formation of the base pairs at the bottom of the stem (Fig. 2D). As expected, G1 was cleaved by RNase T1 in ECh+7, but, surprisingly, was resistant to the cleavage in ECh+8. This result suggests that in ECh+8, the bottom of the stem is brought inside RNAP by the force of partial formation of the TH. X-ray structures of RNAP show that the width of the RNA exit channel remains the same along the whole channel (28). In this case, the protection of the mismatched base of the stem in ECh+8 signifies that the TH formation causes major EC rearrangement, which may be necessary for RNA release. These rearrangements can involve shifting of RNAP domains that collide with the hairpin (see Fig. 1B), or opening of the entire RNAP clamp. Earlier, we found that a complete hairpin that formed in ECh+8 caused

8

1. 2. 3. 4. 5. 6. 7. 8. 9.

Therefore, longer stems could be more efficient since the hairpin can nucleate well before termination point is transcribed to ensure the timely completion of the TH. However, it remains unclear how a hairpin can cause termination at broadly distributed multiple sites downstream from the stem as was reported in at least one case (51). X-ray crystallography demonstrated that pro- and eukaryotic RNAPs have remarkably similar structural features (52) implying common mechanisms of their functioning and regulation. RNAPII terminates in vitro at an intrinsic bacterial terminator (33) suggesting that many rules defining stability of the EC and folding of nascent RNA are common for pro- and eukaryotic RNAPs. We propose that EC interference with transcript folding can affect the formation of functional RNA in both pro- and eukaryotes and can influence such regulatory processes as cotranscriptional binding of proteins to RNA, transcription pausing, termination, and RNA splicing. Acknowledgments - We thank Mikhail Kashlev and Robert Weisberg for providing facilities for the research in their labs, Robert Weisberg for reading the manuscript and critical advice, Arkady Mustaev for comments and help with Fig. 1B, Michael Lichten for suggestions on the manuscript, Robert Landick for strain RL916, Konstantin Severinov for the GalP1 template, and Shelley Lloyd for participating in the early stages of this project. This work was supported by the Intramural Research Program of the National Cancer Institute, Center for Cancer Research, and the Eunice Kennedy Shriver National Institute of Child Health and Human Development.

Geissmann, T., Marzi, S., and Romby, P. (2009) RNA Biol 6, 153-160 Spirin, A. S. (2004) RNA Biol 1, 3-9 Tomizawa, J. I., and Itoh, T. (1982) Cell 31, 575-583 Cesareni, D. W. B. a. G. (1985) Trends in Biochemical Sciences 10, 303-306 Hiller, M., Zhang, Z., Backofen, R., and Stamm, S. (2007) PLoS Genet 3, e204 Iida, T., Nakayama, J., and Moazed, D. (2008) Mol Cell 31, 178-189 Moazed, D. (2009) Nature 457, 413-420 Bartel, D. P. (2004) Cell 116, 281-297 Breaker, R. R. (2009) Future Microbiol 4, 771-773


formation of the TH (Fig. 7B, bottom scheme). Such interactions can involve RNA sequences located significantly upstream of the TH but brought close to it by overall folding of the transcript. As a result, the TH is not formed when RNAP transcribes the point of termination, and termination is suppressed. Such subtle RNA-RNA interactions could explain in many cases the dependence of termination efficiency on hairpin sequence and on the sequence context. In agreement with this model, single molecule assays showed that application of a weak force pulling the RNA 5’ end away from RNAP increased termination efficiency (35). This force was not sufficient to pull the EC apart or to unfold the TH, and it was proposed that it unfolded smaller secondary structures that compete with the TH. We excluded the possibility that initiation mode affects RNAP ability to terminate by showing that RNAP initiating at two different classes of promoters has the same termination properties (supplemental Fig. S6). Our results allow making predictions of terminators’ efficiency depending on their structure. These predictions are based on our conclusion that the timing of TH folding and transcription of the termination point should be strongly coordinated so that complete hairpin is formed by the time RNAP transcribes the termination point. Increasing the size of the loop should decrease termination efficiency, because it would enable the subtle interactions with the upstream RNA competing with the TH. For the same reason, terminators with longer stems can be less efficient. On the other hand, the protein interference with hairpin folding in RNA exit channel defines the minimal size of TH stem (6-7 bp) because the first base pair can form only when both complementary RNA bases exit the channel.

9 10. 11. 12. 13.

14. 15. 16.

19. 20. 21. 22. 23. 24. 25.

26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36.


17. 18.

Palangat, M., Meier, T. I., Keene, R. G., and Landick, R. (1998) Mol.Cell 1, 10331042 Yanofsky, C. (2007) RNA 13, 1141-1154 King, R. A., Banik-Maiti, S., Jin, D. J., and Weisberg, R. A. (1996) Cell 87, 893-903 Richardson, J. P., Greenblatt, J., Curtiss, R. C., III, Lin, E. C. C., Low, K. B., Magasanik, B., Neidhardt, F. C., Reznikoff, W. S., Riley, M., Schaechter, M., and Umbarger, H. E. (1996) Control of RNA chain elongation and termination. in Escherichia coli and Salmonella: Cellular and molecular biology, ASM Press, Washington, DC. pp 822-848 Toulme, F., Mosrin-Huaman, C., Artsimovitch, I., and Rahmouni, A. R. (2005) J.Mol.Biol. 351, 39-51 Woodson, S. A. (2000) Cell Mol Life Sci 57, 796-808 Pan, T., Artsimovitch, I., Fang, X. W., Landick, R., and Sosnick, T. R. (1999) Proc.Natl.Acad.Sci.U.S.A. 96, 9545-9550 Heilman-Miller, S. L., and Woodson, S. A. (2003) RNA. 9, 722-733 Lewicki, B. T., Margus, T., Remme, J., and Nierhaus, K. H. (1993) J Mol Biol 231, 581-593 Chao, M. Y., Kan, M. C., and Lin-Chao, S. (1995) Nucleic Acids Res 23, 1691-1695 Groeneveld, H., Thimon, K., and van Duin, J. (1995) RNA 1, 79-88 Balzer, M., and Wagner, R. (1998) J Mol Biol 276, 547-557 Besancon, W., and Wagner, R. (1999) Nucleic Acids Res 27, 4353-4362 Eperon, L. P., Graham, I. R., Griffiths, A. D., and Eperon, I. C. (1988) Cell 54, 393401 Wee, K. B., Pramono, Z. A., Wang, J. L., MacDorman, K. F., Lai, P. S., and Yee, W. C. (2008) PLoS One 3, e1844 von Hippel, P. H. (ed) (1987) Transcript elongation and termination in Escherichia coli. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, ASN press, Washington, DC Korzheva, N., Mustaev, A., Kozlov, M., Malhotra, A., Nikiforov, V., Goldfarb, A., and Darst, S. A. (2000) Science 289, 619-625 Gnatt, A. L., Cramer, P., Fu, J., Bushnell, D. A., and Kornberg, R. D. (2001) Science 292, 1876-1882 Opalka, N., Brown, J., Lane, W. J., Twist, K. A., Landick, R., Asturias, F. J., and Darst, S. A. (2010) PLoS Biol 8 Zaychikov, E., Denissova, L., and Heumann, H. (1995) Proc.Natl.Acad.Sci.U.S.A 92, 1739-1743 Nudler, E., Mustaev, A., Lukhtanov, E., and Goldfarb, A. (1997) Cell 89, 33-41 Sidorenkov, I., Komissarova, N., and Kashlev, M. (1998) Mol.Cell 2, 55-64 Komissarova, N., and Kashlev, M. (1998) Proc.Natl.Acad.Sci.U.S.A 95, 14699-14704 Komissarova, N., Becker, J., Solter, S., Kireeva, M., and Kashlev, M. (2002) Mol.Cell 10, 1151-1162 Yarnell, W. S., and Roberts, J. W. (1999) Science 284, 611-615 Larson, M. H., Greenleaf, W. J., Landick, R., and Block, S. M. (2008) Cell 132, 971982 Goliger, J. A., Yang, X. J., Guo, H. C., and Roberts, J. W. (1989) J.Mol.Biol. 205, 331-341

10 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49.

52.

FIGURE LEGENDS FIGURE 1. The termination hairpin and the structure of transcription elongation complex. (A) Tr2 terminator of E.coli bacteriophage lambda used as a model in our study shown schematically in the context of the EC. The RNA is represented by red line and letters, the DNA, by light grey lines, which separate to show 12 nt transcription bubble partially occupied by 8 nt RNA:DNA hybrid. RNAP is shown by grey oval. (B) The structure of the EC from (28). DNA (dark grey) and RNA (red) are shown in CPK representation. Beta subunit and β’ subunit domain between aminoacids 380-410 (medium grey) are shown in surface representation. β’ structural features (purple) contacting RNA in the exit channel are shown in tube representation. The rest of β’ subunit, which obscured the view of the RNA exit channel, was removed from the structure to demonstrate that fifteen 3’ terminal RNA residues are sequestered in the enzyme. Numbers indicate DNA and RNA nt covered by RNAP and the length of RNA:DNA hybrid. FIGURE 2. Probing with RNase T1 the folding of the TH in the EC. (A) Sequences of the templates employed to follow RNA hairpin folding during transcription. The “signal” G residues in the left arm are shown in bold with their positions indicated by subscript numerals, and the mismatched residues in G1/mis are boxed and in gray type. Arrows beneath the sequences mark the left (upstream) and the right (downstream) arms of the hairpin. (B) The indicated ECs were treated with 500 U/ml RNaseT1 for the time periods shown, the cleavage was stopped with phenol, the products were analyzed by denaturing PAGE. One of the two 20-min samples was washed with TB before phenol addition (marked as “w”). The RNA was labeled in the A h+4 position, except in ECh+2, which was labeled in A h+1,h+2 positions. The asterisk marks the product originating from free RNA dissociated from ECh+7 and cleaved after Gh+5 (see also supplemental Fig. S1). Lanes 25-29, the RNA was isolated from ECh+7 as described in Experimental Procedures. (C) RNAP was walked to the h+5 position on templates G1 and G1/mis, the RNA was extracted from the EC, treated with RNaseT1, analyzed by PAGE. The uncut RNAs have the same size but different mobility because of the effect of the strong secondary structure formed by the hairpin of the G1 transcript. The schemes represent the “perfect” and “mismatched” hairpins formed by the two RNAs, and the susceptibility of the G1 residue to the cleavage with RNase T1. Open scissors symbolize susceptibility to RNase T1, closed scissors symbolize resistance to the cleavage.


50. 51.

Telesnitsky, A. P., and Chamberlin, M. J. (1989) J.Mol.Biol. 205, 315-330 Cheng, S. W., Lynch, E. C., Leason, K. R., Court, D. L., Shapiro, B. A., and Friedman, D. I. (1991) Science 254, 1205-1207 Wilson, K. S., and von Hippel, P. H. (1995) Proc Natl Acad Sci U S A 92, 8793-8797 Kashlev, M., Nudler, E., Severinov, K., Borukhov, S., Komissarova, N., and Goldfarb, A. (1996) Methods Enzymol. 274:326-34, 326-334 Kroger, M., and Hobom, G. (1982) Gene 20, 25-38 Schmidt, M. C., and Chamberlin, M. J. (1987) J.Mol.Biol. 195, 809-818 Kashlev, M., and Komissarova, N. (2002) Journal of Biological Chemistry Arndt, K. M., and Chamberlin, M. J. (1990) J.Mol.Biol. 213, 79-108 Komissarova, N., and Kashlev, M. (1997) Proc.Natl.Acad.Sci.U.S.A 94, 1755-1760 Zuker, M. (2003) Nucleic Acids Research 31, 3406-3415 Chan, C. L., Wang, D., and Landick, R. (1997) J.Mol.Biol. 268, 54-68 Yager, T. D., and von Hippel, P. H. (1991) Biochemistry 30, 1097-1118 Epshtein, V., Cardinale, C. J., Ruckenstein, A. E., Borukhov, S., and Nudler, E. (2007) Mol.Cell 28, 991-1001 d'Aubenton Carafa, Y., Brody, E., and Thermes, C. (1990) J.Mol.Biol. 216, 835-858 Potrykus, K., Murphy, H., Chen, X., Epstein, J. A., and Cashel, M. (2010) Nucleic Acids Res 38, 1636-1651 Ebright, R. H. (2000) J.Mol.Biol. 304, 687-698.

11


Labeled A h+4 is also shown. (D) The ECs obtained using template G1/mis were treated with RNase T1 as in (B). FIGURE 3. Probing of G3, G5, and G7 hairpin positions with RNase T1. The ECs were obtained using templates G3 (A), G5 (B), and G7 (C) and probed with RNaseT1 as described for Figure 2B. Asterisks mark the cleavage products originating from free RNA dissociated from the unstable ECh+6 and ECh+7. FIGURE 4. Hairpin formation in ECh+6. (A) The scheme represents the RNA structure in ECh+6 based on RNase T1 cleavage of this complex formed on templates G1, G3, G5, G7. The gray oval symbolizes RNAP. (B) RNA secondary structures predicted for the ECh+6 transcript formed on template G3 based on the assumption that ten 3’ proximal nt (shaded by gray background) either do not participate or participate with difficulty in base-pairing with the upstream part of the RNA. (C) The sequence and the structures predicted for the transcript in ECh+6 formed on template G3S. (D) The ECs were obtained using template G3S and probed with RNaseT1 as described for Fig. 2B. The bands in lanes 7-12 are, from top to bottom, (1) h+7 uncut, (2) h+6 uncut, (3) the product of the cleavage of free RNA dissociated from ECh+7 cut at Gh+5 (marked by the asterisk), (4) the product of the cleavage of the nascent transcript in ECh+6 cut at G3. The h+6 transcript is present in these lanes because of its inefficient elongation. FIGURE 5. The effect of hairpin sequence on termination efficiency mediated by alternative RNA structures. (A) The transcribed portions of the templates used in (B-D). (B) RNA-labeled ECh-9 was chased with four NTPs and analyzed by denaturing PAGE. (C) ECh+2 and ECh+8 were obtained using template G1L and probed with RNase T1 as in Fig. 2B. The h+9 transcript is present in lanes 7-12 because the of the NTP crosscontamination. (D) The ECs labeled in the RNA and immobilized on NiNTA agarose as described in Experimental Procedures were chased with four NTPs, one half of the supernatant (S fraction) and the remaining half of the supernatant and pellet (P fraction) were sepatately analyzed by denaturing PAGE. Complete dissociation of an EC results in equal distribution of the terminated RNA between the two fractions. FIGURE 6. The effect of sequence context on termination efficiency mediated by alternative RNA structures. (A) Sequences of tR2/T and tR2/T/long templates. (B) Transcription was performed on templates tR2/T and tR2/T/long and “supernatant” (S) and “pellet” (P) fractions were analyzed separately as described in Experimental Procedures. (C) The predicted secondary structure of the transcript in the EC that reached the termination point on the tR2/T/long template (ECh+7) shown both as a sequence and as an outline. The prediction is based on the assumption that ten 3’ proximal nt (grey background) cannot participate in base pairing with the upstream part of the RNA. The complementary interactions competing with the formation of the TH are boxed. (D) Scheme of RNA cleavage in ECh-36, the oval symbolizes the segment of the transcript protected by RNAP from RNases, the labeled C residue is shown in grey. (E) ECh-36 shown in (D) was obtained using template tR2/T/long, one third of the complex was chased, another third was chased after treatment with RNase A and wash, and the remainder was chased after treatment with RNase T1 and wash. FIGURE 7. Schematic of TH folding in the context of the EC. See explanations in the Discussion. (A) Gray lines symbolize the DNA, the two strands of which separate to form transcription bubble. Black/red lines symbolize nascent RNA, which contains sequences encoding the stem (light red) and the loop (dark red) of the TH. The red numbers 1, 3, 5, 7 show the nucleotide positions in the left arm of the TH counting from the base of the stem. Eight 3’ terminal bases of the transcript base pair with template strand of the DNA in the region of transcription bubble to form RNA:DNA hybrid. The gray oval represents RNAP and the small gray circle represents the active center of the enzyme, which coincides with the 3’ end of the RNA. The position of the upstream end of RNAP is based of footprinting data showing protection of 15 nt of RNA and DNA from nucleases, the downstream end of RNAP is placed arbitrarily and does not reflect footprinting data. (B) Because of EC interference with folding of the hairpin, minor RNA-RNA interactions affect termination. The dashed oval line represents a situation that would arise if RNAP did not interfere with TH formation, the thick oval line represents the EC interfering with the TH formation.

12

A

B Transcription bubble Transcription

Transcription

U G G U C G U C C G G

A A U C G C A G G C C

Upstream DNA duplex

-15 termination h+7 h+8

Lid

+20 Downstream DNA duplex

Zn finger domain

-8

Flap

-14 RNA 3’ end RNA:DNA hybrid

Figure 1

Single stranded RNA


UUUUUAUU

Rudder

A

13

h+2 h+7 h0 h+5 h+9 G1 ATCGCCCTCCTAATAATCGGAGGGCAATAGCGATCATCGCAGCGTACCGAGCGC 1

G3 ATCCGCTCCTAATAATCGGAGCGGAATAGCGATCATCGCAGCGTACCGAGCGC 3

G5 ATCCCTGCCTAATAATCGGCAGGGAATAGCGATCATCGCAGCGTACCGAGCGC 5

G7 ATCCCCTCGTAATAATCCGAGGGGAATAGCGATCATCGCAGCGTACCGAGCGC 7

G1/mis ATCGCCCTCCTAATAATCGGAGGAAAATAGCGATCATCGCAGCGTACCGAGCGC 1

Template G1 EC

Time with RNaseT1, min

h+2

h+5

h+6

h+7

h+7

free RNA

h+8

h+9

- 1 3 10 20 20 - 1 3 10 20 20 - 1 3 10 20 20 - 1 3 10 20 20 - 1 3 10 20 - 1 3 10 20 20 - 1 3 10 20 20

w

w

w

w

w

w

*

h+2 full size h+2 cut at G1

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41

Free RNA isolated from ECh+5

C

Template

G1/mis

G1

Time with RNase T1, min - 1 3 10 20 - 1 3 10 20

h0 5’

G1

h+5 full size 30 nt h+5 cut at G1 G1 5’ 26 nt

h+5 full size 30 nt

A 3’ G1

1

2

3

4

D

5

6

7

8

9

EC

h+5 -

1

h+8

h+7

3 20 40

-

1

3 20 40

-

1

3 20 40

h+5 full size h+5 cut at G1 1

2

3

4

5

6

7

Figure 2

8

9 10

A 3’

G1/mis

10

Template G1/mis Time with RNaseT1, min

h0

11 12 13 14 15


B

A

14

Template G3 EC

h+2


h+5

h+6

h+7

h+8

- 1 3 10 20 20 - 1 3 10 20 20 - 1 3 10 20 - 1 3 10 20 20

w

w

w

h+9

- 1 3 10 20 20 - 1 3 10 20 20

w

w

w

*

h+2 full size h+2 cut at G3 1

2 3

4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35

Template G5

B h+5

EC

w

h+5 full size

h+8

- 1 3 10 20 20 - 1 3 10 20 20 -

w

*

w

3 10 20 20

w

*

h+5 cut at G5 1

2

3 4

5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

Template G7

C EC Time with RNaseT1, min

h+2

h+5

- 1 3 10 20 20

w

h+6

- 1 3 10 20 20

w

h+7

- 1 3 10 20 20 - 1 3 10

w

h+8 10

w

h+9

- 1 3 10 20 20 - 1 3 10 20 20

w

w

*

h+2 full size h+2 cut at G7 1 2 3

4 5 6

7 8 9 1 0 11 12 13 14 15 16 17 18 19 20 21 22

Figure 3

24 25 26 27 28 29 30 31 32 33 34 35 36



h+7

h+6

- 1 3 10 20 20

15 A

Template G3

B

Putative RNA structure in ECh+6 based on templates G1, G3, G5, G7

U A A A U C G C G U A C G3 C AU C

G7 G5

h0

G3

h+6

G1

A U

U A A C C U

C h-4 G C G G AAUAGC

dG=-1.1 kcal/mol

C

U A A C

U G3C h-4 C G C G AU AGCGGAAUAGC

dG=-1.8 kcal/mol

Template G3S U A U

A:U inversion in the stem

A U

U A A C U C A A A C U G3C C G AUC GUGCGGAAUAGC

C C G C G A U C G G3 C C G AU C G AAUAGC dG=-1.1 kcal/mol

dG=-0.3 kcal/mol extremely unstable

Template G3S

D EC Time with RNaseT1, min

1

3

10

h+8 and h+6

h+7 and h+6

h+6 -

20

20 W

-

1

3

10

9

10

20

20 W

-

1

3

14

15

10

20

20 W

17

18

h+6 full size

*

h+6 cut at G3

Figure 3 1

2

3

4

5

6

7

8

Figure 4

11

12

13

16


A A

16

termination

h+7 h+8

h0

A

G1/T ATCGCCCTCCTGGTAATCGGAGGGCTTTTTATTTCATCGCAGCGTACCGAGCGC G3/T ATCCGCTCCTGGTAATCGGAGCGGTTTTTATTTCATCGCAGCGTACCGAGCGC G1L/T ATCGCCCTCCTCCTAATCGGAGGGCTTTTTATTTCATCGCAGCGTACCGAGCGC

B

D

Template G1/T G3/T KCl 300 mM 4 NTPs, mM 0.1 0.01 0.1 0.01 Runoff

Termination h+8 h+7

Termination h+8 h+7 1

C C C

2

3

1

4

2

3

4

Template G1L

U A U

Template G1/T G1L/T 300 mM KCl, 1 mM NTPs Fraction s p s p Runoff

C

A U

A C G U C G C U A C C G U C G C C GG AUC G CCAAUAGCGA AUCGCCCU C 1 1 dG=-13.9 kcal/mol

A

EC h+2 h+8, h+9 Time with - 1 3 10 20 20 - 1 3 10 20 20 U w C RNaseT1, min w

G G A G GCCAAUAGCGA

dG=-7.0 kcal/mol

Figure 5

h+9 full h+8 full h+8 cut at G1 1

2

3

4

5

6 7 8 9 10 11 12


G1L ATCGCCCTCCTCCTAATCGGAGGGCAATAGCGATCATCGCAGCGTACCGAGCGC

17

tR2/T 5’ATCGGCCTGCTGGTAATCGCAGGCCTTTTTATTTGGATCGCAGCGTACCGAGCGC3’ termination h+7 h+8 h0 tR2/T/long 5’ATCGAGAGGGACACGGCGAATACCCATCCCAATCGGCCTGCTGGTAATCGCAGGCCTTTTTATTTGGATCGCAGCGTACCGAGCGC3’

B

tR2/T/long 4 NTPs, µM Fraction

10 s

p

100 s

p

C

tR2/T 10 s

p

100 s

5’ A

p GGU

Runoff Termination

RNA-RNA interactions competing with hairpin formation

U A

h+8 h+7

GA CAC CG UCGA GGGA GG A GGCU CCCU CC A C AA AC AU

5’

CGUC GCAGGCCUUUUUAU 3’ AUC h0

4 NTPs, mM Runoff

Runoff

D h+8 Termination h+7 % Runoff

3’

17

52

2

Template tR2/T/long

RNase T1 RNase A

ECh-36

5’ AUCGAGAGGGACACGGCG 3’

Termination

EC[h-36] RNase T1

E

RNase A

termination h+7 h+8

h0


A

20 nt 17 nt 14 nt

0.1 1

0.1 1

1

3

0.1 1

13

Figure 6

2

4

5

6

18 A

h0 ECh+5

1 3 5 7

ECh+6 1 3 5 7

7 1 5 3

ECh+7

ECh+8

3 1

B

Termination

Readthrough

Figure 7


7 5

RNA folding in transcription elongation complex: implication for transcription termination Lucyna Lubkowska, Anu S. Maharjan and Natalia Komissarova J. Biol. Chem. published online July 5, 2011

Access the most updated version of this article at doi: 10.1074/jbc.M111.249359 Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts

http://www.jbc.org/content/suppl/2011/07/05/M111.249359.DC1


Supplemental material: