The 5! Ends of Thogoto Virus ( Orthomyxoviridae) mRNAs Are

JOURNAL OF VIROLOGY, Dec. 1996, p. 9013–9017 0022-538X/96/$04.0010 Copyright q 1996, American Society for Microbiology

Vol. 70, No. 12

The 59 Ends of Thogoto Virus (Orthomyxoviridae) mRNAs Are Homogeneous in both Length and Sequence CARMEN ALBO, JAVIER MARTIŃ,†

AND

AGUSTIŃ PORTELA*

Centro Nacional de Biologıá Fundamental, Instituto de Salud Carlos III, Majadahonda 28220, Madrid, Spain Received 25 April 1996/Accepted 15 August 1996

Thogoto (THO) virus is a tick-borne member of the Orthomyxoviridae whose genome consists of six segments of linear, negative sense, single-stranded RNA. To gain insight into the mechanism by which viral mRNA transcripts are initiated, poly(A)1 RNA isolated from THO virus-infected cells was characterized by (i) primer extension experiments, (ii) immunoprecipitation studies with an anticap monoclonal antibody, (iii) direct sequencing analysis of the isolated RNA, and (iv) cloning and sequencing of individual mRNA molecules. The results indicated that THO virus mRNAs are capped and homogeneous in both length and sequence at their 5* end. These findings contrast with the situation found in all other segmented, negative sense or ambisense, single-stranded RNA viruses so far analyzed in which the 5* ends of viral mRNAs are heterogeneous in length and sequence. These results are discussed in terms of the mechanism used by THO virus to initiate mRNA synthesis.

is referred to as cap snatching) (31). The short capped fragments obtained from cellular mRNAs serve as primers for virus mRNA synthesis (4, 30) and are elongated until the polymerase reaches a stretch of uridine residues, located at 17 to 22 nucleotides from the 59 ends of vRNAs, where transcription terminates and poly(A) is added to mRNA (37). It has not been determined whether synthesis of THO virusspecific RNAs occurs in the nucleus. However, replication of THO virus seems to involve a nuclear phase, since one of the virus-encoded proteins (presumably the nucleoprotein) accumulates in the nucleus of infected cells (33, 40), and replication of THO virus is sensitive to the action of the interferon-induced nuclear Mx1 protein (17). The only THO virus mRNAs analyzed to date, which are those corresponding to vRNA segment 3, contain a poly(A) tail and are, as influenza virus mRNAs, incomplete copies of vRNAs since they lack the nucleotide sequences present at the 59 end of the corresponding vRNA (41). This study was undertaken to characterize the 59 ends of THO virus mRNAs and thus gain insight into the mechanism by which mRNA transcripts are initiated. As indicated above, THO virus polyadenylated RNAs, which are incomplete copies of the corresponding vRNA, have been detected in infected cells. It was therefore hypothesized, by analogy with influenza viruses, that there should exist nonpolyadenylated cRNA molecules to serve as templates for the synthesis of THO vRNAs. Thus, total RNA obtained from THO virus-infected cells was fractionated into poly(A)1 and poly(A)2 by chromatography on oligo(dT) cellulose columns in order to separate mRNAs from cRNAs. Aliquots of the total, poly(A)1, and poly(A)2 RNA samples were then analyzed by primer extension with avian myeloblastosis virus reverse transcriptase (RT) and a 32 P-labeled oligonucleotide (oTHO88) (59TGGCTGTTTTTG TATTGC) representing positions 71 to 88 from the 39 end of vRNA segment 4 according to the sequence reported in reference 27, which would hybridize to virus positive sense RNAs. As shown in Fig. 1A, in the three samples obtained from infected cells, the primer extended to a double band of ca. 88 to 89 nucleotides (as determined by size markers included in the gel [not shown]), whereas no extension of the primer was observed when RNAs obtained from mock-infected cells were

Thogoto (THO) virus is an arbovirus that has been isolated from ticks and vertebrate hosts in different parts of the world (reviewed in reference 28). Although many aspects of the molecular biology of THO virus remain to be elucidated, this virus has been classified within the Orthomyxoviridae family (25) since it shares structural, genetic, and biochemical features with influenza viruses (8, 14, 17, 27, 33, 41). Indeed, THO virus is an enveloped virus whose genome consists of six segments of linear, negative sense, single-stranded RNA (8, 41). Moreover, the sequences at the ends of viral RNA (vRNA) segments resemble those of influenza viruses (27, 41), and the protein encoded by THO vRNA segment 3 shows a low, yet significant, homology to influenza virus PA protein (41), one of the subunits of the viral polymerase complex. In addition, the viral particle is comparable to that of influenza viruses in terms of the number of structural components, their sizes, and their relative abundances (33). Furthermore, replication of THO and influenza viruses is sensitive to the interferon-induced Mx proteins (14, 17). vRNA segment 4 (the only other vRNA segment recorded to date) codes for a protein that shows extensive amino acid identity with the gp64 glycoprotein of baculovirus (27). It has thus been suggested that this viral protein plays a critical role in determining the host range and mode of transmission of THO virus (27, 28, 33). One of the aspects of the THO viral replication cycle that remains to be elucidated is the mechanism by which the viral genome is replicated and transcribed. In influenza viruses, synthesis of virus-specific RNAs takes place in the cell nucleus and involves synthesis of three different RNA species: (i) vRNA molecules which are found in viral particles, (ii) cRNA templates which are complementary and have the same length as vRNAs, and (iii) mRNAs which are capped and polyadenylated (reviewed in reference 21). The influenza virus mRNAs are 10 to 15 nucleotides longer than cRNAs at their 59 ends (7, 11, 39). These additional nucleotides, which are heterogeneous in sequence, are generated by a virus-encoded endonucleolytic activity that cleaves capped host-cell mRNAs (this mechanism * Corresponding author. Phone: 34 1 5097904. Fax: 34 1 5097918. † Present address: Division of Virology, National Institute for Medical Research, London NW7 1AA, United Kingdom. 9013

9014

NOTES

J. VIROL.

FIG. 1. Analyses of positive sense RNAs corresponding to THO virus segment 4. BHK-21 cells were infected with THO virus (isolate SiAr 126) at a multiplicity of infection of 0.05. At 72 h postinfection, cells were collected, and total RNA was isolated by the guanidine thiocyanate method followed by centrifugation through a CsCl cushion (38). The RNA was then chromatographed on columns of oligo(dT) cellulose basically as described previously (38). The poly(A)2 fraction included the RNA species which did not bind to the column in buffer HS (20 mM Tris-HCl [pH 7.5], 1 mM EDTA, 0.5 M NaCl, 0.1% sodium dodecyl sulfate [SDS]). The poly(A)1 fraction included the RNA molecules that bound to the column in buffer HS and that eluted with buffer LS (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 0.05% SDS). (A) Aliquots of the three samples—total RNA (50 mg) (T), poly(A)1 (1.5 mg) (A1), and poly(A)2 (49 mg) (A2) obtained from THO virus-infected cells (THO) or from mock-infected cells (MOCK)—were incubated with 32P-labeled oligonucleotide oTHO88 (see text) and avian myeloblastosis virus RT as previously described (34). The extension products were analyzed by electrophoresis in a 6% polyacrylamide gel containing 7 M urea and autoradiography. (B) Conditions were the same as panel A, but with a negative sense primer corresponding to positions 52 to 69 of vRNA segment 4. (C) The poly(A)1 fraction obtained from THO virus-infected cells was again passed through an oligo(dT) cellulose column, which was sequentially washed with buffer S (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 0.1 M NaCl, 0.1% SDS) (lane S) and then with water (lane W). Aliquots of the two fractions obtained were analyzed by primer extension as indicated for panel A. (D) Primer oTHO88, labeled with 32P, was extended (with Moloney murine leukemia virus RT) on poly(A)1 RNA isolated from THO virus-infected cells (THO) and on an SP6-derived RNA transcript that included the first 224 nucleotides of THO virus RNA segment 4 (SP6) (see text for details). The RNA-cDNA hybrids were then immunoprecipitated with protein-A Sepharose beads which had been preincubated with rabbit anti-mouse immunoglobulins and with either the anticap MAb H-20 (6) (G) or a control MAb (C) that recognizes the G glycoprotein of human respiratory syncytial virus. After three washes with a buffer containing 150 mM NaCl, 1 mM EDTA, and 0.5% Nonidet P-40, the antibody-bound RNAs were analyzed by electrophoresis in a sequencing gel and autoradiography. Of each of the primer extension reactions, 40% was selected with either the anticap MAb or the control MAb. The recovered RNAs were electrophoresed along with 20% of the unselected primer extension product (U). The samples shown in panel D were resolved in the same sequencing gel, but the relative mobility of the two extension products (THO and SP6) shown in the figure does not reflect their actual electrophoretic mobility, since only the relevant parts of the autoradiography are shown. The estimated size of the extension products is indicated for each of the panels shown in the figure.

used. A similar band pattern was obtained when the experiment was performed with a negative sense 32P-labeled oligonucleotide (59GTCAGGTTCTGCTACCCC) corresponding to positions 52 to 69 of vRNA segment 4 (Fig. 1B). The origin of the double band seen in Fig. 1A and B is not clear, and it should be mentioned that the relative intensity of the two major extension products varied, for unknown reasons, in different experiments (Fig. 1A through D and data not shown). Although it cannot be excluded that the two cDNA bands correspond to two different positive sense RNA species, one being one nucleotide longer than the other, it is suggested (see below) that the low-molecular-weight band actually marks the 59 end of positive sense RNAs, whereas the high-molecularweight band would result from reverse transcription of the 59 cap G into a 39-terminal C residue, as reported by others (1, 9, 18). According to this interpretation, the primer extension experiments indicate that all THO virus positive sense RNAs detected in infected cells have the same length at their 59 end. For further analyses, it was important to demonstrate that the poly(A)1 RNA species represented the viral mRNAs and that this fraction was not contaminated with the presumptive cRNA molecules. Two different experiments were carried out to address this question. The poly(A)1 fraction used in the previous experiments corresponded to RNA molecules that bound to the oligo(dT) column in 0.5 M NaCl and that eluted

with a buffer lacking salt (see legend to Fig. 1). It has been shown that some adenylic acid-rich RNAs bind to oligo(dT) cellulose in the presence of 0.5 M NaCl, but that only true 39-polyadenylated RNA molecules are retained in the presence of 0.1 M NaCl (13). Thus, the RNAs recovered in the poly(A)1 fraction from THO virus-infected cells were again passed through an oligo(dT) column, and fractions that corresponded to RNA that eluted with 0.1 M NaCl and to RNA that eluted with water were collected and analyzed by primer extension as described above. As illustrated in Fig. 1C, extension products were only observed in the sample recovered in water. It was thus concluded that the poly(A)1 fraction contained only true 39-polyadenylated RNA species. In a second experiment, an immunoselection assay with an anti-cap monoclonal antibody (MAb H-20) (6) was performed to determine whether the polyadenylated RNAs were capped. This strategy has been previously used to demonstrate the presence of cap structures in viral mRNAs (15, 36, 42). The samples included in the analysis were (i) poly(A)1 RNA obtained from THO virusinfected cells and (ii) a GTP-initiated SP6-derived RNA transcript 375 nucleotides in length, which included from nucleotides 125 to 349 the sequences corresponding to the first 224 nucleotides of THO virus RNA segment 4. In a primer extension experiment with oligonucleotide oTHO88, this in vitro transcript would yield a cDNA with a size of 212 nucleotides.

VOL. 70, 1996

Samples of the RNAs to be analyzed were annealed with 32Plabeled oligonucleotide oTHO88 and incubated with Moloney murine leukemia virus RT to generate primer extension products. The RNA-cDNA hybrids were then immunoprecipitated with either the anti-cap MAb or a control MAb, and the antibody-bound RNAs were analyzed by electrophoresis in a sequencing gel and autoradiography. As shown in Fig. 1D, ;20% (;50% in other experiments) of the primers extended on the poly(A)1 RNA obtained from THO virus-infected cells were immunoselected by the anticap antibody, whereas only 1% of these cDNAs were immunoprecipitated by the control antibody. The same antibodies immunoselected only 3% (the anticap MAb) or 1% (the control MAb) of the extension product of the in vitro-synthesized RNA. The inability to select 100% of the cDNAs extended on THO virus polyadenylated RNAs does not mean that only a fraction of them are capped; rather it appears to be an intrinsic feature of the immunoselection procedure (15, 36, 42). These results therefore demonstrate that THO virus polyadenylated RNAs are capped, and it was thus considered that the RNA species present in the poly(A)1 fraction are indeed the viral mRNAs. To determine the nucleotide sequence at the 59 ends of THO virus positive sense RNAs, direct sequencing analysis of poly(A)1 and poly(A)2 RNA samples was carried out with oligonucleotide oTHO88 end labeled with 32P. As shown in Fig. 2 (top panel), the nucleotide sequences determined for both samples were unique and identical up to the last two nucleotides (N1N2), which could not be determined because bands were found across the four sequencing reactions. As shown in the same figure (bottom panel), N1 was the more intense labeled band in the sequencing reactions and in the primer extension experiment (lane P). It was thus considered that this band marks the 59 end of THO virus RNA sequences and corresponds to the low-molecular-weight band detected in the primer extension experiments, whereas the band indicated by a star in Fig. 2 would correspond to the high-molecularweight band found in the same experiments (Fig. 1 and 2, lane P). To determine the sequence of the first two nucleotides of THO virus mRNAs, individual mRNA molecules corresponding to THO virus RNA segments 3 and 4 were cloned and sequenced. cDNAs of the corresponding mRNAs were obtained by using the 59-ampliFINDER RACE kit (Clontech), which is based on a variation of the RACE PCR technique (12). Briefly, an antisense gene-specific primer (P1) close to the 59 terminus of the predicted end of the corresponding mRNA was used to synthesize single-stranded cDNA. Upon hydrolysis of the RNA, a single-stranded anchor oligonucleotide (59CACGAATTCACTATCGATTCTGGAACCTTCAG AGG), the 39 end of which is blocked to prevent self-ligation, was ligated in the presence of T4 RNA ligase to the 39 end of the cDNA. The ligated DNA was then used as a template for PCR amplification, with Taq polymerase, with a primer (59CT GGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG) complementary to the anchor oligonucleotide and a nested gene-specific primer (P2). The following primers were used for cloning mRNAs corresponding to THO virus RNA segment 3: P1, 59TACCTTGTATGCAACTGCCC, positions 295 to 314; and P2, 59tctagaatctagaTACATATCCATTCTATGGTG, which includes positions 218 to 237 (uppercase) and two recognition sites for restriction enzyme XbaI (lowercase). The following primers were used to clone mRNAs corresponding to THO vRNA segment 4: P1, 59ACACTGGTGAGATGATCCCC, positions 314 to 333; and P2, 59tctagaatctagaTAAGCCACCC AGGCTGTGCG, which includes positions 205 to 224 (uppercase) and two recognition sites for the enzyme XbaI. The positions refer to the 39 end of the corresponding vRNA seg-

NOTES

9015

FIG. 2. Direct sequencing analyses of positive sense RNAs corresponding to THO virus segment 4. Oligonucleotide oTHO88 (end labeled with 32P) was used to prime the synthesis of cDNA in the presence of specific dideoxynucleoside triphosphates (G, A, T, and C) as previously described (23). The samples analyzed were the poly(A)1 (A1) and poly(A)2 (A2) RNA samples obtained from THO virus-infected cells. The deduced sequence is indicated on the right in positive sense. Lane P, primer extension experiment with oligonucleotide oTHO88 and poly(A)1 obtained from infected cells. The bottom panel is a shorter exposure of the same gel (the symbols [star, N1, and N2] are explained in the text).

ment (27, 41). The amplified products were then cloned with the pGEM-T Vector System (Promega), and the recombinant Escherichia coli colonies obtained were screened with specific oligonucleotides 59CAAGCACTTGACATGACA and 59CAA GCAGATGTTCCTTCA, which included nucleotides 9 to 26 of THO virus segments 3 and 4, respectively. By this strategy, we could precisely determine the nucleotide sequences derived from the cDNA, since the procedure did not involve any homopolymeric tailing step and the sequence of the anchor primer is known. Of the 13 recombinant plasmids sequenced, 2 of them lacked some of the anchor primer sequences and were not considered for the analysis. The cDNA-derived sequences found in the remaining 11 clones (6 corresponding to RNA segment 3 and 5 corresponding to RNA segment 4) are indicated in Table 1. Since similar results were obtained for the two different viral mRNAs analyzed, the data obtained are discussed together. Five cDNAs initiated with the sequence AGCA. . ., four contained the same nucleotide sequence preceded by an additional G, and three clones lacked the nucleotides AGC at the 59 end of the cDNAs. As mentioned above, it has been reported that RT can incorporate a C residue in response to the G residue of the cap structure (1, 9). Indeed,

9016

NOTES

J. VIROL.

TABLE 1. Sequences at the 59 ends of THO virus mRNAs corresponding to virus segments 3 and 4 No. of plasmidsa Total

Segment 3

Segment 4

5 4 2

3 2 1

2 2 1

Nucleotide sequenceb

...gtgaattcgtg AGCAAAAACAAG... ...gtgaattcgtgGAGCAAAAACAAG... ...gtgaattcgtg AAAAACAAG...

a The total number of cDNAs sequenced and the number that correspond to segment 3 or 4, respectively, are indicated. b The 59-terminal sequence of positive sense RNAs is shown in capital letters, and the anchor primer-derived sequences are shown in lowercase letters. Empty spaces have been left in order to align the THO virus-derived sequences.

Hirzman et al. (18) showed that when cloning the 59 ends of an in vitro-synthesized capped mRNA, 50% of the clones contained an additional uncoded G residue at the 59 end of the complementary strand. Therefore, we suggest that the 59-terminal G found in four of the THO virus cDNAs is derived from the cap structure at the 59 end of THO virus mRNAs and that the five cDNAs that lack the extra G are derived from mRNAs in which the cap structure has not been transcribed by RT. Importantly, the data obtained from sequencing of individual mRNA molecules are consistent with the primer extension experiments that showed the presence of two major extension products and suggest that the high-molecular-weight band observed in those experiments corresponds to mRNA molecules in which the cap structure has been copied into a C residue. It is considered that mRNA molecules corresponding to the cDNA clones that lack three residues do not exist in infected cells, since primer extension products with the size expected for these transcripts were not detected in the experiments shown in Fig. 1 and 2. It is thus suggested that these molecules arise because of artifacts during the cloning procedure. From the sequencing studies, it was concluded that the 59 ends of THO virus mRNAs corresponding to viral segments 3 and 4 are single sized and have the structure cap-AGCAAA. . .. Interestingly, O. Haller and collaborators have recently obtained similar results for the mRNAs of THO vRNA segment 5 (16a). Furthermore, Staunton et al. (41) determined that the sequence at the 59 end of positive sense RNAs corresponding to vRNA segment 3 was AGCA. . .. This sequence was determined by carrying out Maxam and Gilbert sequence analyses of a cDNA product extended on a sample of total cellular RNA obtained from infected cells, and therefore the authors could not conclude that it corresponded to the sequence at the 59 end of mRNAs. The structure of the 59 ends of THO virus mRNAs contrasts with that reported for all other viruses possessing a segmented, negative or ambisense, single-stranded RNA genome, including members of the Orthomyxoviridae (7, 11, 39), Arenaviridae (15, 26, 32, 35), Bunyaviridae (3, 5, 13, 16, 20, 29), and tenuiviruses (19, 36), in which the 59 ends of viral mRNAs are heterogeneous in both length and sequence. For all of these viruses, it has been suggested that these additional nucleotides are generated by a cap snatching mechanism similar to that described for influenza A virus (4, 30, 31) and Bunyaviridae (29, 42). One explanation to account for the structure of the 59 end of THO virus mRNAs would be that the viral transcripts are initiated with ATP, and then a virus- or cell-encoded capping activity introduces the cap structure at their 59 end. Alternatively a cap structure derived from a virus- or host-derived enzymatic activity could be used as primer for mRNA synthe-

sis. It should be noted, however, that our data do not preclude the existence of a cap snatching mechanism. It may be that only the cap structure is stolen from host cell mRNAs or that the primers used for mRNA transcription contained the cap structure plus a few nucleotides, whose sequence should exactly match that found for the 59 ends of viral mRNAs. In the latter case, the viral polymerase would probably display binding specificity for capped mRNAs with the structure cap-A. . ., capAG. . ., or cap-AGC. . . . In this regard, it is notable that the distribution of methylated nucleosides adjacent to the cap structure of influenza virus mRNAs is different from that in the mRNAs of the host cell, suggesting that the influenza virus polymerase preferentially uses a subset of the host cell capped RNAs as primers for mRNA synthesis (22). Interestingly, 70% of influenza virus mRNAs contain a methylated adenosine following the cap structure, and 30% contain a methylated guanosine. These results are consistent with the data obtained from sequencing of individual viral mRNA molecules (39); of 29 influenza virus mRNAs sequenced, 16 of them initiate with an A, and the most frequent dinucleotides found at the 59 ends of mRNAs are AG (in 7 of the mRNAs) and AA (in 6 of the mRNAs). Strikingly, a similar distribution is observed when cloned mRNAs from Hantaan virus (Bunyaviridae) are analyzed; of 32 viral mRNAs sequenced, 19 initiate with an A, and the most frequent dinucleotide at the 59 end of mRNAs is AG, found in 11 mRNAs (16). Although we know that the frequencies determined from analyses of cloned mRNAs are biased since the number of viral mRNAs containing G as the penultimate nucleotide is not known (because in most cases the cloning procedure involved a homopolymeric tailing with dCTP), these data suggest that the influenza and Hantaan virus polymerases use preferentially capped mRNAs with the structure cap-AG for mRNA transcription initiation. It can thus be speculated that THO virus polymerase binds exclusively to this type of capped RNAs. It this is true and a viral endonucleolytic activity cleaves the cell mRNAs further down from this sequence (cap-AG), there should exist an exonucleolytic activity to remove nucleotides from the 39 end of the capped fragments and generate primers whose sequence matched that found at the ends of viral mRNAs. Experiments with purified polymerase components and defined RNA primers will be required to discriminate between these different possibilities. Replication of THO and influenza viruses is blocked by actinomycin D (2, 24, 40, 43). This inhibitor appears to act on influenza virus replication in two different ways: (i) it inhibits synthesis of cellular heterogeneous nuclear RNAs and consequently reduces the number of capped host-cell mRNAs available to act as substrates for the viral polymerase in the cap stealing process (24), and (ii) it interferes with the nucleocytoplasmic transport of the different influenza virus RNA species by a yet unknown mechanism (24, 40). It remains to be determined whether actinomycin D exerts similar effects on THO virus-infected cells. Thus, the inhibitory effect of this drug cannot be taken as a direct proof of the existence of a cap snatching mechanism in THO virus. However, the fact that actinomycin D affects events occurring in the cell nucleus provides additional evidence to suggest that THO virus has a nuclear replication phase. The sequence at the 39 ends of THO virus RNAs (segments 3 and 4), which presumably serve as a template for the synthesis of the 59 end sequences of the mRNAs, has not been determined. It is, however, considered that this sequence is 39UCGUUUU. . ., which is complementary to that determined here for viral mRNAs. This assumption is based on the fact that (i) the sequences at the 39 ends of all vRNAs of influenza A, B, and C viruses (10) and Dhori virus (another tick-borne

VOL. 70, 1996

NOTES

virus which has many features in common with influenza viruses and THO virus) (8) share in common the first three nucleotides (39UCG. . .); and (ii) the sequence at the 39 end of THO virus RNA segment 5 is 39UCG. . . (16a). On the basis of this assumption, another feature that distinguishes THO virus mRNAs from those of the other segmented single-stranded RNA viruses is that the 59 ends are exact copies of the vRNA templates. In summary, we have shown that THO virus mRNAs are unique in size and sequence at their 59 end. To our knowledge, this is the first case reported for a negative sense RNA virus with a segmented genome. This result is even more striking considering the number of features shared by influenza viruses and THO virus and suggests that THO virus may have a unique mechanism for initiating mRNA synthesis. It is tempting to speculate that the mechanism used by THO virus for mRNA transcription initiation is of ancient lineage, possibly evolving into that adopted by influenza viruses and other segmented negative sense RNA viruses. This work was supported by Fondo de Investigaciones Sanitarias (grant 95/0348), and the EU (Human Capital and Mobility, grant ERBCHRXCT949453). We thank R. Lu ¨hrmann for providing the anti-cap MAb, O. Haller for communicating unpublished results, and P. Nuttall and J. Ortıń for critically reading the manuscript. REFERENCES 1. Ball, L. A. 1995. Requirements for the self-directed replication of flock house virus RNA 1. J. Virol. 69:720–727. 2. Barry, R. D. 1964. The effects of actinomycin D and ultraviolet irradiation on the production of fowl plague virus. Virology 24:563–569. 3. Bishop, D. H. L., M. E. Gay, and Y. Matsuoko. 1983. Nonviral heterogeneous sequences are present at the 59 ends of one species of snowshoe hare bunyavirus S complementary RNA. Nucleic Acids Res. 11:6409–6418. 4. Bouloy, M., M. A. Morgan, A. J. Shatkin, and R. M. Krug. 1979. Cap and internal nucleotides of reovirus mRNA primers are incorporated into influenza viral complementary RNA during transcription in vitro. J. Virol. 32: 895–904. 5. Bouloy, M., N. Pardigon, P. Vialat, S. Gerbaud, and M. Girard. 1990. Characterization of the 59 and 39 ends of viral messenger RNAs isolated from BHK21 cells infected with germiston virus (Bunyavirus). Virology 175: 50–58. 6. Bringmann, P., R. Reuter, J. Rinke, B. Appel, R. Bald, and R. Lu ¨hrmann. 1983. 59-terminal caps of snRNAs are accessible for reaction with 2,2,7trimethylguanosine-specific antibody in intact snRNPs. J. Biol. Chem. 258: 2745–2747. 7. Caton, A. J., and J. S. Robertson. 1980. Structure of the host-derived sequences present at the 59 ends of influenza virus mRNA. Nucleic Acids Res. 8:2591–2603. 8. Clerx, J. P. M., F. Fuller, and D. H. L. Bishop. 1983. Tick-borne viruses structurally similar to Orthomyxoviruses. Virology 127:205–219. 9. Davison, A. J., and B. Moss. 1989. Structure of vaccinia virus early promoters. J. Mol. Biol. 210:749–769. 10. Desselberger, U., V. R. Racaniello, J. J. Zarza, and P. Palese. 1980. The 39 and 59-terminal sequences of influenza A, B and C virus RNA segments are highly conserved and show partial inverted complementarity. Gene 8:315– 328. 11. Dhar, R., R. M. Chanock, and C.-J. Lai. 1980. Nonviral oligonucleotides at the 59 terminus of cytoplasmic influenza viral mRNA deduced from cloned complete genomic sequences. Cell 21:495–500. 12. Dumas, J. B., M. Edwards, J. Delort, and J. Mallet. 1991. Oligodeoxynucleotide ligation to single-stranded cDNAs: a new tool for cloning 59 ends of mRNAs and for constructing cDNA libraries by in vitro amplification. Nucleic Acids Res. 19:5227–5232. 13. Emery, V. C., and D. H. L. Bishop. 1987. Characterization of punta toro S mRNA species and identification of an inverted complementary sequence in the intergenic region of punta toro phlebovirus ambisense S RNA that is involved in mRNA transcription termination. Virology 156:1–11. 14. Frese, M., G. Kochs, U. Meier-Dieter, J. Siebler, and O. Haller. 1995. Human MxA protein inhibits tick-borne Thogoto virus but not Dhori virus. J. Virol. 69:3904–3909. 15. Garcin, D., and D. Kolakofsky. 1990. A novel mechanism for the initiation of Tacaribe arenavirus genome replication. J. Virol. 64:6196–6203. 16. Garcin, D., M. Lezzi, M. Dobbs, R. M. Elliot, C. Schmaljohn, C. Y. Kang, and D. Kolakofsky. 1995. The 59 ends of Hantaan virus (Bunyaviridae) RNAs

9017

suggest a prime-and-realign mechanism for the initiation of RNA synthesis. J. Virol. 69:5754–5762. 16a.Haller, O. Personal communication. 17. Haller, O., M. Frese, D. Rost, P. A. Nuttall, and G. Kochs. 1995. Tick-borne Thogoto virus infection in mice is inhibited by the orthomyxovirus resistance gene product Mx1. J. Virol. 69:2596–2601. 18. Hirzman, J., D. Luo, I. Hahnen, and G. Hobom. 1993. Determination of messenger RNA 59-ends by reverse transcription of the cap structure. Nucleic Acids Res. 21:3597–3598. 19. Huiet, L., P. A. Feldstein, J. H. Tsai, and B. W. Falk. 1993. The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 59 termini. Virology 197:808–812. 20. Jin, H., and R. M. Elliott. 1993. Non-viral sequences at the 59 ends of dugbe nairovirus S mRNAs. J. Gen. Virol. 74:2293–2297. 21. Krug, R. M., F. V. Alonso-Caplen, I. Julkunem, and M. G. Katze. 1989. Expression and replication of the influenza virus genome, p. 89–152. In R. M. Krug (ed.), The influenza viruses. Plenum Press, New York. 22. Krug, R. M., M. A. Morgan, and A. J. Shatkin. 1976. Influenza viral mRNA contains internal N6-methyladenosine and 59-terminal 7-methylguanosine in cap structures. J. Virol. 20:45–53. 23. Lo´pez, J. A., C. Pen ˜ as, B. Garcıá-Barreno, J. A. Melero, and A. Portela. 1990. Location of a highly conserved neutralizing epitope in the F glycoprotein of human respiratory syncytial virus. J. Virol. 64:927–930. 24. Mark, G. E., J. M. Taylor, B. Broni, and R. M. Krug. 1979. Nuclear accumulation of influenza viral RNA transcripts and the effects of cycloheximide, actinomycin D, and a-amanitin. J. Virol. 29:744–752. 25. Mayo, M. A. 1995. A listing of virus families and genera with some discriminatory features. Arch. Virol. 140:1337–1341. 26. Meyer, B. J., and P. J. Southern. 1993. Concurrent sequence analysis of 59 and 39 RNA termini by intramolecular circularization reveals 59 nontemplated bases and 39 terminal heterogeneity for lymphocytic choriomeningitis virus mRNAs. J. Virol. 67:2621–2627. 27. Morse, M. A., A. C. Marriott, and P. A. Nuttall. 1992. The glycoprotein of Thogoto virus (a tick-borne orthomyxo-like virus) is related to the baculovirus glycoprotein GP64. Virology 186:640–646. 28. Nuttall, P. A., M. A. Morse, L. D. Jones, and A. Portela. 1995. Adaptation of members of the Orthomyxoviridae family to transmission by ticks. In A. J. Gibbs, C. H. Calisher, and F. Garcıá-Arenal (ed.), Molecular basis of virus evolution. Cambridge University Press, Cambridge. 29. Patterson, J. L., B. Holloway, and D. Kolakofsky. 1984. La Crosse virions contain a primer-stimulated RNA polymerase and a methylated cap-dependent endonuclease. J. Virol. 52:215–222. 30. Plotch, S. J., M. Bouloy, and R. M. Krug. 1979. Transfer of 59-terminal cap of globin mRNA to influenza viral complementary RNA during transcription in vitro. Proc. Natl. Acad. Sci. USA 76:1618–1622. 31. Plotch, S. J., M. Bouloy, I. Ulmanen, and R. M. Krug. 1981. A unique cap(m7GpppXm)-dependent influenza virion endonuclease cleaves capped RNAs to generate the primers that initiate viral RNA transcription. Cell 23:847–858. 32. Polyak, S. J., S. Zheng, and D. G. Harnish. 1995. 59 termini of Pichinde arenavirus S RNAs and mRNAs contain nontemplated nucleotides. J. Virol. 69:3211–3215. 33. Portela, A., L. D. Jones, and P. Nuttall. 1992. Identification of viral structural polypeptides of Thogoto virus (a tick-borne orthomyxo-like virus) and functions associated with the glycoprotein. J. Gen. Virol. 73:2823–2830. 34. Portela, A., J. A. Melero, C. Martinez, E. Domingo, and J. Ortıń. 1985. Oriented synthesis and cloning of influenza virus nucleoprotein cDNA that leads to its expression in mammalian cells. Virus Res. 4:69–82. 35. Raju, R., L. Raju, D. Hacker, D. Garcin, R. Compans, and D. Kolakofsky. 1990. Nontemplated bases at the 59 ends of tacaribe virus mRNAs. Virology 174:53–59. 36. Ramirez, B.-C., D. Garcin, L. A. Calvert, D. Kolakofsky, and A.-L. Haenni. 1995. Capped nonviral sequences at the 59 end of the mRNAs of rice hoja blanca virus RNA4. J. Virol. 69:1951–1954. 37. Robertson, J. S., M. Schubert, and R. A. Lazzarini. 1981. Polyadenylation sites for influenza virus mRNA. J. Virol. 38:157–163. 38. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 39. Shaw, M. W., and R. A. Lamb. 1984. A specific sub-set of host-cell mRNAs prime influenza virus mRNA synthesis. Virus Res. 1:455–467. 40. Siebler, J., O. Haller, and G. Kochs. 1996. Thogoto and Dhori virus replication is blocked by inhibitors of cellular polymerase II activity but does not cause shutoff of host cell protein synthesis. Arch. Virol. 141:1587–1594. 41. Staunton, D., P. A. Nuttall, and D. H. L. Bishop. 1989. Sequence analyses of Thogoto viral RNA segment 3: evidence for a distant relationship between an arbovirus and members of the Orthomyxoviridae. J. Gen. Virol. 70:2811–2817. 42. Vialat, P., and M. Bouloy. 1992. Germiston virus transcriptase requires active 40S ribosomal subunits and utilizes capped cellular RNAs. J. Virol. 66:685– 693. 43. Vogel, U., and C. Scholtissek. 1995. Inhibition of the intracellular transport of influenza viral RNA by actinomycin D. Arch. Virol. 140:1715–1723.