The 26S proteasome in Schistosoma mansoni - CiteSeerX

Available online at www.sciencedirect.com

Experimental Parasitology 117 (2007) 337–347 www.elsevier.com/locate/yexpr

The 26S proteasome in Schistosoma mansoni: Bioinformatics analysis, developmental expression, and RNA interference (RNAi) studies Joseph F. Nabhan, Fouad El-Shehabi, Nicholas Patocka, Paula Ribeiro

*

Institute of Parasitology, McGill University, Macdonald Campus, 21,111 Lakeshore Road, Sainte Anne de Bellevue, Que., Canada H9X 3V9 Received 12 May 2007; received in revised form 28 July 2007; accepted 4 August 2007 Available online 16 August 2007

Abstract The 26S proteasome is a proteolytic complex responsible for the degradation of the vast majority of eukaryotic proteins. Regulated proteolysis by the proteasome is thought to influence cell cycle progression, transcriptional control, and other critical cellular processes. Here, we used a bioinformatics approach to identify the proteasomal constituents of the parasitic trematode Schistosoma mansoni. A detailed search of the S. mansoni genome database identified a total of 31 putative proteasomal subunits, including 17 subunits of the regulatory (19S) complex and 14 predicted catalytic (20S) subunits. A quantitative real-time RT-PCR analysis of subunit expression levels revealed that the S. mansoni proteasome components are differentially expressed among cercaria, schistosomula, and adult worms. In particular, the data suggest that the proteasome may be downregulated during the early stages of schistosomula development and is subsequently upregulated as the parasite matures to the adult stage. To test for biological relevance, we developed a transfection-based RNA interference method to knockdown the expression of the proteasome subunit, SmRPN11/POH1. Transfection of in vitro transformed S. mansoni schistosomula with specific short-interfering RNAs (siRNAs) diminished SmRPN11/POH1 expression nearly 80%, as determined by quantitative RT-PCR analysis, and also decreased parasite viability 78%, whereas no significant effect could be seen after treatment with the same amount of an irrelevant siRNA. These results indicate that the subunit SmRPN11/POH1 is an essential gene in schistosomes and further suggest an important role for the proteasome in parasite development and survival. 2007 Elsevier Inc. All rights reserved. Index Descriptors and Abbreviations: Proteasome; Developmental expression; Schistosoma; Helminth; POH1; Real-time PCR; RNA interference; RNAi

1. Introduction The 26S proteasome is a multi-subunit complex responsible for most intracellular proteolytic activity in fungi and animal cells (Voges et al., 1999; Zwickl et al., 1999). The complex includes a 20S catalytic core particle (CP), the site of proteolysis, which is typically capped at both ends by 19S regulatory particles (RP). The CP is composed of four stacked heptameric rings of a- and b-subunits organized into a barrel-shaped structure. The outer rings consist solely of a-subunits and the two inner rings of b-subunits. a-Subunits are thought to gate access of substrates into the *

Corresponding author. Fax: +1 514 398 7857. E-mail address: [email protected] (P. Ribeiro).

0014-4894/$ - see front matter 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2007.08.002

internal proteolytic chamber of the 20S proteasome whereas the b-subunits catalyze the degradation of substrates (Bochtler et al., 1999). Prior to degradation, the RP attaches to the surface of the a rings and processes substrates before guiding them into the central proteolytic chamber of the CP. The RP can be divided into two major regions, the lid and base sub-assemblies. The lid includes 8–9 subunits (RPN3-9, RPN11-12), which mediate binding and early processing of substrates, including substrate deubiquitination. The RP base contains six ATPase subunits (RPT1-6) and two non-ATPase subunits (RPN1 and 2) that unfold substrates and direct them into the CP. Another subunit, RPN10, was previously thought to form a hinge between the lid and base regions. Recent evidence suggests that the primary role of RPN10 may be to

338

J.F. Nabhan et al. / Experimental Parasitology 117 (2007) 337–347

shuttle proteins to the proteasome, particularly the 19S base (Verma et al., 2004). The proteasome and associated pathway of controlled protein degradation have been the subject of much research in a variety of systems, primarily yeast and mammalian cells (Voges et al., 1999) and also parasitic protozoa (Paugam et al., 2003). By comparison, considerably less is known about protein degradation in parasitic worms. A recent study by Guerra-Sa et al. demonstrated the presence of a functional proteasomal complex in Schistosoma (Guerra-Sa et al., 2005) but only two subunits of this complex have yet been identified (Harrop et al., 1999; Nabhan et al., 2002; Ram et al., 2003) and there is little information available about the role of the proteasome on schistosome development and viability. Here we have conducted a comprehensive bioinformatics survey of the Schistosoma mansoni genome database to identify 20S and 19S subunits of the schistosome proteasomal complex. We also surveyed the mRNA expression levels of several proteasome subunits

in cercaria, schistosomula, and adult worms using quantitative real-time PCR. The striking variation in expression levels among the different life stages suggests the 26S proteasome plays a critical role in the development of S. mansoni. RNA interference (RNAi) targeting a previously described S. mansoni RP subunit, SmRPN11/POH1 (Nabhan et al., 2002) in schistosomula yielded a lethal phenotype. 2. Materials and methods 2.1. Identification of S. mansoni proteasome sequences To search for schistosome proteasomal subunits we first assembled all known human and Saccharomyces cerevisae orthologues available in the Uniprot database (http:// www.uniprot.org) (Table 1). A schematic representation of how these subunits are organized in the complex is shown in Fig. 1. Each of these human and yeast sequences was used as a query to search the S. mansoni genome data-

Table 1 Putative proteasome subunit sequences in Schistosoma mansoni Proteasome subunit

S. mansoni putative orthologue

Human orthologue

Yeast orthologue (S. cerevisae)

% Identity with Hsa subunits

Sjb put. orthologue (gic)

19S RP RPN1 RPN2 RPT1 RPT2 RPT3 RPT4 RPT5 RPT6 RPN3 RPN4 RPN5 RPN6 RPN7 RPN8 RPN9 RPN10 RPN11 RPN12

Sm03179 Sm01419 Smp_012470 Smp_173840 Smp_072340 Smp_017070 Smp_0422702 Sm01713 Smp_085310.2 — Smp_058650 Smp_064650 Smp_052870 Smp_026630 Smp_178810 AAM27438 AAC02298 Sm00725

Q13200 Q99460 P35998 P62193 P43686 P62333 P17980 P62198 O43242 — O00232 O00231 Q15008 P51665 Q9UNM6 P55036 O00487 P48556

P38764 P32565 P33299 P40327 P33298 P53549 P33297 Q01939 P40016 Q03465 Q12250 Q12377 Q06103 Q08723 Q04062 P38886 P43588 P32496

40 56 82 87 80 82 80 83 55 — 53 56 57 62 45 47 80 41

28360165 28324479 56756889 — 28359025 56755741 — 56758410 56754694 — 28358005 28341862 29841024 28338138 29841120 29841229 56752603 56753943

20S CP a1 a2 a3 a4 a5 a6 a7 b1 b2 b3 b4 b5 b6 b7

Sm01587 Smp_067890 Smp_070930 Smp_076230 Smp_032580.2 Smp_170730 Smp_092280 Smp_034490 Sm04459 Smp_121430.2 Smp_074500 Sm04797 Smp_025800 Smp_056500

P60900 P25787 P25789 O14818 P28066 P25786 P25788 P28072 Q99436 P49720 P49721 P28074 P20618 P28070

P21243 P23639 P23638 P40303 P32379 P40302 P21242 P38624 P25043 P25451 P22141 P30656 P23724 P30657

56 73 67 73 69 53 58 50 59 60 54 68 50 46

56755003 56754539 — — 29841012 — 76156596 29841433 56754849 56755285 29841035 56756153 56758256 56757988

a b c

Hs, Homo sapiens. Sj, Schistosoma japonicum. gi, Gene identification number.


339

1000 U/ml penicillin (Sigma–Aldrich) and 0.25 lg/ml fungizone (Invitrogen), and left for 10 min at room temperature. Transformed schistosomula were finally collected by centrifugation at 1200 rpm at 28 C for 10 min. The pellet, containing clean schistosomula, was resuspended in OptiMEM (Invitrogen) supplemented with antibiotics. Immediately after transformation, schistosomula were placed in 24-well plates and kept in a 37 C 5% CO2 incubator. Cultures were supplemented with OPTI-MEM containing 4% fetal bovine serum (FBS) every 3 days. 2.3. 20S proteasome assays

Fig. 1. Schematic representation of the eukaryotic proteasome. The eukaryotic structure consists of two major complexes, the 20S catalytic particle (CP) and the 19S regulatory particle (RP). The latter is further subdivided into a base and lid regions. Depending on the species and cellular conditions the 20S CP may be capped with two RPs, one at each end, or a single RP at one end only. Details of the various subunits in each complex can be found in Table 1.

base. Searches were done with the BlastP tool and the E-value cutoff was set at e10 (http://www.genedb.org/ genedb/smansoni/blast.jsp). Sequences were subsequently examined for the presence of proteasomal signature motifs and domains, using the Interproscan tool (http://www.ebi. ac.uk/InterProScan/) and verified by ClustalW alignments with human and yeast orthologues. Finally, the putative S. mansoni subunits were used as queries for a reverse BlastP analysis of the NCBI database to identify orthologues of the closely related species, Schistosoma japonicum.

Schistosoma mansoni cercaria, 6-day-old schistosomula and adults were washed 3· with PBS and lysed by sonication (6 · 10 s pulses) in proteasome stabilizing buffer (25 mM Tris–HCl pH 7.5, 1 mM DTT, 2 mM ATP, 5 mM MgCl2, and 1:200 protease inhibitor cocktail from Sigma). Protein concentration was measured using the Bradford assay (Bio-Rad) and the lysates were adjusted to a total protein concentration of 10 lg/ml. Aliquots (500 ll) were subsequently subjected to an overnight treatment at 4 C with 50 ll protein A agarose beads coupled to 3 lg anti-20S proteasome antibodies or protein A agarose beads alone (without antibody). For these experiments we used a commercial monoclonal antibody raised against human 20S subunits (BIOMOL). The beads were removed the next day by centrifugation and 20S peptidase assays were performed, as described previously (Nabhan and Ribeiro, 2006), using 50 ll of each sample and SucLLVY-AMC (N-Succinyl-Leu-Leu-Val-Tyr- 7-amino-4methylcoumarin; Biomol) as a degradation substrate. Briefly, aliquots of S. mansoni lysates were supplemented with sodium dodecyl sulfate (SDS) activation buffer (0.03% SDS in 25 mM Hepes buffer, 0.5 mM EDTA, pH 7.6 final concentration), followed by addition of the proteasomal substrate (10 nM final concentration). The reactions, which were carried out in black 96-well plates, were allowed to proceed for 45 min at 37 C before fluorescence was recorded with a Fluostar Galaxy Fluorometer (BMG Lab Technologies) equipped with the appropriate excitation (kex = 380 nm) and emission (kem = 440 nm) filters.

2.2. Parasites Biomphalaria glabrata snails infected with S. mansoni were obtained from Dr. Fred Lewis (Biomedical Research institute, Rockville, MD) and induced to shed cercaria, as described (Salafsky et al., 1988). Adult worms were obtained from infected mice 6–8 weeks after subcutaneous challenge with cercaria and washed thoroughly in PBS. To obtain schistosomula, the cercaria were transformed by vortexing for 2 min in 10 ml 70% Percoll (Sigma–Aldrich) prepared in minimal essential medium (MEM) followed by centrifugation at 1700 rpm at 4 C for 10 min. Cercarial bodies were recovered from the pellet in MEM supplemented with 1 mg/ml Streptomycin (Sigma–Aldrich),

2.4. RNA preparation and quantitative real-time PCR (qRT-PCR) To extract RNA from cercaria and schistosomula, we used the RNeasy micro kit (Qiagen) according to the manufacturer’s recommendations, with minor modifications for the lysis method. Animals stored at 120 C were resuspended, while frozen, in 350 ll of the supplied kit buffer, supplemented with carrier RNA (supplied with the kit), and immediately sonicated for 1 min (6 · 10 s pulses). RNA from adult S. mansoni was extracted using the RNeasy mini kit (Qiagen), according to the manufacturer’s specifications, and was diluted 1:10 in DNAse-free RNAse-free water.

340


Table 2 Oligonucleotide primers used to amplify S. mansoni proteasome sequences by quantitative real-time PCR Gene (Proteasome subunit)

Primer sequence (5 0 fi 3 0 )

Amplicon size (bp)

SmRPN8

F: AACGCTCGAGAGAAGATTG R: AGCACTGAGTTTGGAGCAT F: GCACAGGTGTGAGCGTCGAAG R: GATAACCAGCAACCGAATCCA F: GCCCACCTCGCACTTC R: TGGCAAGCCTAGTCAATTCT F: CGCTGATGTCGTATCCGT R: CCCAAGCTCCGATGTCACTC F: ATGGGCTGTTACCGCTCTT R: AGCGCAAATGAGGATGGTAG F: TCTACTCTCTGACGGAACGA R: CCCAGAAGGCTCTATCACGA F: CGGGAGTCTTGCGTGTAT R: ATCGACATTACTGCCAGACC

108

SmRPN11 SmRPN10 SmRPN1 SmRPN2 Sma1 Smb1

132 109 110 101 140 136

Reverse transcription (RT) was performed on 2 ll of purified RNA from schistosomula or 2 ll of 1:10 diluted adult S. mansoni RNA in a 10 ll reaction volume using Superscript III reverse transcriptase (Invitrogen). The amount of total RNA added per RT reaction was 200–300 ng. Parallel control-RT reactions, containing the same amount of RNA but no reverse transcriptase enzyme, were done routinely to rule out possible genomic DNA contamination. Primers (Table 2) were designed using Oligo (MBI) and the settings were adjusted to the highest possible stringency to generate 100–150 bp amplicons. Primer specificity was examined by BLAST analysis against the NCBI (http://www.ncbi.nlm. nih.gov/BLAST/) and Schistosoma mansoni genome (http://www.genedb.org/genedb/smansoni/) databases. All oligonucleotides were obtained from Operon (Huntsville, AL) and were reconstituted in RNAse-free water. Preliminary validation experiments demonstrated that the amplification efficiencies of the target genes and the internal reference (S. mansoni a-Tubulin; gi:161071) were approximately equal, as required for use of the comparative DDCT method (Livak and Schmittgen, 2001). PCRs were performed using the Quantitect SYBR Green PCR kit (Qiagen) in a final volume of 10 ll using the Rotor-Gene RG3000 instrument (Corbett Research). Cycling conditions were as follows: 95 C for 15 min followed by 50 cycles of 95 C for 15 s, 60 C for 15 s, and 72 C for 20 s. The generation of specific PCR products was tested first by melting curve analysis and agarose gel electrophoresis. All PCR products were subsequently verified by DNA sequencing. qPCRs were repeated three times, each in triplicate. Relative differences in expression were finally calculated using the comparative DDCT method (Livak and Schmittgen, 2001). 2.5. Treatment of schistosomula with SmRPN11/POH1 siRNA Ambion’s Silencer siRNA cocktail kit was used to generate SmRPN11/POH1-specific siRNAs. We designed

primers to amplify a 185-bp fragment from SmRPN11/ POH1 (Nabhan et al., 2002) by PCR and introduced a T7 promoter at both ends. The following forward and reverse primers were used: 5 0 - TAATACGACTCACTA TAGGGTACTCTTTACCTATTAATTATCG-3 0 and 5 0 TAATACGACTCACTATAGGGTTCATCTTCAAGAG ATTTATGG-3 0 . The amplified 226-bp fragment, including the T7 promoter sequences, was analyzed by 1.6% agarose electrophoresis and purified using the Qiaex II gel extraction kit (Qiagen). The purified SmRPN11/POH1 fragment was then used as a template to transcribe double stranded RNA (dsRNA), which was analyzed on a 15% polyacrylamide gel. dsRNA (15 lg) was finally digested to generate siRNA with the Silencer siRNA cocktail kit (RNAse III; Ambion) according to the manufacturer’s instructions. Transfection of schistosomula, inoculated in 250 ll OPTIMEM/well in 24-well plates, was carried out immediately after transformation. A 50 ll mix consisting of 60 nM SmRPN11/POH1, 60 nM scrambled siRNA, or no siRNA, 2 ll siPORT lipid transfection reagent (Ambion), and Opti-MEM (Invitrogen) was applied to each well containing approximately 50 schistosomula/well and left for 9 days before harvesting. Schistosomula cultures were supplemented with 5% fetal bovine serum (FBS) 2–3 h after transfection. Fresh OPTI-MEM was added every 3 days thereafter. To monitor the transfection, we labeled siRNA with FAM (Fluoranthylmaleimide) using a RNA labeling kit from Ambion. Schistosomula, transfected with 20 nM of FAM-labeled SmRPN11/POH1 siRNA, were examined 2 days post-transfection by fluorescence microscopy and found to exhibit widespread punctate fluorescence. The effects of siRNA treatment were monitored by measuring changes in SmRPN11/ POH1 mRNA by quantitative RT-PCR (see above) and by visual inspection of the animals under a microscope. Viability was assessed by methylene blue exclusion assays (Gold, 1997). Schistosomula were collected 9 days posttransfection, transferred to 0.075% methylene blue in saline solution and left at 37 C for 20 min. Stained schistosomula were examined using an inverted microscope and the proportion of stained animals per sample was recorded. The data are derived from five separate samples, each containing approximately 20 animals, for a total of about 100 animals monitored per transfection condition. 2.6. Other methods Western blot analysis was done according to standard protocols, using the same anti-20S proteasome antibody described above (Biomol) and an HRP-conjugated 2 antibody (Pierce). All statistical analysis was performed in Prism 4.0 (Graphpad Software). Quantitative real-time expression of proteasome subunits and measurements of 20S proteasome activity were analyzed by one-way ANOVA, followed by a Tukey pairwise comparison with P < 0.001 considered significant.


3. Results 3.1. The Schistosoma mansoni proteasome A major goal of this study was to use bioinformatics tools to identify proteasome subunit genes of S. mansoni. Initially, over 60 putative sequences were found in the S. mansoni genome database that exhibited >30% amino acid identity to human and yeast proteasome subunits. The search was further refined using ClustalW alignments with human and yeast proteasome subunits, followed by the Interproscan tool (http://www.ebi.ac.uk/InterProScan/) to identify signature motifs. This led to the identification of S. mansoni orthologues for all known human proteasomal subunits, 31 in total, and all but one of the yeast subunits. The exception is yeast RPN4, which is absent in all metazoans examined to date and therefore may be absent in schistosomes as well. Two of the S. mansoni sequences listed in Table 1 (RPN10 and RPN11) were previously cloned and annotated (Harrop et al., 1999; Nabhan et al., 2002); the remaining are CDS (coding sequence) predictions. Also shown in Table 1 are predicted subunits of the S. japonicum proteasomal complex. These ESTs were identified through a reverse BlastP analysis of the NCBI database using the S. mansoni sequences as queries. The level of sequence identity between S. mansoni and S. japonicum orthologues was generally >80%. The oligomeric composition of the 20S CP is highly conserved across phylogeny and schistosomes appear to be no exception. There are 14 different subunits in the CP, including 7 a (a1–7) and 7 b (b1–7) subunits, all of which are present in S. mansoni. Notably we identified all three predicted catalytic subunits, b1, b2, and b5 (Fig. 2), which are thought to be responsible for the caspase-like, trypsin-like, and chymotrypsin-like activities of the proteasome, respectively (DeMartino and Slaughter, 1999). The S. mansoni b1, b2, and b5 sequences exhibit high overall identities (50–68%) compared to the human orthologues and they all carry a positionally conserved catalytic motif (Arendt and Hochstrasser, 1997). Within this motif, we identified the predicted catalytic Thr and Lys/Arg residues, in addition to the signature GSG and SGG/S peptides (Fig. 2), characteristic of the catalytically active subunits in other organisms (Seemuller et al., 1995). In the 19S RP we identified 17 putative subunits, including the six highly conserved RPT (Regulatory particle triple-A) ATPases (RPT1-6) of the base region and 11 RPN (Regulatory particle non-ATPase) subunits. The latter include two predicted subunits of the RP base (RPN1 and RPN2), eight RP lid subunits (RPN3, RPN5-9, RPN11-12) and RPN10 (Table 1). The RPTs are members of the AAAATPase superfamily (Patel and Latterich, 1998) and show exceptionally high sequence homology (>80% identity) across phylogeny. In contrast, the RPN subunits are generally less conserved, with identity levels among species typically ranging from 40% to 50%. The only exception is RPN11 (also known as POH1), which is highly conserved

341

(70–80% identity) in most organisms examined to date, including S. mansoni. RPN subunits are characterized by the presence of several distinctive motifs, all of which are present in schistosomes. In particular, S. mansoni RPN10 contains three ubiquitin interacting motifs (UIM) (Elsasser et al., 2004), which in other species, have been implicated in the binding and shuttling of ubiquitinated proteins to the proteasome (Mayor et al., 2005). The MPN (Mpr1, Pad1, N-terminal) domain, characteristic of RPN8 and RPN11 (Glickman et al., 1998) was present in the S. mansoni orthologues, as was the protease-resistant Mov34 domain of SmRPN8 (Alves et al., 2006). SmRPN5, SmRPN6, and SmRPN7 all contain the conserved PINT (Proteasome, Int-6, Nip-1, and TRIP-15) /PCI (Proteasome, COP9, Initiation factor) domain at their C-termini (Ciccarelli et al., 2003), though only a partial domain could be detected in RPN7. 3.2. Proteasome expression and activity in S. mansoni Proteasomal expression was tested first at the RNA level by quantitative (real-time) RT-PCR analysis (Fig. 3a) and then by measurements of 20S peptidase activity (Fig. 3b) in different developmental stages of S. mansoni. For the PCR analysis we examined the expression patterns of subunits from each major proteasomal complex, including the 20S CP (Sm b1, Sma1), the 19S RP base (SmRPN1, SmRPN2), the 19S RP lid (SmRPN8, SmRPN11/POH1) and also the hinge (SmRPN10). Data were normalized relative to an endogenous standard (Sm a-tubulin) and were calculated as the fold-change in expression levels relative to stage 0 schistosomula (S0), which was used as an arbitrary reference. Sm a-Tubulin is constitutively expressed throughout the parasite life cycle and is commonly used as an endogenous reference in RT-PCR studies (Mei and LoVerde, 1997). Based on the analysis of these subunits, we conclude that the proteasome is expressed in S. mansoni cercaria, schistosomula and adult worms but the levels of expression among these stages vary significantly. The results suggest that proteasomal expression is relatively high in the cercaria, it is decreased after cercarial transformation and is then elevated again by day 12 of schistosomula development (S12). There were no further significant changes between the S12 larvae and adult worms for any of the subunits tested. We noted a difference, however, in the recovery of Sm b1 and Sma1, the two 20S subunits, compared to the 19S (RPN) subunits tested. Sm b1 and Sma1 were upregulated sooner, reaching adult levels by day 6 (S6), whereas the 19S subunits did not recover significantly until day 9 (SmRPN11/POH1) or, for the most part, the S12 stage. When comparing cercaria with adult worms, the levels of subunit expression in the cercaria were similar or, in some cases, significantly higher (P < 0.0001). To test how these differences at the RNA level relate to proteasomal activity, we performed 20S peptidase assays in crude lysates of cercaria, 5-day-old in vitro transformed schistosomula and adult worms, using a fluorogenic proteasomal

342


Fig. 2. Phylogenetic tree analysis of putative S. mansoni 20S b-subunit orthologues. Bootstrap phylogenetic analyses conducted with 1000 iterations using 70 sequences (b1, b2, b3, b4, b5, b6, and b7 orthologues) with Neighbor-joining on a matrix of Poisson correction distance. Numbers at the nodes indicate the bootstrap confidence as a percentage. Putative S. mansoni b-subunits are highlighted in gray. A schematic diagram of the putative catalytic motif of S. mansoni b-subunits, b1, b2, and b5, is shown in the bottom left corner. The active site Threonine (T) is highlighted by a shaded box. The catalytically essential basic (K/R) residue and the conserved GSG and SGG/S peptides are marked. Abbreviations: Athaliana, Arabidopsis thaliana; Dmelanogaster, Drosophila melanogaster; Mmusculus, Mus musculus; Celegans, Caenorhabditis elegans; Smansoni, Schistosoma mansoni; Hsapiens, Homo sapiens; Spombe, Schizosaccharomyces pombe; Scerevisae, Saccharomyces cerevisae; Rnorvegicus, Rattus norvegicus.

substrate (Succ-LLVY-AMC). The results were consistent with the pattern of mRNA expression in that the lowest activity was seen in young (S5) schistosomula compared either to cercaria or adult worms, suggesting again that the proteasome is downregulated during early larval development. Recently it was reported that the proteasome has lower specific activity in cercaria compared to adult worms (Guerra-Sa et al., 2005). Here, however, we could not

detect a significant difference between these two stages (Fig. 3b). As negative controls for the peptidase assays we repeated the experiments with lysates that were precleared of proteasomes, using an anti-20S proteasome antibody coupled to protein A agarose beads. This antibody was shown in our lab to recognize the schistosome complex by Western blot analysis (data not shown). Lysates depleted of proteasomes showed only background


343

Fig. 3. Developmental expression analysis of S. mansoni proteasome subunits and activity. (a) Quantitative real-time RT-PCR analysis of 19S lid and base subunits. Expression levels of proteasomal subunits were measured in S. mansoni cercaria, adult worms, stage 0 schistosomula (S0) and 3, 6, 9 and 12-dayold schistosomula (S3-S12) by quantitative RT-PCR. The analysis targeted subunits of the S. mansoni 19S lid (SmRPN8, SmRPN11/POH1), 19S base (SmRPN1, SmRPN2, SmRPN10) and the 20S catalytic particle (Smb1, Sma1). Expression levels were calibrated according to the comparative DDCT method (Livak and Schmittgen, 2001), using the constitutively expressed Sm a-Tubulin as an endogenous control (Mei and LoVerde, 1997) and were normalized relative to the stage 0 (S0) schistosomula, which was harvested immediately after transformation. Expression levels are means ± SD of three separate experiments (each in triplicate). aStatistically higher than the S0 reference; bStatistically higher than the adult level (one-way ANOVA followed by Tukey pairwise comparison; P < 0.0001). (b) 20S peptidase activity assays. Aliquots of lysates from cercaria, S5 schistosomula, and adult S. mansoni worms or equal amount of the same lysates depleted of 20S proteasomes were subjected to a peptidase assay against a fluorogenic substrate (Succ-LLVYAMC) and fluorescence was recorded using a fluorometer. Data are normalized relative to the amount of protein in each sample and are means ± SE of three separate experiments (each in triplicate). aStatistically different from cercaria; bStatistically different from the adult level (P < 0.001).

fluorescence compared to those samples treated with protein A agarose beads alone (without antibody) (Fig. 3b), indicating the activity was proteasome-specific. 3.3. SmRPN11/POH1 siRNA experiments The biological relevance of the complex was tested by ‘‘silencing’’ expression of one of its more conserved subunits, SmRPN11/POH1, through RNA interference (RNAi). In vitro transformed schistosomula were transfected with SmRPN11/POH1 siRNAs or a control immediately after tail detachment, using a cationic liposome delivery method. To monitor the transfection, we performed parallel experiments in which the larvae were treated with a small amount (20 nM) of FAM-labeled siRNAs and then inspected after 2 days by fluorescence microscopy (Fig. 4a). The results show widespread internal fluorescence in animals treated with transfection agent, suggesting the siRNAs could be taken up under these conditions, whereas animals treated with the labeled siRNAs in the absence of transfection agent showed no significant fluorescence. For RNAi, the cultured schistosomula were transfected with 60 nM SmRPN11/POH1 siRNA, an equal amount of scrambled (irrelevant) siRNA control, or vehicle only and harvested 9 days post-transfection. The effects of treatment were assessed by measuring changes in the level of SmRPN11/POH1 mRNA, using quantitative RT-PCR,

as well as changes in the visual appearance of the animals and viability. At the RNA level, we observed 80% decrease in expression in animals transfected with the gene specific siRNA, whereas no difference could be seen in the irrelevant siRNA control, indicating the silencing effect was specific (Fig. 4b). Other concentrations of siRNA (20 and 40 nM) and incubation periods (3 and 6 days) were also tested but did not yield as strong a reduction in the amount of SmRPN11/POH1 transcript (data not shown). In addition to a decrease in target mRNA, we detected an effect of treatment on the motility and morphology of the schistosomula in culture. After 9 days of transfection, the animals treated with 60 nM SmRPN11/POH1 siRNA showed virtually no movement and displayed a more rounded morphology compared to the typical elongated shape of the controls. Viability was monitored using a methylene blue dye exclusion assay, as described by Gold (1997). Based on the proportion of dye-stained animals (Fig. 4c and d), we estimate that approximately 78% of the larvae in the SmRPN11/POH1 siRNA group were dead after 9 days of treatment. By comparison, we detected only about 15–20% death in the controls after the same period of time. 4. Discussion Genes encoding proteasome subunits have been identified in organisms ranging from archaeans to humans

344


Fig. 4. RNAi targeting of the RP lid subunit, SmRPN11/POH1. Cercaria were transformed in vitro and immediately transfected with 60 nM SmRPN11/ POH1 siRNA, 60 nM control (scrambled) siRNA, or siPORT lipid transfection reagent alone. (a) A preliminary control experiment with FAM-labeled siRNAs shows visible labeling in the presence of transfection reagent. (b) Total RNA was isolated after 9 days of treatment, reverse-transcribed using Superscript III and subjected to real-time PCR analysis to determine the relative expression levels of SmRPN11. Sm a-Tubulin was used as an internal calibrator. Expression levels were normalized relative to lipid transfected schistosomula according to the DDCT method and are means ± SD of three individual experiments, each in triplicate. To measure the effect of siRNA on viability, S9 schistosomula were treated with 0.075% methylene blue for 20 min at 37 C, as described (Gold, 1997). Stained animals were examined by light microscopy and the numbers of live and dead animals were recorded. Data are represented as means ± SD of 5 determinations each based on 20 animals. (c) Typical larvae stained with methylene blue after a 9-day treatment with POH1 siRNAs or (d) scrambled siRNA control. The test sample is heavily stained compared to the control and shows a rounder morphology.

(Voges et al., 1999), including parasitic protozoa (Paugam et al., 2003), but little is known about this complex in helminths. Here we have taken advantage of recent advances in schistosome genomics to carry out a first sequence analysis of proteasomal subunits in S. mansoni. The results identified 31 sequences that show significant homology with human and yeast proteasomal subunits. Among these sequences are the expected 14 a and b subunits of the 20S complex, an indication that the structural organization of the schistosome CP is likely similar to that of other species (Pickart and Cohen, 2004; Voges et al., 1999). Notably we identified potential orthologues for the three principal catalytic subunits (b1, b2, b5), all of which carry positionally conserved proteolytic motifs (Arendt and Hochstrasser, 1997). This explains why schistosomes have the same three types of 20S peptidase activity as in other systems (GuerraSa et al., 2005) and why this activity is sensitive to classical proteasome inhibitors, such as lactacystin and MG132, which target the 20S core. Also identified were 17 putative subunits of the 19S RP, including the previously described RPT ATPases of the 19S base and several RPN (non-ATPase) subunits. These subunits are present in every eukaryote examined to date, from yeast to humans, and are thought to constitute an invariant core of the 19S complex (Ferrell et al., 2000; Pickart and Cohen, 2004). However, the RP is a dynamic particle and its subunit composition can vary depending on the species or cellular conditions (Ferrell et al., 2000; Glickman and Raveh, 2005). Thus there may be additional schistosome-specific RP components that could not be identified by this type of analysis.

It should be emphasized that 19S subunits, those of the lid region especially, are known to have other functions outside the proteasome. RPN proteins have been implicated in the shuttling of substrates to the proteasome (Madura, 2004; Verma et al., 2004), transcriptional regulation (Gonzalez et al., 2002; Nabhan and Ribeiro, 2006; Stitzel et al., 2001) and a variety of other extra-proteasomal activities (Voges et al., 1999). In schistosomes, SmRPN10 (Sm5a) was first described as a secreted protein (Harrop et al., 1999) and an interaction partner for the cercarial calcium binding protein, CaBP (Ram et al., 2003), suggesting this parasite RPN protein could be acting in more than one capacity. Thus the sequences described here are important, not only as proteasomal subunits, but also for their other potential activities in the parasite. The availability of these sequences opens new doors for further characterization of these proteins. As a first step in the investigation of the schistosome proteasomal complex, we compared 20S peptidase activity and mRNA expression of selected subunits at different life cycle stages of S. mansoni. Previously it was reported that cercaria treated with the proteasome inhibitor, MG132, showed significant accumulation of ubiquitinated substrates and were unable to develop to lung-stage schistosomula in the mammalian host (Guerra-Sa et al., 2005). This was the first indication that an active proteasome was present in cercaria and was required for host penetration and/or subsequent transformation, events that would be expected to involve extensive protein turnover. Our analysis confirms that the proteasome is abundantly


expressed in the free-living cercaria. We detected high levels of 20S proteasomal activity in crude cercarial extracts and the RT-qPCR analysis demonstrated the same or higher subunit expression levels in cercaria than any other stage tested, including the adults. It is unclear why some subunits, for example SmRPN2 and 10, are so highly expressed in the cercaria. The core proteasomal components are present in stoichiometric amounts (Glickman and Raveh, 2005; Pickart and Cohen, 2004) and therefore it is unlikely the additional expression would result in more of a particular subunit being incorporated into the complex. A more plausible explanation is that the higher mRNA levels reflect a need for these proteins in other yet unidentified functions outside the proteasome. This is worthy of further examination. Upon transformation, we detected a marked decrease in the expression levels of all proteasomal subunits tested. The newly transformed schistosomula (S0) showed on average 3- to 6-fold lower subunit mRNA levels compared to the free-living cercaria. Expression levels remained low during the first few days of schistosomula development and increased again after 6–9 days of culture. We noted, however, that the 19S RP components were generally slower to recover compared to the two 20S subunits tested, suggesting there may be a temporal difference in the assembly of these two complexes during early parasite development. These results raise a number of interesting questions about the regulation of the proteasome and its role in schistosome development. Not much is known about the mechanisms that govern subunit expression, not only in schistosomes but other systems as well. A few studies of mammalian cells have shown that proteasomal activity is significantly decreased during times of oxidative stress (Chondrogianni et al., 2003; Halliwell, 2002). Conversely, antioxidants are known to stimulate expression of proteasomal subunits and to increase activity (Kwak et al., 2003). Newly transformed schistosomula have substantially lower levels of antioxidants and are more sensitive to oxidative challenges compared to 2-week-old parasites (Nare et al., 1990). It is possible therefore that changes in antioxidant capacity are contributing to the fluctuation of proteasome levels. In mammalian cells, oxidatively modified proteins are preferentially degraded by uncapped 20S particles via a ubiquitin-independent mechanism (Davies, 2001). The presence of the RP is thought to hinder degradation of these oxidized substrates by restricting access to the catalytic core. If the same is true in schistosomes, this could explain why we see differential expression of 20S versus 19S RP subunits. A delay in RP subunit expression would favor formation of uncapped 20S particles, possibly as a strategy to remove oxidized proteins that might otherwise accumulate in the young larvae. There may be, however, other factors contributing to these changes that cannot be explained at present. Research is underway to determine how the fluctuation at the mRNA level influences proteasome biogenesis and to identify the mechanism(s) involved in this regulation.

345

The importance of controlled protein degradation is evident by what happens when the pathway is disrupted either with inhibitors or, as shown in this study, RNAi. Previous studies have shown that treatment of parasites with classical proteasome inhibitors blocked parasite development in vitro and/or the host. This was demonstrated in the aforementioned study of MG132-treated S. mansoni cercaria (Guerra-Sa et al., 2005) and has also been well documented in studies of parasitic protozoa. For example, in Trypanosoma cruzi, treatment with lactacystin prevents transformation of tryposmatigotes into amastigotes (de Diego et al., 2001), suggesting that an active proteasome is need for this developmental switch. Similarly, in Plasmodium, development of exoerythrocytic and erythrocytic stages are blocked by lactacystin (Lindenthal et al., 2005) and the same treatment blocks encystation of Entamoeba (Makioka et al., 2002). Here we confirmed the importance of this system in schistosomes through a gene silencing approach that targeted SmRPN11/POH1, one of the more conserved subunits of the 19S lid region. RPN11/POH1 is a proteasomal deubiquitinase and an essential gene in yeast (Verma et al., 2002; Yao and Cohen, 2002). Its depletion in insect cells has been linked to increased apoptosis and DNA overreplication (Lundgren et al., 2003). We had predicted therefore that SmRPN11/POH1 would be similarly important in schistosomes, a prediction confirmed by the RNAi analysis. The results demonstrated that a decrease in SmRPN11/POH1 mRNA correlated with significant schistosomula death, indicating this proteasomal subunit is essential for parasite viability. To silence gene expression we transfected schistosomula with target-specific siRNAs. Two recent publications have reported successful delivery of dsRNAs into schistosomula, either by electroporation (Correnti et al., 2005) or through incubation (‘‘soaking’’) of cercaria with dsRNA during the transformation process (Skelly et al., 2003). Here, we used a different approach in which the schistosomula were successfully transfected with shorter siRNAs using a liposome-based reagent. We found that the addition of transfection reagent improved the efficiency of delivery compared to soaking methods, with no detectable toxicity to the parasite. This offers an alternative, simpler method of RNAi that promises to facilitate future knockdown experiments in schistosomula. That a component of the proteasome is required for schistosome survival highlights the potential of this complex for drug development. Although some parasite subunits are conserved compared to mammalian orthologues, there is sufficient divergence, particularly among RPN subunits, to enable selective drug targeting. Proteasome inhibitors, such as the anti-neoplastic agent bortezomib, have already been shown to have chemotherapeutic qualities and can be used to treat disease (Richardson et al., 2006). A better understanding of the S. mansoni proteasome and its involvement in the development of the parasite may lead to the discovery of novel chemotherapeutic agents for treatment of infected individuals.

346


Acknowledgments The authors thank Dr. Fred Lewis, Biomedical Research Institute (Bethesda, MD) for supplying S. mansoni-infected snails. J.F. Nabhan and F. El-Shehabi received support from the Fonds Que´bećois de Recherche sur la Nature et les Technologies (FQRNT) Center for Host–Parasite Interactions and from the Canadian Institutes of Health Research (CIHR), respectively. This research was supported by a grant from the Natural Sciences and Engineering Research Council of Canada (NSERC) to P.R. References Alves, B.S., Oyama Jr., S., Gozzo, F.C., Sanches, M., Guimaraes, B.G., Zanchin, N.I., 2006. Characterization of the human ortholog of Mov34 reveals eight N-terminal residues important for MPN domain stability. Biochem. Biophys. Res. Commun. 347, 608–615. Arendt, C.S., Hochstrasser, M., 1997. Identification of the yeast 20S proteasome catalytic centers and subunit interactions required for active-site formation. Proc. Natl. Acad. Sci. USA 94, 7156–7161. Bochtler, M., Ditzel, L., Groll, M., Hartmann, C., Huber, R., 1999. The proteasome. Annu. Rev. Biophys. Biomol. Struct. 28, 295–317. Chondrogianni, N., Stratford, F.L., Trougakos, I.P., Friguet, B., Rivett, A.J., Gonos, E.S., 2003. Central role of the proteasome in senescence and survival of human fibroblasts: induction of a senescence-like phenotype upon its inhibition and resistance to stress upon its activation. J. Biol. Chem. 278, 28026–28037. Ciccarelli, F.D., Izaurralde, E., Bork, P., 2003. The PAM domain, a multiprotein complex-associated module with an all-alpha-helix fold. BMC Bioinformatics 4, 64. Correnti, J.M., Brindley, P.J., Pearce, E.J., 2005. Long-term suppression of cathepsin B levels by RNA interference retards schistosome growth. Mol. Biochem. Parasitol. 143, 209–215. Davies, K.J., 2001. Degradation of oxidized proteins by the 20S proteasome. Biochimie 83, 301–310. de Diego, J.L., Katz, J.M., Marshall, P., Gutierrez, B., Manning, J.E., Nussenzweig, V., Gonzalez, J., 2001. The ubiquitin-proteasome pathway plays an essential role in proteolysis during Trypanosoma cruzi remodeling. Biochemistry 40, 1053–1062. DeMartino, G.N., Slaughter, C.A., 1999. The proteasome, a novel protease regulated by multiple mechanisms. J. Biol. Chem. 274, 22123–22126. Elsasser, S., Chandler-Militello, D., Muller, B., Hanna, J., Finley, D., 2004. Rad23 and Rpn10 serve as alternative ubiquitin receptors for the proteasome. J. Biol. Chem. 279, 26817–26822. Ferrell, K., Wilkinson, C.R., Dubiel, W., Gordon, C., 2000. Regulatory subunit interactions of the 26S proteasome, a complex problem. Trends Biochem. Sci. 25, 83–88. Glickman, M.H., Raveh, D., 2005. Proteasome plasticity. FEBS Lett 579, 3214–3223. Glickman, M.H., Rubin, D.M., Coux, O., Wefes, I., Pfeifer, G., Cjeka, Z., Baumeister, W., Fried, V.A., Finley, D., 1998. A subcomplex of the proteasome regulatory particle required for ubiquitin-conjugate degradation and related to the COP9-signalosome and eIF3. Cell 94, 615–623. Gold, D., 1997. Assessment of the viability of Schistosoma mansoni schistosomula by comparative uptake of various vital dyes. Parasitol. Res. 83, 163–169. Gonzalez, F., Delahodde, A., Kodadek, T., Johnston, S.A., 2002. Recruitment of a 19S proteasome subcomplex to an activated promoter. Science 296, 548–550. Guerra-Sa, R., Castro-Borges, W., Evangelista, E.A., Kettelhut, I.C., Rodrigues, V., 2005. Schistosoma mansoni: functional proteasomes are

required for development in the vertebrate host. Exp. Parasitol. 109, 228–236. Halliwell, B., 2002. Hypothesis: proteasomal dysfunction: a primary event in neurogeneration that leads to nitrative and oxidative stress and subsequent cell death. Ann. NY Acad. Sci. 962, 182–194. Harrop, R., Coulson, P.S., Wilson, R.A., 1999. Characterization, cloning and immunogenicity of antigens released by lung-stage larvae of Schistosoma mansoni. Parasitology 118, 583–594. Kwak, M.K., Wakabayashi, N., Greenlaw, J.L., Yamamoto, M., Kensler, T.W., 2003. Antioxidants enhance mammalian proteasome expression through the Keap1-Nrf2 signaling pathway. Mol. Cell Biol. 23, 8786–8794. Lindenthal, C., Weich, N., Chia, Y.S., Heussler, V., Klinkert, M.Q., 2005. The proteasome inhibitor MLN-273 blocks exoerythrocytic and erythrocytic development of Plasmodium parasites. Parasitology 131, 37–44. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Lundgren, J., Masson, P., Realini, C.A., Young, P., 2003. Use of RNA interference and complementation to study the function of the Drosophila and human 26S proteasome subunit S13. Mol Cell Biol. 23, 5320–5330. Madura, K., 2004. Rad23 and Rpn10: perennial wallflowers join the melee. Trends Biochem. Sci. 29, 637–640. Makioka, A., Kumagai, M., Ohtomo, H., Kobayashi, S., Takeuchi, T., 2002. Effect of proteasome inhibitors on the growth, encystation, and excystation of Entamoeba histolytica and Entamoeba invadens. Parasitol. Res. 88, 454–459. Mayor, T., Lipford, J.R., Graumann, J., Smith, G.T., Deshaies, R.J., 2005. Analysis of polyubiquitin conjugates reveals that the Rpn10 substrate receptor contributes to the turnover of multiple proteasome targets. Mol Cell Proteomics 4, 741–751. Mei, H., LoVerde, P.T., 1997. Schistosoma mansoni: the developmental regulation and immunolocalization of antioxidant enzymes. Exp. Parasitol. 86, 69–78. Nabhan, J.F., Hamdan, F.F., Ribeiro, P., 2002. A Schistosoma mansoni Pad1 homologue stabilizes c-Jun. Mol. Biochem. Parasitol. 121, 163–172. Nabhan, J.F., Ribeiro, P., 2006. The 19 S proteasomal subunit POH1 contributes to the regulation of c-Jun ubiquitination, stability, and subcellular localization. J. Biol. Chem. 281, 16099–16107. Nare, B., Smith, J.M., Prichard, R.K., 1990. Schistosoma mansoni: levels of antioxidants and resistance to oxidants increase during development. Exp. Parasitol. 70, 389–397. Patel, S., Latterich, M., 1998. The AAA team: related ATPases with diverse functions. Trends Cell Biol. 8, 65–71. Paugam, A., Bulteau, A.L., Dupouy-Camet, J., Creuzet, C., Friguet, B., 2003. Characterization and role of protozoan parasite proteasomes. Trends Parasitol. 19, 55–59. Pickart, C.M., Cohen, R.E., 2004. Proteasomes and their kin: proteases in the machine age. Nat. Rev. Mol. Cell Biol. 5, 177–187. Ram, D., Ziv, E., Lantner, F., Schechter, I., 2003. Interaction of the proteasome S5a/Rpn10 multiubiquitin-binding protein and the 8 kDa calcium-binding protein of Schistosoma mansoni. Parasitology 127, 337–347. Richardson, P.G., Mitsiades, C., Hideshima, T., Anderson, K.C., 2006. Bortezomib: proteasome inhibition as an effective anticancer therapy. Annu. Rev. Med. 57, 33–47. Salafsky, B., Fusco, A.C., Whitley, K., Nowicki, D., Ellenberger, B., 1988. Schistosoma mansoni: analysis of cercarial transformation methods. Exp. Parasitol. 67, 116–127. Seemuller, E., Lupas, A., Stock, D., Lowe, J., Huber, R., Baumeister, W., 1995. Proteasome from Thermoplasma acidophilum: a threonine protease. Science 268, 579–582. Skelly, P.J., Da’dara, A., Harn, D.A., 2003. Suppression of cathepsin B expression in Schistosoma mansoni by RNA interference. Int. J. Parasitol. 33, 363–369.

J.F. Nabhan et al. / Experimental Parasitology 117 (2007) 337–347 Stitzel, M.L., Durso, R., Reese, J.C., 2001. The proteasome regulates the UV-induced activation of the AP-1-like transcription factor Gcn4. Genes Dev. 15, 128–133. Verma, R., Aravind, L., Oania, R., McDonald, W.H., Yates, J.R., 3rd, Koonin, E.V., Deshaies, R.J., 2002. Role of Rpn11 metalloprotease in deubiquitination and degradation by the 26S proteasome. Science 298, 611–615. Verma, R., Oania, R., Graumann, J., Deshaies, R.J., 2004. Multiubiquitin chain receptors define a layer of substrate selectivity in the ubiquitinproteasome system. Cell 118, 99–110.

347

Voges, D., Zwickl, P., Baumeister, W., 1999. The 26S proteasome: a molecular machine designed for controlled proteolysis. Annu. Rev. Biochem. 68, 1015–1068. Yao, T., Cohen, R.E., 2002. A cryptic protease couples deubiquitination and degradation by the proteasome. Nature 419, 403– 407. Zwickl, P., Voges, D., Baumeister, W., 1999. The proteasome: a macromolecular assembly designed for controlled proteolysis. Philos. Trans R. Soc. Lond. B. Biol. Sci. 354, 1501–1511.