The Amyloid &Protein Precursor Promoter - The Journal of Biological ...

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1992 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 267, No. 24, Issue of August 25, pp. 17362-17368.1992 Printed in U.S.A.

The Amyloid&Protein Precursor Promoter A REGION ESSENTIAL FOR TRANSCRIPTIONAL ACTIVITY CONTAINSA NUCLEAR FACTOR BINDING DOMAIN* (Received for publication, December 23,1991)

Wolfgang W. Quitschke and Dmitry Goldgaber From the Departmentof Psychiatry and New York 11794-8101

.I2

havwral Science, State University of NewYork, Stony Brook,

A manifestation of Alzheimer’s disease is the presence of amyloid depositionsin brains ofafflicted individuals. A major component of these depositions is the amyloid @-protein, which is a truncated form of the larger amyloid @-proteinprecursor (APP). To investigate the regulation of APP gene expression, the APP promoter and selected deletions were placed 6’ to the reporter gene chloramphenicol acetyltransferase. The promoter deletionswere transfected into different cell lines that showed variant levels of endogenous APP transcripts. Transient transfection assays showed that 96 base pairs 6’ to the transcriptional start site are sufficient for cell type-specific promoter activity. A nuclear factor that binds tothis region in a sequencespecific manner was identified by mobility shift electrophoresis, DNase footprinting, and methylation interference. The DNase-protected region covers about 26 base pairs on both strands (position -31 to -56). Mutations within this domain revealed a sequence of 12 base pairs that is crucial for factor binding. This sequence overlaps with the consensus sequences for transcription factors AP-1 and AP-4. However, competition experiments suggest that the nuclear factor that binds to the APP promoter is distinct from both AP-1 and AP-4. Factor binding to the characterized recognition sequence is observed in nuclear extracts originating from human, mouse, and rat cells, suggesting a high degreeof conservation.

The extracellular deposition of amyloid @-proteinis a characteristic neuropathological manifestation of Alzheimer’s disease, Down’s syndrome, and hereditary cerebral hemorrhage with amyloidosis of the Dutch type (for review see Selkoe (1991)). Such depositions are also found in aging individuals, but to a lesser degree. The identification of the amyloid @protein precursor (APP)’ gene, its localization to chromosome 21, and itsexpression in various tissues and cell types presents an opportunity to determine pathological processes leading to the formation of amyloid @-protein (Goldgaber et al., 1987; Kang et al., 1987; Robakis et al., 1987; Tanzi et al., 1987). The APP gene has a complex transcriptional unit and encodes multiple transcripts for a family of secreted proteins (de

* This work wassupported by National Institutesof Health Grants AGO9320 (to D. G.) and NS30994 (to W. Q . ) .The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. The abbreviations used are: APP, amyloid 8-protein precursor; CAT, chloramphenicol acetyltransferase; kb, kilobase pair(s); EGTA, [ethylenebis(oxyethylenenitrilo)]tetraacetic acid; Hepes, 4-(2-hydroxyethy1)-1-piperazineethanesulfonic acid.

Sauvage and Octave, 1989; Jacobsen et al., 1991; Kitaguchi et al., 1988; Ponte et al., 1988; Tanzi et al., 1988). The APPgene is differentially expressed in all major tissues. In brain it is expressed primarily, but not exclusively, in neurons (Schmechel et al., 1988). The apparent overexpression of the APP gene in Down’s syndrome (Neve et al., 1988) and in certain areas of the brain in Alzheimer’s disease (Cohen et al., 1988; Higgins et al., 1988; Johnson et al., 1990) indicates that this overexpression might be a criticalrequirement for Alzheimer’s disease neuropathology (Goldgaber et al., 1987). Recent experiments with transgenic mice showed that APP overexpression indeed leads to amyloid deposition (Quon et al., 1991; Wirac et al., 1991a). These observations illustrate the importance of elucidating the mechanism of APP gene expression. The proximal APP promoter region is devoid of CCAAT and TATA elements but contains numerous consensus sequences for known regulatory transcription factors (La Fauci et al., 1989; Salbaum et al., 1988). Of these, only two HOX1.3 elements have been shown to actually be recognized by the corresponding transcription factor (Goldgaber et al., 1991). TheAPP promoter mediates neuron-specific gene expression of a reporter gene in transgenic mice (Wirac et al., 1991b). Phorbolesters,interleukin-1, andother cytokines increase levels of APP transcripts (Donnelly et al., 1990; Goldgaber et al., 1989;Mobley et al., 1988). However, no promoter elements that are involved in such increases have been identified. Theseresults,togetherwith the complex pattern of APP gene expression, suggest that the APP promoter contains sequence elements that are targets for regulatory transcription factors.The purpose of this study was to identify promoter regions that areessential forthe expression of the APP gene. This was accomplished by analyzing promoter deletions in transient transfection assays. A proximal promoter that extends to position -96 upstream of the transcriptional start site was found to be essential for high levels of expression. This domain contains a recognition sequence for a nuclear binding factor. MATERIALS ANDMETHODS

Cell Cultures and Transfection-The cell lines PC-12 (rat, neuronal properties; ATCC CRL 1721), C2C12 (mouse, myogenic; ATCCCRL 1772), Y79 (human, retinoblastoma; ATCC HTB 181, H4 (human, glioma; ATCC HTB 148), C6 (rat, glioma; ATCCCCL 107), and 10T1/2 (mouse, mesodermal) (Reznikoff et al., 1973) were grown in Dulbecco’s modified Eagle’s medium with 10% fetal calf serum and chloramphenicol (40 rg/ml). Cells were grown to about 70% confluence in 25-cm2 flasks and then transfected with 20pgof plasmid DNA/flask by the calcium phosphate-DNA coprecipitation method (Gorman, 1985). The precipitate was left on the cell monolayers for 12-18 h. Thereafter, fresh medium was added, and cells were harvested 48 h later a t about 90% confluence. Plasmids-The plasmid pCAT2bGAL (Fig. IC) was derived from pUC18, pCHllO (Hall et al., 1983), and pSV2-CAT (Gorman, 1985).

17362

Analysis of APP Regulation Promoter The @-galactosidase gene was excised from pCHllO as a HindIIIXmnI restriction fragment and subcloned into pUC18. The @-actin promoter was cloned 5' to the @-galactosidase gene into the SalI restriction site of the polycloning site of pUC18 as an XhoI-HinfI (-277 to +1) restriction fragment, in which the HinfI site had been converted to SalI with linkers (Quitschke et al., 1989a). The entire@galactosidase gene, including the p-actin promoter, was excised as a BamHI-BarnHI restriction fragment in which the BamHI sites were converted to NotI restriction sites with linkers. This fragment was cloned intotheNdeI restriction site of pUC18, which had been converted with linkersto a NotI restriction site. The chloramphenicol acetyltransferase (CAT) gene was excised from pSV2-CAT as a HindIII-BarnHI restrictionfragment. The BamHI site was bluntended,andthe CAT gene was then cloned between theHindIII restriction site and the blunt-ended NarI restriction site of pUC18 containing the @-galactosidasegene. The structure of the APP promoter has been described in detail elsewhere (La Fauci et al., 1989; Salbaum et al., 1988). The APP promoterfragment used in this study extends from theBarnHI restriction site at position +lo0 downstream of the transcriptional start site to theEcoRI restriction site a t position -2832 upstream of the transcriptional start site(Fig. L4). Deletions at the5' end of this fragment were produced using selected restriction sites. Deletion 1 was introducedat position -1359 (SspI),deletion 2at -488 (HindIII), deletion 3 at -303 (XbaI), deletion 4 at -204 (EagI), deletion 5 at -96 (NarI), and deletion6 at -49 (PuuII). Resultingrestriction fragments were cloned into the polycloning site of pCAT2bGAL. In addition, the chicken @-actinpromoter was cloned into the polycloning site of pCAT2bGAL as a reference promoter. In this control plasmid, both the @-galactosidaseand the CAT genes are transcribed from identical @-actinpromoter fragments. Expression Assays-Transfected cells were harvested, disrupted in three freeze-thaw cycles, and centrifuged at 12,000 X g for 5min. The supernatant was used for subsequent enzyme assays. @-Galactosidase activity was determined by using chlorophenol red-@-D-galactopyranoside (Boehringer Mannheim) as a substrate. Five percent of cell extract from 25-cmZflasks was incubated a t 37 "C in 5 mM chlorophenol red-@-D-galactopyranoside,1 mM MgClz, 100 mM Hepes pH 7.6 for 5-30 min,dependingontransfection efficiency. Substrate conversion was determined spectrophotometrically at a wavelength of 570 nm. The @-galactosidase activitywas determined to normalize all extracts with regard to transfection efficiency and other variables prior to performing CAT assays. CAT assays (Gorman, 1985) were performedwith cell extracts adjusted to identical @-galactosidaseactivity and quantitatedby liquid scintillation counting of the acetylated and nonacetylated forms of ~-threo-[dichloroacetyl-l-~~C]chloramphenicol (Amersham Corp.), which were excised from thin layer chromatographyplates. CAT assays were adjusted so that totalconversion into themonoacetylated forms was within the linear range of less than 40%. The CAT activity resulting from each APP promoter construct was normalized to the CAT activity from the @-actin promoter, which was assigned the value 100% in each cell line. Each construct was tested in a t least four separate assays. RNA Isolation andNorthern Anulysis-Cytoplasmic RNA was isolated from cultured cells as described (Maniatiset al., 1989). Approximately 15 pg of each RNA sample was subjected to Northern blot analysis using nick-translated radiolabeled probes. The APP probe was an approximately 1-kb EcoRI fragment (Goldgaber et al., 1987) from a human APP,,, cDNA (base pairs 2020-3076). The @actin probe was an approximately 1.6-kb fragment representing a full-length chicken @-actincDNA (Eldridge et al., 1985). Mobility Shift Electrophoresis-Oligonucleotides or restriction fragments were 5' end-labeled with [-y-32P]ATP (Maniatis etal.,1989) and incubated for 10 min at room temperature (20,000-50,000 cpm/ reaction) with 10-20 pg of protein from nuclear extracts in binding buffer (75 mM NaCl, 0.1 mM EGTA, 15 mM Tris, pH 7.5, 0.5 mM dithiothreitol, 0.05% Nonidet P-40, and 5% glycerol) supplemented with 2 pg of poly(d1-dC) and 10 pg of yeast tRNA in a total reaction volume of 30 pl. The incubation mixture was electrophoresed in 1% agarose gels with 0.5 X Tris-borate-EDTA (Maniatis et al., 1989) a t 30 mA constant current for 2.5h. Gels were dried and autoradiographed for 2-4 h at -70 'C. DNase Footprinting and Methylation Interference-DNase footprinting (Galas and Schmitz, 1978) was carried out on a 5' endlabeled APP promoter fragment extending from position -96 (NarI) t o +53 (SrnaI) (Fig. 1B). This fragment was incubated with nuclear extract from rat brain as described above, and 0.1 unit of DNase I

17363

was added for 2 min followed by electrophoresis in 1% agarose in 0.5 X Tris-borate-EDTA. TheDNA was then transferred todiethylaminoethylcellulose paper (Whatman) andautoradiographed. The bound and the free DNA fragments were eluted in 1.5% NACl overnight, extracted with phenol-chloroform,and precipitated with ethanol.The DNase I-digested bound and free fragments were electrophoresed in an 8% sequencing gel. Methylation interference was assayed by partially methylating the same APP promoter fragment with dimethyl sulfate (Maxam and Gilbert, 1981) before mobility shift electrophoresis. After isolating the bound and the free fragmentsas described above for DNase footprinting, the partially methylated fragments were cleaved with piperidine, separated in an 8%sequencing gel, and autoradiographed. Nuclear Extracts-Nuclear extracts from cultured cells were prepared as described elsewhere (Heberlein and Tjian, 1988). Nuclear extracts from rat brain were obtained by a modification of the same protocol. Rat brains(5-15 g) were homogenized in 5 volumes of buffer A (10 mM Hepes pH 7.6, 15 mM KCl, 2 mM MgC12, 0.1 mM EDTA, 1 mM dithiothreitol, 1 mM NaS205, 0.2 mM phenylmethylsulfonyl fluoride). The homogenate was filteredmultiple times throughlens paper to remove connective tissue and large debris. Subsequently, the homogenate was centrifuged at 15,000 X g for 10min, andthe supernatant was discarded. The pellet was rehomogenized in 5 volumes of buffer A containing 1.2 M sucrose. The homogenate was filtered through lens paper once more and centrifuged in a swinging bucket rotor at 100,000 X g for 30 min. The pellet was rehomogenized in buffer A and centrifuged at 15,000 X g for 10 min. The supernatant was discarded, and the pellet was homogenized in a total volume of 18 ml of buffer A. To this, 2 ml of buffer B (50 mM Hepes pH 7.6, 1 M KCl, 30 mM MgCI,,0.1 mM EDTA, 1 mM dithiothreitol, 1 mM NaS206, 0.2 mM phenylmethylsulfonylfluoride) and 2 ml of 4 M (NH&S04, pH 7.6 were added. The viscous solution was mixed in a rotator for 20 min and centrifuged at 100,000 X g for 30 min. The pellet was discarded, and 0.3 g of solid (NH4)&04was added per ml of supernatant and stirred until dissolved. The precipitated protein was pelleted and redissolved in buffer C (25 mM Hepes pH 7.6, 40 mM KCl, 12.5 mM MgClZ,0.1 mM EDTA, 1 mM dithiothreitol, 0.5 mM NaSZO3,0.1 mM phenylmethylsulfonyl fluoride, 10% glycerol) to a final concentration of 2-5 mg of protein/ml. The protein solution was dialyzed against 500 ml of buffer C for 2-4 h. Insoluble material was pelleted, and the supernatantwas aliquoted and stored at -80 "C for use in binding studies. All operations were carried out at 4 "C. Oligonucleotides and Fragments-Complementary double-stranded oligonucleotides were synthesized on an Applied Biosystems DNA synthesizer. They were deblocked and gel-purified prior to labeling and hybridization. Most double-stranded oligonucleotides that were used as competitors and probes are indicated in Figs. 6 and 8. An additionaldouble-stranded oligonucleotide containinga CCAAT binding domain from the chicken @-actinpromoter (position -106 to -71) was used as a control for the quality of the nuclear extracts (Fig. 4), 5'-AGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCG. The recognition sequence for the CCAAT binding factor is underlined (Quitschke et al., 1989a). Restrictionfragments derived from the APP promoter are described in Fig. l. Additional restriction fragments used as mobility shift competitors were obtained from the chkken @-actin promoter and the chicken cardiac a-actin promoter. The chicken @-actinpromoter fragment extendedfrom position -106 to +1and included both TATA and CCAAT domains as well as an spl and a CArG consenses sequence (Quitschke et al., 1989a). The cardiac a-actin promoter extended from position -100 to +16 and included a TATA and a CArG element (Quitschke et al., 198913). RESULTS

Deletion Analysis of the Human APP Promoter in Transfected Cell Lines-There are numerous consensus sequences for binding sites ofnuclearregulatoryfactorswithin2832 base pairs upstream of the primary transcriptional start site (+1) of the APP promoter (La Fauci et al., 1989; Salbaum et al., 1988).To determine which part the of promoter is essential for transcriptional activity, deletions were introduced at the restriction sites SspI (-1359), HindIII (-488), XbaI (-303), EagI (-204), NarI (-96), andPuuII (-49) (Fig. lA). The APP promoter and its 5' deletion constructswere introduced into the polycloning site of the expression vector

Analysis of APP Promoter Regulation

17364

[czclzl[cnl[ l l ' l ~ [ 1 ' ( ' 1 2 ~ [ Y 7 Y ~ [ 1 n21l ' l

FIG.2. APP transcript levels in selected cell lines. Cytoplasmic RNA was isolated from the cell lines C2C12, C6, H4, PC-12, Y79, and 10T1/2 and analyzed by Northern blotting. The blot was sequentially probed with a 1-kbAPP cDNA probe and the full-length 1.6-kb chicken$ actin cDNA (Eldridge et al., 1985) as indicated.

1

F=w-wS h

ylIll"fll+l,

FIG. 1. Structure of APP promoter and expression vector. A, the general structure of the APP promoter is schematically illustrated. The approximate positions of consensus sequences for known transcription factors are indicated (boxes).These include HOX-1.3 (Odenwald et al., 1989), NF-KB (Lenardoand Baltimore, 1989), AP1 (Lee et al., 1987), the heat shock element (HSE)(Wu et al., 19871, AP-2 (Williams et al., 1988), and AP-4 (Mermod et al., 1988). The positions of relevant restriction sites (vertical lines) are indicated with respect to their distance from the main transcriptional start site (+l).The position numbers of restriction sites mark the first 5'nucleotide that is part of that restriction site. B, the sequence of the proximal promoter segment from position -96 to +105. The positions of relevant restriction sites and reference nucleotides are indicated. This portion of the promoter also contains consensus sequences AP4 (TCAGCTGACT) and AP-1 (TGACTCG) (underlined). C, schematic structure of the expression vector pCAT2bGAL.All APP promoter constructs and the chicken @-actinpromoter (Quitschke et al., 1989a) were cloned into thepolycloning site of this vector.

pCAT2bGAL, which was used for transfection studies (Fig. IC). This plasmid contains the transcriptional unit of the bacterial @-galactosidasegene, which is transcribed from the constitutive chicken @-actinpromoter(Quitschke et al., 1989a) and serves as an internalcontrol for the expression of the reporter gene CAT (Gorman, 1985). The colinear arrangement of the CAT and @-galactosidasetranscriptional units in pCAT2bGAL minimized experimentalvariationsresulting from differences intransfection efficiencies and handling procedures. The reporter gene CAT is transcribed from the APP promoter or its 5' deletion fragments. In addition, a control plasmid was generated in which the @-actin promoter was introduced into thepolycloning site of pCAT2bGAL. The control plasmid was used to compare the level of expression from the @-actin promoter withthat from the APPpromoter and its deletion constructs (Fig. IC). Plasmids containingthe promoterconstructs were transfected into PC-12, H4, C6, C2C12, and 10T1/2 cells by the calcium phosphate-DNA coprecipitation method (Gorman, 1985). In addition, the steady state level of endogenous APP transcript was determined by Northern blotanalysis in these cell lines and the human retinoblastoma line Y79 (Fig. 2). The primary APP transcripts in all cell lines migrated to a position corresponding to a size of about 3.3 kb. This represents theapproximate size of the threemajor APP transcripts APP770, APPT5,,and APPss5.The highest level, byfar, of APP transcript was observed in the human retinoblastoma cell line Y79. In thiscell line, the level of APP transcriptexceeds that of @-actintranscript, which was determined for reference. PC12 and H4 cells contained lower levels of APP transcript than @-actin transcript.The level of APP transcript in 10T1/2, C6, and C2C12 cells was exceedingly low and barely detectable.

PC-12

H4

C6

C2C6 10T112

FIG. 3. Deletion analysis of the APP promoter.CAT activity from the APP promoter and its deletions in the cell lines PC-12, H4, 10T1/2, C6, and C2C12 are shown. The CAT activities obtained from the full-length APP promoter ( A ) and its deletions (1-6) were normalized to those from the &actin promoter, which were assigned the value 100% in each cell line. Each bar represents the mean value of a t least four independent assays.

The cell lines PC-12, H4, C6, C2C12, and 10T1/2 grow as fibroblast-like monolayers. In contrast, the cell line Y79 grows in suspension, which complicates transfection procedures. Therefore, it was excluded from transient transfection experiments even though it showed the highest level of endogenous APP transcript(Fig. 2). The CAT expression from each APP promoter construct was compared with the CAT expression from the @-actin promoter inthe control plasmid, which was assigned the value 100% in each cell line. The highest level of APP promoter expression relative to the expression from the @-actin promoter occurs in PC-12 cells followed by H4, 10T1/2, and C6 cells (Fig. 3). The lowest level of CAT activity from the APP promoter is observed in C2C12 cells. These relative levels of expression are in rough agreement with the levels of APP transcript observed in the different cell lines (Fig. 2). Furthermore,deleting the APP promoter from position -2832 (APP) to position -96 (deletion 5) has no significant effect on promoter activity in anyof the cell lines, regardless of level of expression relative to the @-actinpromoter. However, further deleting the promoter to position -49 (deletion 6) causes a 7-10-fold decline in promoter activity in all cell lines. These results suggest that a crucial promoter element is present within the 96 base pairs upstream of the transcriptional start site that is either disrupted or removed in deletion 6. Nuclear Factor Binding to the Proximal APP Promoter Element-To determine if this sequence contains a nuclear factor binding domain, the promoter region extending from position -96 to +53 (NarI-SmaI; Fig. 1B) was 5' end-labeled, and factor binding was examined by mobility shift electrophoresis. Nuclear extracts were obtained from rat brain (Manning et al., 1988) and the human retinoblastoma line Y79 (Fig.

Analysis of APP 17365 Regulation Promoter same when the AuaI-AuaI (position -77 to -13) fragment was used as competitor (Fig. 40, lanes 5-7). No significant competition for binding was observed with a 100-fold molar excess of either cardiaca(lane 8 ) or p-actin (lane 9)promoter fragments. This suggests that factor binding is sequencespecific and that the recognition sequence is located within the promoter fragment extendingfrom position -77 to -13. Mapping of Factor Binding Site by DNase Footprinting and Methylation Interference-To more precisely define the binding domain, the fragment from position -96 to +53 was 5' end-labeled on either strand. The labeled fragment was incubated with rat brain nuclear extract and partially digested with DNaseI. A protectedregion is observed on both strands, which covers approximately 25 base pairs and extends from position -55 to -31 (Fig. 5). These results suggest that the nuclear factor binding domain extends from position -55 to -31 upstream of the transcriptional start site. Incidentally, deletion 6 at position -49, which displays diminished promoter activity (Fig. 3), interrupts this binding domain (Fig. 1B). The same fragment was also analyzed by methylation interference assayto determine structurally relevant DNA contact points. Partial inhibition of binding was observed with methylation of two G residues on each strand. The G residues that cause binding interference are located within the DNaseprotected domain determined by the footprinting assay 4C). (Fig. 5). Mobility shift competition was performed to determine the Effect of Sequence Mutations on Binding Activity-To idenspecificity of binding and whether the factor binding to the tify the recognition sequence for factor binding, complemenA I ~ - A u urestriction I fragment is identical to thefactor bind- tary double-stranded oligonucleotides that included the pro;' to the entire NarI-SmaI restriction fragment. The 5' endlabeled NarI-SmaI fragment was incubated with nuclear exA B tract from rat brain with increasing concentrations of unlaC N c s b f h f h f h f beled fragment as competitor. Significant Competition for binding occurs when a 50-fold molar excess of competitor is added (Fig. 40,lanes 1-4). The level of competition was the 2) since these contain high levels of APP transcript. Thecell line Y79 was also selected because it is of human origin since it is possible that a nuclear factor might recognize a sequence that is specific for the human promoter studied here. A 36base-pair oligonucleotide containingaubiquitous CCAAT binding recognition sequence from the chicken P-actin promoter (Quitschke et al., 1989a) was included in the mobility shift analysis to control for the quality of the nuclear extract. Both rat brain and Y79 nuclear extracts show the characteristic mobility shift observed with the CCAAT binding domain of the @-actinpromoter(Quitschke et al., 1989a, 1989b) (Fig. 4A).In addition, both extractsgenerate adistinct mobility shift with the APPpromoter fragmentfrom position -96 to +53 (Fig. 4B). The bound APP promoter fragment migrates to the same position with both rat brain and Y79 nuclear extracts. Identical mobility shift patterns have also been observed with nuclear extracts from PC-12 (rat), C6 (rat), C2C12 (mouse), 10T1/2 (mouse),and H4 (human) cells, indicating that thebinding factor is structurally conserved in these species (not shown). To further define the binding region, a different fragment of the APPpromoter was used as a probe. This AuaI-AuaI restriction fragment extends from position -77 to -13 (Fig. 1B) andincludes the PuuII restriction site a t position -49. This fragment also produces a mobility shift with rat brain and Y79 nuclear extracts (Fig.

I

11,

:

X

Ill\

ill,

.

I

5,h

:

,

IO,

,

.,a

;,I\

#

*

,

"

I,",, I,",,

FIG. 4. Mobility shift electrophoresis. A, mobility shift assay with a 36-base pair double-stranded oligonucleotide from the chicken @-actin promoter.This oligonucleotide contains the binding site of a ubiquitous CCAAT binding factor (Quitschkeet al.,1989a). The assay was performed with nuclear extracts from rat brain ( B r ) and the human retinoblastoma line Y79. The bound ( b )and free ( f) fragments are indicated. B, mobility shift assay usingan APPpromoter fragment from position -96 to +53 (NarI-SrnaI;Fig. 1B) asa probe. C, mobility shift assay using an APPpromoter fragment from -77 to -13 (AvaIAoaI) as a probe. D, mobility shift competition. The 5' end-labeled APP promoter fragment from position -96 to +53 (NarI-SrnaI) was incubated with nuclear extract from rat brain (lane I ). The mobility shift was competed with a lo-, 30-, and 50-fold molar excess ( I O x , 30x, and 50x) of unlabeled fragment (lanes 2-4). In lanes 5-7, the APP promoter fragment from position -77 to -13 ( A d - A u a I ) was used as an unlabeled competitor. Lunes 8 and 9 show mobility shifts ) the chicken cardiac-a actin with a 100-fold molar excess ( 1 0 0 ~of (-100 to +16) (Quitschke et al.,1989b) and thechicken &actin (-107 t o +1) (Quitschke et al., 1989a) promoters.

0 .

.-

-m

"

II

I

44

m9

-1

.:> .&' C' GGGGlGGGCCGG~lCAGClGAClCGCClGGClCllGAGCCC

r

\ CCCCACCC GCCIA TC ACTGAGCGGACCGA ACTCGGG

FIG. 5. DNase footprinting and methylation interference. For both assays, the APP promoter fragment from position -96 to +53 was 5' end-labeled and incubated with rat brain nuclear extract. A, DNase footprinting of coding (C) and noncoding ( N )strands. Free (f) and bound ( b ) fragments were separated by mobility shift after digestion with DNase. Brackets indicate the approximate binding domain. B, methylation interference. The methylated G residues that interferewithbinding are indicated by arrows. The lower panel summarizes the results from DNase footprinting and methylation interference. Brackets indicate the DNase-protected binding domain, and arrows show methylated bases that interfere with binding.

17366


moter region from position -58 to -30 were synthesized. Within this domain, blocks of transverse mutations were introduced, and binding activity was analyzed by mobility shift andcompetition assays (Fig. 6 ) . Mutating theperipheral nucleotides from -58 to -54 and -30 to -38 (Fig. 6 , lane M I ) has no appreciable effect on binding activity. Oligonucleotides containing these transverse mutations display nuclear factor binding that is indistinguishable from the binding to thewild type oligonucleotides and show the samedegree of binding competition. However, mutating threeadditional nucleotides on the 5' side of the binding domain (lane M 2 ) causesa significant reduction in factor binding. Mutating blocks of 3 base pairs at a time beyond that point (lanes M3M 5 ) causes almost complete inhibition of binding for the next 9 base pairs. Mutating an additional three base pairs (lane M 6 ) further downstream has only a marginal effect on factor binding. These results suggest that the core binding recognition seauence (underlined) is comDosed of the nine baseDairs (GGA)TCAGCTGAC(TCG). The' core is flanked by 3-base Dairs on either side. which disDlav a limited effect on factor binding when mutated (Fig. 6 ) : " Nuclear extracts from cell lines used for APP expression studies were also analyzed to determine if factors present in these cells bind to the same recognition sequence. Electrophoretic mobility shift assays were performed with nuclear extracts from six cell lines (Fig. 7). The extracts were incubated with labeled oligonucleotides containing the unmodified native sequence (Fig. 7, lane W T ) and mutations Ml"6 (Fig. 6 A ) . The nuclear extracts from all sources display the same binding pattern asis observed with nuclearextract from rat brain (Figs. 6B and 7). This indicates that nuclear factors present in cells of mouse, human, and rat origin bind to the same recognition sequence. The 9-base pair core domain and its flanking nucleotides

r-

CB c2c12 10TW

ws PC-12 H4 W M1 M2 M3 M4 M5 M6

FIG. 7. The effect of mutations on factor binding with nuclear extracts from different cell lines.Labeled oligonucleotides containing the unmodified APP promoter sequence ( W T ) or mutations M1-M6 (Fig. 6A) were incubated with nuclear extracts from the cell lines C6, C2C12, 10T1/2,Y79, PC-12, and H4. The bound fragments are shown for each cell line and oligonucleotide sequence as indicated. A . X I

-58

GGGCCGGATCAGCTGACTCGCCTGGCTCT WI' G G G C C G G A G K G C E E E ~ ~ C T G G C T C T ~7

sv40

5'- G G A A A G A ~ A A T G L G I U U

B

\VI

\I7

D

C

~ \ J I I h-1\ I 7 b \ d L'llmwlll~,r, IIKIY

JOY 1 m \ 1

I n 1w\1

\17

\\Jo

FIG. 8. Comparison of mobility shift patterns of fragments containing AP-1 and AP-4 sequence elements. A, sequence of the oligonucleotide containing theunmodified APP promoter binding domain ( W T ) .A mutation of 4 base pairs ( M 7 ) in which a perfect AP-1 consensus sequence wasgenerated (bracket)while the consensus sequence AP-4 was eliminated is shown. The portion of the SV40 enhancer ( S V 4 0 ) ,which contains botha copy of an AP-4 binding site (boxed) and a copy of-an AP-1 binding site in reverse orientation (underlined) is shown. B, mobility shift pattern with labeled oligonucleotides WT, M7, and SV40 incubated with rat brain nuclear extracts. C,mobility shift competition of labeled WT oligonucleotide with unlabeled competitors WT, M7, and SV40 added a t a 100-fold molar excess ( I O O X ) . D, mobility shift competition of labeled oligonucleotides M7 and SV4O with either no competitor (OX)or with a 100-fold molar excess ( I O O X ) of the respective unlabeled oligonucleotide as competitor. b

contain the recognition sequences for transcription factors AP-4 (CAGCTG) andAP-1 (TGACTCG) (Mermod et al., 1988; Hu et aZ., 1990). It was investigated whether either of these factors contributeto thebinding activity described here. In one case, a complementary pair of oligonucleotides was synthesized in which parts of the APP sequence were replaced FIG. 6. Effects of mutations on factor binding. A, block mu- to generate a perfect AP-1 site (Bohmann et aZ., 1987), while tationsin oligonucleotides containingthenuclearfactorbinding eliminating the upstream AP-4 site (Fig. SA, lane M7). These domain were tested for their ability t o bind and compete the nuclear factor from rat brain. WT indicates the unmodified APP sequence base replacements resulted in aprofound reduction in binding domain of an oligonucleotide from position -58 to -30. Oligonucle- and a different mobility shift pattern(Fig. SB, lane M7). otides MI-M6 contain various block transverse mutations. The muThe original studies on AP-4 and AP-1were performed on tated sequence elements are underlined. B, mobility shift assay with the SV40 enhancer, which contains both sequence elements the 5' end-labeled nucleotides described in A using rat brain nuclear a 75-fold molar in the vicinity of each other (Mermod et al., 1988). However, extract. C, mobility shiftcompetitionassaywith excess of the unlabeled oligonucleotides describedin A as competitors. the AP-1element is in opposite orientation to the AP-4 element. A 29-base pair oligonucleotide identical to that part T h e left lane shows a mobility shift assay without competitor.


17367

sion in deletion 6 a t position -49 further substantiates the notion that theobserved cell type-specific difference in APP promoter expression is mediated by sequence elements in the proximal promoter domain that are eliminated in deletion 6. In a different study,APP promoter deletions were analyzed by transient transfection of HeLa and PC-12 cells as reported by Lahiri and Robakis (1991). Those authors report two blocks of regulatory elements within the analyzed promoter region. One block, from position -600 to -460, acts as a positive regulator and another, from position -450 to -150, acts asa negative regulator. The reason for the discrepancies with the results reported here is currently unclear, but it may DISCUSSION be related to theuse of different methods for normalizing the The APP promoter does not contain a CCAAT or TATA CAT activity between transfection experiments. DNase footprinting, methylation interference, and mobility element in the vicinity of the main transcriptional start site. However, the GC content of the proximal promoter region shift assays indicate anuclear factor that binds in asequence(-96 to +1)exceeds 75% and containsmultiple CpG elements. specific manner toa region that extends from position -55 to It is thus similar to promoters of housekeeping genes, which -31. Using synthetic oligonucleotides with transverse mutamay be transcriptionally regulated through DNA methylation tions, the recognition sequence was determined to contain a (Bird, 1986; Gardiner-Garden and Frommer, 1987). In addi- core domain of 9 base pairs. The core recognition sequence tion, the APP promoter studied here contains several consen- (underlined) with flanking nucleotides GGAT[CAGC(TG]ACTCG) contains the overlapping recognition sequences APsus sequences of known potential binding sites for nuclear regulatory factors (Fig. 1).However, no function has been 4 [CAGCTG] and AP-1 (TGACTCG).A close association assigned to any of these binding sites, and only two HOX-1.3 between AP-4 and AP-1 binding sites is not unique and has recognition sequences have been shown to be recognized by been reported in other eukaryotic promoters (Comb et al., the corresponding transcriptionfactor (Goldgaber et al., 1988; Gabudza et al., 1989; Mermod et al., 1988). In estimating the contribution of these two sequence ele1991). The APP promoter was dissected by introducing 5’ deletions at selected restriction sites. These deletion con- ments to the factor binding described here, the following structs were analyzed by transient transfection in cell lines points should first be considered. Mutating the first 3 base derived from different species and tissues. In each cell line, pairs of the 9-base pair core domain from TCA to GAC the activity of the APP promoter constructs was compared completely eliminates the AP-4 consensus sequence but leaves with the activity of the chicken 8-actin promoter. The activity theAP-1 consensus sequence intact. Nevertheless, factor of this promoter is dependent on a ubiquitous CCAAT binding binding is completely abolished, suggesting that the binding factor and is constitutively expressed in all cell lines examined factor is not AP-1. Furthermore, competition of factor binding to date (Quitschke et al., 1989a; Seiler-Tuyns et al., 1984; to the wild type sequence is not abolished with a 100-fold Vourio et al., 1990). Consequently, the ,&actin promoter serves molar excess of an oligonucleotide containing the AP-1 conas a suitable control for variations in promoter expression sensus sequence (Fig. 8), and mutating the 5”flanking sedueto differences inexperimental procedures as well as quence GGA to TTC has a profoundly reducing effect on differences in metabolic conditions of cells that may affect binding activity to this promoter fragment. This sequence element is not part of the recognition sequence for AP-4, and general transcriptional activity. After normalizing the activities from the APP promoter on that basis alone it is questionable whether the binding constructs with those from the P-actin promoter, it became factor described here is AP-4. Further evidence that AP-4 is apparent that APPpromoter expression varied in the differ- not involved in the binding to this APP promoter region is ent cell lines. This suggested that the human APP promoter obtained from mobility shift experiments using an oligonuclecontained sufficient sequence information to mediate cell otide that contains an AP-4 binding site as partof the native type-specific expression. In addition, in each cell line, pro- SV40 enhancer (Mermod et al., 1988). This fragment generis different from the pattern moter expression remained largely constant despite a reduc- ates a mobility shift pattern that tion in promoter size from -2832 to -96 base pairs upstream obtained with the APP promoter fragment. In addition, the from the transcriptional start site and the removal of two SV40 enhancer fragment does not compete with the binding HOX-1.3sites, four NF-KB sites,one AP-1 site,one heat to the APPpromoter fragment (Fig. 8 B ) . shock element, and one AP-2 site (Fig. lA). The expression These experiments indicatethat the APP promoter binding from the APP promoter differs in each cell line with respect factor is distinct from both AP-1 and AP-4. However, other t o expression from the P-actin promoter as determined by DNA binding factors that share thehelix-loop-helix motif of transient transfection. Similarly, there are variations in the AP-4 (Hu et al., 1990) include Pan (Nelson et al., 1990), the levels of APP transcript between the cell lines with respect immunoglobulin gene enhancer binding proteins (Murre et to the level of P-actin transcript (Figs. 2 and 3). In general, al., 1989), muscle-specific differentiation factors (Lassar et the cell lines with the highest level of expression from the al., 1989; Wright et al., 1989; Braun et al., 1989), and DFOAPP promoter also contained the highest level of endogenous sophila regulatory factors (Caudy et al., 1988; Murre et al., APP transcript (Figs. 2 and 3). This suggests that an endog- 1989). These factors have very similar core recognition seenous regulatory mechanism exists, which confers levels of quences, and itis conceivable that thebinding factor observed APP expression that are specific for each cell line. This cell here belongs to the same class of binding factors. Alternatype-specific level of expression from the APP promoter is tively, the APP promoter binding factor may be unrelated to maintained with only 96 base pairs upstream from the tran- AP-1 and AP-4. For example, two factor binding sites, which scriptional start site (Fig. 3). Sequence elements further up- are near each other within the enhancer of the proenkephalin stream appear to have a negligible effect, if any, on base-line gene, are required for the transcriptional response to CAMP promoter expression. The reduction in APP promoter expres- and phorbol ester. These binding elements contain overlapof the SV40 enhancer sequence was analyzed (Fig. 8A, lane SV40). A mobility shift assay with this oligonucleotide results in strong binding activity; however, the bound fragment migrates faster than thenative APP promoter fragment (Fig. 8A, lane SV40). More importantly, neitherthe M7 nor the SV40 fragments are able to compete for the binding factor to the wild type APP fragment, whereas they are able to compete for their own binding factor (Fig. 8, B and C). These experiments indicate that this APP promoter binding factor is distinct from AP-1 andAP-4.

17368


ping recognition sequences with AP-1 and AP-4; however, they are also recognized by binding factors related to NF-1 (Chu et al., 1991; Comb et al., 1988). The interpretation of binding and transient transfection studies seems to suggest that thenuclear factor described here is a transcriptional activator, since deletion 6 at position -49 both interrupts the binding domain and displays diminished promoter activity. However, the experiments do not preclude the possibility that the bindingfactor acts as a negative regulator that modifies transcription by a positive factor. If this is the case, the sequence elements responsible for transcriptional activation must nevertheless be located near the recognition sequence of the binding factor described here, since deleting the promoter from position -96 to -59 profoundly reduces its expression. Further studies are required to characterize this APP promoter binding factor and determine its precise functional significance. Acknowledgments-We thank Michael P. Vitek for invaluable support during all phases of this project and Bruce M. Paterson for providing 8-actin cDNA. Note Added in Proof-Since the submission of this manuscript, relatedarticleson thehuman (Pollwein, P., Masters, C. L., and Beyreuther, K. (1992) Nucleic Acids Res. 20, 63-68) and mouse (Izumi, R., Yamada, T., Yoshikai, S.-i., Sasaki, H., Hattori, M., and Sakaki, Y. (1992) Gene (Amst.) 112, 189-195) APP promoters have been published. REFERENCES Bird, A. P. (1986) Nature 321, 209-213 Bohmann, D., Bos, T. J.,Admon, A,, Nishimura, T., Vogt, P. K., and Tjian,R. (1987) Science 238,1386-1392 Braun, T., Buschhausen-Denker,G., Bober, E., Tannich, E., and Arnold, H. H. (1989) EMBO J. 8, 701-709 Caudy, M., Viissin, H., Brand, M., Tuma, R., Jan, L. Y., and Jan, Y. N. (1988) Cell 65,1061-1067 Chu, H:M., Fischer, W. H., Osborne, T. F., and Comb, M. J. (1991) Nucleic Acids Res. 19,2721-2728 Cohen, M. L., Golde, T. E., Usiak, M. F., Younkin, L. H., and Younkin, S. G. (1988) Proc. Natl. Acad. Sci U. S. A. 85,1227-1231 Comb, M., Mermod, N., Hyman, S. E., Pearlberg,J., Ross, M. E., and Goodman, H. M. (1988) EMBO J. 7,3793-3805 de Sauvage, F., and Octave, J.-N. (1989) Science 246,651-653 Donnelly, R.J., Friedhoff, A. J., Beer, B., Blume, A. J., and Vitek, M. J. (1990) Cell. Mol. Neurobiol. 10, 485-495 Eldridge, J., Zehner, Z., and Paterson, B. M. (1985) Gene (Amst.) 36, 55-63 Gabudza, D. H., Hess, J. L., Small, J. A,, and Clements, J. E. (1989) Mol. Cell. Bwl. 9,2728-2733 Galas, J. D., and Schmitz, A. (1978) Nucleic Acids Res. 5, 3157-3170 Gardiner-Garden, M., and Frommer, M. (1987) J. Mol. Biol. 196, 261-282 Goldeaber. D.. Lerman. M. I.. McBride. 0. W.. Saffiotti. U.. and Gaidusek, D. ' C. 11987) Science 236,877-880 Goldgaber, D., Harris, H. W., Hla, T., Maciag, T., Donnelly, R. J., Jacobsen, J. S., Vitek, M. P., and Gajdusek, D. C. (1989) Proc. Natl. Acad. Sei. U. S. A. Ra. - -, 7.- -m- .~- -7- ~ n Goldeaber. D.. Schmechel. D. E.. and Odenwald. W. F. (1991) Brain Res. Reu. 16; 89-91 ' Gorman, C. (1985) in DNACloning (Glover, D.M., ed) Vol.2, pp. 143-149, IRL Press, Washington D. C. Hall, C. V., Jacob, P. E., Ringold, G. M., and Lee, F. (1983) J. Mol. Appl. Genet. 2, 101-109

Heberlein, U., and Tjian, R. (1988) Nature 331,410-415 Higgins, G. A., Lewis, D. A,, Bahmanyar, S., Goldgaber, D., Gajdusek, C. D., Young, W. G., Morrison, J. H., and Wilson, M. C. (1988) Proc. Natl. Acad. Sci. U. S. A. 85,1297-1301 Hu. Y.-F.. Luscher. B.. Admon.. A,., Mermod., N... and Tiian. - . R. (1990) Genes & Deu. 4,'1741-1752 ' Jacobsen, S. J., Muenkel, H. A,, Blume, A. J., andVitek, M. P. (1991) Neurobiol. Agmg 12,575-583 Johnson, S. A,, McNeill, T., Cordell, B., and Finch, C . E. (1990) Science 248, 854-856 Kang, J., Lemaire, H.-G., Unterbeck, A., Salbaum, M. J.,Masters, C. L., Grzeschik, K. H., Multhaup, G., Beyreuther, K., and Muller-Hill, B. (1987) Nature 325,733-736 Kitaguchi, N., Takahashi, Y., Tokushima, Y., Shiojiri, S., and Ito, H. (1988) Nature 331,530-532 La Fauci, G., Lahiri, D. K., Salton, S. R. J., and Robakis, N. K. (1989) Biochem. Biophys. Res. Commun. 159, 297-304 Lahiri, D. K., and Robakis, N. K. (1991) Mol. Brain Res. 9,253-257 Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D., and Weintraub, H. (1989) Cell 5 8 , 823-831 Lee, W., Mitchell, P., and Tjian, R. (1987) Cell 4 9 , 741-752 Lenardo, M. J., and Baltimore, D. (1989) Cell 58, 227-229 Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Manning, R. W., Reid, C. M., Lampe, R. A., and Davis, L. G. (1988) Mol. Brain Res. 3, 293-298 Maxam, A. M., and Gilbert, W. (1981) Methods Enzymol. 65,499-560 Mermod, N., Williams, T. J., and Tjian, R. (1988) Nature 332,557-561 Moblev. W. C.. Neve. R. L.. Prusiner. S. B.. and McKinlev. - . M. P. (1988) Proc. Nuti Acad. sci. U.'S. A. 85,9811-9815 ' Murre, C., McCaw, P. S., and Baltimore, D. (1989) Cell 56, 777-783 Nelson. C.. Shen. L.-P.. Meister.. A,. . . .Fodor. E., and Rutter, W. J. (1990) Genes & Deu. 4, 1035-1043' Neve, R. L., Finch, E. A,, and Dawes, L. R. (1988) Neuron 1,669-677 Odenwald, W. F., Garbern, J., Arnheiter, H., Tournier-Lasserve, E., and Lazzarini, R. A. (1989) Genes & Deu. 3 , 158-172 Ponte, P., Gonzalez-DeWhitt, P., Schilling, J., Miller, J., Hsu, D., Greenberg, B., Davis, K., Wallace, W., Lieberburg, I., Fuller, F., and Cordell, B. (1988) Nature 331,525-527 Quitschke, W. W., Lin, Z.-Y., DePonti-Zilli, L., and Paterson, B. M. (1989a) J . Biol. Chem. 264,9539-9546 Quitschke. W. W.. DePonti-Zilli.. L... Lin.. Z.-Y.. and Paterson. B.M.(198913) .MU/. ceil. ~ i o ls,3218-3230 . Quon, D., Wang, Y., Catalano, R., Scardina, J. M., Murakami, K., and Cordell, B. (1991) Nature 3 5 2 , 239-241 Reznikoff, C. A,, Brankow, D. W., and Heidelberger, C. (1973) Cancer Res. 3 3 , 3231-3238 Robakis, N. K., Wisniewski, H. M., Jenkins, E. C., Devine-Gage, E.A,, Houck, G. E., Yao, X. L., Ramakrishna, N., Wolfe, G., Silverman, W. P., and Brown, W. T. (1987) Lancet 8629,384-385 Salbaum, J. M., Weidemann, A., Lemaire, H.-G., Masters, C. L., and Beyreuther, K. (1988) EMBO J. 7,2807-2813 Schmechel, D. E., Goldgaber, D., Burkhart, D. S., Gilbert, J. R., Gajdusek, D. C.. and Roses. A. D. (1988) Alzheimer Dis. Assoc. Disord. 2.96-111 Seiler-Tuyns, A:, Eldridge, J: D., and Paterson, B. M. (1984) Proc. Natl. Acad. Sci. .. . A. 1 . 2 9 ~ 0~ - 2 -9 ~ 4- ~ .... IT. - . S. .. ~ ","" Selkoe, D. J. (1991) Neuron 6,487-498 Tanzi, R. E., Gusella, J. F., Watkins, P. C., Bruns, G. A. P., St. George-Hyslop, P.. Van Keuren. M. L.. Patterson.. D.., Paean. - . S... Kurnit, D. M., and Neve. R.'L. (1987) Science 235,880-884 Tanzi, R. E., McClatchey, A. I., Lamperti, E. D., Villa-Komaroff, L., Gusella, J. F., and Neve, R. L. (1988) Nature 331,528-530 Vuorio, T., Maity, S. N., and de Crombrugghe, B. (1490) J. Biol. Chem. 2 6 5 , 22480-22486 Williams, T., Admon, A,, Luscher, B., and Tjian, R. (1988) Genes & Deu. 2, 1557-1569 Wirak, D. O., Bayney, R., Ramabhadran, T. V., Fracasso, R. P., Hart, J. T., Hauer. E.. Hsiau. P.. Pekar. S. K.. Scaneos. G.A.. Tram. B.D.. and . ~ . .P. .~ Unterbeck, A: J. (1996)'Scieke 252, 323-3% ' Wirac, D. O., Bayney, R., Kundel, C.A., Lee, A., Scangos, G. A., Trapp, B. D., and Unterbeck, A. J. (1991b) EMBO J. 10, 289-296 Wright, W. E., Sassoon, D. A,, and Lin, V. K. (1989) Cell 56,607-617 Wu. C.. Wilson, S.. Walker. B.. Dawid, I., Paisley, T., Zimarino, V., and Ueda, H . (i987) science 238,124711253 ~

~

~~~~~

~