The APP intracellular domain (AICD) potentiates ER stress-induced ...

Neurobiology of Aging 33 (2012) 2200 –2209 www.elsevier.com/locate/neuaging

The APP intracellular domain (AICD) potentiates ER stress-induced apoptosis Donat Kögela,1, Caoimhín G. Concannonb,1, Thorsten Müllerc, Hildegard Königa, Caroline Bonnerb, Simone Poeschelb, Steffi Changa, Rupert Egenspergerd, Jochen H.M. Prehnb,* a

Experimental Neurosurgery, Center for Neurology and Neurosurgery, Goethe University Hospital, Frankfurt, Germany b Department of Physiology and Medical Physics, Royal College of Surgeons in Ireland, Dublin, Ireland c Functional Proteomics, Medizinisches Proteom-Center, Ruhr-University, Bochum, Bochum, Germany d Center for Neuropathology and Prion Research, Ludwig Maximilians University, Munich, Germany Received 14 February 2011; received in revised form 3 June 2011; accepted 17 June 2011

Abstract Here we employed human SHEP neuroblastoma cells either stably or inducibly expressing the amyloid precursor protein (APP) intracellular domain (AICD) to investigate its ability to modulate stress-induced cell death. Analysis of effector caspase activation revealed that AICD overexpression was specifically associated with an increased sensitivity to apoptosis induced by the 2 endoplasmic reticulum (ER) stressors thapsigargin and tunicamycin, but not by staurosporine (STS). Basal and ER stress-induced expression of Bip/Grp78 and C/EBP-homologous protein/GADD153 were not altered by AICD implying that AICD potentiated cell death downstream or independent of the conserved unfolded protein response (UPR). Interestingly, quantitative polymerase chain reaction analysis and reporter gene assays revealed that AICD significantly downregulated messenger RNA levels of the Alzheimer’s disease susceptibility gene ApoJ/clusterin, indicating transcriptional repression. Knockdown of ApoJ/clusterin mimicked the effect of AICD on ER stress-induced apoptosis, but had no discernible effect on staurosporine-induced cell death. Our data suggest that altered levels of AICD may abolish the prosurvival function of ApoJ/clusterin and increase the susceptibility of neurons to ER stress-mediated cell death, a pathway that may contribute to the pathogenesis of Alzheimer’s disease. © 2012 Elsevier Inc. All rights reserved. Keywords: Alzheimer’s disease; Amyloid precursor protein; ER stress; Apoptosis; Caspases; Transcription; Unfolded protein response

1. Introduction Altered processing of the amyloid precursor protein (APP) plays a pivotal role in the pathogenesis of Alzheimer’s disease (AD) (Selkoe, 2004; Walsh et al., 2007). Sequential cleavage of APP by !- and "-secretase activities yield A!, the major constituent of Alzheimer plaques (Selkoe, 2004; Walsh et al., 2007). However, the physiological and pathophysiological functions of sev-

* Corresponding author at: Royal College of Surgeons in Ireland, 123 St. Stephen’s Green, Dublin 2, Ireland. Tel.: !353 1 402 2255; fax: !353 1 402 2447. E-mail address: [email protected] (J.H.M. Prehn). 1 These authors contributed equally to the work. 0197-4580/$ – see front matter © 2012 Elsevier Inc. All rights reserved. 10.1016/j.neurobiolaging.2011.06.012

eral other APP-derived C-terminal protein fragments are not completely understood. Recent research has revealed biological functions for the APP intracellular domain (AICD), the short APP C-terminal region which is generated by "-and/or #-secretase cleavage (Müller et al., 2008). In a manner analogous to the Notch signaling pathway, AICD binds to several cofactors involved in the regulation of transcription, in particular Fe65, Tip60, and CP2 (Bressler et al., 1996; Cao and Südhof, 2001; Fiore et al., 1995; Zambrano et al., 1998). Upon interaction with its cofactors, AICD is stabilized, thus enabling its translocation to the nucleus where it is implicated in the regulation of several putative target genes (Müller et al., 2008) and endoplasmic reticulum (ER) Ca2! homeostasis (Leissring et al., 2002).

D. Kögel et al. / Neurobiology of Aging 33 (2012) 2200 –2209

It has been proposed that AICD is preferentially generated via the amyloidogenic pathway of APP processing (Belyaev et al., 2010; Goodger et al., 2009). In line with this observation it was shown that AICD-overexpressing transgenic mice exhibit AD-like characteristics, including hyperphosphorylation and aggregation of tau, neurodegeneration, and working memory deficits (Ghosal et al., 2009). Consistent with its potential role in AD pathogenesis, AICD levels were found to be elevated in brains from AD Patients (Ghosal et al., 2009). We have recently analyzed the transcriptome of human neural cells inducibly expressing AICD50 or AICD59, corresponding to "-secretase-mediated cleavage at the #- or "-cleavage site of APP (Müller et al., 2007). One of the genes downregulated upon AICD induction was ApoJ/clusterin (Müller et al., 2007). Gene variants of ApoJ/clusterin have recently been identified as a genetic risk factor for AD (Harold et al., 2009; Lambert et al., 2009, Van Broeckhoven, 2010). There is evidence for disturbed expression of ApoJ/clusterin in the aging brain and in the brains of Alzheimer Patients (McGeer et al., 1992; Nuutinen et al., 2009). Apo/JClusterin is a lipoprotein which is released via the secretory pathway and is required for the transport of lipids in the blood (Burkey et al., 1992). ApoJ/clusterin can also be retrogradely transported from the ER to the cytosol, where it can bind to the proapoptotic protein Bax, thereby inhibiting Bax oligomerization and mitochondrial outer membrane permeabilization, a prerequisite for the activation of the mitochondrial apoptosis pathway (Zhang et al., 2005). ER stress is caused by the accumulation of unfolded and malfunctional proteins within the lumen of the ER, and has been increasingly implicated in the pathophysiology of AD (Hoozemans et al., 2009; Imaizumi et al., 2001; Unterberger et al., 2006). AICD overexpression has been shown to directly induce apoptosis or to sensitize cells to stressinduced apoptosis (Kim et al., 2003; Kinoshita et al., 2002; Nakayama et al., 2008; Ozaki et al., 2006; Passer et al., 2000). The underlying molecular mechanisms of this potentiating effect and its role during ER stress remain poorly characterized. In this study, we explored the role of AICD in sensitizing neural cells to stress-induced apoptosis. We demonstrate that AICD specifically sensitizes cells to ER stress-induced cell death, and suggest a role for AICDinduced ApoJ/clusterin repression in this process. 2. Methods 2.1. Materials Caspase substrate acetyl-DEVD-7-amido-4-methylcoumarin (Ac-DEVD-AMC) and inhibitor z-Val-Ala-Asp (Omethyl)-fluoromethyl ketone (zVAD.Fmk) were from Bachem (St, Helen’s, UK). Tunicamycin, thapsigargin, staurosporine (STS), and Hoechst 33258 were purchased from Sigma-Aldrich (Tallaght, Dublin, Ireland). All other

2201

chemicals came in analytical grade purity from SigmaAldrich (Tallaght). 2.2. Cell lines and culture SHEP neuroblastoma cell lines conditionally overexpressing AICD50 and Fe65 using a Tet-off system (SHEP iFA cells) were previously described (Müller et al., 2007). To establish cell lines constitutively expressing AICD, SHEP cells were stably transfected with an empty vector (pIRES2-EGFP) to generate EGFP K1, EGFP K2, EGFP K3, and EGFP K4 or with a pIRES2-EGFP-derived construct encoding the C-terminal 50 aa residues of APP (for cell lines AICD50 K1, AICD50 K2 and AICD50 K3) or with a pIRES2-EGFP-derived construct encoding the C-terminal 59 AA residues of APP (for cell lines AICD59 K1, AICD59 K2 and AICD59 K3). Cells were maintained in RPMI medium containing 10% fetal bovine serum, penicillin, and streptomycin. All transfections were performed using lipofectamine 2000 (Invitrogen, Karlsruhe, Germany). 2.3. Real-time polymerase chain reaction (PCR) To quantitate AICD induction and expression of C/EBPhomologous protein (CHOP), BiP, and ApoJ/clusterin, SYBR Green assays were performed on a GeneAmp 5700 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) Total RNA was isolated as described previously (Müller et al., 2007). Template complementary DNA (cDNA) was synthesized from 2 $g total RNA using the Omniscript reverse transcriptase Kit (Qiagen, Hilden, Germany) and the T7-(dT)24 primer, following manufacturer’s instructions. Sense and antisense primer sequences will be given upon request by the authors. Cycling conditions were 50 °C for 2 minutes, 95 °C for 10 minutes, followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 1 minute. Gene expression ratios were calculated according the delta-delta cycle threshold (ddCt) method normalized against glyceraldehyde 3-phosphate dehydrogenase. Experiments were done at 2 independent dates as quadruplicate. Melting curve analysis confirmed that only 1 product was amplified. Specificity was confirmed by gel electrophoresis of PCR products showing only 1 product with each primer set. 2.4. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting Preparation of cell lysates and Western blotting was carried out as described (Müller et al., 2007). The resulting blots were probed with a mouse monoclonal anti-KDEL antibody (StressGen Biotechnology, Victoria, Canada) diluted 1:1000, a rabbit polyclonal anti-Chop antibody (Santa Cruz Biotechnology, Heidelberg, Germany) diluted 1:250, a goat polyclonal ant-clusterin antibody (Santa Cruz Biotechnology), or a mouse monoclonal anti-%-tubulin antibody (clone DM 1A; Sigma-Aldrich), diluted 1:5000. Horserad-

2202


ish peroxidase conjugated secondary antibodies (Thermo Fisher Scientific, Northumberland, UK) were detected using SuperSignal West Pico chemiluminescent Substrate (Thermo Fisher Scientific) and imaged using a Fujifilm LAS-3000 imaging system (Fuji, Sheffield, UK). 2.5. Determination of caspase-3-like protease activity DEVDase (caspase-3-like) activity was determined fluorometrically using carbobenzoxy-Asp-Glu-Val-Asp-7-amino-4-methyl-coumarin (DEVD-AMC) as substrate. Cleavage of DEVD-AMC to liberate free AMC was monitored by measuring fluorescence after 1- and 2-hour intervals. Protein content was determined using the Pierce Coomassie plus Protein assay reagent (Thermo Fisher Scientific). Caspase activity is expressed as change in fluorescent units per hour and per $g protein. 2.6. Transient transfections and luciferase reporter gene assays Cells were transiently transfected in 24-well plates using Metafectene (Biontex, Martinsried, Germany) as per manufacturer’s instruction. For the small interfering RNA (siRNA) mediated inhibition of ApoJ/clusterin expression, cells were transfected with 100 nM of clusterin specific siRNA (Zhang et al., 2005) or control for 24 hours prior to subsequent treatment. Sequences used were ApoJ/clusterin AAGUACGUCAAUAAGGAAAUU and Control 5= ACUUAACCGGCAUACCGGC dTdT 3=. To study clusterin promotor activity, a vector encoding the clusterin-promotor fused to luciferase (pGL ApoJ) was transfected in induced (48 hours) and noninduced cell clones (EGFP control cells and AICD/Fe65 inducible cells). The pCMVbeta vector encoding !-Gal was cotransfected. After 24 hours whole cell lysates were prepared. Luciferase activity was measured and normalized to the !-Gal activity. For background normalization untransfected cells were analyzed as well. 2.7. Flow cytometry Following treatments cells were stained with propidium iodide (2 $g/mL in phosphate-buffered saline). Samples were analyzed immediately by flow cytometry using the FSC/FL2 profile and measuring the uptake of propidium iodide in nonfixed cells. In all cases, a minimum of 104 events per sample were acquired. Flow cytometric analyses were performed on a CyFlow ML (Partec, Munster, Germany) followed by analysis using FloMax software version 3.0. 2.8. Confocal fluorescence microscopy SHEP15 cells were grown and treated on 13-mm glass coverslips in 24-well plates, after which they were fixed at room temperature in 4% paraformaldehyde for 20 minutes. Cells were washed 3 times with phosphate-buffered saline and incubated with 0.1% Triton X-100 and 5% horse serum (Invitrogen) to permeabilize the cells and to block unspe-

cific binding. The incubation with a polyclonal primary antibody clusterin-% (M-18) (sc-6420; Santa Cruz) for 1 hour at room temperature was followed by 3 washing steps. To investigate activation of Bax, a primary monoclonal mouse antibody which selectively detects only the active conformation of Bax protein was used (clone 6A7, ALX804-224 Enzo Life Sciences, Lorrach, Germany). Primary antibodies were detected with Cy2-conjugated affinipure donkey antigoat IgG (H_L) secondary antibodies (705-225-147; Dianova, Hamburg, Germany) and Cy3-conjugated affinipure donkey anti-mouse IgG (H_L) secondary antibodies (715-165-150; Dianova). Images were taken with a Nikon C1i confocal microscopy system (Nikon, Düsseldorf, Germany) with the EZ-C1 software Version 3.9 (Nikon). Cy2-conjugated IgG was visualized using an excitation 488 nm/emission 509 nm filter set and Cy3-conjugated IgG was detected using an excitation 554 nm/emission 568 nm filter set. To quantitatively analyze subcellular localisation of Clusterin and activated Bax, a total number of 300 cells was analyzed in 3 independent cultures for each treatment by epifluorescence microscopy using an Eclipse TE 300 inverted microscope and a 40" objective (Nikon). 2.9. Statistics Data are given as mean # standard error. For statistical comparison, t-test or 1-way analysis of variance (ANOVA) followed by Tukey test were employed using SPSS software version 15.0 (SPSS GmbH Software, Munich, Germany). p values smaller than 0.05 were considered to be statistically significant. 3. Results Processing of the C-terminus of APP by "-secretase activity can result in the generation of different AICD isoforms corresponding to cleavage at the "-site or the #-site, leading to production of AICD59 or AICD50, respectively (Müller et al., 2007). To analyze the possible role of AICD in modulation of gene expression and cell death, we stably transfected SHEP-SF neuroblastoma cells with an empty vector (cell lines EGFP K1, EGFP K2, EGFP K3 and EGFP K4), with a construct encoding the C-terminal 50 AA residues of APP (cell lines AICD50 K1, AICD50 K2, AICD50 K3) or with a construct encoding the C-terminal 59 AA residues of APP (cell lines AICD59 K1, AICD59 K2, AICD59 K3). Real time qPCR analysis revealed significant overexpression of AICD50 in comparison with endogenous expression of APP (Fig. 1A). Both control cell lines and the 2 AICD50 expressing cell lines were subsequently treated with the 2 ER stressors thapsigargin (1 $M) and tunicamycin (1 $M) for 16 hours. Following treatments whole cell lysates were harvested and measured for DEVDase (caspase-3 like) activity using a fluorogenic assay (Fig. 1B and C). Interestingly, overexpression of AICD significantly increased ER stress-triggered effector caspase activation after application of thapsigargin in all 3 AICD50- and all 3 AICD59-overexpress-

2203

N-fold expression

A

B

700

DEVD Cleavage [A.U. x h-1x µg Protein-1]


600

AICD mRNA 180 160 140 120 100 80 60 40 20 0

* *

DMSO

*

Thapsi

*

*

500

*

300 200 100

con 1 con 2

clone 1

clone 2 con 1

con 2

clone 1

clone 2 clone 3

clone 1 clone 2

DMSO Tuni

250 200

*

*

150 100 50 con 1

con 2

clone 1



D

300

clone 2

AICD50

1800

clone 3

AICD59

AICD50

0

*

400

AICD50

C

*

DMSO STS

1600 1400 1200 1000 800 600 400 200 0

con 1

con 2

clone 1

clone 2

AICD50

Fig. 1. Constitutive overexpression of AICD sensitizes neuroblastoma cells to ER stress-induced apoptosis. (A) Increased expression levels of AICD50 mRNA in cell lines constitutively expressing AICD50 (clone 1 and clone 2) compared to control cell lines (con 1 and con 2). AICD50 mRNA levels were measured by real time qPCR and normalized to GAPDH mRNA levels. Data are mean # standard error of the mean (SEM) from n $ 3 independent samples. * p % 0.05 compared with empty vector expressing cells. (B) Constitutively AICD overexpressing clones reveal increased caspase-3 activity after thapsigargin stimulation. DEVDase activity was measured by analysis of fluorescence tagged DEVD peptides for 2 control clones (con 1 and con 2), 3 clones overexpressing isoform AICD50, and 3 clones overexpressing isoform AICD59. Cleavage of DEVD peptides was examined after 16-hour stimulation with 1 $M thapsigargin or dimethyl sulfoxide (DMSO), respectively. All stable AICD overexpressing clones revealed significantly (t-test p % 0.05) increased DEVDase activity in comparison with control clones. Experiments were performed in triplicate. (C) Cultures of control (con 1 and con 2) or AICD50 expressing clone 1 and clone 2 cells were treated with 1 $M tunicamycin (Tuni) or vehicle (DMSO) for 16 h. Increased DEVDase (Caspase-3 like) activity was observed in AICD50 expressing cells compared to control empty vector expressing cells. Data are mean # SEM from n $ 4 cultures. * p % 0.05 different from empty vector expressing cells treated with Tunicamycin (ANOVA post hoc Tukey). (D) Cultures of control (con 1 and con 2) or AICD50 expressing (clone 1 and clone 2) cells treated with 1 $M staurosporine (STS) or vehicle (DMSO) for 6 hours demonstrate similar levels of DEVDase activity. Data are mean # SEM from n $ 4 cultures. Experiment was repeated twice with similar results.

ing cell lines (Fig. 1B). There were no discernible differences in the extent of apoptosis induced by AICD50 and AICD59, and AICD induction alone did not elicit any detectable increase in basal apoptosis. Similar to the effects of AICD on thapsigargin-induced apoptosis, effector caspase induction was increased in AICD50 K2 and AICD50 K3 cells after treatment with tunicamycin (Fig. 1C). In contrast to cell death triggered by ER stressors, AICD had no potentiating effect on apoptosis induced by the kinase inhibitor staurosporine (STS) (Fig. 1D). To investigate these stimulus-specific effects of AICD on cell death in a second, independent model, we employed SHEP-SF Tet off cells inducibly expressing both AICD50 and its interaction partner Fe65 (SHEP iFA cells) (Müller et al., 2007). qPCR analysis indicated approximately 15-fold and 30-fold induction of AICD50 and Fe65 respectively after 72 hours of doxycycline withdrawal (Fig. 2A). Similar to the effects of stably overexpressed AICD, induced expression of AICD50 and Fe65 led to significantly enhanced

sensitivity to thapsigargin (1 $M) or tunicamycin (1 $M) as measured by the DEVDase activity assay (Fig. 2B) and by flow cytometry analysis of propidium iodide uptake (Fig. 2C). Again, we observed no AICD-dependent increase of cell death when we treated induced SHEP iFA cells with STS at two different concentrations for 6 hours (Fig. 2D). Furthermore, inducible expression of Fe65 alone did not sensitize SHEP cells to ER stress triggered by thapsigargin and tunicamycin (Fig. 2E). The unfolded protein response plays a pivotal role in cell death/cell survival decisions under conditions of prolonged ER stress (Ron and Walter, 2007). To further dissect the molecular mechanisms of the potentiating effect of AICD on ER stress-triggered cell death, we analyzed whether concomitant induction of AICD and Fe65 modulated the expression of the 2 unfolded protein response (UPR) target genes Bip/Grp78 and CHOP/GADD153 (Fig. 3). A time course experiment over a period of 16 hours revealed that

2204


30

10

Non-Induced Induced

*

*

10

Control

Thapsi


E

* Non-Induced Induced

Tuni

*

3 2 1 Control

D

20

0

4

0

Fe65

SHEP iFA 40 30

% Cell Death

*

AICD50

SHEP iFA

5

*

Non-Induced Induced

20

0

C

B

SHEP iFA

Fold DEVDase activity

40

Thapsi

Tuni

SHEP iFA


N-fold expression

A

2000

Non-Induced Induced

1500 1000 500 0

Control

STS (0.2 µM) STS (1 µM)

SHEP iF

2000

1500

1000

500

0

DMSO

Thapsi

Tuni

Fig. 2. Inducible expression of AICD potentiates ER stress-induced apoptosis (A) AICD50 and Fe65 mRNA levels were examined by real time PCR in SHEP neuroblastoma cells conditionally overexpressing AICD50/Fe65 for 72 hours. Total RNA was extracted and the expression levels of AICD50 and Fe65 were examined by real time PCR and normalized to GAPDH levels. Data are mean # SEM from n $ 3 cultures. * p % 0.05 compared with noninduced cells. (B) Induction of AICD50/Fe65 for 72 hours increases DEVDase activity in SHEP cells treated with either 1 $M tunicamycin or 1 $M thapsigargin for 16 hours. Data are mean # standard error of the mean (SEM) from n $ 3 samples. * p % 0.05 different from similarly treated noninduced cells. (C) Induction of AICD50/Fe65 for 72 hours increases cell death in SHEP cells treated with either 1 microM tunicamycin or 1 microM thapsigargin for 24 hours. Cell death was assessed by propidium iodide staining and subsequent flow cytometry analysis. Data are mean # SEM from n $ 4 cultures. * p % 0.05 different from similarly treated noninduced cultures. Experiment was repeated twice with similar results. (D) Induction of AICD50/Fe65 for 72 hours does not modulate levels of DEVDase activity following treatment with 0.2 microM or 1 $M staurosporine for 6 hours. Data are mean # SEM from n $ 4 samples. The experiment was repeated with similar results. (E) Induction of Fe65 expression alone for 72 hours does not sensitize SHEP neuroblastoma cells to treatment with either 1 $M tunicamycin or 1 $M thapsigargin for 16 hours. After treatments whole cell lysates were harvested and measured for DEVDase (caspase-3 like) activity using a fluorogenic assay. Data are mean # SEM from n $ 3 cultures.

Bip/Grp78 was induced in a time-dependent manner by thapsigargin (Fig. 3A and B) whereas CHOP/GADD153 was more rapidly activated (Fig. 3B). However, induced overexpression of AICD50/Fe65 in SHEP iFA cells did not

lead to detectable changes in the basal expression of both genes or in the extent of their induction at the investigated time points in our qPCR analyses (Fig. 3A and B). These findings were confirmed by Western blotting with a mono-


A

SHEP iFA

N-fold expression vs non-induced control

80

Grp78 mRNA Non-Induced Induced

60

40

20

0

N-fold expression vs non-induced control

B

Con

4h

8h

16 h

SHEP iFA 100

Chop mRNA Non-Induced Induced

80 60 40 20 0

Con

C

4h

8h

16 h

SHEP iFA Non-induced Con

Tuni

Thap

Induced Con

Tuni

Thap

Grp78 Tubulin

Fig. 3. AICD does not alter expression of UPR target genes. (A, B) SHEP neuroblastoma cells were induced to overexpress AICD50/Fe65 for 72 hours followed by treatment with 1 $M thapsigargin for 16 hours. Total RNA was extracted and the expression levels of Grp78 (A) and Chop (B) examined by real time qPCR relative to GAPDH levels and normalized to non-induced cells treated with DMSO. Data are mean # standard error of the mean (SEM) from n $ 3 independent samples. (C) SHEP neuroblastoma cells conditionally overexpressing AICD50/Fe65 for 72 hours were treated with either 1 $M tunicamycin or 1 $M thapsigargin for 16 hours. Induction of AICD50/Fe65 did not modulate the induced expression levels of Grp78 as examined by Western blotting. Probing with tubulin served as a loading control.

clonal antibody recognizing Bip/Grp78 on the protein level (Fig. 3C). Transcriptome analyses using Affymetrix DNA microarrays had previously suggested that ApoJ/clusterin was significantly downregulated (2.1-fold) in SHEP iFA cells induced to express AICD (Müller et al., 2007). Given the fact that ApoJ/clusterin is an important regulator of stress-induced apoptosis (Nuutinen et al., 2009), we next analyzed the effect of doxycycline withdrawal on the expression levels of ApoJ/clusterin in these cells by qPCR (Fig. 4A). In congruence with the microarray data (Müller et al., 2007), expression of ApoJ/Clusterin was reduced approximately

2205

2-fold in the presence of overexpressed AICD/Fe65 (Fig. 4A). This downregulation was also confirmed by Western blotting on the protein level (Fig. 4B). Further evidence for the AICD-dependent downregulation of ApoJ/clusterin by AICD was obtained with a luciferase reporter gene assay employing an ApoJ/clusterin promoter construct (Fig. 4C). In analogy to the qPCR data, withdrawal of doxycycline in SHEP iFA cells led to a 60% reduction of luciferase activity under the control of the ApoJ/clusterin promoter (Fig. 4C). Transcription levels of the reporter gene did not vary between control cell lines and noninduced SHEP iFA cells. Interestingly, it was previously demonstrated that the presence of Bax is required for the antiapoptotic effect of ApoJ/clusterin. In a study by Zhang and colleagues, ApoJ/ clusterin was shown to specifically interact with activated Bax, thereby inhibiting Bax oligomerization and cytochrome c release (Zhang et al., 2005). Furthermore, under certain stress conditions, ApoJ/clusterin was shown to evade secretion and instead can be retrogradely transported to the cytoplasm (Nizard et al., 2007). To analyze the subcellular localization of ApoJ/clusterin and activated Bax during ER stress-induced apoptosis, we next performed confocal immunofluorescence analyses with antibodies against ApoJ/clusterin and the conformation-specific antiBax antibody 6A7 which detects Bax in its activated conformation. Following treatment with thapsigargin, there was a general increase in the intensity and compartmentalization of the intracellular signal obtained with the ApoJ/clusterin antibody. We could also detect a partial colocalization of ApoJ/clusterin and active Bax in thapsigargin-treated cells. In contrast, while treatment with STS induced a similar Bax activation, we did not detect compartmentalization of ApoJ/ clusterin immunofluorescence, or a colocalization with active Bax immunofluorescence (Fig. 4D). Because our data indicated that AICD could enhance ER stress-mediated apoptosis and downregulate ApoJ/clusterin expression, we next investigated whether ApoJ/clusterin could protect SHEP cells from this type of cell death. To this end, we transiently transfected cells with siRNAs silencing ApoJ/clusterin (Fig. 5). Knockdown of ApoJ/Clusterin significantly sensitized SHEP control cells to apoptosis triggered by thapsigargin and tunicamycin, respectively (Fig. 5) whereas it had no potentiating effect on cell death induced by STS, mimicking the effects of AICD expression on the sensitivity to these drugs. 4. Discussion In the present study, we provide evidence that AICD decreases the expression of the AD susceptibility gene ApoJ/clusterin through a transcriptional repression. Furthermore, our data suggest that both increased AICD expression and decreased ApoJ/clusterin levels are sufficient to potently sensitize neural cells to ER stress-induced apoptosis. ER stress is defined as an accumulation of unfolded/

2206


Fig. 4. AICD represses expression of the anti-apoptotic gene Clusterin (A) Induction of AICD50/Fe65 for 72 hours in SHEP neuroblastoma cells reduces the expression of Clusterin mRNA as examined by real time qPCR. Data are mean # standard error of the mean (SEM) from n $ 3 independent samples. (B) Clusterin promoter activity is diminished after induction of AICD/Fe65. Cells were transfected with a luciferase reporter gene under the control of the clusterin promoter and induced to express either EGFP or AICD50/Fe65 for 72 hours. Luciferase activity within the cultures was analyzed and normalized for the cotransfected ß-Gal expression. Cells with induced expression of AICD/Fe65 revealed significantly less luciferase activity (p % 0.05; t-test) compared to the non-induced condition. Experiments were done in triplicate. (C) SHEP neuroblastoma cells were left untreated (left lane) or induced (right lane) to express AICD50/Fe65 for 72 hours. Whole cell lysates were prepared and the expression levels of Clusterin examined by Western blotting. Probing with tubulin served as a loading control. (D) SHEP neuroblastoma cells were grown on coverslips and treated with Dimethyl sulfoxide (DMSO) 1 $M thapsigargin (Thapsi), 1 $M tunicamycin (Tuni) each for 16 hours and 1 $M staurosporine (STS) for 5 hours. After fixation and permeabilization, subcellular localization of clusterin and activated Bax of representative cells were detected by immunocytochemistry (left panel). Scale bar 50 $m. Quantitative analysis of Clusterin and Bax clustering reveals co-localization of Clusterin and Bax after treatment with Thapsigargin (upper right panel) but not STS (lower right panel) in comparison to DMSO-treated controls.


A

Con

Clusterin Clusterin

Tubulin

B

25

% Cell Death

20

Control siRNA Clusterin siRNA

*

*

15 10 5 0

C

Thapsi

Tuni

70 60

% Cell Death

DMSO

50

Control siRNA Clusterin siRNA

40 30 20 10 0

Con

STS

Fig. 5. Knockdown of Clusterin mimics the potentiating effects of AICD on ER stress-induced apoptosis (A) Western blot demonstrating decreased expression of Clusterin in SHEP-SF cells transfected with either a Clusterin-specific siRNA (right lane) compared to a control sequence (left lane) for 24 h. (B) Cultures were subsequently treated with either 1 microM tunicamycin or 1 microM thapsigargin for 24 hours. Increased levels of cell death as assessed by propidium iodide staining and flow cytometry analysis was evident in Clusterin siRNA transfected cultures. Data are mean# SEM from n $ 4 samples. *P % 0.05 different from similarly treated control siRNA cultures (ANOVA post-hoc Tukey). Experiment was repeated twice with similar results. (C) SHEP-SF cells were transfected with either a Clusterin specific siRNA or a control sequence for 24 hours. Cultures were subsequently treated with 1 microM staurosporine for 6 hours. Levels of cell death was assessed by propidium iodide staining and did not significantly differ between control and Clusterin siRNA transfected cells. Data are mean# SEM from n $ 4 samples. Experiment was repeated once with similar results.

misfolded proteins in the lumen of the ER (Marciniak and Ron, 2006). It activates a conserved cellular stress response, resulting in increased production of ER chaperones, attenuated protein synthesis, and increased ER-associated protein degradation (Kim et al., 2008; Xu et al., 2005). If left uncompensated or under conditions of prolonged exposure to ER stressors, ER stress results in cell death via activation of apoptosis (Kim et al., 2008; Marciniak and Ron, 2006;

2207

Reimertz et al., 2003; Xu et al., 2005). We noted that AICD expression was specifically associated with an increased sensitivity to ER stress-induced apoptosis, but not to the unrelated death stimulus STS. Overexpression of Fe65 alone did not enhance effector caspase activation after ER stress, clearly demonstrating an AICD-dependent mechanism. The activation of the unfolded protein response during ER stress also was unaltered by AICD expression, suggesting that the potentiating effect of AICD on apoptosis was not caused by a dysfunctional unfolded protein response survival response. We have previously shown that overexpression of holo-APP potentiates expression of C/EBP-homologous protein (CHOP) and cell death induced by Ca2! store depletion (Copanaki et al., 2007). However, we did not observe AICD-dependent upregulation of CHOP in the SHEP iFA cells in this study, suggesting that the CHOP pathway was not involved in enhanced sensitivity toward ER stress in the AICD-expressing cells. Our data rather suggest that the transcriptional repression of ApoJ/clusterin by AICD may be related to its enhancing effects on ER stress-induced apoptosis. In line with this hypothesis, knockdown of ApoJ/clusterin was able to mimic the potentiating effect of AICD on ER stressinduced apoptosis, but had no discernible effect on STSinduced cell death. Upregulation of ApoJ/clusterin is generally viewed as a neuroprotective stress response. ApoJ/clusterin is known to be transcriptionally induced by several stress stimuli, including ER stress and proteasomal stress (Nuutinen et al., 2009). ApoJ/clusterin is normally secreted from cells, but in many cells including neurons, under conditions of cellular stress it can be retrogradely transported to the cytoplasm where it acts as a stress-induced chaperone (Nizard et al., 2007). ApoJ/clusterin binds to Bax in its activated conformation and inhibits neuronal apoptosis (Nuutinen et al., 2009; Zhang et al., 2005). In line with these observations, we observed enhanced intracellular expression of ApoJ/ clusterin and a partial colocalization with activated Bax under conditions of ER stress. Interestingly, Hrd1/synoviolin, an E3 ubiquitin ligase which ubiquitinates ApoJ/ clusterin and directs the protein into the cytosol is an ER stress-regulated gene, and could be a central regulator of targeting ApoJ/clusterin to the cytoplasm (Qi et al., 2004). ApoJ/clusterin has also been shown to act as a chaperone and has a variety of additional functions, including binding and clearance of amyloid-! peptides, suppression of complement activation, induction of neuroprotective transforming growth factor-! signaling via binding to Smad2/3 (Nuutinen et al., 2009) and it was recently shown to interact with and facilitate the degradation of the copper-ATPases ATP7A and ATP7B (Materia et al., 2011). ApoJ/clusterin has been linked to AD pathology in several studies. A single nucleotide polymorphism (SNP) in the gene encoding ApoJ/clusterin has recently been identified as

2208


a genetic risk factor for late onset Alzheimer’s disease (LOAD) by 2 genome-wide association studies (Harold et al., 2009; Lambert et al., 2009). The functional consequences of this variant are not clear at present, but it was proposed that it might lead to alternative splicing or expressional regulation of ApoJ/clusterin mRNA (Bertram and Tanzi, 2009). Indeed, there is evidence for disturbed expression of ApoJ/clusterin in the aging brain and in the brains of Alzheimer patients (McGeer et al., 1992; Nuutinen et al., 2009). Secreted ApoJ/clusterin can associate with amyloid-ß and inhibit its fibrillization, thereby reducing plaque burden (Nuutinen et al., 2009; van Es and van den Berg, 2009). Interestingly, frontal lobe tissue from AD patients carrying the ApoE4/4 allele revealed significantly decreased expression of ApoJ/clusterin in comparison with control subjects (Harr et al., 1996). In addition to ApoJ/clusterin, AICD was also shown to regulate brain apolipoprotein E and cholesterol metabolism through lipoprotein receptor LRP1 (Liu et al., 2007). In conclusion, our data suggest that altered levels of AICD expression may abolish the prosurvival function of ApoJ/clusterin and increase the susceptibility of neurons to ER stress-induced, Bax-dependent cell death. Given the fact that nuclear signaling by AICD occurs predominantly through the amyloidogenic processing pathway (Goodger et al., 2009) and that enhanced ER stress is implicated in AD, these findings may shed new light on the mechanisms underlying the demise of neurons in AD. Disclosure statement All authors disclose no actual or potential conflicts of interest. Acknowledgements This research was supported by grants from the Health Research Board (RP/2005/206) and Science Foundation Ireland (08/IN.1/B1949; JHMP) and by the Deutsche Forschungsgemeinschaft (KO 1898/6-1; DK). Appendix. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.neurobiolaging. 2011.06.012. References Belyaev, N.D., Kellett, K.A., Beckett, C., Makova, N.Z., Revett, T.J., Nalivaeva, N.N., Hooper, N.M., Turner, A.J., 2010. The transcriptionally active amyloid precursor protein (APP) intracellular domain is preferentially produced from the 695 isoform of APP in a {beta}secretase dependent pathway. J. Biol. Chem. 285, 41443– 41454. Bertram, L., Tanzi, R.E., 2009. Genome-wide association studies in Alzheimer’s disease. Hum. Mol. Genet. 18, R137–R145. Bressler, S.L., Gray, M.D., Sopher, B.L., Hu, Q., Hearn, M.G., Pham, D.G., Dinulos, M.B., Fukuchi, K., Sisodia, S.S., Miller, M.A., Dis-

teche, C.M., Martin, G.M., 1996. cDNA cloning and chromosome mapping of the human Fe65 gene: interaction of the conserved cytoplasmic domains of the human beta-amyloid precursor protein and its homologues with the mouse Fe65 protein. Hum. Mol. Genet. 5, 1589 –1598. Burkey, B.F., Stuart, W.D., Harmony, J.A., 1992. Hepatic apolipoprotein J is secreted as a lipoprotein. J. Lipid Res. 33, 1517–1526. Cao, X., Südhof, T.C., 2001. A transcriptionally [correction of transcriptively] active complex of APP with Fe65 and histone acetyltransferase Tip60. Science 293, 115–120. Copanaki, E., Schürmann, T., Eckert, A., Leuner, K., Müller, W.E., Prehn, J.H., Kögel, D., 2007. The amyloid precursor protein potentiates CHOP induction and cell death in response to ER Ca2! depletion. Biochim. Biophys. Acta 1773, 157–165. Fiore, F., Zambrano, N., Minopoli, G., Donini, V., Duilio, A., Russo, T., 1995. The regions of the Fe65 protein homologous to the phosphotyrosine interaction/phosphotyrosine binding domain of Shc bind the intracellular domain of the Alzheimer’s amyloid precursor protein. J. Biol. Chem. 270, 30853–30856. Ghosal, K., Vogt, D.L., Liang, M., Shen, Y., Lamb, B.T., Pimplikar, S.W., 2009. Alzheimer’s disease-like pathological features in transgenic mice expressing the APP intracellular domain. Proc. Natl. Acad. Sci. U. S. A. 106, 18367–18372. Goodger, Z.V., Rajendran, L., Trutzel, A., Kohli, B.M., Nitsch, R.M., Konietzko, U., 2009. Nuclear signaling by the APP intracellular domain occurs predominantly through the amyloidogenic processing pathway. J. Cell Sci. 122, 3703–3714. Harold, D., Abraham, R., Hollingworth, P., Sims, R., Gerrish, A., Hamshere, M.L., Pahwa, J.S., Moskvina, V., Dowzell, K., Williams, A., Jones, N., Thomas, C., Stretton, A., Morgan, A.R., Lovestone, S., Powell, J., Proitsi, P., Lupton, M.K., Brayne, C., Rubinsztein, D.C., Gill, M., Lawlor, B., Lynch, A., Morgan, K., Brown, K.S., Passmore, P.A., Craig, D., McGuinness, B., Todd, S., Holmes, C., Mann, D., Smith, A.D., Love, S., Kehoe, P.G., Hardy, J., Mead, S., Fox, N., Rossor, M., Collinge, J., Maier, W., Jessen, F., Schurmann, B., van den Bussche, H., Heuser, I., Kornhuber, J., Wiltfang, J., Dichgans, M., Frolich, L., Hampel, H., Hull, M., Rujescu, D., Goate, A.M., Kauwe, J.S., Cruchaga, C., Nowotny, P., Morris, J.C., Mayo, K., Sleegers, K., Bettens, K., Engelborghs, S., De Deyn, P.P., Van Broeckhoven, C., Livingston, G., Bass, N.J., Gurling, H., McQuillin, A., Gwilliam, R., Deloukas, P., Al-Chalabi, A., Shaw, C.E., Tsolaki, M., Singleton, A.B., Guerreiro, R., Muhleisen, T.W., Nothen, M.M., Moebus, S., Jockel, K.H., Klopp, N., Wichmann, H.E., Carrasquillo, M.M., Pankratz, V.S., Younkin, S.G., Holmans, P.A., O’Donovan, M., Owen, M.J., Williams, J., 2009. Genome-wide association study identifies variants at CLU and PICALM associated with Alzheimer’s disease. Nat. Genet. 41, 1088 – 1093. Harr, S.D., Uint, L., Hollister, R., Hyman, B.T., Mendez, A.J., 1996. Brain expression of apolipoproteins E, J, and A-I in Alzheimer’s disease. J. Neurochem. 66, 2429 –2435. Hoozemans, J.J., van Haastert, E.S., Nijholt, D.A., Rozemuller, A.J., Eikelenboom, P., Scheper, W., 2009. The unfolded protein response is activated in pretangle neurons in Alzheimer’s disease hippocampus. Am. J. Pathol. 174, 1241–1251. Imaizumi, K., Miyoshi, K., Katayama, T., Yoneda, T., Taniguchi, M., Kudo, T., Tohyama, M., 2001. The unfolded protein response and Alzheimer’s disease. Biochim. Biophys. Acta 1536, 85–96. Kim, H.S., Kim, E.M., Lee, J.P., Park, C.H., Kim, S., Seo, J.H., Chang, K.A., Yu, E., Jeong, S.J., Chong, Y.H., Suh, Y.H., 2003. C-terminal fragments of amyloid precursor protein exert neurotoxicity by inducing glycogen synthase kinase-3beta expression. FASEB J. 17, 1951–1953. Kim, I., Xu, W., Reed, J.C., 2008. Cell death and endoplasmic reticulum stress: disease relevance and therapeutic opportunities. Nat. Rev. Drug Discov. 7, 1013–1030. Kinoshita, A., Whelan, C.M., Berezovska, O., Hyman, B.T., 2002. The gamma secretase-generated carboxyl-terminal domain of the amyloid

D. Kögel et al. / Neurobiology of Aging 33 (2012) 2200 –2209 precursor protein induces apoptosis via Tip60 in H4 cells. J. Biol. Chem. 277, 28530 –28536. Lambert, J.C., Heath, S., Even, G., Campion, D., Sleegers, K., Hiltunen, M., Combarros, O., Zelenika, D., Bullido, M.J., Tavernier, B., Letenneur, L., Bettens, K., Berr, C., Pasquier, F., Fiévet, N., BarbergerGateau, P., Engelborghs, S., De Deyn, P., Mateo, I., Franck, A., Helisalmi, S., Porcellini, E., Hanon, O., European Alzheimer’s Disease Initiative Investigators, de Pancorbo, M.M., Lendon, C., Dufouil, C., Jaillard, C., Leveillard, T., Alvarez, V., Bosco, P., Mancuso, M., Panza, F., Nacmias, B., Bossu, P., Piccardi, P., Annoni, G., Seripa, D., Galimberti, D., Hannequin, D., Licastro, F., Soininen, H., Ritchie, K., Blanche, H., Dartigues, J.F., Tzourio, C., Gut, I., Van Broeckhoven, C., Alperovitch, A., Lathrop, M., Amouyel, P., Amouyel, P., 2009. Genome-wide association study identifies variants at CLU and CR1 associated with Alzheimer’s disease. Nat. Genet. 41, 1094 –1099. Leissring, M.A., Murphy, M.P., Mead, T.R., Akbari, Y., Sugarman, M.C., Jannatipour, M., Anliker, B., Müller, U., Saftig, P., De Strooper, B., Wolfe, M.S., Golde, T.E., LaFerla, F.M., 2002. A physiologic signaling role for the gamma -secretase-derived intracellular fragment of APP. Proc. Natl. Acad. Sci. U. S. A. 99, 4697– 4702. Liu, Q., Zerbinatti, C.V., Zhang, J., Hoe, H.S., Wang, B., Cole, S.L., Herz, J., Muglia, L., Bu, G., 2007. Amyloid precursor protein regulates brain apolipoprotein E and cholesterol metabolism through lipoprotein receptor LRP1. Neuron 56, 66 –78. Marciniak, S.J., Ron, D., 2006. Endoplasmic reticulum stress signaling in disease. Physiol. Rev. 86, 1133–1149. Materia, S., Cater, M.A., Klomp, L.W., Mercer, J.F., La Fontaine, S., 2011. Clusterin (APOJ): a molecular chaperone that facilitates degradation of the copper-ATPases, ATP7A and ATP7B. J. Biol. Chem. 286, 10073– 10083. McGeer, P.L., Kawamata, T., Walker, D.G., 1992. Distribution of clusterin in Alzheimer brain tissue. Brain Res. 579, 337–341. Müller, T., Concannon, C.G., Ward, M.W., Walsh, C.M., Tirniceriu, A.L., Tribl, F., Kögel, D., Prehn, J.H., Egensperger, R., 2007. Modulation of gene expression and cytoskeletal dynamics by the amyloid precursor protein intracellular domain (AICD). Mol. Biol. Cell 18, 201–210. Müller, T., Meyer, H.E., Egensperger, R., Marcus, K., 2008. The amyloid precursor protein intracellular domain (AICD) as modulator of gene expression, apoptosis, and cytoskeletal dynamics-relevance for Alzheimer’s disease. Prog. Neurobiol. 85, 393– 406. Nakayama, K., Ohkawara, T., Hiratochi, M., Koh, C.S., Nagase, H., 2008. The intracellular domain of amyloid precursor protein induces neuronspecific apoptosis. Neurosci. Lett. 444, 127–131.

2209

Nizard, P., Tetley, S., Le Drean, Y., Watrin, T., Le Goff, P., Wilson, M.R., Michel, D., 2007. Stress-induced retrotranslocation of clusterin/ApoJ into the cytosol. Traffic Copenhagen Denmark 8, 554 –565. Nuutinen, T., Suuronen, T., Kauppinen, A., Salminen, A., 2009. Clusterin: a forgotten player in Alzheimer’s disease. Brain Res. Rev. 61, 89 –104. Ozaki, T., Li, Y., Kikuchi, H., Tomita, T., Iwatsubo, T., Nakagawara, A., 2006. The intracellular domain of the amyloid precursor protein (AICD) enhances the p53-mediated apoptosis. Biochem. Biophys. Res. Commun. 351, 57– 63. Passer, B., Pellegrini, L., Russo, C., Siegel, R.M., Lenardo, M.J., Schettini, G., Bachmann, M., Tabaton, M., D’Adamio, L., 2000. Generation of an apoptotic intracellular peptide by gamma-secretase cleavage of Alzheimer’s amyloid beta protein precursor. J. Alzheimers Dis. 2, 289 –301. Qi, X., Okuma, Y., Hosoi, T., Kaneko, M., Nomura, Y., 2004. Induction of murine HRD1 in experimental cerebral ischemia. Brain Res. 130, 30 –38. Reimertz, C., Kögel, D., Rami, A., Chittenden, T., Prehn, J.H., 2003. Gene expression during ER stress-induced apoptosis in neurons: induction of the BH3-only protein Bbc3/PUMA and activation of the mitochondrial apoptosis pathway. J. Cell Biol. 162, 587–597. Ron, D., Walter, P., 2007. Signal integration in the endoplasmic reticulum unfolded protein response. Nat. Rev. Mol. Cell Biol. 8, 519 –529. Selkoe, D.J., 2004. Cell biology of protein misfolding: the examples of Alzheimer’s and Parkinson’s diseases. Nat. Cell Biol. 6, 1054 –1061. Unterberger, U., Höftberger, R., Gelpi, E., Flicker, H., Budka, H., Voigtländer, T., 2006. Endoplasmic reticulum stress features are prominent in Alzheimer disease but not in prion diseases in vivo. J. Neuropathol. Exp. Neurol. 65, 348 –357. Van Broeckhoven, C., 2010. The future of genetic research on neurodegeneration. Nat. Med. 16, 1215–1217. van Es, M.A., van den Berg, L.H., 2009. Alzheimer’s disease beyond APOE. Nat. Genet. 41, 1047–1048. Walsh, D.M., Minogue, A.M., Sala-Frigerio, C., Fadeeva, J.V., Wasco, W., Selkoe, D.J., 2007. The APP family of proteins: similarities and differences. Biochem. Soc. Transact. 35, 416 – 420. Xu, C., Bailly-Maitre, B., Reed, J.C., 2005. Endoplasmic reticulum stress: cell life and death decisions. J. Clin. Invest. 115, 2656 –2664. Zambrano, N., Minopoli, G., de Candia, P., Russo, T., 1998. The Fe65 adaptor protein interacts through its PID1 domain with the transcription factor CP2/LSF/LBP1. J. Biol. Chem. 273, 20128 –20133. Zhang, H., Kim, J.K., Edwards, C.A., Xu, Z., Taichman, R., Wang, C.Y., 2005. Clusterin inhibits apoptosis by interacting with activated Bax. Nat. Cell Biol. 7, 909 –915.